The Role of Versican in Modulating Breast Cancer Cell Self-Renewal

Published OnlineFirst February 28, 2013; DOI: 10.1158/1541-7786.MCR-12-0461

Molecular Cancer Cell Cycle and Senescence Research

The Role of Versican in Modulating Breast Cancer Cell Self-renewal

William Weidong Du1,3, Ling Fang1,2, Xiangling Yang1,2, Wang Sheng1,2, Bing L. Yang1, Arun Seth1,2, Yaou Zhang4, Burton B. Yang1,2, and Albert J. Yee1,3

Abstract Versican ishighly expressed duringthe early stages of tissue development and its expression iselevated during wound repair and tumor growth. There is little literature on the potential role of breast cancer stem cells on the cellular– extracellular matrix interactions involving versican. An anti-versican short hairpin RNA (shRNA) was used to observe the effect of reduction of versican on breast cancer self-renewal. A versican G3 construct was exogenously expressed in breast cancer cell lines. Colony formation and mammosphere formation assays were conducted; ﬂow cytometry was applied to analyze the prevalence of side population cells. The versican G3- and vector-transfected 66c14 cells were injected transdermally into BALB/c mice as a 10-fold dilution series from 1 105 to 1 102 cells per mouse. Versican G3 domain enhanced breast cancer self-renewal in both experimental in vitro and in vivo models. Versican G3–transfected cells contained high levels of side population cells, formed more mammospheres when cultured in the serum-free medium, and formed a greater number and larger colonies. Reduction of versican's functionality through anti-versican shRNA or knocking out the EGF-like motifs reduced the effect of versican on enhancing mammosphere and colony formation. Versican-enhanced self-renewal played a role in enhanced chemotherapeutic drug resistance, relating partly to the upregulated expression of EGF receptor (EGFR) signaling. Versican is highly expressed in breast cancer progenitor cells and was maintained at high levels before cell differentiation. Overexpression of versican enhanced breast cancer self-renewal through EGFR/AKT/GSK-3b (S9P) signaling and conferred resistant to chemotherapeutic drugs tested. Mol Cancer Res; 11(5); 443–55. 2013 AACR.

Introduction tumor progenitor cells are characterized by their ability to Experimental and clinical evidence support the under- form new serially transplantable tumors in mice and to standing that tumorigenesis is sustained by a small popula- display stem/progenitor cell properties such as competence for self-renewal and the capacity to reestablish tumor het- tion of cells that function as tumor stem/progenitor cells fl (1, 2). In breast cancer, these cells arise from mutated erogeneity (6, 7). In addition to awed regulation of the self- mammary stem/progenitor cells, which have been charac- renewal pathways, the number of cells within a tumor that terized by the expression of key cell surface markers (e.g., have the ability to self-renew is constantly expanding, fl resulting in a continuous expansion of tumorigenic cancer CD24, CD44, CD29, or Sca-1) as well as dye ef ux assays fi based on the differential release of incorporated Hoechst cells (8). Thus, the identi cation of mechanisms in which dyes or rhodamine-121 through overexpressed or overacti- cancer cells regenerate through self-renewal is critical to our vated drug transporters in the cell membrane (3–5). These understanding of tumorigenesis (9). A number of develop- mental signaling pathways, such as Wnt, Notch, and Hedge- hog, have been observed to play pivotal roles in governing Authors' Affiliations: 1Sunnybrook Research Institute; 2Department of both self-renewal and the process of malignant transforma- Laboratory Medicine and Pathobiology; 3Centre for the Study of Bone tion (10, 11). Metastasis, Odette Cancer Centre, and Holland Musculoskeletal Program, Sunnybrook Health Sciences Centre, Division of Orthopaedic Surgery, Tumor stem cells, as well as other cells in the tissue, do not Department of Surgery, University of Toronto, Toronto, Ontario, Canada; function autonomously as independent self decision-making and 4Division of Life Science, Graduate School at Shenzhen, Tsinghua entities. Increasing evidence shows the influence of the University, Shenzhen, China cellular microenvironment on tumor development and pro- Note: Supplementary data for this article are available at Molecular Cancer gression (2, 12). Cellular activity is closely regulated through Research Online (http://mcr.aacrjournals.org/). interactions with adjacent cells that create well-defined Corresponding Author: Albert J. Yee, Sunnybrook Health Sciences Cen- microenvironments in which tumor stem cells reside. How- tre and Centre for the Study of Bone Metastasis, Odette Cancer Centre, Department of Surgery, University of Toronto, 2075 Bayview Avenue, Rm. ever, tumor cells also possess the ability to interact with and MG 371-B, Toronto, Ontario M4N 3M5, Canada. Phone: 416-480-6815; influence their surrounding environment. Examples of these Fax: 416-480-5886; E-mail: [email protected] properties include neo-angiogenesis, recruitment of epithe- doi: 10.1158/1541-7786.MCR-12-0461 lial cells, and modification of tissue architecture. Interest- 2013 American Association for Cancer Research. ingly, certain extracellular matrix (ECM) and cell-surface

www.aacrjournals.org 443

Du et al.

receptor molecules, such as Wnt, Notch, and TGF-b have obtained from Santa Cruz Biotechnology. EGF, selective been shown to be involved in stem cell self-renewal and EGFR inhibitor AG 1478, selective mitogen-activated pro- tumor development (2, 10, 11, 13). tein/extracellular signal–regulated kinase (MEK) inhibitor Versican, a chondroitin sulfate (CS) proteoglycan, is one PD 98059, hydroxyurea, and the monoclonal antibody of the main components of the ECM and provides a loose against b-actin were obtained from Sigma. Polyclonal anti- and hydrated matrix during key events in development and bodies against versican V1 isoform (ab19345), GSK-3b disease (14). To date, 4 isoforms of versican (V0, V1, V2, (S9P), and CD44 were obtained from Abcam. Monoclonal and V3) have been identified in various tissues (15). Versican antibody against Sca-1 came from Bio-Rad. Monoclonal is structurally composed of an N-terminal G1 domain, a CS antibody against ALDH1 and Sox2 were obtained from BD. attachment region, and a C terminus (or G3) selectin-like Horseradish peroxidase (HRP)–conjugated goat anti-mouse domain. The G3 domain interacts with different ECM immunoglobulin G (IgG) and HRP-conjugated goat anti- proteins and binds to certain cell surface proteins including rabbit IgG were obtained from Bio-Rad. Immunoblotting EGF receptor (EGFR; ref. 16). The G3 domain is composed was carried out using the ECL Western Blot Detection Kit. of 2 EGF-like repeats, a lectin-like motif, and a complement Mouse mammary tumor cell lines 67NR, 66c14, 4T07, binding protein-like motif. 4T1, and human breast cancer cell line MDA-MB-231 were Versican is highly expressed in the early stages of tissue cultured in Dulbecco's modified Eagle's medium (DMEM) development, and its expression decreases after tissue mat- media. Human breast cancer cell lines MT-1, MCF-7, and uration. It is also highly expressed in the interstitial tissues at MDA-MB-468 were cultured in RPMI-1640 media. Cells the invasive margins of breast carcinoma (17). Expression were supplemented with 10% fetal calf serum (FCS), pen- levels of versican seem to be related to the metastatic icillin (100 U/mL), streptomycin (100 mg/mL), and main- fi potential of breast cancer and are predictive of relapse and tained at 37 C in a humidi ed atmosphere of 5% CO2.A overall survival (18). Relapse in women with node-negative pcDNA1-G3 (G3) construct and pcDNA1-G3 fragment breast cancer seems related to the level of versican deposited lacking the EGF-like motifs (G3DEGF) construct were in peritumoral stroma by mammary fibroblasts (18, 19). stably expressed in 66c14, 4T07, 4T1, and MT-1 cells as Neoplastic remodeling of the ECM through increased ver- described previously (25, 26). sican deposition may facilitate local invasion and subsequent A monoclonal antibody 4B6 that recognizes an epitope in metastasis (20). The G3 domain of versican has been the leading peptide engineered to the G3 and G3DEGF previously shown to be important in both local and systemic construct was used to confirm expression of the G3 products tumor invasiveness of breast cancer and may enhance the (25, 26). interactions between tumor cells and their surrounding A short hairpin RNA (shRNA) construct targeting versi- stromal components. Furthermore, the G3 domain of ver- can was generated by inserting the sequence 50-ccca- sican has been shown to enhance neo-vascularization gatctccgtggcagcgagaattcttgttcaagagacaagaattctcgctgc- through interactions with VEGF and fibronectin cactttttggaagagctcatcga into the plasmid pSuper. This con- (17, 21). Thus, versican participates in cell adhesion, pro- struct thus targeted the sequence of versican at nucleotides liferation, migration, aggregation, and angiogenesis and 9453-9471 (50-gtggcagcgagaattcttg, NM 004385.4). seems to play a central role in normal tissue morphogenesis (14, 22–24). Given recent scientific interest in the biology Side population cell analysis of cancer stem cells, the role of versican in the regulation Cells were removed from tissue culture dishes with trypsin of breast cancer cell self-renewal has not been well and EDTA, washed, suspended at 106 cells/mL in DMEM characterized. containing 2% FCS, and preincubated at 37C for 10 To investigate the effects of versican expression on breast minutes, then cultured for 90 minutes with 2.5 mg/mL cancer cell self-renewal, we exogenously expressed a versican Hoechst 33342 dye, either alone or in combination with 50 G3 construct in mouse mammary tumor cell lines 4T1, mmol/L verapamil. Cells were analyzed by flow cytometry 66c14, 4T07, and human breast cancer cell lines MT-1, using a dual-wavelength analysis (blue, 424–444 nm; red, MB-468. To determine the expression of versican in breast 675 nm) after excitation with 350-nm UV light. Propidium cancer stem/progenitor cells and the role of the versican G3 iodide–positive dead cells (<15%) were excluded from the domain on breast cancer cell self-renewal, both in vitro and analysis. in vivo models were used. Finally, we aimed to determine the effect of commonly prescribed chemotherapeutic drugs on Western blot analysis breast cancer cell sensitivity/resistance to versican G3– Samples were subjected to SDS-PAGE using 7% to 10% enhanced tumor progenitor cell activity. acrylamide. Separated proteins were transblotted onto a nitrocellulose membrane in 1 Tris/glycine buffer containing 20% methanol at 60 V for 2 hours in a cold room. The Materials and Methods membrane was blocked in TBST (10 mmol/L Tris–Cl, pH Materials and cell cultures 8.0, 150 mmol/L NaCl, and 0.05% Tween 20) containing Monoclonal antibodies against phosphorylated extracel- 5% nonfat dry milk powder (TBSTM) for 1 hour at room lular signal–regulated kinase (perk), integrin-b1, and the temperature, and then incubated with primary antibodies polyclonal antibodies against pEGFR and pAKT were at 4C overnight. The membranes were washed with TBST

444 Mol Cancer Res; 11(5) May 2013 Molecular Cancer Research

Versican Modulates Breast Cancer Cell Self-renewal

(3 30 minutes) and then incubated with appropriate PCR with 2 appropriate primers. PCR products were HRP-conjugated secondary antibodies in TBSTM for 1 measured using quantitative real-time PCR (qRT-PCR) hour. After washing, the bound antibodies were visualized incorporating TaqMan chemistry (Applied Biosystems). by ECL detection. Sequences of primers used in this study were: mouse integrin-b1: forward, 50-tgaatttgcaactggtttcctgg; reverse, 50-ctatg- Mammosphere culture tcacttgctggcaaccc; mouse Sca-1: forward, 50-tggacacttctc- Harvested G3- and vector-transfected cells were mechan- acactacaaagtc; reverse, 50-cagagcaaggtctgcaggag; human ically and enzymatically dissociated in 0.05% Trypsin– Oct-4: forward, 50-gcgccttccttccccatggcggg; reverse, 50- EDTA for 10 minutes at 37C, followed by resuspension gtacgccatccccccacataactc; human GapdH: forward, 50- in serum-free DMEM/F12 medium containing 10 ng/mL aaggctggggctcatttgcag; reverse, 50-gatgttctggagagcccccgcg; basic fibroblast growth factor (bFGF), 20 ng/mL EGF, mouse GapdH: forward, 50-atggtgaaggtctgtgtgatcatc; 0 L-glutamine (1:400), and B27 supplement (1:50). Single reverse, 5 -tgggttctcactcctggaagaagg cell suspensions were plated onto 60-mm Petri dishes at a density of 1,000 cells/mL. After culturing for 3 days, sphere Immunofluorescence staining cells were collected by gentle centrifugation, dissociated to Cultured cells were fixed with cold 3.5% paraformalde- single cells in 0.05% Trypsin–EDTA as described previ- hyde for 15 minutes, washed 3 times with PBS and per- ously, and cultured to generate mammospheres. Complexes meabilized with 1% Triton X-100 in PBS for 30 minutes. containing 30 or more cells were considered "large" spheres, After washing 3 times with PBS, cells were blocked in 1% whereas small spheres contained less than 30 cells per bovine serum albumin (BSA) in PBS for 30 minutes, and sphere. then incubated with primary antibodies (1:200) at 4C overnight. After washing, the cells were incubated with Colony formation in soft agarose gel fluorescein isothiocyanate (FITC)-conjugated secondary A total of 103 cells were mixed in 0.3% low-melting antibodies (1:400) for 1 hour. Control samples were treated agarose in DMEM supplemented with 10% FBS and plated with either secondary antibody alone or preimmune on 0.66% agarose-coated 6-well tissue culture plates. Four mouse serum. The samples were examined under a Nikon weeks after cell inoculation, colonies were examined and Eclipse E600 upright microscope equipped with fluorescent photographed. Complexes containing 100 cells were con- devices. sidered large colonies, whereas small colonies contained 30– 100 cells per colony. Flow cytometry Cells were washed once with PBS and harvested in 0.05% Cell viability assays trypsin/0.025% EDTA. Detached cells were washed with The G3- and vector-transfected 66c14 cells (2 105) PBS containing 1% FCS and 1% penicillin–streptomycin were cultured in 10% FBS/DMEM medium in culture (wash buffer) and resuspended in wash buffer (106 cells/100 dishes and maintained at 37C for 12 hours. After cell mL). Cells were then incubated with Sca-1 monoclonal attachment, culture media was changed into serum-free antibodies and FITC-conjugated secondary antibodies for DMEM medium or 10% FBS/DMEM medium containing 30 minutes on ice. The labeled cells were washed in wash different concentrations of chemotherapeutical chemicals buffer and then analyzed by flow cytometry. including C2-ceramide, docetaxel, doxorubicin, or epirubicin. Cells were harvested daily and cell number was analyzed In vivo tumorigenicity in BALB/c mice by Coulter counter. Cell survival assays were conducted The G3- and vector-transfected 66c14 cells were cultured using a colorimetric proliferation assay (Cell Proliferation in 10% FBS/DMEM media at 37 C with 5% CO2. At 70% Reagent WST-1; Basel, Switzerland). Versican G3- and to 80% subconfluency, the cells were re-fed with fresh 10% control vector-transfected breast cancer cells (1 104 FBS/DMEM media 24 hours before inoculation into mice. cells/well) were inoculated and cultured in 10% FBS/ Cell viability was determined by Trypan blue exclusion and DMEM medium in 96-well culture dishes for 12 hours. cells were suspended with greater than 95% viability without After cell attachment, culture media was changed to serum- cell clumping. Ethics approval was received from the insti- free DMEM medium or 10% FBS/DMEM medium con- tutional animal care committee. Four-week-old BALB/c taining differing concentrations of C2-ceramide, docetaxel, mice were injected transdermally with the G3- and vec- doxorubicin, or epirubicin, and then cultured with 10 mL tor-transfected 66c14 cells (1 102,1 103,1 104, and 1 WST-1 reagent for 4 hours. The absorbance of the samples 105 cells in 150 mL 10% FBS/DMEM medium). Injec- read against a blank control was measured by a microplate tion was administered into the fourth (inguinal) mammary (ELISA) reader. fat pad using a 1 mL syringe with a 26 G needle. Each experimental group contained 8 randomly chosen mice. RT-PCR Tumors were measured weekly with a vernier caliper. All A total of 2 106 66c14 or MT-1 cells were harvested and mice were sacrificed when the tumor measured 1 cm, when total RNA was extracted using the Qiagen RNeasy Mini Kit. acceptable tumor endpoints in animal care where reached, Two micrograms of total RNA were used to synthesize or at 21 weeks posttransplantation. Primary tumors were cDNA, a portion of which (0.2 mg RNA) was used in a harvested and fixed in 10% formalin.

www.aacrjournals.org Mol Cancer Res; 11(5) May 2013 445

Du et al.

A C Serum Serum free 3.5 ** 3 3 7 7 14 14 3.0

2.5 Versican V1 (250 kDa) 2.0 170 1.5

SP cells (%) ** 1.0 80 * 58 0.5 46 0.0 35 67NR 66c14 4T07 4T1

0.61 1.01 1.29 1.45 1.32 1.37 1.35 B β-Actin

67NR 66c14 4T07 4T1 D Serum Serum free Serum recovery Versican V1 4 8 16 24 48 72 0.58 0.66 0.72 1.31 Versican V1 β-Actin (250 kDa) 0.57 1.61 1.72 1.25 1.18 1.04 0.49 0.51

β-Actin

E 250K 250K 250K 200K 200K 200K

150K 150K 150K

100K 100K 100K 2.5% 14.7% 9.93% 50K 50K 50K Hoechst blue 0 0 0 0 50K 100K 150K 200K 250K 0 50K 100K 150K 200K 250K 0 50K 100K 150K 200K 250K Hoechst red In sphere 4 h Differentiated 250K 250K 250K 200K 200K 200K

150K 150K 150K

100K 100K 100K 5.25% 4.34% 50K 2.2% 50K 50K

Hoechst blue 0 0 0 0 50K 100K 150K 200K 250K 0 50K 100K 150K 200K 250K 0 50K 100K 150K 200K 250K Hoechst red 16 h 24 h 48 h

Figure 1. Expression of versican in mammary tumor stem/progenitor cells. A, prevalence of Hoechstlow side population (SP) cells in the 4 mouse mammary cell lines. Compared with 66c14 cells; , P < 0.05; , P < 0.01; n ¼ 4; analyzed with t test. B, cells of the 4 mouse mammary cell lines were cultured in DMEM medium with 10% FBS and cell lysates were prepared and subjected to immunoblotting with antibodies to versican and b-actin. C, 4T1 cells were cultured in DMEM medium with 10% FBS or cultured as mammospheres in suspension with serum-free medium for 3, 7, and 14 days. Cell lysates were prepared and subjected to immunoblotting with antibodies to versican and b-actin. D, 4T1 cells were cultured as mammospheres in suspension with serum-free medium for 14 days. The mammosphere cells were also recovered with 10% FBS/DMEM for 4, 8, 16, 24, 48, and 72 hours. The differentiated cells were cultured with 10%

446 Mol Cancer Res; 11(5) May 2013 Molecular Cancer Research

Versican Modulates Breast Cancer Cell Self-renewal

Tissue slide H&E staining and immunohistochemistry showed that mammosphere 4T-1 cells not only expressed Freshly excised primary tumors were fixed in 10% for- high levels of versican, but also expressed high levels of malin overnight, immersed in 70% ethanol, embedded in characteristic breast cancer stem cell markers Sca-1, Sox2, paraffin, and sectioned. Sections were deparaffinized with and ALDH1 (Supplementary Fig. S1). These results indi- xylene and ethanol and boiled in a pressure cooker. After cated that versican was highly expressed in mammary tumor washing with TBS containing 0.025% Triton X-100, the stem/progenitor cells and its expression seemed to be down- sections were blocked with 10% goat serum and incubated regulated during cell differentiation. with primary antibody in TBS containing 1% BSA overnight. The sections were washed and labeled with biotiny- Versican G3 enhances breast cancer cell mammosphere lated secondary antibody, followed by avidin-conjugated and colony formation HRP provided by the Vectastain ABC Kit (Vector, PK- To investigate the effect of versican on breast cancer self- 4000). The slides were then counterstained with Mayer's renewal, we exogenously expressed a versican G3 construct Hematoxylin and slide-mounted. in MT-1, 66c14, 4T07, and 4T1 cell lines. Flow cytometry assays showed that the proportions of side population cells Results were higher in versican G3-transfected MT1, 66c14, and Versican is highly expressed in mammary tumor stem/ 4T07 cells than in vector control groups (Fig. 2A and B). progenitor cells Cultured in suspension with serum-free medium, versican The Hoechst 33342 dye-based side population technique G3-transfected cells formed larger mammospheres than facilitated isolation of mouse mammary stem/progenitor vector control cells (Fig. 2C). The number of mammo- cells. To investigate the prevalence of side population cells spheres reflected the quantity of cells capable of in vitro self- in breast cancer cells, we stained the 4 mouse mammary renewal, whereas the number of cells/sphere indicated the tumor cell lines with Hoechst 33342 dye and identified the self-renewal capacity of each sphere-generating cell. Disso- side population by its characteristic fluorescent profile in ciated G3-transfected cells from primary mammospheres dual-wavelength analysis. The 4 mouse mammary tumor cell generated an equivalent proportion of secondary and tertiary lines contained side population cells ranging from 0.4% to spheres, which highlighted their potential for in vitro self- 3.2% of the total viable cells (67NR, 0.62% 0.12%; renewal (Fig. 2D and E). Versican G3-expressing breast 66c14, 0.42% 0.05%; 4T07, 0.96% 0.11%; 4T1, cancer cells showed enhanced colony formation capacity on 2.73% 0.53%). The proportion of side population cells in soft agarose gel (Supplementary Fig. S2A and S2B). 4T1 cell lines were substantially higher than observed in the other 3 cell lines, with a median of 2.56% and a range of Versican enhances breast cancer cell resistance to 1.98% to 3.34% (Fig. 1A). Immunoblotting also showed chemotherapy and influences markers associated with that 4T1 cells expressed higher levels of the versican V1 self-renewal isoform than other cell lines (Fig. 1B). We compared the We treated versican G3- and vector-transfected 66c14 expression of versican in mammary/progenitor cells with cells with 8 mmol/L doxorubicin or 10 mmol/L epirubicin for that of differentiated mammary tumor cells by using mam- 24 hours. We observed that versican G3-transfected 66c14 mosphere-derived cells grown in suspension culture with cells showed resistance to doxorubicin and epirubicin treat- serum-free medium versus regularly cultured 4T1 cells with ment (27). To investigate whether these remaining viable 10% FBS medium. Immunoblotting showed that the cells were of tumor stem cell origin, we carried out immu- expression of versican is greater in stem/progenitor cells nofluorescence staining with antibodies to Sca-1, which was contained within mammospheres than in differentiated cells highly expressed in mouse mammary tumor progenitor/stem cultured in serum medium (Fig. 1C). The mammosphere cells. Remaining viable cells showed a high level of Sca-1 4T1 cells expressed higher levels of versican compared with expression (Supplementary Fig. S3A). An immunofluores- the differentiated cells and approached that of differentiated cence staining experiment carried out on 66c14 cells cul- cells once cultured in serum medium for 72 hours (Fig. 1D). tured in 10%FBS/DMEM medium also showed that versi- The mammosphere 4T1 cells also contained a high percent- can G3-transfected cells expressed higher levels of Sca-1 than age of side population cells when compared with differen- the vector cells (Supplementary Fig. S3B). In studying the tiated cell cultures. The prevalence of side population relationship between versican-enhanced breast cancer cell cells declined rapidly once cultured with serum medium self-renewal and chemotherapy resistance, we also cultured and cells were also observed to be differentiating (Fig. 1E). the 4 mouse mammary tumor cell lines 67NR, 66c14, 4T01, Cells containing a high percentage of side population cells, and 4T1 (containing different proportions of side popula- possessing stem cell-like properties, also produced high levels tion cells and differential versican expression) in 8 mmol/L of versican before cell differentiation. Immunostaining doxorubicin for 4 days. We observed that although the 4T1

FBS medium on tissue culture dishes for 3 days. Cell lysates were prepared and subjected to immunoblotting with antibodies to versican and b-actin. E, 4T1 cells were cultured as mammospheres in suspension in Petri dishes containing serum-free medium for 14 days. The mammosphere cells were also recovered with 10% FBS/DMEM for 4, 8, 16, 24, 48, and 72 hours. All the samples were harvested, stained with Hoechst 33342 dye, and subjected to analysis measuring the prevalence of side population cells. The differentiated cells were cultured with 10% FBS medium on tissue culture dishes for 3 days.

www.aacrjournals.org Mol Cancer Res; 11(5) May 2013 447

Du et al.

A MT-1 66c14 4T07 4T1 250K 250K 250K 250K

200K 200K 200K 200K

150K 150K 150K 150K Vector 100K 100K 100K 100K 2.59 50K 1.69 50K 0.18 50K 1.44 50K 0 0 0 0 0 50K 100K150K200K250K 0 50K 100K150K200K250K 0 50K 100K150K200K250K 0 50K 100K150K200K250K 250K 250K 250K 250K

200K 200K 200K 200K

150K 150K 150K 150K G3 100K 100K 100K 100K 2.98 2.72 50K 50K 0.59 50K 2.5 50K Hoechst blue Hoechst 0 0 0 0 0 50K 100K150K200K250K 0 50K 100K 150K200K250K 0 50K 100K150K200K250K 0 50K 100K150K200K250K Hoechst red B C Vector G3

4 1 d

** 3 **

Vector 3 d 2 G3 SP cellsSP (%)

1 ** 5 d

0 MT-1 66c14 4T07 4T1

10 d

D Vector G3

15 d Primary

E 35 ** 30 ** ** Secondary 25 Primary 20 Secondary 15 10 Tertiary 5 Spheres/1,000 cells Teritary 0 Vector G3

Figure 2. Expression of versican G3 domain enhanced breast cancer cell mammosphere formation. A, the typical prevalence of Hoechstlow side population (SP) cells in versican G3- and vector-transfected MT-1, 66c14, 4T07, and 4T1 cell lines as shown by ﬂow cytometry. B, prevalence of Hoechstlow side population cells in versican G3- and vector-transfected MT-1, 66c14, 4T07, and 4T1 cell lines. Compared with vector control group; , P < 0.05; , P < 0.01; n ¼ 4; analyzed with t test. C, a typical mammosphere of versican G3- and vector-transfected 66c14 cells cultured in suspension with serum-free medium. D, typical mammospheres of versican G3- and vector-transfected 66c14 cells formed primarily, secondarily (generated from dissociated primary spheres), and tertiary. E, numbers of primary, secondary, and tertiary mammospheres. Compared with vector control group; , P < 0.05; , P < 0.01; n ¼ 6; analyzed with t test.

448 Mol Cancer Res; 11(5) May 2013 Molecular Cancer Research

Versican Modulates Breast Cancer Cell Self-renewal

cells, which had a high proportion of progenitor cells and expressed high levels of pEGFR, pAKT, GSK-3b (S9P), expressed higher levels of versican compared with other Sca-1, Sox2, and ALDH1. These effects were blocked by mouse mammary tumor cell lines, showed evidence of inhibitor AG 1478 and selective AKT inhibitor triciribine cellular survival (Supplementary Fig. S3C). (Fig. 4B). To observe whether versican enhanced breast cancer cell self-renewal through EGFR-AKT-GSK-3b Versican-expressing cells expressed high levels of breast (S9P)–mediated pathways, we cultured the versican G3- cancer self-renewal markers expressing cells in 40 mmol/L c2-ceramide or 2 mmol/L RT-PCR and immunoblotting experiments showed that docetaxel. We observed inhibited expression of GSK-3b the versican G3-transfected mouse mammary tumor cells (S9P) in breast cancer cells (27). Immunoblotting also expressed high levels of Sca-1 and integrin-b1 (Supplemen- showed decreased expression of GSK-3b (S9P) with c2- tary Fig. S3D–S3F). Immunoblotting showed that G3- ceramide and docetaxel. Previously observed effects of ver- expressing human breast cancer cells expressed increased sican G3-expressing cells on enhanced expression of stem ALDH1, CD44, and integrin-b1 (Supplementary Fig. cell markers—Sca-1, Sox2, and ALDH1—were blocked S3G). These cells expressed high levels of Oct-1 as evaluated (Fig. 4D). by RT-PCR (Supplementary Fig. S3H). The evaluated Overexpression of versican in breast cancer cells enhanced breast cancer cell self-renewal markers seemed upregulated expression of pEGFR and its downstream effects on pERK, in versican G3-transfected breast cancer cells, supporting pSAPK/JNK, and pAKT. pAKT seemed to enhance the G30sinfluence on breast cancer self-renewal. expression of GSK-3b (S9P) and some stem cell markers (Sca-1, Sox2, and ALDH1) resulting in enhanced tumor cell Effect of versican on promoting breast cancer cell self- resistance to chemotherapy, enhanced cellular survival, and renewal is related to its EGF-like motifs enhanced self-renewal (Fig. 4C). On the other hand, The 4T07 cells were stably transfected with a G3 con- enhanced expression of pEGFR/pJNK in cancer cells seemed struct, a G3 fragment lacking the EGF-like motifs to enhance cell sensitivity to the chemotherapeutic drugs (G3DEGF), and a vector control. We observed that evaluated (27). G3DEGF expression did not enhance mammosphere formation to the degree observed with G3-transfected cells (Fig. Silencing versican's functionality reduces its observed 3A and D). Colony formation assays showed that both G3 effects on breast cancer cell self-renewal and G3DEGF-transfected cells formed more colonies than To investigate the effect of silencing versican's function on vector control cells. However, G3DEGF-expressing cells breast tumor cell self-renewal, we first transfected the human formed smaller colonies when compared with G3-expressing breast cancer cell line MDA-MB-231 with anti-versican cells (Fig. 3B and E). The prevalence of side population cells shRNA. These transfected cells formed fewer and smaller in G3DEGF-expressing cells was lower than in G3-expres- mammospheres when cultured in suspension culture con- sing cells (Fig. 3F). Immunoblotting showed that G3DEGF- ditions using serum-free medium (Fig. 5A and B). Flow expressing cells did not show enhanced pEGFR, Sca-1, Sox2, cytometry showed that anti-versican shRNA cells possessed ALDH1, and integrin-b1 as was observed with G3-trans- lower proportions of tumor progenitor/stem cells compared fected cells (Fig. 3C). Flow cytometry indicated that without with vector control cells (Fig. 5C). Immunoblotting showed the EGF-like motifs, G3-expressing 4T07 cells did not that anti-versican shRNA-expressing MDA-MB-231 cells significantly enhance Sca-1 expression (Fig. 3G). decreased expression levels of versican V1, pEGFR, pAKT, GSK-3b (S9P), and stem cell markers Sca-1, Sox2, and Versican promoted breast cancer self-renewal through ALDH1 (Fig. 4D). Anti-versican shRNA-expressing cells enhanced EGFR signaling also showed reduced colony formation ability when com- To investigate the role of EGFR signaling in G3-enhanced pared with the vector control cells (Fig. 5E and F). self-renewal, the G3- and vector-transfected 4T07 cells were cultured in suspension culture conditions using serum-free Expression of versican promoted breast cancer self- stem cell medium. G3 cells were also cultured with or renewal in vivo without EGF, with selective EGFR inhibitor AG 1478, We injected versican G3- and vector-transfected 66c14 jun selective ERK inhibitor PD 98059, selective c- -NH2- cells into the fourth mammary fat pad of BALB/c mice as a kinase (JNK) inhibitor side population 600125, or selective 10-fold dilution series from 1 105 to 1 102 cells per AKT inhibitor triciribine for 14 days. The G3 cells formed mouse. With as few as 1,000 inoculated cells, G3-transfected more mammospheres than the vector control cells, however, 66c14 cells could form tumors in BALB/c mice, whereas the the G3 cells were observed to form very few mammospheres vector control cells were unable to show the same ability at without EGF in the medium (Fig. 4A). Both selective EGFR the same dilution (Table 1). Although tumors could form if inhibitor AG 1478 and selective AKT inhibitor triciribine greater than 10,000 vector control cells were injected, the prevented versican G3-enhanced mammosphere formation, incidence of tumors in the vector control group was much which indicated that observed G3-enhanced breast cancer lower than that observed of the G3 group using the same self-renewal effects were due, at least in part, to its effect on number of injected cells. influencing the EGFR/AKT pathway (Fig. 4A). Immuno- Immunohistochemical staining showed that primary blotting showed that the versican G3-expressing cells tumor tissues of versican G3-treated mice not only expressed

www.aacrjournals.org Mol Cancer Res; 11(5) May 2013 449

Du et al.

A B C Vector G3 G3 EGF

4B6 0.15 1.95 2.16

Vector Vector pEGFR 0.65 1.31 0.74

Sca-1 0.85 1.45 0.79 G3 G3 ALDH1

0.47 1.10 0.52

SOX2 G3ΔEGF Δ G3 EGF 0.62 1.70 0.59

Integrin-β1

0.53 1.15 0.66 D E Vec t or 16 β-Actin G3 ** 50 ** ** 14 Δ G3 EGF ** 3.5 12 40 F 3.0 * 10 ** * 30 2.5 8 2.0 6 20

SP cells(%) 1.5

Spheres/1,000 cells 4 ** 10 1.0 2 Colonies/1,000 cells 0.5

0 0 0.0 7 d 14 d 21 d Small colony Large colony Vector G3 G3 EGF

G 120 30 50

90 40 20 30 60 # Cells # Cells # Cells # 91 9.01 20 100 0.043 10 99.8 0.21 30 10

0 0 0 100 101 102 103 104 100 101 102 103 104 100 101 102 103 104 FL1-H: NL493 FL1-H: NL493 FL1-H: NL493 FSC-H, SSC-H subset FSC-H, SSC-H subset FSC-H, SSC-H subset vector G3 G3ΔEGF

Event count: 1989 Event count: 1720 Event count: 1966

Figure 3. Knocking out the EGF-like motifs in the versican G3 construct (G3DEGF) resulted in reduced effects on breast cancer cell self-renewal. A, typical mammospheres of vector-, versican G3-, and G3DEGF-transfected 4T07 cells formed in serum-free DMEM medium after culture for 14 days. B, typical colonies of vector-, versican G3-, and G3DEGF-transfected 4T07 cells formed in soft agarose gel after culture for 4 weeks. C, vector-, versican G3-, and G3DEGF-transfected 4T07 cells were cultured in 10% FBS/DMEM medium. Cell lysates were prepared and subjected to immunoblotting with antibodies to versican G3, pEGFR, Sca-1, Sox2, ALDH1, integrin-b1, and b-actin. D, the numbers of mammospheres of vector-, versican G3-, and G3DEGF-transfected 4T07 cells counted at 7, 14, and 21 days. Compared with vector control group; , P < 0.05; , P < 0.01; n ¼ 6; analyzed with t test. E, the numbers of colonies of vector-, versican G3-, and G3DEGF-transfected 4T07 cells formed on soft agarose gel. Compared with vector control group; , P < 0.05; , P < 0.01; n ¼ 3; analyzed with t test. F, prevalence of Hoechstlow side population (SP) cells of vector-, G3-, and G3DEGF-transfected 4T07 cells. Compared with 4T07 cells; , P < 0.05; , P < 0.01; n ¼ 4; analyzed with t test. G, typical ﬂow cytometry of vector-, G3-, and G3DEGF-transfected 4T07 cells stained with antibodies against Sca-1 and FITC-conjugated secondary antibodies.

450 Mol Cancer Res; 11(5) May 2013 Molecular Cancer Research

Versican Modulates Breast Cancer Cell Self-renewal

A B Vector G3 Figure 4. Expression of versican Control AG PD SP TCN promoted breast cancer cell self- 1478 98059 600125 renewal through enhanced EGFR/ 45 pEGFR AKT/GSK-3b (S9P) signals. A, 40 numbers of mammospheres of G3- 35 0.72 2.59 0.92 1.84 2.41 3.61 transfected 4T07 cells cultured in 30 25 suspension with serum-free medium pAKT with or without EGF or with selective 20 ** 15 EGFR inhibitor AG1478 (2 mmol/L), ** 10 ** 0.61 1.75 0.46 1.28 1.10 0.53 selective MEK inhibitor PD 98059 (50 Spheres/1,000 cells ** m 5 GSK-3β mol/L), selective JNK inhibitor side 0 (S9P) population (SP) 600125 (100 nmol/L), Vector G3 Without AG PD SP TCN or selective AKT inhibitor triciribine (2 EGF 1478 98059 600125 0.49 1.49 0.64 1.80 1.26 0.28 mmol/L) for 14 days. The vector cells were also cultured in suspension with Sca-1 serum-free medium. Compared with P < P < C G3 control cells; , 0.05; , 0.49 1.36 0.32 1.10 1.34 0.52 0.01; n ¼ 3; analyzed with t test. B, all the suspended cells were cultured for ALDH1 2 days, lysised, and subjected to Expression of versican G3 immunoblotting with antibodies to 0.33 1.04 0.29 0.98 0.93 0.27 pEGFR, pERK, GSK-3b (S9P), Sca-1, Sox2, ALDH1, and b-actin. C, the SOX2 effects of expression of versican on AG 1478 EGFR breast cancer cell invasion, 0.71 3.79 0.104 3.57 3.60 1.34 metastasis, and tumorigenesis via EGFR signaling. Overexpression of β-Actin versican in breast caner cells enhances expression of pEGFR and TCN pAKT its down-pathway pERK, pAKT. D Vector G3 Expression of ERK enhances tumor Control C2 Doc cell migration, invasion, growth, and pGSK-3β metastasis. Expression of pAKT (S9P) enhances GSK-3b (S9P), and some GSK-3β (S9P) stem cell markers—Sca-1, Sox2, 0.34 1.47 0.72 0.51 ALDH1, resulting in tumor cell Sca-1 enhanced chemical resistance, cell survival, and cell self-renewal. D, the 0.71 1.32 0.65 0.83 Sca-1 vector- and G3-transfected 4T07 ALDH1 cells were cultured in 10%FBS/ SOX2 ALDH1 DMEM with 40 mmol/L c2-ceramide or 2 mmol/L docetaxel for 24 hours, 0.41 1.09 0.69 0.58 lysised, and subjected to SOX2 immunoblotting with antibodies to b GSK-3 (S9P), Sca-1, Sox2, ALDH1, Chemical resistence 0.49 1.62 0.79 0.70 and b-actin. Cell survival Cell self-renewal β-Actin

high levels of 4B6, pEGFR, pAKT, and GSK-3b (S9P), all of facilitates tumor growth and metastatic transformation in which were related with tumor invasiveness, but also breast cancer are still not clear. Our study highlights the expressed high levels of tumor stem cell markers Sox2, understanding that versican expression is greater in more Sca-1, and ALDH1. Our in vivo studies complemented invasive breast cancer cell lines, such as 4T1. In our experi- observed in vitro effects on breast cancer self-renewal (Fig. 6). ments using the Hoechst 33342 dye-based side population technique, we observed that invasive breast cancer cell lines contained a high proportion of side population cells, an Discussion enriched source of stem cells or primitive and undifferentiated In human breast carcinoma, versican is detected in the cells (29, 30). This was concordant with high levels of versican interstitial tissues at the invasive margins and in the elastic expression. Mammary stem/progenitor cells were reported in tissues associated with tumor invasion (25, 28). The high this study as Hoechst 33342–negative and Sca-1–positive expression of versican in human breast tumors is prognostic, cells (31). To conﬁrm the relationship between versican being predictive of relapse, and negatively impacting overall expression and tumor progenitor cell activity, we cultured survival rates (18, 19). The mechanisms by which versican 4T1 cells on a nonadherent surface. Mammospheres, which

www.aacrjournals.org Mol Cancer Res; 11(5) May 2013 451

Du et al.

A Vector siRNA B 40 ** 35 3 d Vector 30 s iRNA 25 20 Figure 5. Expression of anti- 15 versican shRNA decreased breast 7 d 10 cancer cell mammosphere and Spheres/1,000 cells colony formation. A, typical 5 ** mammospheres of vector- and 0 anti-versican shRNA-transfected Small spheres Large MDA-MB-231 cells cultured in 7 d spheres suspension using serum-free medium. B, numbers of small and C D Control siRNA large mammospheres. Compared P < Vector siRNA with vector control group; , Versican V1 P < n ¼ 250K 250K 0.05; , 0.01; 5; analyzed (250 kDa) with t test. C, the typical prevalence 1.12 0.38 200K 200K of Hoechstlow side population (SP) cells of vector- and anti-versican 150K 150K pEGFR shRNA-transfected MDA-MB-231 100K 100K cells shown by ﬂow cytometry. D, 1.59 0.72 the vector- and anti-versican 50K 50K 1.58 1.12 shRNA-transfected MDA-MB-231 pAKT Hoechst blue 0 0 cells were cultured in 10%FBS/ 0 50K 100K 150K 200K250K 0 50K 100K 150K200K 250K DMEM medium, lysised, and 1.06 0.57 Hoechst red subjected to immunoblotting with pGSK-3 β antibodies to versican V1, pEGFR, E F (S9P) pAKT, GSK-3b (S9P), Sca-1, Sox2, ALDH1, and b-actin. E, typical 2.11 0.48 colonies of vector- and anti- 80 Sca-1 versican shRNA-transfected MDA- 70 MB-231 cells formed in soft agarose gel after culture for 4 0.94 0.51 Vector 60 weeks. F, the numbers of colonies ** 50 ALDH1 formed on soft agarose gel. Compared with vector control 40 group; , P < 0.05; , P < 0.01; 1.05 0.66 n ¼ t 30 3; analyzed with test.

Colonies/1,000 cells SOX2 siRNA 20

10 1.60 0.71 0 β-Actin Vector siRNA

Table 1. Tumor formation of versican G3- and are spherical colonies formed by epithelial cells when cultured on nonadherent surfaces, were enriched in stem/progenitor vector-transfected 66c14 cells in vivo cells (30). Increasing expression of versican, as well as Sca-1, Sox2, and ALDH1, was observed in cultured mammo- Cell number injected and tumors formed spheres. Sca-1, the ﬁrst identiﬁed mouse stem cell marker,

2 3 4 5 is an anchored membrane protein expressed by different 1 10 1 10 1 10 1 10 progenitor populations including the mammary gland pro- Vector 0/8 0/8 3/8 8/8 genitors (32). Sox2 and ALDH1 are also reported to be stem G3 0/8 4/8 7/8 8/8 cell markers in human breast cancer cells. The mammosphere NOTE: Versican G3- and vector-transfected 66c14 cells 4T1 cells contained a high percentage of side population cells were injected into the fourth mammary fat pad of BALB/c when compared with differentially cultured cells. An inter- mice as a 10-fold dilution series from 1 105 to 1 102 cells esting observation included the high expression of versican in per mouse. All mice were sacriﬁced after 6 weeks (, P < 0.05). mammospheres. Both the expression of versican as well as the The overall test for differences in stem cell frequencies prevalence of side population cells were reduced as cellular between the groups were calculated the website: http:// differentiation occurred over time in serum medium culture. bioinf.wehi.edu.au/software/elda/, P ¼ 0.00132). Structurally, all versican splice forms include an N-terminal G1 domain and a C-terminus containing a selectin-

452 Mol Cancer Res; 11(5) May 2013 Molecular Cancer Research

Versican Modulates Breast Cancer Cell Self-renewal

Vector tumor G3 tumor Vector tumor G3 tumor Versican G3 Sca-1

100 μm

pEGFR ALDH1

Figure 6. Expression of versican promoted breast cancer cell tumor formation and self-renewal in vivo. Shown are hematoxylin and eosin (H&E) staining and immunohistochemistry of primary tumors arising from G3-transfected pAKT Sox2 66c14 cell inoculations tested with antibodies to versican G3, pEGFR, pAKT, GSK-3b (S9P), Sca-1, Sox2, ALDH1.

pGSK-3 β (S9P)

like (G3) domain (33, 34). Given their ubiquitousness and mammary tumor cells also showed increased expression of high degree of conservation, it is likely that G1 and G3 play integrin-b1 and Sca-1. Increased expression of breast cancer vital roles in proteoglycan functionality (35). The effects of cell self-renewal markers was associated with the increased versican were greatly reduced when the G3 domain or EGF- expression of versican G3. This was supported by studies like motifs within the G3 domain were deleted (36–38). silencing versican or the versican G3 domain's functionality. This study showed that the versican G3 domain not only Using shRNA or G3 untranslated region (UTR) reduced the enhanced breast cancer cell mammosphere formation and effects on mammosphere and colony formation corroborat- colony formation but also promoted tumor formation in ing versican G3 domain's role in enhancing breast cancer cell vivo, consistent with observations from our in vitro experi- self-renewal. ments. With as few as 1,000 cells, G3-transfected 66c14 cells Given the frequency at which abnormalities in EGFR could form tumors in BALB/c mice, whereas the vector signaling are present in human breast cancer, EGFR has been control cells required more than 10,000 cells before tumor an attractive target for therapeutic manipulation (39–42). formation. Versican G3-expressing human breast cancer Versican-promoted breast tumor invasion is inﬂuenced by cells expressed higher levels of CD44, Sox2, ALDH1, its enhanced expression of EGFR signaling (25). In our study Sca-1, and integrin-b1, whereas the G3-expressing mouse of stem cell renewal, we observed that negating the effects of

www.aacrjournals.org Mol Cancer Res; 11(5) May 2013 453

Du et al.

EGF-like motifs using a versican G3 fragment (G3DEGF) of the versican G3 domain enhanced breast cancer self- reduced versican G3 effects on breast cancer cell mammo- renewal through EGFR/AKT/GSK-3b (S9P) signaling and sphere and colony formation. Mammosphere formation conferred enhanced resistance to the chemotherapeutic assays showed that versican G3-enhanced breast cancer drugs. Findings from our mechanistic study complement self-renewal was related to enhanced expression of key clinical literature recognizing the importance of versican in markers in the EGFR/AKT/GSK-3b (S9P) pathway. Both cancer invasiveness and metastasis. Strategies designed to selective EGFR inhibitor AG 1478 and selective AKT target versican-mediated breast cancer self-renewal may lead inhibitor triciribine could block this signaling pathway and to therapies and/or adjuncts benefiting patients with breast prevent the versican G3-observed effects on mammary cancer. cancer cell mammosphere formation and expression of GSK-3b (S9P), Sox2, ALDH1, and Sca-1. Moreover, reduc- Disclosure of Potential Conflicts of Interest ing the expression of GSK-3b (S9P) using C2-ceramide or No potential conflicts of interest were disclosed. docetaxel also inhibited versican-enhanced expression of 0 stem cell markers—Sox2, ALDH1, and Sca-1. G3 s effect Authors' Contributions on in vivo tumor formation was associated with changes to Conception and design: W.W. Du, L. Fang, X. Yang, W. Sheng, B.L. Yang, A. Seth, both EGFR/AKT/GSK-3b (S9P) signaling and the afore- Y. Zhang, B.B. Yang, A.J. Yee Development of methodology: W.W. Du, L. Fang, A. Seth, Y. Zhang, B.B. Yang, A. mentioned tumor cell self-renewal markers. EGFR/AKT/ J. Yee GSK-3b (S9P) signaling and breast cancer cell self-renewal Acquisition of data (provided animals, acquired and managed patients, provided — — facilities, etc.): W.W. Du, L. Fang, A. Seth, Y. Zhang, B.B. Yang, A.J. Yee markers Sox2, ALDH1, and Sca-1 were observed to be Analysis and interpretation of data (e.g., statistical analysis, biostatistics, compu- much higher in primary tumors of G3-treated mice as tational analysis): W.W. Du, L. Fang, A. Seth, Y. Zhang, B.B. Yang, A.J. Yee compared with those of the vector control group. Writing, review, and/or revision of the manuscript: W.W. Du, L. Fang, A. Seth, Y. Zhang, B.B. Yang, A.J. Yee In this study, we also observed that versican G3-promoted Administrative, technical, or material support (i.e., reporting or organizing data, breast cancer cell self-renewal conferred enhanced resistance constructing databases): W.W. Du, A. Seth, Y. Zhang, B.B. Yang, A.J. Yee to chemotherapeutic drug therapy using clinical agents such Study supervision: L. Fang, X. Yang, W. Sheng, B.L. Yang, A. Seth, Y. Zhang, B.B. Yang, A.J. Yee as doxorubicin and epirubicin. Recent studies have proposed that cancer-initiating cells may be more resistant to irradi- Acknowledgments ation than other cells in the tumor population (1, 43, 44). The authors thank Ms. Gisele Knowles (Cytometry and Microscopy Core Facility There are also reports that cancer-initiating cells can be more of Sunnybrook Health Sciences Centre) for her assistance with the cell-cycle assays, resistant to chemotherapeutic drugs because of increased Miss Sarah Davies and Mr. Weining Yang (Division of Orthopaedics, Sunnybrook Health Sciences Centre) for assistance with the article submission and editing. expression of antiapoptotic proteins or increased expression of the ATPase drug efflux pump ABCG2/5 (1, 45–47). It has been reported that when EGFR targeting therapy was Grant Support This work was partly supported by a grant from National Sciences and Engineering coadministered with cytotoxic chemotherapy agents or Research Council of Canada (227937-01) to B.B. Yang, who is the recipient of a Career radiotherapy, additive or even synergistic antitumor effects Investigator Award (CI5958) from the Heart and Stroke Foundation of Ontario. Funding, in part, fort his work was also supported by a grant from the Holland were observed (26, 27, 48). The study of versican as a Musculoskeletal Program, Sunnybrook Health Sciences Centre (to A.J. Yee). potential treatment target merits further preclinical study. The costs of publication of this article were defrayed in part by the payment of page Versican is highly expressed in breast cancer progenitor charges. This article must therefore be hereby marked advertisement in accordance with cells and its expression is maintained at high levels before 18 U.S.C. Section 1734 solely to indicate this fact. cellular differentiation. Silencing versican expression was Received July 30, 2012; revised December 6, 2012; accepted December 10, 2012; shown to inhibit breast cancer self-renewal. Overexpression published OnlineFirst February 28, 2013.

References 1. Hill RP, Perris R. "Destemming" cancer stem cells. J Natl Cancer Inst 8. Reya T, Morrison SJ, Clarke MF, Weissman IL. Stem cells, cancer, and 2007;99:1435–40. cancer stem cells. Nature 2001;414:105–11. 2. Ponti D, Zaffaroni N, Capelli C, Daidone MG. Breast cancer stem cells: 9. Clarke MF. A self-renewal assay for cancer stem cells. Cancer Che- an overview. Eur J Cancer 2006;42:1219–24. mother Pharmacol 2005;56(Suppl 1):64–8. 3. Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF. 10. Dontu G, Al-Hajj M, Abdallah WM, Clarke MF, Wicha MS. Stem cells in Prospective identification of tumorigenic breast cancer cells. Proc Natl normal breast development and breast cancer. Cell Prolif 2003;36 Acad Sci U S A 2003;100:3983–8. (Suppl 1):59–72. 4. Smalley MJ, Clarke RB. The mammary gland "side population": a 11. Liu S, Dontu G, Mantle ID, Patel S, Ahn NS, Jackson KW, et al. putative stem/progenitor cell marker? J Mammary Gland Biol Neo- Hedgehog signaling and Bmi-1 regulate self-renewal of normal plasia 2005;10:37–47. and malignant human mammary stem cells. Cancer Res 2006;66: 5. Hadnagy A, Gaboury L, Beaulieu R, Balicki D. SP analysis may be 6063–71. used to identify cancer stem cell populations. Exp Cell Res 2006;312: 12. Bhowmick NA, Chytil A, Plieth D, Gorska AE, Dumont N, Shap- 3701–10. pell S, et al. TGF-beta signaling in fibroblasts modulates the 6. Al-Hajj M, Clarke MF. Self-renewal and solid tumor stem cells. Onco- oncogenic potential of adjacent epithelia. Science 2004;303: gene 2004;23:7274–82. 848–51. 7. Rafii S, Lyden D. Therapeutic stem and progenitor cell transplantation 13. Taipale J, Beachy PA. The Hedgehog and Wnt signalling pathways in for organ vascularization and regeneration. Nat Med 2003;9:702–12. cancer. Nature 2001;411:349–54.

454 Mol Cancer Res; 11(5) May 2013 Molecular Cancer Research

Versican Modulates Breast Cancer Cell Self-renewal

14. Rahmani M, Wong BW, Ang L, Cheung CC, Carthy JM, Walinski H, 31. Welm B, Behbod F, Goodell MA, Rosen JM. Isolation and character- et al. Versican: signaling to transcriptional control pathways. Can J ization of functional mammary gland stem cells. Cell Prolif 2003;36 Physiol Pharmacol 2006;84:77–92. (Suppl 1):17–32. 15. Dours-Zimmermann MT, Zimmermann DR. A novel glycosaminogly- 32. Grange C, Lanzardo S, Cavallo F, Camussi G, Bussolati B. Sca-1 can attachment domain identified in two alternative splice variants of identifies the tumor-initiating cells in mammary tumors of BALB-neuT human versican. J Biol Chem 1994;269:32992–8. transgenic mice. Neoplasia 2008;10:1433–43. 16. Wu YJ, La Pierre DP, Wu J, Yee AJ, Yang BB. The interaction of 33. Zako M, Shinomura T, Kimata K. Alternative splicing of the unique versican with its binding partners. Cell Res 2005;15:483–94. "PLUS" domain of chicken PG-M/versican is developmentally regu- 17. Yee AJ, Akens M, Yang BL, Finkelstein J, Zheng PS, Deng Z, et al. The lated. J Biol Chem 1997;272:9325–31. effect of versican G3 domain on local breast cancer invasiveness and 34. Sandell LJ. In situ expression of collagen and proteoglycan genes in bony metastasis. Breast Cancer Res 2007;9:R47. notochord and during skeletal development and growth. Microsc Res 18. RicciardelliC,BrooksJH,SuwiwatS,SakkoAJ,MayneK,Raymond Tech 1994;28:470–82. WA, et al. Regulation of stromal versican expression by breast 35. Yang BL, Cao L, Kiani C, Lee V, Zhang Y, Adams ME, et al. Tandem cancer cells and importance to relapse-free survival in patients repeats are involved in G1 domain inhibition of versican expression and with node-negative primary breast cancer. Clin Cancer Res 2002; secretion and the G3 domain enhances glycosaminoglycan modifica- 8:1054–60. tion and product secretion via the complement-binding protein-like 19. Suwiwat S, Ricciardelli C, Tammi R, Tammi M, Auvinen P, Kosma VM, motif. J Biol Chem 2000;275:21255–61. et al. Expression of extracellular matrix components versican, chon- 36. Zhang Y, Cao L, Yang BL, Yang BB. The G3 domain of versican droitin sulfate, tenascin, and hyaluronan, and their association with enhances cell proliferation via epidermial growth factor-like motifs. disease outcome in node-negative breast cancer. Clin Cancer Res J Biol Chem 1998;273:21342–51. 2004;10:2491–8. 37. Yang BL, Yang BB, Erwin M, Ang LC, Finkelstein J, Yee AJ. Versican G3 20. Delpech B, Girard N, Olivier A, Maingonnat C, van Driessche G, van domain enhances cellular adhesion and proliferation of bovine inter- Beeumen J, et al. The origin of hyaluronectin in human tumors. Int vertebral disc cells cultured in vitro. Life Sci 2003;73:3399–413. J Cancer 1997;72:942–8. 38. Du WW, Yang BB, Shatseva TA, Yang BL, Deng Z, Shan SW, et al. 21. Zheng PS, Wen J, Ang LC, Sheng W, Viloria-Petit A, Wang Y, et al. Versican G3 promotes mouse mammary tumor cell growth, migration, Versican/PG-M G3 domain promotes tumor growth and angiogenesis. and metastasis by influencing EGF receptor signaling. PLoS ONE FASEB J 2004;18:754–6. 2010;5:e13828. 22. Theocharis AD. Versican in health and disease. Connect Tissue Res 39. Mendelsohn J, Baselga J. The EGF receptor family as targets for 2008;49:230–4. cancer therapy. Oncogene 2000;19:6550–65. 23. Wu Y, Chen L, Cao L, Sheng W, Yang BB. Overexpression of the C- 40. Prenzel N, Zwick E, Leserer M, Ullrich A. Tyrosine kinase signalling in terminal PG-M/versican domain impairs growth of tumor cells by breast cancer. Epidermal growth factor receptor: convergence point intervening in the interaction between epidermal growth factor recep- for signal integration and diversification. Breast Cancer Res 2000;2: tor and beta1-integrin. J Cell Sci 2004;117:2227–37. 184–90. 24. Zheng PS, Vais D, Lapierre D, Liang YY, Lee V, Yang BL, et al. PG-M/ 41. O'Donovan N, Crown J. EGFR and HER-2 antagonists in breast versican binds to P-selectin glycoprotein ligand-1 and mediates leu- cancer. Anticancer Res 2007;27:1285–94. kocyte aggregation. J Cell Sci 2004;117:5887–95. 42. Hutcheson IR, Knowlden JM, Jones HE, Burmi RS, McClelland RA, 25. Wu Y, Zhang Y, Cao L, Chen L, Lee V, Zheng PS, et al. Identification of Barrow D, et al. Inductive mechanisms limiting response to anti- the motif in versican G3 domain that plays a dominant-negative effect epidermal growth factor receptor therapy. Endocr Relat Cancer on astrocytoma cell proliferation through inhibiting versican secretion 2006;13(Suppl 1):S89–97. and binding. J Biol Chem 2001;276:14178–86. 43. Bao S, Wu Q, McLendon RE, Hao Y, Shi Q, Hjelmeland AB, et al. Glioma 26. Arteaga C. Targeting HER1/EGFR: a molecular approach to cancer stem cells promote radioresistance by preferential activation of the therapy. Semin Oncol 2003;30:3–14. DNA damage response. Nature 2006;444:756–60. 27. Du WW, Yang BB, Yang BL, Deng Z, Fang L, Shan SW, et al. Versican 44. Phillips TM, McBride WH, Pajonk F. The response of CD24(/low)/ G3 domain modulates breast cancer cell apoptosis: a mechanism for CD44þ breast cancer-initiating cells to radiation. J Natl Cancer Inst breast cancer cell response to chemotherapy and EGFR therapy. PLoS 2006;98:1777–85. ONE 2011;6:e26396. 45. Frank NY, Margaryan A, Huang Y, Schatton T, Waaga-Gasser AM, 28. Paulus W, Baur I, Dours-Zimmermann MT, Zimmermann DR. Differ- Gasser M, et al. ABCB5-mediated doxorubicin transport and che- ential expression of versican isoforms in brain tumors. J Neuropathol moresistance in human malignant melanoma. Cancer Res 2005;65: Exp Neurol 1996;55:528–33. 4320–33. 29. Zucchi I, Sanzone S, Astigiano S, Pelucchi P, Scotti M, Valsecchi V, 46. Liu G, Yuan X, Zeng Z, Tunici P, Ng H, Abdulkadir IR, et al. Analysis of et al. The properties of a mammary gland cancer stem cell. Proc Natl gene expression and chemoresistance of CD133þ cancer stem cells in Acad Sci U S A 2007;104:10476–81. glioblastoma. Mol Cancer 2006;5:67. 30. Dontu G, Abdallah WM, Foley JM, Jackson KW, Clarke MF, Kawa- 47. Doyle LA, Ross DD. Multidrug resistance mediated by the breast can- mura MJ, et al. In vitro propagation and transcriptional profiling of cer resistance protein BCRP (ABCG2). Oncogene 2003;22:7340–58. human mammary stem/progenitor cells. Genes Dev 2003;17: 48. Sirotnak FM. Studies with ZD1839 in preclinical models. Semin Oncol 1253–70. 2003;30:12–20.

www.aacrjournals.org Mol Cancer Res; 11(5) May 2013 455

The Role of Versican in Modulating Breast Cancer Cell Self-renewal

William Weidong Du, Ling Fang, Xiangling Yang, et al.

Mol Cancer Res 2013;11:443-455. Published OnlineFirst February 28, 2013.

Updated version Access the most recent version of this article at: doi:10.1158/1541-7786.MCR-12-0461

Supplementary Access the most recent supplemental material at: Material http://mcr.aacrjournals.org/content/suppl/2013/02/28/1541-7786.MCR-12-0461.DC1

Cited articles This article cites 48 articles, 17 of which you can access for free at: http://mcr.aacrjournals.org/content/11/5/443.full#ref-list-1

Citing articles This article has been cited by 2 HighWire-hosted articles. Access the articles at: http://mcr.aacrjournals.org/content/11/5/443.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mcr.aacrjournals.org/content/11/5/443. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.