Identification and Characterization of the Cysteine Protease Inhibitor

Insect Molecular Biology

Insect Molecular Biology (2011) 20(5), 577–586 doi: 10.1111/j.1365-2583.2011.01088.x

Identiﬁcation and characterization of the cysteine protease inhibitor gene MdCPI from Musca domestica

X. Dong, F. Liu, D. Zhang, T. Tang and X. Ge 1. Introduction College of Life Sciences, Hebei University, Baoding, Proteinaceous cysteine protease inhibitors (CPIs) have Hebei, China been found in various animal and plant tissues. Cystatins are the best-characterized CPI group of mammalian and

Abstractimb_1088 577..586 insect origins, and are known to form a superfamily of structurally homologous proteins (Barrett et al., 1986; Cysteine proteinase inhibitors (CPIs) are involved in Kordis & Turk, 2009). In mammals, many cystatins share many vital cellular processes such as signalling path- three conserved sequence motifs including a Gly in the ways, apoptosis, immune response and development; vicinity of the N-terminal region, Q-X-V-X-G in the first however, no CPIs have yet been reported from the hairpin loop and P-W in the second hairpin loop. Structural housefly Musca domestica. Here we report the isola- analysis has revealed that the amino-terminal segment tion and characterization of a housefly CPI gene des- and two loops of cystatins form a tripartite wedge-shaped ignated MdCPI. The gene contains an open reading edge that interacts with the active site cleft of cognate frame of 357 bp encoding a protein of 118 amino acid cysteine proteases (Bode et al., 1988). The cystatins are residues with a putative signal peptide of 17 amino tight-binding and reversible inhibitors of cysteine pro- acid residues. Protein alignment demonstrated a high teases, and the activity is vital for the delicate regulation of homology to that of Sarcophaga crassipalpis (identity normal physiological processes by limiting the potentially = 51%). Phylogenetic analysis suggested that all CPIs highly destructive activity of their target proteases such as from dipterans, including the housefly, belong to the the papain belonging to enzyme family C1, including cys- I25A family and may be descended from a single teine cathepsins B, H, L and S. Some of the cystatins also common ancestor. The gene was expressed in and inhibit legumain-related proteases of the family C13 purified from Escherichia coli. Biochemical studies (Rzychon et al., 2004; Turk et al., 2008; Carrillo et al., showed that MdCPI exerts an inhibiting function on 2010). In Sarcophaga peregrina, cathepsin L acts as a papain, which is a classical assay to confirm CPIs. regulator of metamorphosis, and blocking the action of Real-time quantitative PCR and immunolocaliza- cathepsin L can inhibit differentiation of imaginal discs tion analysis revealed that MdCPI is specifically (Homma et al., 1994), and cathepsin B participates in expressed in haemocytes and fat bodies. It is highly dissociation of the fat body during metamorphosis (Taka- down-regulated in larvae and markedly up-regulated hashi et al., 1993). One of the CPIs in S. peregrina, sar- in the pupal stage, suggesting that it may be related to cocystatin A (Scys-A), is an important regulator of development. metamorphosis by inhibiting the activity of cysteine and/or Keywords: Musca domestica, cysteine proteinase serine proteases that are needed for digesting larval inhibitor, cloning, recombinant expression, inhibitory, tissue during metamorphosis (Suzuki & Natori, 1985; fat body, haemocyte, development. Saito et al., 1989). Most CPIs are ubiquitously expressed, but others have a more restricted tissue distribution, resulting in specialized functions. For example, some insects utilize cysteine proteases as their major digestive enzymes for food protein degradation. These cystatins are mostly First published online 28 June 2011. expressed in guts and are involved in regulating the Correspondence: Fengsong Liu, College of Life Sciences, Hebei Univer- sity, Baoding, Hebei, 071002, China. Tel.: + 86 312 5079363; fax: + 86 312 level of cysteine proteases (Zhu-Salzman et al., 2003). In 5079362; e-mail: [email protected] haemocytes and fat bodies, cystatins selectively inhibit

© 2011 The Authors Insect Molecular Biology © 2011 The Royal Entomological Society 577 578 X. Dong et al. activity of the cysteine proteases, which digest most of the (Fig. 1B). The amino acid sequence of MdCPI showed the larval tissues during metamorphosis and protect develop- highest homology with sarcocystatin A of Sarchophaga ing adult tissues in pupae from attack by cysteine pro- crassipalpis (identity = 51%) in the light of a homologous teases (Suzuki & Natori, 1985; Goto & Denlinger, 2002). assay. The resulting phylogenetic tree indicated that the Some cystatins are also present in lysosomes, where they CPIs from the housefly and other dipterans descended play a major role in intracellular protein degradation (Turk from a single common ancestor and belong to the I25A et al., 2001). The differences in tissue specificity suggest family (cystatin family) (Fig. 2). that different cystatins play distinct roles in each tissue. Musca domestica L. (Diptera: Muscidae), commonly Gene expression analysis called the housefly, is a major domestic, medical and veterinary pest that causes irritation, spoils food and acts Bacteria-challenged larvae. The relative expression levels as a vector for many pathogenic organisms (Malik et al., of MdCPI at 3, 6, 12, 24, 36, 48 and 60 h after induction 2007). It is commonly associated with animal faeces, but are exhibited in Fig. 3A. The data are presented as ratios has adapted well to feeding on garbage, and so is abun- of gene expression between the induced and control dant almost anywhere there are human living. It is chroni- larvae. The expression data indicated that the MdCPI cally exposed to fluctuating environmental conditions in transcripts were constitutively expressed in naive larvae nature. As houseflies are ubiquitous, research on various and down-regulated after the larvae were challenged with aspects, especially their developmental processes, has bacteria. The result suggest that MdCPI may not be been conducted worldwide. involved in defence responses to microbial invasion. Although quite a few CPIs have been intensively studied and have been demonstrated to play important Developmental regulation of MdCPI. To analyse the roles, both in development and the immune system (Agar- expression of MdCPI during M. domestica development, wala et al., 1996; Yamamoto et al., 1999), the precise we performed a real-time qPCR (RT-qPCR) analysis. The function of these proteins in insects remain unclear. In this data showed a similar pattern of expression for MdCPI: study a new CPI, named MdCPI, was cloned from the expression increased markedly in the pupal stage and housefly (M. domestica) by rapid amplification of cDNA reached a maximum in adults, but interestingly, expres- ends based on the expressed sequence tags database sion of MdCPI was highly down-regulated in the larval (dbEST) information. The activity of recombinant MdCPI stages and reached a minimum in third instar larvae was detected. Immunohistochemical localization of (Fig. 3B). These results suggest that MdCPI may be MdCPI in the larvae was investigated using polyclonal related to development. antibodies. Quantitative PCR (qPCR) showed that it is expressed highly in haemocytes and the fat body, but Larval tissues. Tissue distribution of MdCPI was investi- at lower levels in the epithelium. MdCPI is expressed gated in third instar larvae. MdCPI mRNA was highest in at a higher level during the larval and adult stages, haemocytes, next highest in fat bodies and gut, but lower with decreased expression during larvae feeding and in the epithelium (Fig. 3C). These differences in tissue increased levels in larvae moulting and the metamorphi- distribution suggest that MdCPI may play distinct roles in cally committed stage. These results suggest that MdCPI different tissues. The MdCPI may be synthesized in fat participates in developmental processes of the housefly. body and haemocytes and involved in the regulation of the activities of cysteine proteases in larvae.

Results Prokaryotic expression, purification and Western blot of MdCPI. To carry out functional analysis of the enzyme, the Features of MdCPI recombinant plasmid (pET-17b-MdCPI) was confirmed by MdCPI, a cysteine protease inhibitor gene, was cloned sequencing and transformed into Escherichia coli BL21. A (GenBank: GU324273). It has a 357 bp open reading functional expression system for recombinant MdCPI frame encoding 118 amino acid residues. Analysis with protein (rMdCPI) was constructed to obtain sufficient SIGNALP revealed that the deduced peptide contained a protein for characterization of the properties of MdCPI. putative signal peptide of 17 amino acids and mature After centrifugation, rMdCPI was in soluble fraction of peptide of 101 amino acids. The molecular mass of the sonication lysate and purified using nickel-nitrilotriacetic deduced mature peptide was 10.8 kDa. It is anionic, with acid (Ni-NTA) Resin. The purified rMdCPI showed a single a theoretical isoelectric point (pI) of 5.9. The full-length band in sodium dodecyl sulphate polyacrylamide gel elec- nucleotide sequence and the deduced amino acid trophoresis (SDS-PAGE) of about 11.6 kDa (Fig. 4A). sequence were determined (Fig. 1A). MdCPI was aligned The purified rMdCPI and total protein of the housefly together with various cystatins using the BIOEDIT program larvae were subjected to Western blot analysis. The rabbit

Figure 1. The complete nucleotide and deduced amino acid sequences of Musca domestica cysteine protease inhibitor (MdCPI). (A) ATG and TAA indicate the start site and the stop codon, respectively, the shadowed letters (AATAAA) indicate the polyadenylation signal and signal peptides at the N-termini are underlined. (B) Alignment of CPIs from M. domestica, Sarcophaga peregrina (Scys-A), Drosophila melanogaster, Sarcophaga crassipalpis, Aedes aegypti and Aedes albopictus. The conserved motifs are underlined. anti-rMdCPI polyclonal antibody is relatively specific strate. Concentration of purified rMdCPI was 2.46 mg/ml. because it detects only a single major band in native The curve of inhibitory activity of rMdCPI on papain was larvae expressing MdCPI. The mature MdCPI from larvae constructed by using the SIGMAPLOT 10.0 program. The was about 10.8 kDa (Fig. 4B). results show a highly statistically significant linear relation- ship (P < 0.01) between amounts of rMdCPI (x-axis)

(under 3 mg) and DOD595 (the deﬁnation of DOD595 is Activity detection and statistical analysis described in experimental procedures) (y-axis), with the The inhibitory activity of rMdCPI was investigated using inhibition curve found to be y = 0.1676x - 0.0487(R2 = papain as the proteolytic enzyme and casein as the sub- 0.988). However, there was no signiﬁcant difference

Figure 2. Phylogenetic tree of amino acid sequences of cysteine protease inhibitors of Musca domestica and other insects. Neighbour-joining method with genetic distance calculated using the Kimura two- parameter model. The numbers above the branches indicate the percentages of times that the species are grouped together in the bootstrap trees. The scale bar indicates the number of substitutions per site for a unit branch length. Sarcophaga peregrina (Swiss-Prot: P31727); Sarcophaga crassipalpis (GenBank: BAB88880); M. domestica (GenBank: GU324273); Drosophila melanogaster (GenBank: CAA38963); Aedes aegypti (National Center for Biotechnology Information reference sequence: XP_001656574); Aedes albopictus (GenBank: AAV90738); Glyptapanteles ﬂavicoxis (GenBank: ACE75077); Lonomia oblique (GenBank: AAV91420); Manduca sexta (GenBank: BAE97580); Oncopeltus fasciatus (GenBank: ABN54486); Leptinotarsa decemlineata (MEROPS: MER043936); Bombyx mori (GenBank: CAB41937); Nasonia vitripennis (MEROPS: MER172710); Pediculus humanus (MEROPS: MER172653); Acyrthosiphon pisum (MEROPS: MER159643); Culex pipiens quinquefasciatus (MEROPS: MER162552); Drosophila yakuba (MEROPS: MER142456).

(P > 0.05) amongst these groups when the amounts of the N-terminal region and Q-V-I-Q-G in the middle region, rMdCPI were more than 3 mg (Fig. 5). The results of activ- but no P-W in the C-terminal region (Fig. 1B). It is similar ity detection showed that about 1 mg recombinant MdCPI to cystatin A from Homo sapiens (NP_005204). On could inhibit the activity of 14 mg papain. From these data, binding, the N-terminal residues of stefin A adopt the form the inhibitory constant of MdCPI for papain was calculated of a hook with Q-X-V-X-G (Jenko et al., 2003). MdCPI may to be 3.8 nM. act in a similar manner. The recombinant protein showed inhibitory activity against papain. MdCPI is highly similar to Scys-A from S. peregrina haemocytes (GenBank acces- Expression of MdCPI in larval whole bodies of sion no.: BAB88880) in terms of amino acid sequence. Musca domestica Scys-A protein was purified from haemolymph and was To localize the expression of MdCPI protein in the whole found to belong to the I25A family of the I25 inhibitor body, rabbit-anti-rMdCPI polyclonal antibody was used to subfamily (Suzuki & Natori, 1985; Rawlings, 2010; http:// analyse the expression and distribution of MdCPI in third merops.sanger.ac.uk/). It is not involved in defence instar larval tissue sections. As shown in Fig. 4, there was responses to microbial invasion (Masova et al., 2009), but intense immunofluorescence (Cy3, red) in the transverse is up-regulated in the pupal stage and acts as an impor- side of fat body in larval (A1, A2 and B), fat body (C) and tant regulator of metamorphosis by inhibiting the activity of haemocyte (D) sections. No MdCPI expression was cysteine proteinases that are needed for digesting larval observed in either the epithelium or gut. Furthermore, no tissue during the metamorphic stage. Its expression was immunofluorescence was found in the control (E), for detected in the fat body, but at lower levels than in the which tissues were incubated only with preimmune anti- whole body. Thus, Scys-A is thought to protect developing serum (1:12 dilution) (Fig. 6). adult tissues in pupae from attack by cysteine proteases (Saito et al., 1989; Goto & Denlinger, 2002). A CPI from the horseshoe crab, Tachypleus tridentatus, Discussion limulus (L)-cystatin, has antimicrobial activity against Cystatins, the inhibitors of cysteine proteases, are of key Gram-negative bacteria (Agarwala et al., 1996). Cysteine importance because of the wide distribution of these pro- proteinase inhibitors from the silkmoth, Bombyx mori, act teases in all living organisms involved in various biological as defence proteins against invading pathogens and para- and pathological processes (Honey & Rudensky, 2003). In sites, many of which use cysteine proteinases to enter the present study, a novel cysteine proteinase inhibitor their hosts (Yamamoto et al., 1999). To obtain a better cDNA termed MdCPI from M. domestica was cloned. Its understanding of MdCPI, the gene expression patterns mature peptide, a 108-residue protein, was then deduced following bacterial challenges and in different develop- and expressed in E. coli. The structural motifs of the ment stages were analysed via RT-qPCR in the present cystatin domain are conserved in MdCPI, includingaGin study. MdCPI showed a similar pattern of expression for

Figure 3. Real-time PCR quantitative analysis of the relative expression of Musca domestica cysteine protease inhibitor (MdCPI). (A) Time-course analysis of MdCPI expression in larvae in response to Escherichia coli or Staphylococcus aureus challenge. Inductive stage 8 points represented 1: CK, normal control; 2: infected 3 h; 3: infected 6 h; 4: infected 12 h; 5: infected 24 h; 6: infected 36 h; 7: infected 48 h; 8: infected 60 h. Grey bar, challenged with E. coli; black bar, challenged with S. aureus. (B) Expression of MdCPI at different developmental stages of M. domestica. (C) Expression of MdCPI at different tissues in naive larvae. Each bar represents the mean value from three determinations with the standard error (SE) of the means (mean Ϯ SE, n = 3). ** denotes highly significant difference (P < 0.01) between the treatment and the control in (A), different stages and third instar larvae (B), each tissue and epithelium in (C), * denotes significant difference (C) (P < 0.05) between first instar pupa and third instar larvae with Student’s test (TTEST).

Scys-A: MdCPI is not involved in defence responses to tease (Ahn & Zhu-Salzman, 2009), S. peregrina cathepsin microbial invasion and expression of MdCPI gradually L (Homma et al., 1994) and cathepsin B in the fat body of increased during the metamorphic stage. However, B. mori (Lee et al., 2009). Select cysteine proteinases are interestingly, the expression markedly decreased to a digestive enzymes, such as cysteine proteinases in minimum in the third (ﬁnal) larval instar, and reached a Coleoptera (Cristofoletti et al., 2003) and Diptera maximum at the adult stage (Fig. 3B). The results indicate (Matsumoto et al., 1995). However, a number of cysteine that MdCPI is expressed at a higher level during the larval proteinases play key roles in developmental processes. and adult stages, with decreased expression during larvae Meanwhile, a functional expression system for recom- feeding and increased levels afterward in larvae moulting binant MdCPI protein (rMdCPI) in E. coli cells was and the metamorphically committed stage. Insect cysteine constructed to obtain sufficient protein for characterization proteases play a number of roles in life processes. A of the properties of MdCPI. In addition, other inhi- number of cysteine proteinases also have opposite pat- bitors activity detection has also been observed in terns: Helicoverpa armigera cathepsins L (Wang et al., Manduca sexta CPI (Miyaji et al., 2007), Angiostrongylus 2010), Callosobruchus maculatus cathepsin D-like pro- cantonensis CPI (Liu et al., 2010) and Cotesia congregata

Figure 4. Sodium dodecyl sulphate polyacrylamide gel electrophoresis analysis of expression of pET-17b-Musca domestica cysteine protease inhibitor (MdCPI) and Western blot. (A) Lane 1: non-induced cells; lane 2: soluble fraction of sonication lysate after isopropyl b-D-thiogalactoside induction; lane 3: purified recombinant MdCPI (rMdCPI); lane M: protein molecular weight marker. (B) After electrophoresis, the peptides were transferred to nitrocellulose membranes. Lane 1: purified rMdCPI (11.6 kDa); lane 2: naive MdCPI of total protein extracted from larvae (10.8 kDa); lane M: prestained protein molecular weight marker. bracovirus CPI (Espagne et al., 2005). rMdCPI also effec- with lower expression of proteinase inhibitor was benefi- tively inhibited the papain of the C1 cysteine protease cial to the cysteine cathepsins in digesting most of the family. The in vitro inhibitory efficacy of rMdCPI against the larval tissues, tissue remodelling and puparium and imagi- commercial papain detected that 1 mg rMdCPI could nal disc formation during metamorphosis (Takahashi inhibit the activity of 14 mg papain and the inhibitory con- et al., 1993; Homma et al., 1994; Wang et al., 2010). After stant was calculated to be 3.8 nM. this, the gradual up-regulation of MdCPI is likely to serve One of the roles of MdCPI might be the regulation of to protect developing adult tissues in pupae from attack by family C1 cysteine proteases that are involved in meta- cysteine proteases and to regulate the level of cysteine morphosis. High expression of a gene encoding a protein- protease in the adult body. Therefore, we speculate that ase inhibitor in early larval stages is thus likely to indicate the expression of MdCPI is regulated in a developmental the inhibition of endogenous cysteine protease that pro- stage-dependent manner. motes growth and development of larva. During the Western blot analysis revealed that the protein was larval–pupal stage, increasing proteinase concomitantly recognized specifically by the rabbit anti-rMdCPI poly-

Figure 5. The curve of inhibitory activity of recombinant Musca domestica cysteine protease inhibitor (MdCPI) on papain. As described in the Experimental procedures, a ﬁxed amount of papain was mixed with increasing amounts of recombinant MdCPI and inhibitory activity was assayed by the change of absorbance. Casein was used as the substrate. Enzyme activities were determined by changes in the ﬂuorescence emission intensity (mean Ϯ SE, n = 3).

Figure 6. Musca domestica cysteine protease inhibitor (MdCPI) protein was immunolocalized to the fat body of whole third instar M. domestica larvae and isolated haemocytes. Intense immunofluorescence signal (Cy3, red) was observed in fat body of the whole body. (A1), (A2) and (B), fat body at different magnifications; A2 – ¥20, A1, B – ¥10. In isolated fat body and gut, intense immunofluorescence signal occurred only in the fat body (C – ¥20), with almost no signal in the gut. In (D) – ¥40, immunofluorescence signal was observed in isolated haemocytes. No immunofluorescence was found in the control using preimmune antibody (E – ¥10). (F) The same larval tissues as in (C) observed under white light. (G) The same haemocytes as in (D) observed under white light. (H) The same larval section as in (B) observed under white light. Scale bars = 200 mm.

clonal antibody raised against total protein of housefly involved in fat body remodelling by regulation of devel- larvae, demonstrating that rMdCPI was indeed MdCPI. opment and differentiation of haemocytes (Turk et al., Intense immunofluorescence signal was found in 2001, 2008; Wang et al., 2010). MdCPI contains a puta- haemocytes and fat body, but not in gut and epithelium tive signal peptide of 17 amino acids and is likely be (Fig. 6). MdCPI transcripts were present highest in secreted into the extracellular environment to achieve its haemocytes, next highest in fat body and gut, but low function, which was characterized as inhibitory activity in the epithelium as shown by RT-qPCR (Fig. 3C). against the cysteine protease. The MdCPI, synthesized However, the MdCPI transcripts detected in the in fat body and haemocytes and then secreted into haemocytes of the gut may cause a false positive in haemolymph, may be involved in the regulation of the RT-qPCR. The results showed that MdCPI was specifi- activities of cysteine proteases during different develop- cally expressed in haemocytes and the fat body and mental stages. might not be a digestive enzyme. Many regulatory pro- Consequently, our study has demonstrated that MdCPI teins are known to be synthesized by the fat body and is expressed highly in haemocytes and fat body and par- secreted into the haemolymph in response to the intro- ticipates in developmental processes of the housefly. Our duction of foreign substances to regulate the balance of results provide some new insights for insect biological endogenous cysteine protease, and might also be research on proteolytic enzyme inhibitors.

obtained from dbEST. The PCR was performed with gene- Experimental procedures specific primer CPI-f and anchor primer AP (GGCCACGCGTC Insect rearing GACTAGTAC). The PCR reaction was an initial 4 min predenaturation at 94 °C, 94 °C for 30 s, 58 °C for 40 s, 72 °C for 60 s, The housefly strain used in this study was a gift from Miss Fengqin after 35 amplification cycles the last extension step was He, Institute of Zoology, Chinese Academy of Sciences. Musca extended 10 min at 72 °C, followed by cooling to 10 °C. The larvae were raised at 25 °C on a medium of bran (55 g), heat- PCR products were ligated with the pMD18-T cloning vector inactivated yeast (3 g), milk (150 ml) and the antimycotic nipagin using T4 DNA ligase and transformed into E. coli DH5a com- (0.35 g) until pupariation. After eclosion, adult flies were fed on petent cells. The transformed bacteria were plated onto LB agar water, sugar and milk powder. Flies were maintained at 25 °C plates containing ampicillin, 5-bromo-4-chloro-3-indolyl b-D- under 12 h light/12 h dark cycles (LD12:12) (Codd et al., 2007). galactoside and isopropyl b-D-thiogalactoside (IPTG), followed by overnight incubation at 37 °C. Randomly selected white Induction experiment clones were sequenced. The sequences were searched in GenBank with BLASTx. The Gram-negative bacteria E. coli and Gram-positive bacteria The putative MdCPI open reading frame was found by Staphylococcus aureus were used for the infection. The bacteria the BIOEDIT program (NCBI, http://www.ncbi.nlm.nih.gov/). were cultured in 10 ml luria-bertani (LB) medium at 37 °C to an Sequence alignment analysis was performed using the National optical density at 600 nm (OD ) of 1 and washed twice with 600 Center for Biotechnology Information (http://www.mbio.ncsu. 0.9% NaCl by centrifugation at 12 000 g for 2 min. The washed edu/bioedit.html) blast program and MEROPS database (http:// cells were thoroughly resuspended and mixed in the small merops.sanger.ac.uk/). The signal peptide was predicted by the volume of saline (about 1/10 of original volume). We used house- SIGNALP 3.0 program (http://www.cbs.dtu.dk/services/SignalP/). fly larvae (second instar) for the infection experiment. Septic Phylogenetic analysis was performed based on amino acid injury was performed by pricking the larva body with a sterile sequences of known CPI molecules of M. domestica and other needle previously dipped into a concentrated mixture of the bac- insects using CLUSTAL W (Chenna et al., 2003) and MEGA teria [108 colony forming units per milliter (CFU/ml)]. A sterile version 4.0 (Kumar et al., 2004). The sequence data were trans- needle was used for injury of control larvae. Total RNA of the M. formed into a distance matrix. One thousand bootstraps were domestica larvae was extracted at 3, 6, 12, 24, 36, 48 and 60 h performed for the neighbour-joining tree to check for repeatabil- after infection. At least six larvae for each time point and induction ity of the results. challenge were used.

Isolation of larval tissues Gene expression analysis with RT-qPCR The fat body, epithelium and gut were excised from the third instar Expression of MdCPI in bacteria-challenged larvae. The mRNA larvae under a binocular microscope (Nikon SMZ1500, Sendai, levels of MdCPI in bacteria-challenged larvae were measured by Japan) and placed into a physiological saline-containing Petri RT-qPCR amplification. Total RNA was extracted from whole dish on ice. The anterior tip of the larvae was cut off with a pair of larval bodies. In previous work, we cloned the beta-actin mRNA fine scissors and haemolymph was collected and exuded in an partial sequence from M. domestica successfully (data not ice-cold test-tube. About 100 ml haemolymph was collected from shown). Expression of beta-actin showed stable and no change ~ 30 larvae (Fu et al., 2009). to bacterial infection (data not shown). PCR amplifications were performed in 25 ml reactions containing 2.5 ml cDNA, 2.5 ml Total RNA extraction and cDNA preparation 10 mM each of gene-specific forward MdCPI-F1 (TGATGGTCCT CATTACACGC) and reverse primer MdCPI-R1 (GGAAACCCT Total RNA of the M. domestica larvae was freshly extracted from GAATAACTTGG), 12.5 mlof2¥ SYBR Premix Ex Taq (TaKaRa, whole bodies or larval tissues using TRizol reagent (Invitrogen, Dalian, Liaoning, China) and 7.5 ml double-distilled H2O. The Carlsbad, CA, USA) according to the manufacturer’s protocol. RT-qPCR was performed on a Miniopticon instrument (Bio-Rad, RNA sample purity was estimated using spectrophotometric mea- Hercules, CA, USA). The amplification reaction protocol was an surement at the value of 260/280 absorbance (A260/280) initial 2 min predenaturation at 95 °C, 40 cycles at 95 °C for 20 s, absorbency, and its integrity was checked by agarose gel 60 °C for 30 s, followed by the protocol for the melting curve with electrophoresis. an increase of 0.5 °C between each cycle from 60 to 95 °C. We First-strand cDNA was made using an universal forward primer used the differences in threshold cycle (DCT) values for statistical adaptor oligo dT primer (AOLP) [GGCCACGCGTCGACTAGTAC analysis of RT-qPCR data. The relative level of MdCPI mRNA (T)16(A/C/G)] (Liu et al., 2005, 2009). A reverse transcription (RT) was determined by the 2-DDCT method. The results are shown as reaction was performed with 2 mg RNA as a template in RT buffer the mean and a range specified by 2-(DDCT+SD), where SD is the containing 10 mM deoxy-ribonucleotide triphosphate, 10 mM of standard deviation, for six biological replicates each from inde- each universal primer, 1 mM dithiothreitol and one unit of pendent collections. Statistical analyses were determined by Moloney murine leukaemia virus polymerase in 25 ml total t-tests (SPSS 13.0 (http://en.wikipedia.org/wiki/spss)) at a signifi- volume. After an initial 5 min denaturation at 70 °C, 1 h extension cance level of P < 0.01 or a nonsignificance level of at 42 °C, followed by cooling to 4 °C. P > 0.05.

Cloning and analysis of the MdCPI gene Expression of MdCPI in different developmental stages. Beta- Primer CPI-f (AAAATCATGAAACTTTTCGTTGTTG) was actin was used as the internal control. Relative expressions of designed based on the partial cDNA fragment sequence MdCPI at the first and third (final) larval instar, first and third pupal

© 2011 The Authors Insect Molecular Biology © 2011 The Royal Entomological Society, 20, 577–586 Cysteine protease inhibitor 585 instar and adult stage were detected. Total RNA was extracted Antibody and Western blot from whole M. domestica bodies. The procedure for the PCR reaction was the same as above. The purified protein rMdCPI was used as an antigen to produce rabbit polyclonal antibody by the traditional method. The purified rMdCPI and total protein of the housefly larvae extracted with a Expression of MdCPI in larval tissues. Expression of KEYGEN (Keygen, Nanjing, Jiangsu, China) nuclear-cytosol glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was extraction kit were analysed by SDS-PAGE. After electrophoresis, shown to be more stable than beta-actin in larval tissues by the peptides were transferred to nitrocellulose membranes using qPCR. PCRs were standardized using GAPDH-specific primers wet transfer. The rabbit anti-rMdCPI polyclonal antibody (1:8 (GAPDH F: GCTGGTGCCGAATATGTTGTTG and GAPDH R: dilution) was used as the primary antibody, and horseradish GCAGATGGAGCGGAGATGATGA). The procedure was the peroxidase-conjugated goat anti-rabbit Immunoglobulin G (IgG) same as above. (1:300) was used as the secondary antibody. 3, 3′- diaminobenzidine was used as the substrate of the peroxidase. Expression and purification of recombinant MdCPI protein

The DNA fragment encoding mature MdCPI was obtained by Immunolocalization of MdCPI in larvae PCR amplification with the following two primers, CPI-exf The whole body of M. domestica larvae (third instar) was fixed (GCTAGCcatcatcatcatcatcatAGTCCCCCCTGTTTGGGT) and overnight in 4% paraformaldehyde at 4 °C. Fixed larvae was CPI-exr (AAGCTTTTACGAGCTATGTTTCTTG) (lower case frozen and cut into 20-mm sections with optimum cutting tempera- letters indicate 6 ¥ His-tagged codons, underlined letters indicate ture compound (JUNG tissue freezing medium, Leica, Wetzlar, NheI and HindIII sites). The PCR product was digested with NheI Germany). The sections were fixed in cold acetone for 10 min, and HindIII and ligated into the vector pET-17b (Novagen, washed with PBS twice, and permeabilized for 10 min with a PBS Madison, WI, USA). The recombinant plasmid (pET-17b-MdCPI) solution containing 0.3% Triton X-100 (Sigma, St Louis, MO, was confirmed by sequencing and transformed into E. coli BL21 USA), then treated with a PBS blocking solution of 10% goat and the recombinant protein was induced with 1 mM IPTG for 4 h serum and 0.1% Triton X-100 (PBS-T) at room temperature for at 37 °C. Then the cells were harvested and lysed by sonication 90 min, and incubated with rabbit anti-rMdCPI polyclonal anti- in phosphate-buffered saline (PBS) (pH 7.4). The lysate was body diluted 1:12 in PBS-T overnight at 4 °C. After washing with centrifuged at 10 000 g for 10 min. The recombinant MdCPI PBS twice, sections were incubated in the dark at room tem- (rMdCPI) protein was purified using Ni-NTA Resin (GenScript, perature for 1 h with secondary antibodies Cy3 (cyanine dyes) Nanjing, Jiangsu, China) according to the supplier’s instructions conjugated goat anti-rabbit IgG (1:200 dilution in PBS-T). and analysed by SDS-PAGE. Protein concentrations were deter- Sections were again washed and images were observed mined by a modified Bradford method using a commercial kit using a fluorescence microscope (OLYMPUS BX51 DP71, (Pierce, Rockford, IL, USA) and bovine serum albumin as a + Tokyo, Japan). All images were imported into Adobe (http:// standard. www.adobe.com) Photoshop for assembly and annotation.

Assay of cysteine protease inhibitory activity Acknowledgements Inhibitory activity toward papain was measured by the method of Bradford (Filippova et al., 1984). Papain [United States Pharma- This work was financially supported by the Specialized copoeia (USP)/6000/mg, Sigma, St Louis, MO, USA] was dis- Research Fund for the Doctoral Program of Higher Edu- solved at 10 mg/ml in 50 mM Tris-HCl buffer (pH 7.6) containing cation of China (No. 20101301120005), the Natural 2 mM L-cysteine hydrochloride, 0.1 mM ethylenediaminetet- Science Fund of Hebei Province (No. C2011201027) and raacetic acid. Five microlitres of papain solution was added with 20 ml casein as substrate solution (casein was dissolved at the Natural Science Fund of Hebei University (No. 5.0 mg/ml) and various amounts of the rMdCPI solution. The 2010001). same buffer was added to give a final volume of 300 ml and incubated at 37 °C for 20 min. After incubation, 2 ml Coomassie Brilliant Blue G250 was added and mixed completely. The absor- References bance was measured at 595 nm after 3 min. Inhibitory activity Agarwala, K.L., Kawabata, S., Hirata, M., Miyagi, M., Tsunasawa, was defined as the following formula: S. and Iwanaga, S. (1996) A cysteine protease inhibitor stored in the large granules of horseshoe crab hemocytes: purifica- ΔOD595=−′ OD 595 OD 595 tion, characterization, cDNA cloning and tissue localization. J

OD595 indicated the absorbance of the reaction to which rMdCPI Biochem 119: 85–94. solution was added in incubation, OD595′ indicated the absor- Ahn, J.E. and Zhu-Salzman, K. (2009) CmCatD, a cathepsin bance of the reaction in which casein was completely hydrolysed d-like protease has a potential role in insect defense against a by papain without rMdCPI solution, DOD595 indicated the diversity phytocystatin. J Insect Physiol 55: 678–685. between OD595 and OD595′. All data represent the mean of tripli- Barrett, A.J., Fritz, H., Grubb, A., Isemura, S., Jarvinen, M., cate determination with standard deviation (n = 3). Statistical Katunuma, N. et al. (1986) Nomenclature and classification of analyses were determined by t-tests (SPSS 13.0) at a signifi- the proteins homologous with the cysteine-proteinase inhibitor cance level of P < 0.01 or a nonsignificance level of P > 0.05. The chicken cystatin. Biochem J 236: 312. inhibitory constants toward papain used in this study were deter- Bode, W., Engh, R., Musil, D., Thiele, U., Huber, R., Karshikov, A. mined by the method of Henderson (1972). et al. (1988) The 2.0 A X-ray crystal structure of chicken egg

white cystatin and its possible mode of interaction with cys- ride factor in Chinese shrimp (Fenneropenaeus chinensis). teine proteinases. EMBO J 7: 2593–2599. Mar Biotechnol (NY) 7: 600–608. Carrillo, L., Martinez, M., Alvarez-Alfageme, F., Castanera, P., Liu, F., Li, F., Dong, B., Wang, X. and Xiang, J. (2009) Molecular Smagghe, G., Diaz, I. et al. (2010) A barley cysteine- cloning and characterisation of a pattern recognition protein, proteinase inhibitor reduces the performance of two aphid lipopolysaccharide and beta-1,3-glucan binding protein species in artificial diets and transgenic Arabidopsis plants. (LGBP) from Chinese shrimp Fenneropenaeus chinensis. Mol Transgenic Res 20: 305–319. Biol Rep 36: 471–477. Chenna, R., Sugawara, H., Koike, T., Lopez, R., Gibson, T.J., Liu, Y.H., Han, Y.P., Li, Z.Y., Wei, J., He, H.J., Xu, C.Z. et al. Higgins, D.G. et al. (2003) Multiple sequence alignment with (2010) Molecular cloning and characterization of cystatin, a the Clustal series of programs. Nucleic Acids Res 31: 3497– cysteine protease inhibitor, from Angiostrongylus cantonensis. 3500. Parasitol Res 107: 915–922. Codd, V., Dolezel, D., Stehlik, J., Piccin, A., Garner, K.J., Racey, Malik, A., Singh, N. and Satya, S. (2007) House fly (Musca S.N. et al. (2007) Circadian rhythm gene regulation in the domestica): a review of control strategies for a challenging housefly Musca domestica. Genetics 177: 1539–1551. pest. J Environ Sci Health B 42: 453–469. Cristofoletti, P.T., Ribeiro, A.F., Deraison, C., Rahbe, Y. and Terra, Masova, A., Sindelka, R., Kubista, M., Kindl, J. and Jiracek, J. W.R. (2003) Midgut adaptation and digestive enzyme distri- (2009) Gene expression responses in larvae of the fleshfly bution in a phloem feeding insect, the pea aphid Acyrthosi- Sarcophaga bullata after immune stimulation. Folia Biol 55: phon pisum. J Insect Physiol 49: 11–24. 98–106. Espagne, E., Douris, V., Lalmanach, G., Provost, B., Cattolico, L., Matsumoto, I., Watanabe, H., Abe, K., Arai, S. and Emori, Y. Lesobre, J. et al. (2005) A virus essential for insect host- (1995) A putative digestive cysteine proteinase from Droso- parasite interactions encodes cystatins. J Virol 79: 9765–9776. phila melanogaster is predominantly expressed in the embry- Filippova, I., Lysogorskaya, E.N., Oksenoit, E.S., Rudenskaya, onic and larval midgut. Eur J Biochem 227: 582–587. G.N. and Stepanov, V.M. (1984) L-Pyroglutamyl-L- Miyaji, T., Kouzuma, Y., Yaguchi, J., Matsumoto, R., Kanost, phenylalanyl-L-leucine-p-nitroanilide–a chromogenic sub- M.R., Kramer, K.J. et al. (2007) Purification of a cysteine strate for thiol proteinase assay. Anal Biochem 143: 293–297. protease inhibitor from larval hemolymph of the tobacco horn- Fu, P., Wu, J. and Guo, G. (2009) Purification and molecular worm (Manduca sexta) and functional expression of the identification of an antifungal peptide from the hemolymph of recombinant protein. Insect Biochem Mol Biol 37: 960–968. Musca domestica (housefly). Cell Mol Immunol 6: 245–251. Rawlings, N.D. (2010) Peptidase inhibitors in the MEROPS data- Goto, S.G. and Denlinger, D.L. (2002) Genes encoding two cys- base. Biochimie 92: 1463–1483. tatins in the flesh fly Sarcophaga crassipalpis and their distinct Rzychon, M., Chmiel, D. and Stec-Niemczyk, J. (2004) Modes of expression patterns in relation to pupal diapause. Gene 292: inhibition of cysteine proteases. Acta Biochim Pol 51: 861–873. 121–127. Saito, H., Suzuki, T., Ueno, K., Kubo, T. and Natori, S. (1989) Henderson, P.J. (1972) A linear equation that describes the Molecular cloning of cDNA for sarcocystatin A and analysis steady-state kinetics of enzymes and subcellular particles of the expression of the sarcocystatin A gene during deve- interacting with tightly bound inhibitors. Biochem J 127: 321– lopment of Sarcophaga peregrina. Biochemistry 28: 1749– 333. 1755. Homma, K., Kurata, S. and Natori, S. (1994) Purification, char- Suzuki, T. and Natori, S. (1985) Purification and characterization of acterization, and cDNA cloning of procathepsin L from the an inhibitor of the cysteine protease from the hemolymph culture medium of NIH-Sape-4, an embryonic cell line of of Sarcophaga peregrina larvae. J Biol Chem 260: 5115–5120. Sarcophaga peregrina (flesh fly), and its involvement in the Takahashi, N., Kurata, S. and Natori, S. (1993) Molecular differentiation of imaginal discs. J Biol Chem 269: 15258– cloning of cDNA for the 29 kDa proteinase participating 15264. in decomposition of the larval fat body during metamorphosis Honey, K. and Rudensky, A.Y. (2003) Lysosomal cysteine pro- of Sarcophaga peregrina (flesh fly). FEBS Lett 334: 153– teases regulate antigen presentation. Nat Rev 3: 472–482. 157. Jenko, S., Dolenc, I., Guncar, G., Dobersek, A., Podobnik, M. and Turk, V., Turk, B. and Turk, D. (2001) Lysosomal cysteine pro- Turk, D. (2003) Crystal structure of Stefin A in complex with teases: facts and opportunities. EMBO J 20: 4629–4633. cathepsin H: N-terminal residues of inhibitors can adapt to the Turk, V., Stoka, V. and Turk, D. (2008) Cystatins: biochemical and active sites of endo- and exopeptidases. J Mol Biol 326: structural properties, and medical relevance. Front Biosci 13: 875–885. 5406–5420. Kordis, D. and Turk, V. (2009) Phylogenomic analysis of the Wang, L.F., Chai, L.Q., He, H.J., Wang, Q., Wang, J.X. and Zhao, cystatin superfamily in eukaryotes and prokaryotes. BMC Evol X.F. (2010) A cathepsin L-like proteinase is involved in moult- Biol 9: 266. ing and metamorphosis in Helicoverpa armigera. Insect Mol Kumar, S., Tamura, K. and Nei, M. (2004) MEGA3: integrated Biol 19: 99–111. software for molecular evolutionary genetics analysis and Yamamoto, Y., Watabe, S., Kageyama, T. and Takahashi, S.Y. sequence alignment. Brief Bioinform 5: 150–163. (1999) Purification and characterization of Bombyx cysteine Lee, K.S., Kim, B.Y., Choo, Y.M., Yoon, H.J., Kang, P.D., Woo, proteinase specific inhibitors from the hemolymph of Bombyx S.D. et al. (2009) Expression profile of cathepsin B in the fat mori. Arch Insect Biochem Physiol 42: 119–129. body of Bombyx mori during metamorphosis. Comp Biochem Zhu-Salzman, K., Koiwa, H., Salzman, R.A., Shade, R.E. and Physiol 154: 188–194. Ahn, J.E. (2003) Cowpea bruchid Callosobruchus maculatus Liu, F., Liu, Y., Li, F., Dong, B. and Xiang, J. (2005) Molecular uses a three-component strategy to overcome a plant defen- cloning and expression profile of putative antilipopolysaccha- sive cysteine protease inhibitor. Insect Mol Biol 12: 135–145.