5.13 Mrna Decay Experiments

Research Collection

Doctoral Thesis

Yeast LA-related proteins and the LA-motif defining RNA targets and roles in gene expression control

Author(s): Schenk, Luca

Publication Date: 2011

Permanent Link: https://doi.org/10.3929/ethz-a-006602028

Rights / License: In Copyright - Non-Commercial Use Permitted

This page was generated automatically upon download from the ETH Zurich Research Collection. For more information please consult the Terms of use.

ETH Library DISS. ETH Nr. 19506

YEAST LA-RELATED PROTEINS AND THE LA-MOTIF: DEFINING

RNA TARGETS AND ROLES IN GENE EXPRESSION CONTROL

A dissertation submitted to

ETH ZURICH

for the degree of

Doctor of Sciences

presented by

LUCA SCHENK

Dipl. Biol. University of Basel

born January 2, 1980

Citizen of Eggiwil, BE

Accepted on the recommendation of

Prof. Dr. Michael Detmar / Referent Prof. Dr. Cornelia Halin Winter / Korreferentin PD Dr. André Gerber / Korreferent

2011

Table of Contents

1 SUMMARY ...... 5

1.1 SUMMARY ...... 7 2.2 ZUSAMMENFASSUNG ...... 9 2 INTRODUCTION ...... 13

2.1 POSTTRANSCRIPTIONAL GENE REGULATION ...... 15 2.1.1 The eukaryotic gene expression program ...... 15 2.1.2 RNA binding proteins: Leaders of the RNA world ...... 17 2.1.3 Specificity of RNA‐protein interactions ...... 18 2.1.4 Non‐coding RNAs in posttranscriptional gene regulation ...... 21 2.1.5 Posttranscriptional gene regulation means networking ...... 22 2.1.6 The posttranscriptional operon model ...... 24 2.1.7 Methods to study posttranscriptional gene regulation ...... 25 2.1.7.1 RIP‐Chip ...... 26 2.1.7.2 CLIP and PAR‐CLIP ...... 27 2.2 LA‐MOTIF, LA PROTEINS AND LA‐RELATED PROTEINS...... 30 2.2.1 The La‐motif ...... 34 2.2.2 The La proteins ...... 36 2.2.2.1 La in non‐coding RNA metabolism ...... 37 2.2.2.2. La in mRNA metabolism ...... 39 2.2.3 The La‐related proteins ...... 42 2.2.3.1 The Larp 1 family ...... 43 2.2.3.2 The Larp 4 family ...... 44 2.2.3.3 The Larp 6 family ...... 45 2.2.3.4 The Larp 7 family ...... 47 2.2.4 Yeast Larps ...... 48 2.2.4.1 Sro9p ...... 49 2.2.4.2 General aspects of copper homeostasis and implications for human disease ...... 50 2.2.4.3 Slf1p ...... 55 2.3 AIM AND WORKING STRATEGY OF THE THESIS ...... 56 3 RESULTS ...... 59

3.1 COPPER PHENOTYPE AND RNA BINDING ACTIVITY ...... 61 3.1.1 The copper phenotype assay ...... 61 3.1.2 Characterization of Slf1p copper phenotype ...... 63 3.1.3 Functional La‐domain is crucial for Slf1p‐mediated increased resistance to copper ...... 66 3.1.4 Global identification of Slf1p RNA‐targets ...... 68 3.1.5 Characterization of Larp mRNA targets ...... 72 3.1.6 Recombinant Slf1p binds unspecifically to RNA in vitro ...... 77 3.1.7 Mutations in the aromatic patch of the LAM impair mRNA‐binding of Slf1p in vivo ...... 79 3.2 FUNCTIONAL STUDIES ...... 84 3.2.1 Slf1p specifically regulates mRNA steady‐state levels of target RNAs ...... 84 3.2.2 Slf1p is localized to the cytoplasm and affects target‐mRNA decay ...... 89 3.2.3 Analysis of potential Slf1p‐mediated effects on translation ...... 93 3.3 AUTHOR’S CONTRIBUTION AND AFFILIATION ...... 97 4 DISCUSSION ...... 99

4.1 OVERVIEW ...... 101 4.2 THE ROLE OF THE LAM IN MRNA BINDING ...... 102 4.2.1 The La‐motif: important for unspecific in vivo RNA binding? ...... 102 4.2.2 Highly conserved residues mediate mRNA binding ...... 104 4.2.2 Do yeast Larps bind to uridine‐rich structural motifs? ...... 107 4.3 SLF1P FUNCTIONS IN COPPER HOMEOSTASIS ...... 108 4.3.1 Slf1p positively affects the stability of target mRNAs ...... 108 4.3.2 Slf1p might control a posttranscriptional operon important for copper detoxification ...... 110 4.3.3 Differences between Sro9p and Slf1p regarding copper physiology ...... 115 4.3.4 An additional role of Slf1p in translation? ...... 118 4.3 IMPEDING REDUNDANCY OF REGULATORY NETWORKS IN RBP RESEARCH ...... 120 4.4 CONCLUDING REMARKS ...... 121 5 MATERIALS AND METHODS ...... 125

5.1 YEAST STRAINS AND MEDIA ...... 127 5.2 PLASMIDS ...... 128 5.3 PHENOTYPE STUDIES ...... 130 5.4 RNA AFFINITY ISOLATIONS ...... 130 5.5 DNA MICROARRAY ANALYSIS ...... 131 5.6 SUCROSE CUSHION EXPERIMENTS ...... 132 5.7 EXPRESSION OF FLAG‐SLF1‐6HIS IN E. COLI ...... 133 5.8 BIOTIN PULL‐DOWN EXPERIMENTS ...... 134 5.9 SUCROSE DENSITY FRACTIONATION ...... 135 5.10 IMMUNOBLOT ANALYSIS ...... 135 5.11 INDIRECT IMMUNOFLUORESCENCE ...... 136 5.12 MRNA STEADY‐STATE MEASUREMENTS ...... 136 5.13 MRNA DECAY EXPERIMENTS ...... 137 5.14 SYBR GREEN REAL‐TIME RT‐PCR ANALYSIS ...... 137 5.15 BIOINFORMATICS TOOLS AND DATA PROCESSING ...... 138 6 SUPPLEMENTAL DATA ...... 141

SUPPLEMENTAL TABLE S1: SLF1P AND SRO9P TARGET LIST ...... 143 SUPPLEMENTAL TABLE S2: LIST OF GENES IMPLICATED IN RESPONSE TO COPPER‐ AND OXIDATIVE STRESS ...... 159 SUPPLEMENTAL TABLE S3: GENES THAT WERE > 1.5 FOLD UP‐REGULATED ON AVERAGE UPON HIGH SLF1 OVEREXPRESSION ... 162 SUPPLEMENTAL TABLE S4: PRIMERS AND SEQUENCES USED ...... 176 7 ACKNOWLEDGEMENTS ...... 179 8 REFERENCES ...... 183 9 CURRICULUM VITAE ...... 201

1 Summary

1.1 Summary

RNA binding proteins (RBP) are critical factors for coordination and regulation of

gene expression. They are indispensible to assure the correct fate of messenger

RNAs (mRNAs) since they effect crucial processes like RNA processing, export,

localization, translation and degradation. RNA binding domains account for the

modules that enable RBPs to associate with RNA. They have been highly preserved

during evolution and are omnipresent among proteomes. The La-motif (LAM) is an

ancient RNA binding domain defining the superfamily of LAM-containing proteins

which is subdivided into bona fide La and the La-related proteins (Larps). Bona fide

La is the dominant protein in processing and folding of transfer RNAs (tRNAs) and is associated with a variety of diseases such as cancer and acquired immune

deficiency syndrome (AIDS). Larps comprise a widely spread yet largely neglected

family of RBPs which has recently been shown to participate in mRNA metabolism.

They are critical for development, spermatogenesis and transcription. In contrast to canonical LAM-containing proteins, the two paralogous yeast Larps Slf1p and Sro9p do not contain additional annotated domains. They therefore define prime examples

to study the RNA target preferences of the LAM, whose role in binding to the highly

heterogenous La and Larp targets remains elusive. Moreover, they represent

interesting candidates to study potential roles of Larps in the conserved pathways of

copper-homeostasis, since Slf1p, but not Sro9p, is implicated in copper

detoxification. Differential association of Slf1p and Sro9p with target RNAs might

therefore help elucidate the role of Slf1p in copper physiology.

In order to globally identify yeast Larp-associated RNAs, I applied RNA

immunoprecipitation microarray (RIP-Chip) technology and found that both Larps

bind to overlapping sets of hundreds of functionally-related mRNAs, including most mRNAs coding for components of the ribosome and histones. Moreover, a combined in vitro and in vivo approach with wild-type and mutant Slf1p strongly indicates that the RNA binding activity can be mapped to the LAM. These experiments also revealed that the domain associates with mRNA targets using at least partially the same conserved aromatic residues that were previously shown to be required for interaction of bona fide La to pre-tRNAs. Thus, it appears the domain mediates binding to a broader range of RNAs as previously anticipated and constitutes a critical force in the reported mRNA binding activity of La and Larps. Interestingly, I also detected mRNAs crucial for yeast copper homeostasis among the targets, some of which are exclusively associated with Slf1p. mRNA profiling and decay experiments with SLF1 overexpressing cells revealed that the protein positively affects the steady-state levels of these target transcripts through a mechanism most likely involving direct interference with mRNA decay. Moreover, I could show that

RNA binding activity plays a crucial role in Slf1p copper-biology since overexpression of LAM-mutant gene did not elicit the characteristic hyper resistance against elevated copper concentrations. In line with our discovery that some copper stress-relevant targets might become translationally up-regulated in excess copper, I therefore suggest that Slf1p allocates “translation-ready” pools of stabilized mRNAs important for copper detoxification, which can be used for synthesis of copper- response factors.

Given the relevance of copper-homeostasis in a variety of human disorders such as Menke, Wilson and Alzheimer disease, it will be important to investigate whether similar Larp-mediated copper-detoxification systems exist in human.

2.2 Zusammenfassung

RNA-Bindungsproteine (RBPs) sind zentrale Faktoren für die Koordination und

Regulation der Genexpression. Sie sind verantwortlich für RNA-Prozessierung,

-Export, -Lokalisation, -Abbau und -Translation, und damit entscheidend für das

Schicksal einer Boten-RNA (mRNA). RNA-Bindungsmotive sind die Module der

RBPs die RNA-Bindung ermöglichen. Sie sind stark konserviert worden während der

Evolution und sind omnipräsent in Proteomen. Das La-Motif (LAM) ist ein

altertümliches RNA-Bindungsmotiv, welches die Super-Familie der LAM-

enthaltenden Proteine begründet. Diese können weiter unterteilt werden in

authentische La Proteine und La-verwandte Proteine (Larps). Die authentischen La

Proteine sind die wichtigsten Akteure bei der Prozessierung und Faltung von transfer-RNA (tRNA) und spielen eine enscheidende Rolle bei der Entstehung von

AIDS und Krebs. Sie sind von grosser Bedeutung in der Entwicklung, der

Spermatogenese und der Transkription. Im Gegensatz zu typischen Larps besitzen die paralogen Slf1 und Sro9 keine zusätzlichen RNA-Bindungsmotive. Sie sind deshalb ideale Kandidaten um die RNA-Bindungspräferenz des LAM zu untersuchen, dessen Rolle bei der Bindung zu den äusserst heterogenen La und

Larp-assoziierten RNAs unklar ist. Ausserdem sind sie geeignet um mögliche Rollen von Larps in den evolutiv konservierten Abläufen der Kupfer-Physiologie zu erforschen, da Slf1 in der Kupferentgiftung involviert ist, Sro9 aber nicht. Assoziation mit unterschiedlichen RNA-Molekülen könnte deshalb Aufschluss darüber geben, wie Slf1 seine Funktion im Kupfer-Metabolismus ausübt.

Um die möglichen Hefe-Larp assozierten RNAs global zu identifizieren, habe ich RNA Immunopräzipitations-Microarray (RIP-Chip) Technologie angewendet und

dabei herausgefunden, dass beide Larps mit überlappenden Sets von hunderten

funktionell-verwandter mRNAs assozieren. Darunter befanden sich die meisten mRNAs, die für die Komponenten der Ribosomen und Histone kodieren. Ausserdem hat ein kombinierter in vitro / in vivo Ansatz gezeigt, dass die RNA-Bindungsaktivität mit grosser Wahrscheinlichkeit durch das LAM zustande kommt. Diese Experimente haben auch eröffnet, dass das Motif zumindest teilweise die selben konservierten, aromatischen Aminosäurenreste zur Bindung von mRNA benützt, die auch für die

Interaktion von authentischen La Proteinen mit Pre-tRNA verwendet werden. Es zeigt sich, dass das LAM ein breiteres Spektrum an RNAs binden kann als bisher angenommen und wohl eine zentrale Rolle bei der mRNA-Assoziation von La

Proteinen und Larps spielt.

Interessanterweise habe ich unter den Slf1-assozierten mRNAs auch solche gefunden, die wichtig sind für den Kupfer-Metabolismus von Hefe, einige davon waren nur mit Slf1 assoziert. Eine globale Analyse der mRNA Levels und mRNA-

Zerfall Experimente haben gezeigt, dass das Protein die Abundanz der assoziierten mRNAs erhöht und das dies vermutlich durch direkte Interferenz mit mRNA-

Zerfallsmechanismen geschieht. Überdies habe ich herausgefunden, dass die RNA-

Bindungsaktivität eine zentrale Rolle spielt in der Slf1-Kupfer Biologie, da

Überexpression von LAM-mutiertem SLF1 nicht die charakteristische Hyperresistenz gegen erhöhte Kupfer Konzentrationen zur Folge hatte. In Übereinstimmung mit der

Entdeckung, dass gewisse Kupfer-Stress -relevanten und Slf1-assoziierten mRNAs womöglich translationell aktiviert werden, schlage ich deshalb vor, dass Slf1

Gruppen von stabilisierten, „Translations-bereiten“ mRNAs zur Verfügung stellt, die für Proteine kodieren, welche wichtig sind in der Kupfer-Entgiftung.

In Anbetracht der Relevanz der Kupfer-Physiologie bei einer Vielzahl von menschlichen Krankheiten wie z.B beim Menkes Syndrom, bei Morbus Wilson oder bei Alzheimer, wird es wichtig sein zu untersuchen, ob ähnliche, Larp-gesteuerte

Kupfer-Entgiftungssysteme auch im Menschen existieren.

2 Introduction

2.1 Posttranscriptional gene regulation

2.1.1 The eukaryotic gene expression program

The precise extraction of information stored in the genome of cells is a delicate task.

In order to properly translate DNA-encoded information into something useful to the

cell, i.e. protein or non-coding RNA (ncRNA), a plethora of mechanisms are in place

that assure the correct expression of genes in time and space. Genes are

transcribed in the nucleus where DNA binding proteins associate with sequence

elements in the DNA and recruit RNA polymerases (RNPols) for RNA synthesis

(Figure 2.1). As soon as a RNA precursor has been formed it is guided through a

variety of nuclear processing steps including 5’ end capping, splicing, 3’ end

cleavage and polyadenylation (Dreyfuss et al. 2002; Maniatis and Reed 2002;

Orphanides and Reinberg 2002; Moore 2005). After export through nuclear pore

complexes, the mature transcripts may be actively transported to distinct subcellular regions (RNA localization) for storage or translation (St Johnston 2005; Rougemaille et al. 2008). Protein synthesis requires the assembly of translation factors and ribosomes on the mRNA, a process which can be controlled both globally and

transcript-specifically (Gebauer and Hentze 2004). Ultimately, mRNAs are degraded

by various exonuclease-mediated decay pathways (Parker and Song 2004).

Considering the sheer complexity of the gene expression process it is not

surprising that it is tightly controlled at multiple levels by highly coordinated

regulatory programs. Whereas in the past decades research on gene expression

control has mainly focused on the transcription of DNA into RNA (transcriptional level), the advent of new genomic and proteomic tools in recent years have paved

the way for high impact discoveries greatly advancing a global understanding of posttranscriptional regulation. It has turned out that many of the posttranscriptional processes are mediated by RNA-protein and RNA-RNA interactions, resulting in ribonucleoprotein complexes (RNPs) of distinct compositions that regulate the fate of the 15,000 to 150,000 mRNA molecules in yeast and mammals, respectively.

However, in spite of recent progress, much of the complex live of RNA awaits clarification.

Figure 2.1: Scheme of the eukaryotic gene expression program. Main steps are indicated in red, the different levels of control specified on the right. See text for more details. Adapted from Halbeisen et al., 2008.

2.1.2 RNA binding proteins: Leaders of the RNA world

In prokaryotes, transcription and translation are intimately coupled. Since there is no

physical barrier between nascent transcript and the translational machinery, mRNAs

are usually translated before transcriptional termination. This is in contrast to eukaryotes where the nuclear membrane compartmentalizes the cell into cytoplasm and nucleus and thus prevents direct interactions between DNA polymerases and ribosomes. Therefore, the ultimate decision whether a eukaryotic gene will be expressed as a protein is posttranscriptional and made in the cytoplasm, even though early tags such as the cotranscriptionally assembled exon-junction complex placed on the premature mRNA will influence translational outcome (Moore 2005). In other words, transcription is essential for onset of the gene expression machinery, but the subsequent multiple regulatory steps until translation are decisive and demand high precision in order for the initial transcriptional signals to reach their intended goal of protein expression. However, despite the lack of physical interaction

between transcription and translation, it appears that the two systems are interwoven

by the concerted action of RNA binding proteins (RBPs) that associate with RNA targets and therefore indirectly couple the various multi-component cellular machines that shape gene expression (Orphanides and Reinberg 2002). This coupling is indispensible to coordinate the action of these various “factories” which carry out

separate tasks along the gene expression pathway. The picture emerges that, as

soon as a gene is being transcribed, the nascent RNA is specifically bound by an

armada of RBPs guiding the transcript through the multi-stepped program of gene

expression until and including the synthesis of the protein. As the work of many

laboratories has demonstrated, posttranscriptional gene regulation depends on the

proper functioning of RBPs (Moore 2005; Mansfield and Keene 2009; Sharp 2009).

RBPs are therefore prominently encoded in eukaryotic genomes: In yeast, 5–8% of

genes encode known or predicted RBPs (Keene 2001), and in Caenorhabditis

elegans and Drosophila melanogaster, approximately 2% of the genome is

estimated to encode RBPs (Lasko 2000; Lee and Schedl 2006). Yet new RBPs are

being discovered: In a recent screen for novel RBPs in yeast using protoarrays and

labeled total RNA our lab identified almost 150 proteins as previously unknown

potential RBPs (Scherrer et al. 2010). Surprisingly, more than 40% of them comprise

enzymes not bearing any known RNA binding domains. This suggests a yet

unanticipated potential of the proteome to interact with and possibly exert control over the transcriptome, and vice versa. Since RBPs usually have multiple RNA targets, and typical mRNAs, on the other hand, are bound by a plethora of RBPs,

these protein-RNA interactions provide the basis for a massive combinatorial

network regulating the coordinated mRNA metabolism of functionally-related groups

(see 2.1.6).

2.1.3 Specificity of RNA-protein interactions

Even though some RBPs have been shown to bind RNA unspecifically, like the

cytoplasmic Poly(A)binding protein which associates with poly(A) tails of mRNAs

(Kuhn and Wahle 2004), the majority of the RBP-RNA interaction are believed to be

highly specific. They are driven by RNA binding domain-mediated recognition of

distinct cis-acting structural and sequence motifs present in the untranslated regions

(UTRs) and open reading frames (ORFs) of mRNAs. Bioinformatics and

experimental analysis revealed approximately one hundred distinct RNA-binding

motifs present in eukaryotic genomes, half of them believed to have emerged at

early stages in evolution (Burd and Dreyfuss 1994). Well known examples of RNA

binding domains include the La-motif (LAM, see 2.2.1), the RNA-binding domain

(RBD, also known RNA recognition motif, RRM), the DEAD/DEAH box, the Sm domain, the RGG (Arg-Gly-Gly) box, the K-homology (KH) domain, zinc fingers

(ZnFs), the double stranded RNA-binding domain (dsRBD), the Pumilio/FBF (PUF or

Pum-HD) domain and the Piwi/Argonaute/Zwille (PAZ) domain (reviewed in Glisovic et al. 2008). The specificity of the protein-RNA interaction is determined by different factors: Both nuclear magnetic resonance (NMR) studies of protein-RNA complexes in solution and co-crystal structures of RBP-associated RNAs have revealed that distinct domain residues interact with bases and backbones of their RNA substrates.

These intermolecular interactions are of non-covalent nature such as hydrogen bonding or stacking interactions, which are mainly mediated by Van der Waals forces between aromatic residues and the purine or pyrimidine rings of the RNA

(Cerny and Hobza 2007). Quite often, residues found to interact with RNA have been highly conserved during evolution (Kenan et al. 1991; Shiels et al. 2002; Aratani et al. 2003; Alfano et al. 2004), further underscoring their importance for RNA association. In addition to structural properties, specificity is also believed to arise from distinct domain composition and organization. In line with this, many RBPs contain multiple RNA binding motifs yielding potential for combinatorial arrangement of the different modules. Moreover, precision in RNA target recognition can further be modulated by auxiliary domains, which may not be recognized as RBDs per se.

Both La proteins and Larps, for instance, presumably use also motifs / sequence regions other than their canonical RNA binding domains to associate with target transcripts (Fan et al. 1997; Goodier et al. 1997; Nykamp et al. 2008, see also 2.2).

The second major specificity determinant is comprised of cis-acting elements in the sequence and / or structure of the RNA targets. Basically, three different RNA recognition elements (RREs) can be distinguished: structural motifs, sequence elements and a combination of the two (Figure 2.2). Since RNA molecules, in analogy to proteins, adapt distinct three-dimensional structures, the precise recognition by RBPs often depends on both sequence and structural elements. The human iron regulatory protein 1 (IRP1), for instance, binds iron-responsive elements

(IREs) in mRNAs, to repress translation or degradation, and also displays aconitase activity (Volz 2008). It specifically binds a ∼30-nucleotide-long stem-loop structure called iron-responsive elements (IREs) located within the 5′ or 3′ untranslated regions of the mRNA. However, it also specifically recognizes the conserved AGU- sequence motif located in the bulge of the stem-loop (Walden et al. 2006). Other

RBPs appear to depend on sequence information only, like the Pumilio-Fem-3- binding factor (PUF) family. Most of their members recognize a UGUA(N)AUA consensus sequence (Gerber et al. 2006).

Figure 2.2: Different modes of specific RNA-protein interactions. An RBP may recognize a specific sequence (A), a structural motif (B) or a combination of the two (C). S: specific nucleotide, N: random nucleotide. Adapted from Serganov et al., 2008.

2.1.4 Non-coding RNAs in posttranscriptional gene regulation

The second class of key players in the posttranscriptional gene regulation is

comprised of non-coding (nc) RNAs, such as micro RNAs (miRNAs). MiRNAs

constitute a widely spread class of small RNAs (18-25 nucleotides (nt) in length)

shown to regulate virtually every aspect of biology, including developmental timing,

differentiation, proliferation, antiviral defense and metabolism (reviewed in Filipowicz

et al. 2008). MiRNAs are excised from long RNPol II transcribed primary molecules

(pri-miRNAs) by the sequential action of the two endoribonucleases Drosha and

Dicer. Subsequently, they are incorporated into the RNA-induced silencing complex

(RISC) in the cytoplasm, whose key components are members of the Argonaute

(AGO) family. Guided by imperfect basepairing of the miRNAs to the 3’ UTR of target

mRNAs, RISC induces degradation or inhibits translation of the corresponding

message (Bartel 2009). Since miRNAs do not associate with perfect

complementarity, bioinformatics target prediction has remained a major challenge to

date. Therefore, targets and biological function have been assigned to only a few

miRNAs (Thomas et al. 2010). The expression of many miRNAs has been shown to

be tissue specific or limited to a particular developmental stage, and miRNA profiles

were found altered in several human diseases, including cancer (Zimmerman and

Wu 2011). Interestingly, it becomes apparent that the miRNA machinery interacts

with the RBP system. It has been shown that the two systems can act both

synergistically and competitively leading to accelerated or retarded progression of specific mRNA-metabolism (Kedde et al. 2007; Galgano et al. 2008).

RISC-mediated gene silencing is unlikely to exist in S. cerevisiae, as the organism lacks both miRNA genes and AGO proteins. However, recent tiling array

analyses show that eukaryotic genomes, including S. cerevisiae’s, are more widely transcribed than expected and produce a variety of intergenic or antisense non- coding RNAs, many of which are unstable and rapidly degraded by the nuclear exosome (Carninci et al. 2005; David et al. 2006; Xu et al. 2009). The work by different laboratories revealed the existence of alternate gene silencing mechanisms in S. cerevisiae that depend on long ncRNAs. Francoise Stutz’s group has shown that loss of the exosome component Rrp6 results in PHO84 anti-sense RNA stabilization and repression of PHO84 sense transcription, resulting in the down- regulation of inorganic phosphate and manganese transporter encoded by PHO84.

Notably, anti-sense accumulation and PHO84 silencing also occur in chronologically aged cells, suggesting that Rrp6 activity is regulated in response to physiological changes. Importantly, the stabilization of PHO84 anti-sense RNAs is paralleled by the recruitment of the histone deacetylase Hda1p and deacetylation of the PHO84 promoter resulting in PHO84 gene silencing (Camblong et al. 2007; Camblong et al.

2009).

2.1.5 Posttranscriptional gene regulation means networking

Combinatorial binding of multiple distinct RBPs to individual mRNAs appears to be a hallmark of posttranscriptional gene regulation. In a recent study conducted by

Hogan et al. it was estimated that, on average, every yeast mRNA is bound by a dozen or more different RBPs during its lifetime (Hogan et al. 2008). Since most

RBPs control the posttranscriptional fate of tens and hundreds of different RNA targets, these are always potentially co-regulated together with a plethora of other

messages and thus part of large networks. Access to a certain network is gained by the correct, readily accessible RRE in the sequence or structure of an mRNA. While posttranscriptional regulatory networks in yeast are highly complex, they seem to be even more elaborate in higher eukaryotes: Not only are the numbers and diversities of RBPs exceedingly higher (Finn et al. 2006), the average length of untranslated regions, the major working areas of RBPs, are also much longer. Whilst average yeast UTRs are approximately 300 bp long, their human counterparts span over approximately 1500 bp (Hurowitz and Brown 2003; Hurowitz et al. 2007). Moreover,

UTRs of higher eukaryotes appear to contain more functional elements and thus regulatory information (Birney et al. 2007). It appears that these combinatorial and, most likely, to some extend redundant RBP-RNA networks provide cellular systems with valuable robustness and stability in order to exert control over their genes at all time.

Another important feature of RNA networks is mutual regulation (Morris et al.

2010): It has been found that many RBPs bind to mRNAs coding for other RBPs, which has led to the “regulators of regulators” concept. Such inter-dependence of different regulatory systems can serve to coordinate upstream and downstream functions of gene expression. Interestingly, it has also been observed that certain

RNA networks are equipped with positive or negative feedback loops, as RBPs were found to bind their own mRNAs enabling them to regulate their own protein levels

(Hogan et al. 2008; Kanitz and Gerber 2010; Scherrer et al. 2010). Moreover, interplay between gene expression control systems are not restricted to posttranscriptional networks, there is also massive crosstalk between transcription and posttranscriptional events: Many RBPs were found to bind and presumably

regulate mRNAs encoding transcription factors (Keene 2010). Likewise, every RBP encoding gene is subject to transcriptional control.

2.1.6 The posttranscriptional operon model

As alluded to above, eukaryotic gene expression steps from transcription to translation are closely interconnected by the concerted action RBPs, which assume a bridging role to connect physically separated events. In prokaryotes, Jacob and

Monod discovered that functionally-related genes often cluster together and are transcribed under the control of the same promoter, giving rise to polycistronic mRNAs that contain multiple gene transcripts in tandem (Jacob and Monod 1961).

This mRNA architecture enables cells to coordinately transcribe genes that are functionally-related. While a high percentage of bacterial genes are controlled by

Figure 2.3: Model of the posttranscriptional operon theory. Different RBPs (A-D) specifically bind to distinct RNA recognition elements (RREs; a-d) in the UTR regions of mRNAs (these elements can also be found in ORFs). Depending on the combination of different RREs in the structure or sequence of a mRNA, it is bound by a different set of RBPs reflecting distinct regulatory potentials. The Venn diagram shown on the right depicts subpopulations of mRNA that can be organized in various combinations / posttranscriptional operons. Adapted from Keene et al., 2002.

such “DNA operons”, they have not been discovered in eukaryotes. In mammals the

vast majority of cellular transcripts are monocystronic, suggesting that other

mechanisms of gene coordination may exist. Indeed, a large body of work shows

that most RBPs bind to mRNAs coding for functionally or cytotopically related

proteins, providing cells with a powerful tool to tune the expression of their genes in

an orchestrated manner (Figure 2.3, Tenenbaum et al. 2002; Gerber et al. 2004;

Penalva et al. 2004; Keene and Lager 2005). Thus, in analogy to the prokaryotic

system, where functionally-related genes cluster together and are controlled by

similar sets of DNA binding proteins, eukaryotic cells are equipped with highly

diverse mRNPs which may represent posttranscriptional operons.

2.1.7 Methods to study posttranscriptional gene regulation

First indications that RBPs specifically recognize subpopulations of mRNA came

from in vitro binding studies with recombinant human embryonic lethal abnormal

version (ELAV)/HuB protein, a neuron-specific RBP and homologue to D. melanogaster ELAV, which is vital for proper neuron development in the fly. In vitro

transcribed, degenerated 25nt long RNAs were incubated with tagged human ELAV

and associated RNAs were recovered by affinity purification. The purified RNA was

reverse transcribed and sequenced which revealed that ELAV has a strong

preference for AU-rich elements (Levine et al. 1993). This elaborate technique was

later expanded using cell extracts which uncovered that ELAV binds to the AU-rich

3-UTRs of target RNAs such as C-MYC and C-FOS (Gao et al. 1994). Nowadays, a

combination of biochemical, genetic and computational approaches is typically

applied to determine RBP-RNA interactions.

2.1.7.1 RIP-Chip

A very powerful technique, which has proven successful in identifying many RBP

targets from yeast to human, is the RNA-binding protein immunoprecipitation microarray method, referred to as RIP-Chip (Tenenbaum et al. 2000). In this approach, an RBP and the associated RNAs are affinity purified by means of specific antibodies directed against the endogenous protein or by a genomically encoded affinity-tag fused to the RBP. The co-purified RNA is then isolated, reverse transcribed and labeled with fluorescent dyes. The obtained cDNA is competitively hybridized to oligo DNA microarrays, usually along with differently labeled cDNA reverse transcribed from total RNA. This set up allows for the determination of the relative enrichment of distinct RNAs during the affinity purification procedure. Since the pioneering study by Jack Keene’s group which led to the identification of RNAs associated with three RBPs, HuB, eukaryotic initiation factor 4E (eIF-4E), and poly(A) binding protein (PABP) in P19 embryonic carcinoma stem cells (Tenenbaum et al. 2000), RIP-Chip has been extensively used and enabled the determination of

RNA targets for more than hundred RBPs from yeast to mammals (Morris et al.

2010). The method was also applied in our laboratory to identify a variety of RBP- target sets, e.g. the Pumilio-associated RNAs from S. cerevisiae, D. melanogaster and from human cancer cells (Gerber et al. 2004; Gerber et al. 2006; Galgano et al.

2008). More recently, the RIP approach has also been used with tagged ribosomal proteins that have been purified to isolate actively translating ribosome and to study

reactions of the translatome upon diverse stress conditions in yeast (Halbeisen and

Gerber 2009). In combination with bioinformatics tools such as motif search

algorithms, it is sometimes possible to determine the binding sites of RBPs on the

RNA targets (Gerber et al. 2004; Lopez de Silanes et al. 2004; Hogan et al. 2008).

However, identification of the RRE is usually a difficult task, especially for elusive

sequence motifs spanning over longer stretches of RNA and for RBPs recognizing

structural features in the RNA. Thus, RIP-Chip technology is very effective in

defining RNA targets at the transcriptome level; however, it does not directly identify

the RRE within target RNAs. Moreover, its application is restricted to the

characterization of rather kinetically stable interactions between RNA and RBP,

since short-lived associations might not be detectable due to loss during the affinity

purification procedure.

2.1.7.2 CLIP and PAR-CLIP

A more direct approach to detect RBP-target interactions relies on in vivo UV-

crosslinking: prior to immunoprecipitation and isolation of associated RNAs, cells are irradiated at 254 nm, which leads to the formation of covalent bonds between nucleotides and photo-active amino acids residing in close proximity to each other

(Greenberg 1979). Subsequent RNA digestion and cDNA sequencing allows for a facilitated identification of RBP binding sites, since only the small fraction of protein-

protected /-bound RNA will be sequenced in the end. Subsequent blasting of the

sequenced RNA against the corresponding genome will detect all RBP-RNA

interaction at a given time point, i.e. the point of irradiation. This methodology,

termed CLIP (Ule et al. 2005), was used successfully to determine the RNA targets

of a variety of RBPs, such as of the splicing regulators NOVA1 (Ule et al. 2003) and

FOX 2 (Yeo et al. 2009). However, due to the low crosslinking efficiency at 254 nm

and the not readily identifiable site of the crosslink, it can be laborious to distinguish

between real hits and false positives. In addition, the high energy irradiation imposes

drastic stress onto cells which might lead to artifacts (Hafner et al. 2010).

An improved version of CLIP was introduced very recently and has proven

effective in identifying both already known targets and RREs (Pumilio), as well as new RPB targets and binding sites (IGF2BP1-3, Hafner et al. 2010). As depicted in

Figure 2.4, Photoactivatable-Ribonucleoside-Enhanced Crosslinking and

Immunoprecipitation (PAR-CLIP) follows a protocol very similar to CLIP but provides two main advantages over CLIP: Firstly, it allows for more efficient crosslinking by

incorporation of 4-thiouridine (4SU) into transcripts of cultured cells before

irradiation. The authors claim that the photoactivatable nucleosides improves RNA

recovery 100- to 1000-fold compared to normal CLIP using the same amount of

radiation energy. Secondly, PAR-CLIP allows for very precise RBP binding site

mapping since thymidine (T) to cytidine (C) mutations appear at the binding-site of

the RBP in the sequenced cDNAs. The reason for these transitions is not known but

the authors suggest that during reverse transcription, the transcriptase specifically

miss-incorporates dG across from crosslinked 4SU residues. Thus, RREs can be

identified not only by quantification of sequence reads but also by mutational

analysis. However, this accounts only for RREs containing uridines, since other

nucleosides do not give rise to mutations.

Figure 2.4: Illustration of the basic PAR-CLIP-protocol. Cells are cultured in 4-thiouridine containing medium resulting in 4SU-labeled transcripts. RNAs are crosslinked to RBPs and partially RNase-digested, radioactively labeled RNA-protein complexes are recovered by immunopurification and size-fractionation. Proteinase K treatment releases RNA molecules from proteins, eluted RNAs are then converted into a cDNA library and deep sequenced. Adapted from Hafner et al., 2010.

2.2 La-motif, La proteins and La-related proteins

The La-motif (LAM), an ancient, highly conserved RNA binding domain, is omnipresent in eukaryotes and defines a superfamily of RBPs: the LAM-containing proteins. Based on both structural and functional properties, these RBPs can further be divided in two subfamilies, the genuine La proteins and the La-related proteins

(Larps). A recent bioinformatics study provided a comprehensive phylogenetic analysis of the LAM protein superfamily (Bousquet-Antonelli and Deragon 2009).

Bousquet-Antonelli et al. compared the genomes of 139 species scattered along the tree of life and identified LAM-containing proteins in all eukaryotes except for protists from the Plasmodium genus. The fact that the LAM is absent in archea and eubacteria suggests that the domain originated shortly after the archea-eukarya radiation, which supposedly happened about 2.5 billion years ago (Figure 2.5,

Schleifer 2009). Of the 83 eukaryotic genomes that were analyzed in more detail, the authors retrieved 308 distinct LAM-containing proteins (Figure 2.6). Noteworthy, this domain never occurs more than once in proteins. According to evolutionary as well as structural characteristics, the LAM-containing proteins could be further divided into five distinct families: the genuine La proteins and the Larps 1, 4, 6, and 7.

Whereas the genuine La proteins have a conserved domain architecture, which includes a N-terminal LAM and at least one RNA recognition motif (RRM), Larps have a more heterogeneous structure: The LAM is often located in the middle or towards the C-terminal end of the proteins and is accompanied by additional domains, most of them having unknown function (Figure 2.7). For instance, with the exception of Larp 1, a high proportion of Larps contain a RRM-like (RRM-L) domain adjacent to the LAM, reminiscent of the architecture of genuine La proteins. It

appears that only very few proteins enclose the LAM exclusively. Among them are the two yeast Larps Slf1p and Sro9p.

Figure 2.5: Tree of life according to Carl R. Woese and the emerging of the LAM. Based on phylogenetic analyses the LAM originated soon after the radiation of archea and eucarya. Source: www.wikipedia.com.

Figure 2.6: Phylogenetic relationships among La-motifs. The phylogenetic tree was obtained using LAM sequences from 134 selected proteins (see Bousquet-Antonelli et al. for

details). Blue: Proteins from protists, green: proteins from plants, brown: proteins from fungi, red: proteins from animals. Species names abbreviations: (Am) Apis mellifera, (At) Arabidopsis thaliana, (An) Aspergillus niger, (Ce) Caenorharbditis elegans, (Cs) Capitella sp., (Cr) Chlamydomonas reinhardii, (Ci) Ciona intestinalis, (Dp) Daphnia pullex, (Dd) Dictyostelium discoideum, (Dm) Drosophila melanogaster, (Fr) Fugu rubripes, (Gg) Gallus gallus, (Hs) Homo sapiens, (Lb) Laccaria bicolor, (Lm) Leishmania major, (Lg) Lottia gigantae, (Ng) Naegleria gruberi, (Nv) Nematostella vectensis, (Os) Oriza sativa, (Pc) Phanerochaete chrysosporium, (Pb) Phycomyces blakesleanus, (Php) Physcomitrella patens, (Ps) Phytophthora sojae, (Sc) Saccharomyces cerevisiae, (Sp) Schizosaccharomyces pombe, (Sm) Selaginella moellendorfii, (Stp) Stronggylocentrotus purpuratus, (Tb) Trypanosoma brucei, (Xt) Xenopus tropicalis. Adapted from Bousquet- Antonelli et al., 2009.

Figure 2.7: Schematic alignment of LAM-containing proteins depicting the domain architecture of Larps and bona fide La. The different domains are depicted in white and colored boxes (see above for color code). LAM: La-motif, RRM: RNA recognition motif, RRM-L: RNA recognition motif-like domain, reflects variations from the canonical RRM, DM15: domain of unknown function, LSA: domain of unknown function. In brackets are domains that are facultative.

2.2.1 The La-motif

The LAM has been intensively studied during recent years and several crystal and co-crystal structures of this extremely well conserved, ~ 80 amino acid long RNA binding domain have been solved. These structures have revealed on a molecular level how genuine La proteins recognize and bind the characteristic 3’ UUU-OH ends of RNPol III transcripts, their best-studied target RNAs (see 2.2.2., Clark et al. 1993;

Alfano et al. 2004; Dong et al. 2004; Teplova et al. 2006; Kotik-Kogan et al. 2008).

The LAM is mostly α-helical, consisting of six helices and a three-stranded antiparallel sheet. It adopts a winged helix fold common in DNA binding transcription factors and some RBPs (Figure 2.8, Clark et al. 1993; Yoshizawa et al. 2005). Dong and co-workers, who published the first LAM crystal structure, showed that a highly conserved patch of aromatic amino-acid residues is exposed on the surface of the domain (Dong et al. 2004). By structure-based mutagenesis studies they identified 7 residues that are crucial for high affinity binding to RNAs ending in 3’ UUU-OH (pre- tRNAs). 4 of these residues localized to the aromatic patch and 3 resided in close proximity (see also Figure 3.4 B). Interestingly, their study revealed that one of them, a conserved aspartate corresponding to Slf1p-LAM residue D20, is critical for the recognition of the characteristic 3’ OH ends of RNPol III transcripts, since mutagenesis of the aspartate reduced the specificity of La for hydroxyl compared to phosphate groups. Moreover, Dong et al. confirmed previous data showing that the poly(U) trailer at the 3’ end of pre-tRNAs is indispensable for high affinity binding

(Reddy et al. 1983; Mathews and Francoeur 1984; Stefano 1984). In five co-crystal structures of N-terminal domain (NTD) of human La protein, i.e. LAM and adjacent

RRM, bound to short oligo(U) ending RNAs, these 7 residues were

Figure 2.8: Structure of the LAM and of the LAM-binding pocket associated with a small RNA. (A) Ribbon view of the crystal structure of isolated LAM of T. brucei La. H: alpha helices; B: beta-sheets. (B) Pink surface illustrates conserved aromatic patch. Asterisks indicate residues shown to abolish RNA binding in vitro when changed to alanine. Taken from Dong et al., 2004. (C) High-resolution co-crystal structure of the LAM-RRM formed RNA binding pocket associated with and RNA oligomer ending in 3’ UUU-OH. The seven LAM residues shown to contact the terminal UUU-OH are depicted (human La numbering). U-1, 2 and 3: terminal uridines of the RNA oligomer. Taken from Bayfield et al., 2010.

later shown to interact with RNA ligands by stacking interactions and hydrogen bond

formation (Teplova et al. 2006; Kotik-Kogan et al. 2008). Even though the structures

suggest some conformational plasticity in the recognition of RNA 3’ ends, all except

for one contact made with the terminal uridines appear to be mediated by the LAM,

and not the adjacent RRM of bona fide La proteins. This was unexpected since

previous biochemical analysis with recombinant LAM indicated that this domain

does not bind RNA on its own but requires the concerted action with the RRM for

high affinity binding (Goodier et al. 1997; Horke et al. 2004).

While these structural data explain why genuine La proteins have a strong

preference for 3’ UUU-OH bearing RNA substrates, they cannot account for the

various reports implicating the La protein in binding and regulation of RNAs not

ending in oligo (U), such as mRNAs (see 2.2.2.2). Moreover, it remains elusive

whether the LAM is involved in RNA binding by Larps; these RBPs are mainly

involved in metabolism of RNAs not ending in uridines, i.e. mRNA metabolism (see

2.2.3). Interestingly, most of the 7 residues important for 3’ UUU-OH recognition are

conserved in the majority of Larps. It has therefore been hypothesized that other

domains mediate mRNA binding or that the interaction occurs in a non- 3’ UUU-OH

dependent mode (Bayfield et al. 2010).

2.2.2 The La proteins

The highly abundant La protein was originally discovered as an autoantigen in patients suffering from autoimmune disorders such as Sjogren’s syndrome, systemic lupus erythematosus and neonatal lupus (Mattioli and Reichlin 1974; Reichlin 1981).

Even though it is still not clear why La is targeted as an autoantigen, intense

research ever since its discovery in 1974 has shed light onto this multifunctional RBP

and has helped advance our understanding of RNA metabolism and RBP-RNA

interactions in general. Being among the first proteins found to interact with RNA, the

La protein is considered one of the founding members of RBP research. It is an

essential gene in all metazoans investigated to date including Trypanosoma,

Arabidopsis thaliana, Drosophila Melanogaster, and mice, but it is not essential in both budding and fission yeast (Wolin and Cedervall 2002).

2.2.2.1 La in non-coding RNA metabolism

Early indications concerning target-specificity and function of La were obtained by

Stefano et al., who purified small ribonucleoprotein (RNP) complexes from HeLa cells recognized by anti-La sera. It was found that these RNPs mainly consisted of

RNAs ending in stretches of uridylate residues (Stefano 1984). Mathews et al. then mapped the binding site of La to these oligo(U) ends applying RNA footprinting techniques (Mathews and Francoeur 1984). They also showed that human La binds best to RNAs that contain three or more terminal uridines. La proteins from other organisms such as the fission yeast S. pombe require four or more terminal uridines in the target RNA to be efficiently bound (Huang et al. 2005). Such 3’ UUU-OH ends are present in RNPol III-transcribed RNAs such as s transfer RNAs (tRNAs), 5S ribosomal RNA (rRNA) and U6 small nuclear RNA (snRNA), which is an essential splicing component. Although La binds to all these ncRNAs, it interacts only with the premature RNA such as pre-tRNAs and pre-5S rRNA. This is in agreement with the fact that only precursor RNPol III transcripts contain oligo(U) 3’ ends. During RNA-

maturation the terminal uridylates are usually removed which results in loss of the La

protein binding-site. The fact that La recognizes 3’ oligo(U) ends is also consistent

with the observation that it was found associated with certain RNPol II-transcribed

small RNAs ending in UUU-OH. These RNAs, namely U1, U2, U3, U4 and U5

snRNAs, are posttranscriptionally modified and therefore bear RNPol II-transcript

untypical ends for a limited period of time during their maturation. In addition to

cellular ncRNA, studies with virus infected cells revealed that La also binds to a

number of viral-encoded RNAs including the adenovirus encoded VA-RNA1 and VA-

RNA2,the Epstein-Barr RNAs EBER1 and EBER2 as well as some negative-strand

virus leader RNAs (Lerner et al. 1981; Kurilla and Keene 1983; Wilusz et al. 1983;

Kurilla et al. 1984).

Since La is among the first proteins to associate with nascent RNPol III

transcripts, it had long been suggested to play a role in RNPol III transcription

(reviewed in Wolin and Cedervall 2002). Hela extract from La immuno-depleted cells

has reduced RNPol III activity. In addition, the transcripts contained shorter uridine

trailers at the 3’ end as compared to normal RNPol III products (Gottlieb and Steitz

1989). While other groups could not find an impairment of RNPol III transcription, the

observed 3’ end shortening was confirmed and demonstrated in yeast and the frog

X. laevis. In agreement with these data, Sandra Wolin’s group finally showed that La protects the 3’ end trailers of pre-tRNAs from premature exonucleolytic digestion, assuring the right order of pre-tRNA processing (Van Horn et al. 1997; Yoo and

Wolin 1997). Northern blot analysis demonstrated that yeast cells lacking the La protein yield abnormal tRNA processing patterns. Moreover, it was found that La knock-outs become synthetically lethal with a variety of different mutations disrupting

the secondary structure of essential tRNAs, as well with deletions of components of

the tRNA biogenesis pathway. Considering the broad impact of these mutations for

tRNA synthesis, it was suggested that La not only assists in tRNA processing but also helps their proper folding. This is in agreement with the notion that ectopic La can rescue the deletion of tRNA modification enzymes that catalyze addition of modifications which are likely to stabilize the structure of tRNA (Anderson et al.

1998; Johansson and Bystrom 2002; Copela et al. 2006). Taken together, these results suggest that La does not have a direct role in transcription but instead acts as a molecular chaperon ensuring proper processing and folding of pre-tRNA by protecting the 3’ UUU-OH ends from excessive trimming. Since similar effects were also observed for other La-targets, the bona fide La protein family has been described as general chaperon of terminal uridine-containing RNAs.

2.2.2.2. La in mRNA metabolism

While the vast majority of La proteins is localized to the nucleus under steady-state conditions, where their primary targets reside, the pre-mature RNPolIII transcripts,

La has also been detected in the cytoplasm. It has been worked out that the protein shuttles between the two compartments in a phosphorlyation dependent manner: whereas phosphorylated La is concentrated in the nucleus, the non-phosphorylated form is mainly cytoplasmic (Bachmann et al. 1990; Fok et al. 2006). The responsible phosphorylation sites as well as a nuclear localization element (NLS) are found in

the C-terminal domain of the protein. Disruption of this part has been shown to cause

mislocation of La and malfunctioning of tRNA maturation (Intine et al. 2002).

While the function of nuclear La in maturation of RNPol III transcripts has

been well established, the roles of cytoplasmic La remains obscure. There is strong

evidence that it associates with RNAs distinct from its nuclear targets not ending in 3’

UUU-OH. In fact, La has been implicated in mRNA metabolism and translation of

both cellular and viral RNAs. Early work by Meerovitch and colleagues showed that

La enhances and corrects aberrant translation of poliovirus RNA in reticulocyte

lysate (Meerovitch et al. 1993). A role of La in viral RNA translation was further

evidenced by the finding that the human protein is required for internal ribosome

entry site (IRES)-mediated translation of Hepatitis C virus (Ali et al. 2000). It was

evidenced that La binds close to the initiator AUG and assists the assembly of

ribosomes in order for IRES-mediated translation to start (Pudi et al. 2004).

Moreover, Nahum Sonenbergs laboratory implicated La in human immunodeficiency

virus type1 (HIV1) translation. They demonstrated that La binds to the transactivation response element (TAR) at the 5' end of the HIV-1 mRNAs, which forms a stable hairpin structure inhibitory to translation, and alleviates translational repression (Svitkin et al. 1994). In addition to the many reports implicating human La

in viral RNA translation and pathogenesis, it was shown that the RBP binds to 5’ terminal oligopyrimidine tracks (5’TOP) of mRNAs encoding ribosomal proteins and to the highly abundant histone mRNAs (Pellizzoni et al. 1996; McLaren et al. 1997;

Schwartz et al. 2004). The latter interaction was shown to have a stabilizing effect on the message. In a comprehensive target analysis in yeast using RIP-Chip technology, Inada et al. confirmed that the yeast La protein Lhp1p mainly associates with ncRNAs such as tRNAs and snRNAs, as expected, however, they also detected a substantial amount of mRNAs among the highest enriched targets. Among them were messages encoding ribosomal proteins and the HAC1 mRNA (Inada and

Guthrie 2004). Hac1p is a transcription factor required during the unfolded protein stress response. The authors showed that Lhp1p stabilizes HAC1 mRNA and that it is required when the unfolded protein response is induced at elevated temperatures.

More recently, La was also strongly implicated in cancer-related mRNA-metabolism:

It was shown that La protein levels are elevated in a variety of tumor cell lines as compared to normal cells (Al-Ejeh et al. 2007). It was also reported that BCR/ABL- transformed cells from patients with chronic myeloid leukemia display elevated La protein levels (Trotta et al. 2003). In this study, the authors demonstrated that La promotes murine double minute (MDM2) protein expression through a translational mechanism. In vitro data suggested that only N-terminal truncated parts of La can bind to the MDM2 message, however, it wasn’t specifically addressed whether the

LAM is involved in RNA binding or not. Very recently, it was found that La supports translation of a subset of mRNAs in a serine-threonine protein kinase (AKT) dependent manner in murine glial cells (Brenet et al. 2009). The authors hypothesize that the AKT-mediated shuttling of La between nucleus and cytoplasm might contribute to the well-known oncogenic effect of aberrant active AKT. Finally, it was shown that elevated La protein levels in cervical cancer tissue correlate with aberrant cyclin D1 (CCND1) protein levels and that La binding to CCND1 mRNA promotes

IRES dependent translation. Sommer et al. therefore concluded that La contributes to cell proliferation through posttranscriptional CCND1 control (Sommer et al. 2010).

Despite growing evidence that La can have a strong impact on mRNA metabolism and translation, the structural basis for these functions has remained unclear. It is unknown how the LAM could mediate binding to RNAs not ending in 3’

UUU-OH, leaving open the question whether other known or potentially unknown

domains like the adjacent RRM are responsible for this binding.

2.2.3 The La-related proteins

In contrast to the genuine La proteins, studies on Larps have been very scarce until

recently, even though they belong to a large and well conserved family of RNA- binding proteins that fulfill critical functions in the cell. They were shown to be important for oogenesis, embryogenesis and apoptosis of higher metazoans and to have broad impact on physiology in the unicellular yeast. While Larps share the LAM with genuine La proteins, which is highly conserved between both families, they are distinct from bona fide La both structurally and functionally (Figure 2.7). In contrast to

La, they appear to act mainly in posttranscriptional aspects of mRNA metabolism and translation. However, to date there are only very few examples of proven physical interactions between mRNAs and Larps. The two first identified members of the Larp family are the yeast representatives Slf1p and Sro9p. Both were described for the first time in 1996 as multicopy suppressors of copper hyper-sensitivity and bud growth defect mutants, respectively (see 2.2.4). As mentioned previously and explained in more detail below, Larps can be subdivided into four distinct protein families:

2.2.3.1 The Larp 1 family

Most Larp 1 family members lack a RRM-L domain downstream of the LAM (Figure

2.7). In addition to the LAM, many of them comprise a conserved C-terminal domain of unknown function termed DM15 or Larp 1 domain (Bousquet-Antonelli and

Deragon 2009), which appears to be involved in RNA binding as suggested by in vitro RNA binding assays with truncated versions of C. elegans Larp 1 (Nykamp et al. 2008). As it is the case for most Larps, the majority of residues used by genuine

La proteins for recognition of 3’ UUU-OH are conserved in Larp 1.

The first described Larp 1 member is the D.melanogaster representative, a

Hox target gene which was discovered in 2000 and shown to be required for spermatogenesis (Chauvet et al. 2000; Ichihara et al. 2007). Later, it was also demonstrated to be critical for embryonic development: larp-mutant derived syncytial embryos displayed a range of severe mitotic phenotypes including impaired detachment of centromers from spindle poles and multipolar spindle arrays (Blagden et al. 2009). Additionally, the same study revealed association of Drosphila Larp 1 with the poly(A)-binding protein (PABP). Interestingly, an interaction with PABP was also reported for human Larp 1: Burrows et al. demonstrated that Larp 1 is present in a complex with PABP and eukaryotic initiation factor 4E (eI4E), and that it associates with 60S and 80S ribosomal subunits. In addition, human Larp 1 localizes to the leading edge of migrating cells and physically interacts with components of the cytoskeleton. Since Larp 1 knock-down by small-interfering RNAs (siRNAs) results in mitotic arrest, delayed cell migration and inhibition of global protein synthesis rates, the authors hypothesized that human Larp 1 is important for the localized translation of mRNAs critical for cellular remodeling and migration (Burrows et al.

2010). Given the similar phenotypes and protein interactions observed in the drosophila study, this might hold true as well for the fly version of Larp 1.The third

Larp 1 member that has been studied so far is C.elegans Larp 1. It co-localizes with

P-bodies, which are sites of mRNA degradation or storage (Kulkarni et al. 2010).

Consistent with a role in mRNA degradation, Larp 1 null worms had increased levels of certain mRNAs, including messages coding for components of the Ras-MAPK signaling pathway. Since Larp 1 depleted worms also showed oogenesis defects reminiscent of hyper-active Ras-MAPK signaling pathway the authors suggested that

Larp 1 attenuates Ras-MAPK signaling during oogenesis by promoting specific mRNA degradation (Nykamp et al. 2008). However, it was not specifically addressed whether Larp 1 directly regulates mRNA decay or whether it is involved in the down- regulation of transcription of the corresponding genes. In agreement with an mRNA degradation function of Larp 1, a subsequent study by Zanin et al. revealed that

FEM3 mRNA levels are elevated in larp 1 depleted worms. Since FEM proteins are important for regulation of transcription factors that control sex determination, Larp 1 was suggested to promote oogenesis in the germ line of the hermaphrodite worms

(Zanin et al. 2010).

2.2.3.2 The Larp 4 family

Larp 4 members are exceptional insofar as they lack two aromatic amino acids in their LAM that are crucial for terminal oligo uridine binding. Some even lack a third residue, an aspartic acid, which was shown to specifically contact the 2nd last U

(Teplova et al. 2006, see 2.21). The Larp 4 family is therefore the most distinguished

from genuine La and other Larps, even though most of the proteins contain an RRM-

L domain adjacent to the LAM (Figure 2.7).

So far, there has only been one report on a Larp 4 family member. Schäffler et al. studied human Larp 4b which shares 53% of amino acid similarity with its

homolog hLarp 4 (Schaffler et al. 2010). The authors showed that Larp 4b is a

cytoplasmic protein that cosediments with polysomes in polysomal fractionation

experiments. However, immunofluorescence analysis of hemagglutinin antigen (HA)-

tagged Larp 4b revealed that the protein re-localizes to stress granules upon

arsenate treatment. Further biochemical studies suggested that the protein

physically interacts with two key factors of the translational machinery, the PABP

(which was also shown to interact with Larp 1, see 2.2.3.1) and the receptor for activated C kinase (RACK1). Moreover, in in vivo experiments it could be

demonstrated that Larp 4b positively influences the translation of a large number of

cellular mRNAs, the authors concluded therefore that hLarp 4b acts as general

translation factor. Since the protein interacts with both mRNA 3’ end binding factors

(PABP) and 5’ end binding proteins (RACK1), they put forward a model in which

Larp 4 helps the circularization process of actively translated mRNAs and therefore the reloading of 3’ end ribosomes onto the 5’ end.

2.2.3.3 The Larp 6 family

RBPs of the Larp 6 family contain a central RRM-L adjacent to the N-terminal LAM and an additional domain of unknown function at their C-terminus termed LSA motif

(Figure 2.7).

Larp 6, also named Acheron, was firstly described in a screen for factors induced during apoptosis in intersegmental skeleton muscles (ISM) of the moth

Manduca sexta (Valavanis et al. 2007). In vertebrates, it is mainly expressed in neurons and muscle cells and has been shown to interact with CASK1-C via its C- terminus, a novel CASK/Lin2 family transcription factor important in development

(Weng et al. 2009). In the same paper, it was also reported that the protein co- immunopreciptates with all members of the inhibitor of differentiation (id) proteins.

Additionally, studies in both mammals and zebrafish suggest that Acheron acts upstream of the muscle specific transcription factor MyoD, which promotes myogenesis. Morpholino-mediated knock-down of zebrafish Larp 6 resulted in muscle fiber loss while ectopic Acheron enhanced muscle fiber formation (Wang et al. 2009; Glenn et al. 2010). Whereas all these studies pointed towards a regulatory role of Larp 6 in muscle formation, not necessarily involving RNA binding, a recent report on human Larp 6 demonstrated that the protein associates with a conserved stem-loop in the 5’ UTR of type 1 collagen mRNA in a sequence-specific manner

(Cai et al. 2010). Cai et al. showed that a single U to A mutation in the bulge of alpha1 collagen mRNA abolished binding to hLarp 6. Moreover, using green fluorescent protein (GFP) tagged collagen, they could show that the characteristic translation of collagen-mRNA at discrete regions of the endoplasmatic reticulum

(ER) is only observed when the stem-loop structure in the 5’ UTR of the reporter construct is present. If either the RRE or Larp 6 was missing, this focal pattern of synthesis could not be reproduced and collagen accumulated diffusely throughout the ER. Since in Larp 6 depleted cells ribosome loading on collagen mRNA was reduced, the authors postulated that Larp 6 regulates localized translation of the most abundant protein in the human body, collagen.

2.2.3.4 The Larp 7 family

Larp 7 family members are the most extensively studied Larps and closest related to genuine La proteins. Not only do they contain all residues important for 3’ UUU-OH binding, they also harbor a canonical RRM motif juxtapositioned to the LAM (Figure

2.7).

Consistent with their structural similarity to bona fide La, Larp 7 proteins have been shown to bind ncRNAs ending in 3’ UUU-OH, which makes them exceptional among Larps. It has even been learnt that Larp 7 proteins lacking the C-terminus are able to take over certain steps of pre-tRNA maturation, reflecting both the N-terminal analogy to La and the apparent importance of other regions concerning target- specificity of LAM-containing RBPs (He et al. 2008). Human Larp 7, also called

PIP7S, and drosophila Larp 7 act as tumor suppressors. Both stably bind and protect

7SK snRNA, a RNPol III-transcribed small RNA that bears typical 3’ UUU-OH ends.

7SK snRNP which consists of 7SK snRNA, Larp 7 and the proteins HEXIM 1 and 2, sequesters transcription elongation factor b (P-TEFb) and thereby inhibits its activity.

Consequently, siRNA-mediated knock-down of human Larp 7 results in increased transcriptional elongation and malignant transformation of cells in culture (He et al.

2008). Since HEXIM proteins, 7SK RNA and Larp 7 have recently been detected in many metazoans, it is likely that the described control mechanism of P-TEFb- mediated transcription has been conserved during evolution.

Other well-described examples of Larp 7 members comprise the ciliate homologs p65 (Tetrahymena thermophila) and p43 (Eupliotes aediculatus, Aigner et al. 2000; Aigner et al. 2003; Aigner and Cech 2004; Stone et al. 2007). P65 has been reported to assist both the correct folding of telomerase RNA and the assembly

of the RNP. In the absence either p65 or p43, telomerase activity is impaired presumably due to difficulties of telomerase reverse transcriptase (TERT) to bind to telomerase RNA. These functions of Larp 7 have been observed neither in yeast nor in other vertebrates. This is likely due to the fact that in higher eukaryotes telomerase RNA is transcribed by RNPol II whereas ciliate telomerase RNA is produced by RNPol III, which results in 3’ UUU-OH RNA ends and thus binding sites for Larp 7.

2.2.4 Yeast Larps

There are three annotated LAM-containing proteins in yeast: The bona fide La protein Lhp1p and the two Larps Sro9p and Slf1p. In an early genetic analysis Wolin et al. showed that the deletions of either SRO9 or SLF1 genes are not synthetically lethal with LHP1, suggesting that the three proteins have different functions in the cell and are not engaged in a single essential process (Sobel and Wolin 1999).

Whereas the LAM of Lhp1 is localized N-terminally, as it is the case for all genuine

La proteins, the Sro9p- and Slf1p-LAMs are located towards the C-terminus. Lhp1 displays high sequence homology with the two Larps within the LAM but is otherwise unrelated to Slf1p and Sro9p, which share sequence similarity throughout their length (28% identity). They are believed to have resulted from an ancient gene duplication event (Wolin and Cedervall 2002; Wolfe and Shields 1997).

Among the vast family of Larps Slf1p and Sro9p are exceptional. According to the sequence conservation of their LAM they are closely related to the Larp 1-family, however, they neither comprise the Larp 1-caracteristic DM15 domain nor any other

annotated domain. Regarding the ambiguous role of the LAM in mRNA binding of La

and Larps, they appear as prime examples to study the functionalities and binding preferences of the motif without interference of additional domains.

2.2.4.1 Sro9p

Sro9p is a predominantly cytoplasmic and has originally been identified as a

suppressor of a secretory pathway mutant (Tsukada and Gallwitz 1996). In a

different genetic screen Sro9p was found to suppress the bud growth defect in cells

depleted of ROH3, a gene encoding a Rho-type small GTPase involved in the proper

organization of the actin cytoskeleton (Imai et al. 1996). Since the protein also

showed strong genetic interactions with tropomyosin genes, it was suggested that it

might play a role in actin cytoskeleton rearrangement during bud formation (Kagami

et al. 1997). The proof that Sro9p is an RBP was provided by Sandra Wolin’s

laboratory demonstrating that recombinant Sro9p binds to poly(U) and poly(G) RNA

(Sobel and Wolin 1999). Furthermore, the same study revealed that the protein

associates with translating ribosomes and that sro9 knock-out cells are less sensitive

to a subset of translational inhibitors, namely to paromomycin, which reduces

translational fidelity during elongation, and to the elongation inhibitor cycloheximide.

However, sro9 cells are equally sensitive to hygromycin B, which has similar effects

as paromomycin, and to anisomycin, an inhibitor of the peptidyl transferase activity,

as compared to isogenic wild-type strain. Based on these results, Sobel et al.

suggested that Sro9p either directly or indirectly, affects ribosome structure and / or

function. In addition to translation, Sro9p has also been implicated in RNPol II -

mediated transcription (Tan et al. 2000). High copy SRO9 suppressed transcription

defects caused by deletion of Rpb4, a non-essential subunit of RNPol II. Moreover,

addition of recombinant Sro9p to Rpb4p-depleted extract restored the transcription

defects, indicating a direct involvement of the RBP in transcription. On the other

hand, the same study also suggested a role of Sro9p in stabilization of mRNA, as

mRNA decay experiments with the transcriptional drug thiolutin showed that poly(A)

RNA has increased average half-lives in SRO9 overexpressing cells as compared to

wild-type cells. Thus, elevated poly(A) RNA levels in Sro9p overexpressing cells are

supposedly caused by dual, Sro9p-mediated effects on both mRNA transcription and

stability (Tan et al. 2000). In agreement with the notion that Sro9p might have

multiple effects on mRNA transcription, stabilization and translation, a recent report by Röther et al. revealed that the protein associates with various protein complexes

acting on diverse processes of the gene expression pathway, including RNPol II

subunits, export factors and components of the cytolasmic ribosome (Röther et al.

2010). Consistent with an interaction with both nuclear and cytoplasmic proteins,

Sro9p was shown to shuttle between nucleus and cytoplasm: mRNA export deficient

cells displayed an accumulation of Sro9p in the nucleus. Importantly, the authors

also demonstrated that the protein is recruited to actively transcribed genes,

evidencing a role of Sro9 in transcription (Röther et al. 2010).

2.2.4.2 General aspects of copper homeostasis and implications for human disease

Copper is an essential trace element for literally all organisms and important for

various processes. In humans, for instance, it is required for the production of

neurotransmitters, cellular respiration, peptide biogenesis, pigment formation, iron

homeostasis and free radical scavenging (reviewed in Culotta et al. 1999). Its redox-

properties are crucial for cells and make copper an indispensable cofactor for a

variety of enzymes acting in electron transfer and antioxidant systems (reviewed in

Pena et al. 1999). Also, the relative abundance and solubility of copper in the

environment presumably provided a driving force for natural selection in favor of this

transition metal. However, the beneficial reduction potentials of copper systems can

easily become threatening to cells as copper concentrations rise: Reactive oxygen

species (ROS) and oxidative stress are direct consequences of elevated copper

levels (Avery 2001). Cells are therefore equipped with a variety of mechanisms to

tightly control intracellular copper levels. This is reflected by the fact that free copper

is restricted to less than one atom per cell in Saccharomyces Cerevisiae (Rae et al.

1999).

S. cerevisiae is a model organism with long-standing tradition when it comes

to studies on general aspects of Copper-metabolism and associated human

diseases. On the one hand, this is due to the relative low complexity of yeast cells

and to a variety of powerful tools available to study them, on the other hand, it is

because many proteins and mechanisms controlling copper homeostasis have been

conserved during evolution. For instance, high affinity copper transport proteins (Ctr proteins) have first been described in yeast (Dancis et al. 1994a; Dancis et al.

1994b), but were later discovered in most mammals including humans (reviewed in

Tisato et al. 2009). They regulate copper uptake at the plasma membrane by a series of conserved methionine residues in the hydrophilic extracellular domain (Puig

et al. 2002). Importantly, also genes critical in human diseases have homologs in

yeast: Menkes- and Wilson disease (WD) are caused by mutations in the ATP7A

and ATP7B genes, respectively, which are homologue to PCA1 and CCC2. ATP7A and B are members of the P-type cation transport ATPase family and encode proteins with several membrane-spanning domains, an ATPase consensus sequence and at least two putative copper-binding sites. ATP7A is ubiquitously expressed and responsible for delivery of copper to enzymes in the trans-Golgi network and excretion of the metal from the cell (reviewed in La Fontaine et al.

2010). Menkes disease, also called kinky hair disease, a fatal X-linked disorder, is caused by diverse mutations in the ATP7A gene. Symptoms are associated with lack of copper-enzyme activity and include weak muscle tone, mental retardation, developmental delay and premature death (Tumer and Moller 2010). Wilson disease

(WD) is an autosomal recessive disorder caused by mutations of the ATP7B gene

(Wilson disease gene), which is specifically expressed in liver and important for efflux of hepatic copper into the bile (Petrukhin et al. 1993; Petrukhin et al. 1994).

Accordingly, patients affected by WD suffer from elevated liver copper levels which are pathologically manifested in liver failure, tremors, slurred speech and other neurological impairments. WD treatment consists of orally administered copper chelating agents such as D-penicillamine (Cuprimine), trientine hydrochloride

(Syprine) or tetrathiomolybdate (reviewed in Roberts and Schilsky 2008). Also zinc salts (Galzine e.g.) are in use since zinc prevents absorption of endogenously secreted and dietary copper from the intestine (Brewer et al. 1985). In addition to

Menke and Wilson disease, copper homeostasis appears to be affected in many neurodegenerative disorders and cancers. Even though subject to continuous debate, it is widely accepted that the oxidative stress inducing properties of copper are key factors for pathology (Tapiero et al. 2003). However, there is also evidence that copper can induce the nucleation-dependent protein aggregation (“seeding”)

which provokes neuro- and synaptoxicity in neurodegenerative disorders such as

Alzheimer’s disease (Huang et al. 2004).

The basic yeast system that controls intracellular copper availability consists of import and export pathways (reviewed in Luk et al. 2003, Figure 2.9). During copper starvation, copper is imported into yeast cells by the high affinity transporters

Ctr1p and Ctr3p. Since it can only be imported in the reduced state (I), this requires the concerted action of the ferric / cupric reductases Fre1p and Fre2p. All these genes are controlled by the transcription factor Mac1p. Entering copper is retrieved from Ctr1p by copper chaperones that distribute the metal to the various copper enzymes: Ccsp helps copper loading to Sod1p in cytosol and mitochondria, while

Atox1p transfers copper to the secretory pathway and nucleus. An ensemble of proteins regulates copper delivery to cytochrome C oxidase in the mitochondria, among them Ccop. Note that all of these copper chaperones mentioned have homologs in human (Lutsenko 2010). Elevated environmental copper concentrations bring a different batch of proteins to the scene: they result in the expression of metallothioneins such as Cup1p and Crs5p, which can bind free intracellular copper and therefore play a major role in preventing oxidative damage. Many yeast strains used in laboratories contain an extra copy of CUP1 in order to gain stability and prevent copper damage. Along with the superoxide dismutase Sod1p, which is involved in free radical scavenging, these genes are controlled by the copper binding transcription factor Ace 1 (Zhou and Thiele 1993).

Despite forming a relatively well understood system, novel insights into yeast copper homeostasis are still being generated. In a global screen for genes with varying mRNA steady-state levels in changing copper concentrations, van Bakel et

al. identified 101 genes which showed previously unknown differential regulation in response to copper stress (van Bakel et al. 2005). In subsequent large scale growth phenotype assays with deletion strains, 6 of them were shown to yield hyper resistance or -sensitivity in response to elevated copper concentrations. In a different study by Rees et al., a new copper transporter of the Ctr-protein family was identified, Ctr2. It was shown that this vacuolar transporter regulates the mobilization of intracellular copper stores (Rees et al. 2004).

Figure 2.9: Scheme of the basic copper homeostasis pathways in S.cerevisiae. See text for details. In blue: metallothioneins which sequester intracellular copper and therefore play critical roles in copper detoxification. Transcription factors are yellow. Adapted from vanBakel et al., 2005.

2.2.4.3 Slf1p

Slf1p was first described in a complementation study screening for factors

suppressing the cup14 mutation (Yu et al. 1996). Cup14 mutants show increased

sensitivity to elevated copper concentrations but grow normally when SLF1 is overexpressed. In agreement with a role in copper homeostasis, Yu et al. showed that slf1 mutant cells display a slow growth phenotype on medium containing high copper concentrations, whereas they grow like wild-type cells under standard conditions. Conversely, overexpression of SLF1 in wild-type background resulted in copper-hyperresistant cells. However, mRNA steady state levels of SLF1 are unchanged upon copper addition as determined by Northern blot analysis, suggesting the SLF1 expression is not under the control of a copper-mediated transcriptional response. Since it was found that slf1∆ cells show diminished brown

coloration when grown in conditions of elevated copper concentrations, it was

hypothesized that Slf1p might act in pathways regulating copper sulfide production

on the surface of cells. The brownish hue of yeast cells grown in copper salt

containing medium is believed to result from the formation of copper sulfides mineral

lattices adsorbed on the cell wall (Yu et al. 1996). In addition, Yu and co-worker

showed that cells lacking SLF1 depleted less copper from the medium as compared

to wild-type cells, indicating that some copper transporter may be affected. However,

despite the obvious involvement of Slf1p in copper homeostasis, the underlying

mechanisms remained unclear and direct role of Slf1p in copper sulfide production

could not be shown. It might well be that the changed coloration of slf1∆ cells grown

in copper-medium is due to a secondary effect caused by impaired copper

homeostasis.

In the yeast Larp study by Sobel et al. mentioned previously, also Slf1p was investigated. In analogy to Sro9p, also Slf1p was shown to associated with homopolymeric RNA in vitro, namely with poly(U) and poly(G), whereas weak or no affinity for poly(C) and poly(A) RNA was observed, respectively (Sobel and Wolin

1999). Moreover, both proteins were found to weakly associate with DNA. In addition to its interaction with RNA, Slf1p was also demonstrated to associate with translating ribosomes which might relate to the observation that strains lacking Slf1p are less sensitive to a subset of protein synthesis inhibitors, as it was reported for sro9∆ cells.

However, slf1∆ cells were equally sensitive to cycloheximide as wild-type, which is in contrast to sro9∆ cells that were less sensitive to cycloheximide. This might reflect different effects on translation. In conclusion, additionally to its apparent role in copper-detoxification, Slf1p might play roles in translation.

2.3 Aim and working strategy of the thesis

I set out to determine the role of the two yeast Larps Slf1p and Sro9p in copper- physiology. Moreover, I wanted to address the seemingly contradictory observations that the LAM, on the one hand, constitutes the main specificity factor for binding to

3’UUU-OH ending ncRNAs and, on the other hand, is exclusively found in proteins able to associate with mRNAs. Since Slf1p and Sro9p comprise the LAM as their sole annotated domain, they define prime example to study RNA binding preferences of the motif without the interference of additional domains.

I therefore aimed at globally identifying the RNA targets of Slf1p and Sro9p applying the RIP-Chip method. Along with a combined in vitro and in vivo approach using wild-type and mutant Slf1p, I investigated whether the LAM is required for mRNA binding and, importantly, whether such an interaction would be established by the same conserved residues critical for 3’UUU-OH end-recognition by bona fide La proteins. To study the relevance of Slf1p mRNA association for copper physiology, I applied a system’s approach integrating the data from the RIP-Chip experiments with large scale datasets obtained from mRNA profiling experiments, and combined these with phenotypic studies on cells overexpressing wild-type or RNA-binding deficient Slf1p. In addition, I used a variety of techniques to gain a comprehensive picture of Slf1p-effects on several crucial steps of the eukaryotic gene expression program, including mRNA translation (polysomal profiling), decay (mRNA decay experiments) and transcription (Chromatin immunoprecipitation (CHIP), performed by Dominik Meinel, CIPSM Munich).

3 Results

3.1 Copper phenotype and RNA binding activity

3.1.1 The copper phenotype assay

Slf1 knock-out cells are viable but show increased sensitivity to elevated copper

concentrations (Yu et al. 1996). Based on these data I set out to generate an in vivo

assay to further characterize the Slf1p role in copper homeostasis and to investigate

the importance of the LAM for Slf1p function. To this end, I transformed wild-type

yeast cells with a plasmid bearing C-terminally tagged Slf1p under the control of a

galactose inducible promoter (pBG1805-SLF1, see table 1 for an overview of

plasmids and strains used, materials and methods for details). When transformed

cells were grown in the presence of 2% galactose and 2% raffinose, I observed a

minor growth phenotype as it has been observed for several strongly overexpressed

yeast proteins (Sopko et al. 2006). Instead of raffinose, I therefore used 1% glucose,

which is inhibitory to induction by the GAL1 promoter and leads to a milder

overexpression (Gancedo 1998). Using 3% galactose and 1% glucose instead of

standard overexpression medium still gave rise to substantial overexpression after 6

and 24 hours (Figure 3.1 A), without affecting growth. When SLF1 and empty vector

transformed cells were grown on plates containing galactose and different

concentrations of CuSO4, a salt that was previously used to study copper

metabolism in yeast (Troeger 1964; Yu et al. 1996), only SLF1 overexpressing cells

yielded growth under high copper conditions (1.75 mM and 2.5 mM; Figure 3.1 B).

This is in agreement with a previous study on Slf1p (Yu et al. 1996) and therefore suggests that the used C-terminal tag does not interfere with Slf1p function.

Figure 3.1: SLF1 overexpression yields copper-phenotype. (A) Time course monitoring protein expression of Slf1-tag. (B) Vector and SLF1 transformed wild-type cells were serially diluted (1:10) and grown on selective plates containing different amounts of copper sulfate and either 3% galactose (upper panel), which induces expression of ectopic SLF1, or 2% glucose (lower panel). Only SLF1 overexpressing cells grew on plates containing 2.5 mM

CuSO4 (Black and white picture).

Strain / Plasmid Abbrevation Genotype / characteristics and uses Reference or source Strain Protein Saccharomyces Cerevisiae BY4741 WT - MATα; his3∆1; leu2∆0; met15∆0; ura3∆0 Open Biosystems BY4741 SLF1-TAP SLF1-TAP Slf1-TAP derivate of BY4741 Open Biosystems / Winzeler et al. 1999 BY4741 SRO9-TAP SRO9-TAP Sro9-TAP derivate of BY4741 Open Biosystems / Winzeler et al. 1999 BY4741 FPR1 -TAP FPR1 -TAP Fpr1-TAP derivate of BY4741 Open Biosystems / Winzeler et al. 1999 BY4741 CUP1 -TAP CUP1 - TAP Cup1-TAP Open Biosystems / Winzeler et al. 1999 BY4741 slf1∆ slf1∆ - deletion derivate of BY4741 Open Biosystems

SLF1-TAP MEX67 -- MATα; ura3-52 ; ade2-1 ; his3-11,15 ; leu2-3,112 ; trp1-1 ; This study SLF1-TAP::TRP1-KL, mex67::HIS3 ; pUN100-MEX67 SLF1-TAP mex67-5 -- MATα; ura3-52 ; ade2-1 ; his3-11,15 ; leu2-3,112 ; trp1-1 ; This study SLF1-TAP::TRP1-KL, mex67::HIS3 ; pUN100-mex67-5 SRO9-TAP MEX67 -- MATα; ura3-52 ; ade2-1 ; his3-11,15 ; leu2-3,112 ; trp1-1 ; Röther et al. 2010 SRO9-TAP::TRP1-KL, mex67::HIS3; pUN100-MEX67 SRO9-TAP mex67-5 -- MATα; ura3-52 ; ade2-1 ; his3-11,15 ; leu2-3,112 ; trp1-1 ; Röther et al. 2010 SRO9-TAP::TRP1-KL, mex67::HIS3; pUN100-mex67-5

Escherichia Coli BL-21 (DE3) - - Host used for purification of FLAG-Slf1-6His -

Plasmid Protein Plasmids pBG1805-SLF1 SLF1 Slf1-tag Gal induction results in expression of Slf1-6His-HA-ZZ Open Biosystems / Gelperin et al. 2005 pBG1805-SRO9 SRO9 Sro9-tag Gal induction results in expression of Sro9-6His-HA-ZZ Open Biosystems / Gelperin et al. 2005 pBG1850-LHP1 LHP1 Lhp1-tag Gal induction results in expression of Lhp1-6His-HA-ZZ Open Biosystems / Gelperin et al. 2005 pBG1805-SLF1-LAM-mut La-m Slf1-Lam 3 Mutations in the LAM of Slf1p were introduced: Y11A, F22A, F43A This study pBG1805-SLF1-LAMΔ LaΔ Slf1-LaΔ 51 aa of LAM (~80%) in Slf1p were deleted This study pBG1805 vector - obtained by removal of SLF1 from pBG1805-SLF1 This study pTrc-FLAG-SLF1-6His - Flag-Slf1-6His vector used for expression of Flag-Slf1-6His in E.coli This study

Table 1: Strains and plasmids used in this study

3.1.2 Characterization of Slf1p copper phenotype

In order to further characterize the role of Slf1p in copper detoxification, I performed

a series of phenotypic studies. To test if involvement in copper homeostasis is a

general characteristic of yeast LAM-containing proteins, I overexpressed C-

terminally tagged galactose-inducible versions of Sro9p and of the bona fide La-

protein Lhp1 along with SLF1 and assayed for growth on copper supplemented

plates. In contrast to SLF1, overexpression of neither SRO9 nor LHP1 yielded growth phenotypes (Figure 3.2 A). Next I wanted to address whether the observed overexpression effect of SLF1 reflects a more general involvement of Slf1p in transition metal biology. To this end, I recapitulated the experiment but assayed for growth on cadmium containing plates. In comparison with copper plates, no difference between vector and SLF1 transformed cells was observed (Figure 3.2 B).

The same result was obtained when cells were grown on medium containing hydrogen peroxide, indicating that copper detoxification by Slf1p is not solely brought about by involvement in general defense mechanisms against reactive oxygen species.

Protein function is often regulated by adjusting cellular protein levels according to the momentary needs of a cell and in response to environmental cues. I therefore wondered whether Slf1p concentrations might be regulated in response to elevated copper concentrations. Since I was not in possession of an antibody reliably recognizing the native protein, I used chromosomally C-terminal tandem-affinity purification (TAP)-tagged Slf1p and monitored its expression in a time course experiment, taking samples at various time points after addition of three different concentrations of copper sulfate. Immunoblot analysis with anti PAP-antibody

Figure 3.2: Slf1p-mediated stress-response is copper-specific and not a general feature of yeast LAM-containing proteins (A) Empty vector, SLF1, SRO9 or LHP1 transformed cells were serially diluted (1:10) and grown on plates containing SC media supplemented with indicated concentrations of copper sulfate. (B) Same assay as described in (A) but testing the behavior of SLF1 overexpressing cells grown on SC plates with different concentrations of cadmium chloride or hydrogen peroxide (black and white picture).

directed against the TAP-tag of the protein revealed in none of the concentrations

used a difference in Slf1-TAP levels (Figure 3.3). This result is in agreement with the study by Yu et al., which revealed no difference of SLF1 mRNA steady-state levels in response to changing copper concentrations (Yu et al. 1996). However, since the

TAP-tagged strain used in this experiment had the endogenous SLF1 3’ UTR replaced by the TAP-tag, which is fused immediately downstream of the ORF, I could not monitor a potential 3’ UTR-mediated regulation of Slf1p. In order to finally

address this point one would need either functional antibodies against endogenous

Slf1p or tagged SLF1 with endogenous 3’ UTR.

Figure 3.3: Slf1-TAP levels are not changed in response to elevated copper concentrations. Samples of exponentially growing yeast cells were taken after the indicated time points and Slf1-TAP protein levels were analyzed by immunobloting. Three different copper sulfate concentrations were tested. Note: Since cells were grown in rich medium, much higher copper concentrations were assayed as compared to previous experiments with cells grown in synthetic complete medium. Poinceau staining of membranes control for equal loading (bottom panels).

Taken together these results suggest that Slf1p does not act in pathways controlling general aspects of transition metal homeostasis or oxidative stress response, but participates in a specific defense mechanism against elevated Copper concentrations. Moreover they show that this function is not a common feature of yeast LAM-containing RBPs. However, despite its importance in copper metabolism,

Slf1p protein levels appear to stay invariant under conditions of excess copper.

3.1.3 Functional La-domain is crucial for Slf1p-mediated increased resistance to copper

Since the LAM was previously shown to be indispensable for bona fide La proteins to function in pre-tRNA maturation (see 2.2.2), I set out determine if the motif is also important for the function of Slf1p in copper homeostasis. To this end, I employed a dual approach: On the one hand, I mutated the codons for three amino acid residues located in the LAM previously shown to be crucial for RNA binding (Dong et al. 2004;

Teplova et al. 2006; Kotik-Kogan et al. 2008). On the other hand, I used overhang extension polymerase chain reaction (PCR) to remove approximately 80% of the

LAM (51 aa, corresponding to residues 284 to 334 of Slf1p, see materials and methods). Three aromatic LAM-residues were changed to alanine (tyrosine 11 and phenylalanines 22 and 43, numbering for Slf1p-LAM, see Figure 3.4). These residues are critical for high-affinity binding to 3’ UUU-OH bearing RNAs and located in an aromatic patch on the surface of the proteins. They have been highly conserved among La proteins and Larps (Figure 3.4). Indeed, both mutation and deletion of the LAM resulted in loss of increased copper resistance (Figure 3.5 A).

Immunoblot analysis revealed that Slf1p with mutated LAM was similarly expressed

as the wild-type protein, whereas Slf1p bearing a deletion of the LAM was not detectable (Figure 3.5 B). Possibly, the LAM is crucial for protein stability and deletion of the domain may lead to instability and rapid degradation. These results indicate that Slf1p-mediated copper resistance depends on a functional LAM and potentially on RNA binding activity, since the LAM is likely to mediate protein-RNA interactions (Dong et al. 2004; Teplova et al. 2006).

Figure 3.4: Domain structure and amino acid sequence alignment of selected Larp 1 and La proteins. (A) Domain structure of Larps and La proteins. White: LAM, dark green: RRM1, light green: RRM2, yellow: DM15 motif, grey: CR5 motif. (B) Amino acid sequence alignment of LAMs and mutations introduced in LAM-mutant Slf1p. Most of the violet-colored aromatic residues form the conserved aromatic surface patch important for RNA binding. Residues indicated above the box were shown to abolish in vitro binding of T.Brucei La LAM to terminal uridines, green dots mark residues mutated to alanine in LAM-mutant version of Slf1p.

Figure 3.5: Effect of LAM mutations and LAM deletion on Slf1p copper-phenotype and protein expression. (A) Copper phenotype assay with wild-type cells harboring either empty vector or galactose inducible wild-type (SLF1), LAM-mutant (La-m, upper panel) or LAM-deleted (La∆, lower panel) SLF1. Neither LAM-mutant nor LAM-deletion overexpressing cells grew on plates containing 1.75 mM and 2.5 mM CuSO4.(B) Immunoblot with extracts of wild-type (WT), LAM-mutant (m, upper panel) or LAM-deletion (∆, lower panel) overexpressing cells used in the copper phenotype assay of (A).

3.1.4 Global identification of Slf1p RNA-targets

Since both Slf1p and Sro9p were shown to bind RNA homopolymers in vitro (Sobel and Wolin 1999) and copper-phenotype assays with LAM-mutant Slf1p pointed towards an RNA binding activity of the protein in vivo, I set out to determine potential

Slf1p and Sro9p target RNAs. To this end, I performed RNA affinity purifications

(RIPs) with TAP-tagged Larps expressed under the control of their endogenous

promoter (see Figure 3.6 for scheme of the procedure). The TAP-tag has previously been used in our lab for RIP-Chip experiments since it usually does not interfere with protein function and has the advantage of bearing a cleavage site for a protease from tobacco etch virus (TEV). This allows for mild elution of the affinity-captured proteins from the resin. Associated RNAs were analyzed with yeast DNA oligo arrays, which contain probes for all annotated yeast open reading frames and non- coding RNAs, as well as probes for certain intergenic regions (Halbeisen et al.

2009). In order to measure association of RNAs with the RBP, I competitively hybridized cyanine 5 (Cy5)-labeled cDNA reverse transcribed from affinity-isolated

RNA with cyanine 3 (Cy3)-labeled cDNA obtained from extract RNA (input). In this setup, the oligo-binding ratio of the two RNA populations at a given array element reflects the enrichment of the respective RNA during the RIP procedure (Gerber et al. 2004; Gerber et al. 2006). In order to control for unspecifically associated RNAs, I

Figure 3.6: Schematic illustration of RIP-Chip method. See text for details. Adapted from Gerber et al., 2004.

employed cells expressing TAP-tagged Fpr1p, a cytoplasmic peptidyl-prolyl cis-trans

isomerase implicated in protein folding and not known to bind RNA (Arevalo-

Rodriguez et al. 2004). Since Slf1 and Sro9 are paralogous proteins (37% overall

amino acid identity) that are especially conserved within the LAM (57% amino acid identity) they could serve as mutual controls. Figure 3.7 shows representative immunoblots following the RIP-procedure. I performed three biological replicates with each protein and consistently enriched for RNAs in both Slf1p and Sro9p RIPs. Due to good reproducibility of the data, I applied a relatively low stringent arbitrary cut-off to select features that were reproducibly associated with either protein (p < 0.05 (t-

test); average log2 ratios of RNA enrichment (RBP) > 0.6; average log2 of RNA

enrichment (Fpr1p) < 0.2). As expected I observed a significant overlap between

Figure 3.7: RIP-experiments. (A) Representative immunoblots from Slf1- (left panel) and Fpr1-RIPs (negative control, right panel). IP: Input, SN: Supernatant, B: Beads, E: Eluate, pB: Post-beads, i.e. beads after TEV-elution. Note: The epitope of the anti-PAP antibody (ZZ-domain) is cleaved off from the protein after TEV elution. Therefore no band should be visible in the eluate. (B) Representative, ethidium bromide-stained agarose gel picture of total RNA used for competitive hybridization to DNA oligo arrays. Visible are ribosomal RNAs 26S and 18S.

potential RNA targets: In total, 550 Slf1p- and 840 Sro9p-associated RNAs were

identified, of which 339 are shared targets (Figure 3.8 A and B, supplemental table

S1). Surprisingly, almost exclusively mRNAs were associated with both RBPs. This is in contrast to RIP-Chip experiments performed previously with the bona fide La protein (Lhp1p) in yeast (Inada and Guthrie 2004), which primarily interacted with

Figure 3.8: Slf1p and Sro9p are associated with hundreds of mRNAs. Heat map depicting the log2 ratios of RNA enrichment in three independent biological RIP replicates, Fpr1p served as negative control. Shown are only target RNAs (p-value < 0.05; average log2(RBP) > 0.6; average log2(Fpr1p) < 0.2), ranked according to their p-value. Red:

positive log2 ratios, green: negative log2 ratios. (B) Venn-diagram depicting overlap between Slf1p- and Sro9p- targets. (C) Bar chart showing the fraction of coding and ncRNA among the 100 highest associated transcripts with Slf1p, Sro9p and Lhp1p (Inada and Guthrie 2004; Slf1p / Sro9p: according to p-value of targets; Lhp1p: according to log2 enrichment).

ncRNAs such as tRNAs and other RNA Polymerase III transcripts (Figure 3.8 C). I

found many highly expressed transcripts among both Slf1p and Sro9p targets, such

as mRNAs encoding for ribosomal proteins and histones. However, a substantial

fraction of potential mRNAs targeted by Slf1p (29%) and Sro9p (37%) are of low abundance (≤ 1 mRNA copy/cell, Wang et al. 2002). This indicates that interactions are not solely met by expression level, which could raise concerns about unspecific binding. Moreover, the fact that I did not enrich for ncRNAs like tRNAs or ribosomal

RNAs, which account for the most abundant RNA species (Warner 1999) also speaks for the specificity of the detected RNA-protein interactions.

3.1.5 Characterization of Larp mRNA targets

To further characterize Slf1p and Sro9p-associated mRNA, I performed Gene

Ontology (GO) term searches with target transcripts and found that the two RBPs

bind to specific subsets of mRNA which code for functionally-related proteins (Table

2). Strikingly, both Larps associate with most of the messages coding for the large or small subunits of cytosolic ribosomes (p <0.001 for both Larps) as well as to all eight

yeast mRNAs coding for histones (GO term “nuclear nucleosome”, p(Slf1) <0.001,

p(Sro9) = 0.0012). Besides shared GO IDs, Slf1p-and Sro9p-target lists also

revealed exclusive GO terms: For example, among the Sro9-specific terms figured

“DNA directed RNA Polymerase II core complex” (p < 0.001). In fact, 9 out of 12 mRNAs coding for the complex are associated with Sro9p. Notably, a potential

Sro9p-mediated regulation of these messages might relate to a report implicating

Sro9p in RNA Polymerase II-mediated transcription (Tan et al. 2000). Slf1p, on the other hand, reproducibly binds to 7 out of 14 transcripts encoding the DNA-directed

RNA polymerase I complex (p = 0.007). Interestingly, the GO term “response to copper ion” was significantly enriched among Slf1p but not Sro9p targets (Fisher exact test, p = 0.002). In particular, I found that Slf1p associates with the mRNAs of two key regulators during copper stress: CUP1 and ACE1. CUP1 encodes for a

metallothionein which sequesters intracellular copper and confers increased

resistance to excess copper concentrations when overexpressed (Winge et al. 1985;

Jeyaprakash et al. 1991). Ace1p is the copper binding transcription factor regulating the expression of CUP1 (Thiele 1988; Welch et al. 1989). Based on these data, I systematically assembled a list of copper-stress-relevant mRNAs (5 GO terms:

“copper ion binding, response to copper ion, cellular copper ion homeostasis, copper ion import” and “copper ion transport”, 36 distinct genes), genes that are implicated in response to oxidative stress (2 GO terms: “cellular response to oxidative stress 1” and “cellular response to oxidative stress 2”,64 genes in total), and transcripts engaged in the oxidative branch of the pentose phosphate pathway (PPP, 1 GO term: “pentose-phosphate shunt, oxidative branch”, 5 genes). This resulted in a list of

101 distinct genes (see supplemental table S2 for all 101 genes).

As stated previously, oxidative stress is one of the main toxic effects caused by high copper concentrations (Cadenas 1989; Jamieson 1998; Avery 2001).

Copper-induced oxidative stress was shown to promote the PPP-mediated

production of nicotinamide adenine dinucleotide phosphate (NADPH), which is crucial for several antioxidant systems (Shanmuganathan et al. 2004). Analysis of the Slf1p target set revealed that 14 messages out of 101 are associated with the protein, they are therefore significantly overrepresented (Fisher’s exact test, p =

0.045, Table 2 and Figure 3.9). Out of these 14 targets 5 (CUP1, HSP12, TRR2,

URM1, LOT6) were not reproducibly enriched in Sro9p RIP-Chip experiments. A potential regulation of these messages by Slf1p could therefore relate to the observed resistance of SLF1 overexpressing cells to elevated copper concentrations

GOTerm Slf1p Sro9p process T/G P‐value T/G P‐value translation 129/694 <0.0001 159/694 <0.0001 maturation of SSU‐rRNA 26/103 <0.0001 30/103 0.001 response to copper ion 2/4 0.0027 ‐ >0.05 ribosome biogenesis 54/413 0.02 ‐ >0.05 copper homeostasis and response to oxidative stress* 14/101 0.0453 27/101 0.0002

function structural constituent of ribosome 117/228 <0.0001 136/228 <0.0001 peptidyl‐prolyl cis‐trans isomerase activity 7/15 0.009 8/15 0.0296

component cytosolic large ribosomal subunit 61/98 <0.0001 67/98 <0.0001 cytosolic small ribosomal subunit 39/64 <0.0001 44/64 <0.0001 nuclear nucleosome 8/11 <0.0001 8/11 0.0012 mitochondrial ribosome 18/82 0.0062 26/82 0.0003 DNA‐directed RNA polymerase I complex 7/14 0.0068 ‐ >0.05 DNA‐directed RNA polymerase II, core complex ‐ >0.05 9/12 0.0002 proton‐transporting two‐sector ATPase complex ‐ >0.05 13/35 0.0247

Table 2: Significantly overrepresented GO terms among Slf1p and Sro9p targets. P-values for “response to copper ion” and “copper homeostasis and response to oxidative stress” were calculated using Fisher’s exact test. Asterisk: Manually curated as described in text. T/G: number of targets related to total genes affiliated with a GO term in the genome.

Figure 3.9: Copper and / or oxidative stress-related Slf1p targets. Heat map of log2 affinity purification enrichments for the 14 Slf1p targets potentially implicated in copper homeostasis (see text for details). Shown are the tree biological RIP-replicates of Slf1p, Sro9p and Fpr1p. Boxes depict Slf1p-specific (5) and common Larp targets (9). Red: positive log2 ratios, blue: negative log2 ratios.

and explain why SRO9 overexpression has no effect. However, Sro9p was even more significantly associated with copper and oxidative stress-related transcripts (p <

0.001).The Slf1p exclusive target HSP12 mRNA codes for an oxidative stress

induced heat shock protein localized to the plasma membrane. Notably, vanBakel

and colleagues found that HSP12 mRNA levels are significantly up-regulated in

excess copper and that hsp12∆ cells are hypersensitive to elevated copper

concentrations (van Bakel et al. 2005). The same study revealed that another Slf1p

target SOL4, encoding the second enzyme of the PPP (Godon et al. 1998; Grant

2008), was down-regulated upon copper-deprivation, pointing towards a more specialized role for the enzyme in copper metabolism.

Based on these results, I reasoned that Slf1p association of copper and oxidative stress-relevant mRNAs may be more pronounced under conditions of high copper concentrations. I therefore performed additional RIP-Chip experiments with cells grown in elevated levels of CuSO4. However, several analyses could not confirm major changes in target specificity or association of individual transcripts

(data not shown). They basically confirmed the previously defined target set, further evidencing that our RIP-Chip set up is sensitive and reliable.

Figure 3.10: Yeast Larps have a preference for short, highly translated and long poly(A) tails containing RNAs. Pearson correlation coefficients between RIP-enrichments and selected mRNA characteristics. Red: negative correlation, green: positive correlation, 5utr len: 5’ UTR length; orf len: open reading frame length; 3utr len: 3’ UTR length; tot len: mRNA length; ribo occ: ribosome occupancy; polyA: Poly(A) tail length; half life: mRNA half- life; abund: mRNA abundance (molecules/cell). Upper panel: data of RIPs performed without copper, lower panel: RIPs with 20 µM copper sulfate. The data for Nsrp1 was taken from the study by Hogan et al (Hogan et al. 2008). Fpr1p is a negative control for RIP-Chip experiments.

I also analyzed the Larp-associated RNAs with respect to molecular properties. In a qualitative approach I ranked all RNAs for which I obtained reliable chip signals according to their average RIP enrichments and compared them to various ranked large scale data available for yeast mRNAs, such as 3’ UTR length, ribosome occupancy and poly(A) tail length (Hogan et al. 2008). The calculated

Pearson correlation values between RIP enrichment and the selected mRNA characteristics are depicted in the heat map of Figure 3.10. Strikingly, I found a

tendency for both Slf1p and Sro9p mRNA targets to be relatively short in length,

highly translated and to have long poly(A) tails. The same correlation was found

among RIP-Chip data of cells grown in CuSO4-containing medium (Figure 3.10,

lower panel). Interestingly, a similar analysis for a variety of RBPs conducted by

Hogan et al. revealed that Nsr1p, a ribosomal RNA (rRNA)-binding protein localized

to the nucleolus, prefers similar types of mRNAs (Hogan et al. 2008). Of note, Nsr1p,

like Slf1p and Sro9p, is also implicated in translation (Lee et al. 1991).

3.1.6 Recombinant Slf1p binds unspecifically to RNA in vitro

Isolated, recombinant LAM of both human and T.Brucei bona fide La protein

was previously found to be incapable of binding to 3’ UUU-OH RNAs (Goodier et al.

1997; Alfano et al. 2004; Dong et al. 2004). Only in conjunction with the

juxtapositioned canonical RRM the RNA substrates were efficiently bound. Since

Slf1p contains no other annotated domain besides the LAM, the observed in vivo

RNA-protein interactions could be brought about by Slf1p-associated RBPs. I

therefore wanted to test the possibility for direct binding. For this purpose, I

performed in vitro RNA binding assays with recombinant, E.coli-expressed Slf1p,

which bore a FLAG- and a 6His tag at the N-terminal and C-terminal end, respectively (see table 1 and materials and methods for details on plasmid). The protein was partially purified by means of Ni-nitrilotriacetic acid (NTI) columns (see materials and methods) and incubated with in vitro transcribed, biotinylated target

(CTR2, CUP1) and non-target (negative control) RNAs. Potentially RNA-associated proteins were pulled-down exploiting the high affinity binding of biotin to streptavidin beads. As depicted in Figure 3.11, immunoblots with anti-His antibodies revealed

RNA binding properties of Slf1p. However, Slf1p bound also to a negative control

RNA, indicating that in this assay Slf1p binds unspecifically to RNA. I have further tested a range of conditions to possibly increase the specificity of the Slf1p-RNA interactions, namely by increasing the salt concentration in the buffer to 500 mM, adding high amounts of EDTA (5 mM), and tandem purification of the protein by means of anti FLAG antibodies. However, no further specificity could be obtained.

For these reasons, I concluded that in vitro binding assays are problematic to study the RNA-binding properties of Slf1p and did not further follow this line of investigations.

Figure 3.11: Biotin RNA pull down experiment with recombinant Slf1p. RNA-protein complexes formed between biotinylated full length Slf1p-target RNAs (CUP1 and CTR2) and Flag-Slf1-6His were purified on streptavidin beads and monitored by immunoblot analysis with anti-PAP antibody. As negative control served drosophila para mRNA (partial ORF sequence). A sample without RNA was used to control for RNA-independent binding to the beads (No RNA).

3.1.7 Mutations in the aromatic patch of the LAM impair mRNA- binding of Slf1p in vivo

To determine whether the LAM is required for RNA-binding by Slf1p in vivo, I set out to compare the RNA binding capacities of wild-type and LAM-mutant Slf1p. In order to exclude potential side-effects of endogenous Slf1p I used slf1 knock-out cells and overexpressed the C-terminally 6His-HA-ZZ domain tagged wild-type and mutant

Slf1p, which previously yielded differential results in the copper phenotype assay

(Figure 3.5 B). Four independent RIP experiments each were performed followed by quantitative real-time PCR (qRT-PCR) analysis of associated RNA. Since the tag used does not bear a TEV cleavage site, I eluted in SDS-EDTA buffer, which

resulted in slightly less efficient protein recovery as compared to TEV-elution with

TAP-tagged proteins (compare Figures 3.12 A and B with Figure 3.5). The mRNAs selected for qRT-PCR analysis ranged from high confidence Slf1p-targets (RPL19b,

HSP12, CUP1; p < 0.005) to targets with higher p-values (SOL4, MCR1; p = 0.03 and p = 0.04, respectively), and from well expressed mRNAs (RPL19b, CUP1; 23.6 and 48.9 molecules/cell, respectively) to low expressed ones (MCR1, HSP26, SOL4;

1.8, 0.3 and 0.2 molecules/cell, respectively; Wang et al. 2002). All selected targets were taken from the list of copper / oxidative stress response-relevant messages, except for RPL19b, which codes for large ribosomal subunit component, and the low abundant HSP26. For all targets assayed here, I consistently measured between

21.3 fold (SOL4) and 6.6 fold (CUP1) more RNA in the wild-type as compared to the

LAM-mutant eluate (Figure 3.12 C). Importantly, no difference was observed for the low abundant non-target NUP2 (1.65 fold; 1.2 molecules/cell) and the highly abundant non-target PMA1 (2.4 fold; 43.1 molecules/cell).

To assess whether the mutations introduced in the LAM might interfere with the ability of Slf1p to associate with ribosomes (Sobel and Wolin 1999), I performed sucrose cushion centrifugation experiments with SLF1-TAP and slf1∆ cells overexpressing either wild-typ or LAM-mutant Slf1p. In this experiment, cell-free S10 extract is applied to a 0.5 M sucrose layer and ultracentrifuged at 100 000 Rpm for

90 min, resulting in the distinct sedimentation of cellular particles according to their density, with monosomes and polysomes accumulating in the pellet (Figure 3.13 A, see also materials and methods). In accordance with previous results (Sobel and

Wolin 1999), both endogenously expressed but also overexpressed Slf1p co-

Figure 3.12: RNA-binding activity of LAM-mutant Slf1p is strongly impaired. Representative immunoblots analysis from wild-type (A) and LAM-mutant (B) -RIPs. Anti- PAP antibody against the C-terminal tag of overexpressed SLF1 was used. IP: Input, SN: Supernatant, B: Beads, E: Eluate, pB: Post-beads, i.e. beads after SDS-EDTA elution. (C) qRT-PCR analysis of selected Slf1p-targets and non-targets. Shown are fold differences between wild-type (black) and mutant (white) eluates, four biological replicates were performed. invariant, respectively, in the global microarray measurements reported in A. Double asterisk: p < 0.01, single asterisk: p < 0.05. P-values were calculated based on ∆-Ct values.

sedimented with ribosomes in the pellet (Figure 3.13 B), whereas a substantial part of the non-ribosome associated Zwf1p resided in the supernatant. Likewise, the

LAM-mutant protein also accumulated in the pellet, indicating that the LAM may not be essential for association with ribosomes. This provides further evidence that the changed residues do not impede correct protein folding and that the LAM-mutant version of Slf1p is integer apart from RNA binding. Moreover, it suggests that a functional La-motif is not required for Slf1p-association with ribosomes and, thus, that this interaction is mediated by protein-protein rather than RNA-protein binding.

However, it should be noted that this assay provides only limited amount of information. Polysomal fractionation experiments would allow for a clear distinction between association with ribosomes highly engaged in translation (high fractions) and monosomes. Moreover, it cannot be excluded that the overexpressed proteins form high molecular weight aggregates and therefore accumulate in the pellet. But since I used the same overexpression conditions as for the RIP experiments, where I observed specific association with target mRNAs, which speaks against protein aggregation, this possibility appears to be less likely.

Taken together, these results further support our previous finding that Slf1p binds to distinct target RNAs. In addition, they show that our RIP-Chip set-up is sensitive enough to detect potentially weak interactions between RNA and RBPs, like the associations with SOL4 and MCR1. Importantly, they also demonstrate that mutation of residues located in the conserved aromatic patch, reported to be crucial for in vitro 3’ UUU-OH RNA binding of bona fide La proteins, may also be critical for specific mRNA binding of the Larp Slf1p.

Figure 3.13: Effects of LAM-mutations on association with ribosomes. (A) Scheme of sucrose cushion experiments. See text for details. (B) Immunoblots from sucrose cushion experiments with antibodies detecting endogenously expressing SLF1-TAP cell extracts (left panel) and wild-type or LAM-mutant SLF1 overexpressing slf1∆ cells. Both wild-type and mutant Slf1p sedimented in the pellet (P), indicating that they are associated with ribosomes. In contrast, the cytoplasmic Zwf1p resided mainly in the supernatant (S). The ribosomal protein Rps3p served as positive control. I: Input.

3.2 Functional studies

3.2.1 Slf1p specifically regulates mRNA steady-state levels of target RNAs

In order to explore the regulatory potential of Slf1p, I overexpressed C-terminally

tagged SLF1 in wild-type cells and measured relative changes on the mRNA steady-

state levels by means of cDNA-microarrays. I found that potential Slf1p mRNA

targets are generally more abundant in Slf1p overexpressing cells as compared to

empty vector transformed cells (average up-regulation: 1.3 fold, Figure 3.14 A).

Moreover, when I induced SLF1 expression for only 6 instead of 24 hours, which results in four times less overexpressed Slf1 on the protein- (as determined by western blot) and 13 times less on the mRNA level (as determined by microarray measurement, Figure 3.14 B and C), I observed a less pronounced yet still significant up-regulation of Slf1p-targets (average up-regulation: 1.1 fold, p < 0.001).

Whether this effect is due to longer induction time or higher Slf1p dosage cannot be answered with time course experiments. However, the result argues for Slf1p dosage-dependency as it seems unlikely that the apparent regulatory effect of Slf1p

would need more than 6 hours to set in, considering the short yeast mRNA half-lives

(average half life: approx.19 minutes, Wang et al. 2002). Due to technical difficulties,

I was not able to obtain a stable galactose-inducible SLF1 strain, which could have

been used for reliable testing of a dosage-dependent effect by adjusting galactose

levels.

Interestingly, GO term search analysis with all genes that were more than 1.5

fold up-regulated on average in the two biological replicates with high Slf1p

expression (852 genes, see supplemental table S3) produced a similar list of

significantly overrepresented terms (table 3) as was obtained previously with Slf1p-

targets (see table 2). Namely target RNAs affiliated with translation-related GO

identities such as “ribosome biogenesis” (p < 0.001), “translation” (p < 0.001) and

“cytosolic ribosome” (p < 0.001) along with RNAs involved in “copper and oxidative

stress response” (p < 0.001) showed elevated mRNA steady-state levels.

Interestingly, the group of copper and oxidative stress-related messages was even more prominent among genes that were 1.5 fold up-regulated on average as

compared to the Slf1p target set (p = 0.045).

Surprisingly, I also found many ncRNAs to have significantly higher steady- state levels, namely ribosomal RNAs, small nucleolar RNAs (snoRNAs) and tRNAs

(see table 2 for corresponding GO terms and p-values). Since Slf1p does not bind to ncRNAs, the effect on these RNAs must be indirect. Interestingly, the RIP-Chip data revealed that Slf1p binds to 7 out of 14 mRNAs coding for components of RNA

Polymerase I complex (p < 0.01, table 1), which regulates transcription of the 18S,

5.8S and 25S precursors rRNAs. Moreover, I found all 7 components to be up- regulated in Slf1p overexpressing cells (average up-regulation in all four biological replicates: 1.46 fold). A Slf1p-mediated positive control of the RNPolI complex might explain elevated rRNA levels upon Slf1 overexpression. However, it cannot account for up-regulation of the RNA Polymerase III-transcribed tRNAs and RNA Polymerase

II-produced snoRNAs.

Notably, the highest up-regulation besides SLF1 was observed for the Slf1p-

specific copper metabolism-relevant target HSP12. I therefore tested the effect of

Figure 3.14: High Slf1p levels correlate with high Slf1p-mRNA target levels, in an mRNA binding dependent manner. (A) Relative changes of mRNA steady-state levels were measured after 6 hours (upper scheme) and 24 hours (lower scheme) of SLF1 overexpression and compared to empty vector transformed cells. Shown are log2 ratios of two biological replicates, slf1∆ cells were used as background. In both cases, Slf1p targets (pink) were up-regulated (higher log2 ratios) compared to non-targets (blue). Both target shifts were statistically significant (double asterisk: p < 0.001, Mann-Whitney U test). (B) Relative Slf1 protein levels in the four experiments described in A. R1,2: Replicates 1 and 2. (C) Quantification of both RNA and protein levels in the four experiments described in A. white bars: 6 hours of overexpression; black bars: 24 hours of overexpression. (D) Direct

comparison of mRNA steady-state levels in wild-type and LAM overexpressing slf1∆ cells. mRNA levels for selected experimentally defined Slf1p targets and non-targets were measured by qRT-PCR (two biological replicates). For all targets assayed an mRNA steady- state up regulation was observed in wild-type- (black bars) as compared to LAM- overexpressing cells (white bars). Regulation of RPL19b was very mild (1.1-fold) and not statistically significant. The mRNA levels of non-targets (NUP2 and PMA1) were invariant. These targets and non-targets were also up-regulated or invariant, respectively, in the global microarray measurements reported in A. Double asterisk: p < 0.01, single asterisk: p < 0.05. P-values were calculated based on ∆-Ct values.

GO term Process T/G P‐value rRNA modification 52/84 <0.0001 ribosome biogenesis 107/409 <0.0001 rRNA pseudouridine synthesis 20/32 <0.0001 Translation 131/695 <0.0001 Copper homeostasis and response to oxidative stress* 29/107 <0.0001 proteasomal ubiquitin‐independent protein catabolic process 9/14 0.0042 mitochondrial respiratory chain complex IV assembly 9/14 0.0042

Function RNA modification guide activity 51/71 <0.0001 rRNA binding 57/92 <0.0001 structural constituent of ribosome 82/228 <0.0001 antioxidant activity 14/28 0.0002 peroxidase activity 11/18 0.0002

Component small nucleolar ribonucleoprotein complex 65/105 <0.0001 box C/D snoRNP complex 35/52 <0.0001 box H/ACA snoRNP complex 21/31 <0.0001 large ribosomal subunit 48/143 <0.0001 small ribosomal subunit 36/98 <0.0001 cytosolic proteasome complex 13/26 0.0005

Table 3: Significantly overrepresented GO terms among genes that were more than 1.5-fold up-regulated in cells with high SLF1 overexpression (two biological replicates). “Copper homeostasis and response to oxidative stress” were calculated using Fisher’s exact test. Asteriks: Manually curated as described in text. T/G: number of more than 1.5 fold up- regulated genes related to total genes affiliated with a GO term in the genome.

SLF1 overexpression in an hsp12∆ strain. As reported, hsp12∆ cells showed a clear growth phenotype when tested in the copper phenotype assay (Figure 3.15 A).

Overexpression of SLF1 resulted in increased resistance as compared to empty vector transformed cells, speaking against the possibility that the copper homeostasis role of Slf1p can be explained by individual regulation of HSP12 message. Even though it cannot be determined whether there is a difference between SLF1 overexpression in hsp12∆ and wild-type cells, this result indicates that function of Slf1p in copper homeostasis is likely brought about by regulation of a group of messages instead of single transcripts.

Figure 3.15: Copper phenotype assay with hsp12∆ and SLF1 overexpressing hsp12∆ cells. (A) Copper phenotype assay with hsp12∆ cells. They showed a growth phenotype on copper-containing plates as compared to wild-type and gis2∆ cells (negative control). (B) overexpression of SLF1 in hsp12∆ background induced increased resistance of cells to elevated copper concentrations.

3.2.2 Slf1p is localized to the cytoplasm and affects target-mRNA decay

Specific regulation of mRNA steady-state levels can arise from two distinct mechanisms: transcription rates can be changed and / or mRNA decay may be modulated. The Slf1p paralog Sro9p is implicated in both transcription and translation (Sobel and Wolin 1999 ; Tan et al. 2000), and was recently shown to shuttle between nucleus and cytoplasma (Röther et al. 2010). In order to elucidate the process affected by Slf1p, we first investigated the cellular localization of Slf1p.

This was done under normal growth conditions and after inhibition of Mex67p- mediated mRNA export, a condition in which Sro9p was shown to accumulate in the nucleus. We therefore cloned TAP-tagged SLF1 into mex67-5 cells, which express a temperature-sensitive mutant of the general mRNA export factor Mex67-Mtr2. In these cells, mRNA export is blocked at non-permissive temperature (37°C) and poly(A) RNA accumulates in the nucleus (Segref et al. 1997). In contrast to Sro9p, which concentrates in the nucleus of mex67-5 cells at 37°C, Slf1p was localized to the cytoplasm at both temperatures (Figure 3.16). This is consistent with a report by

Sobel et al, which states that Slf1p is primarily cytoplasmic (Sobel and Wolin 1999).

Since Slf1p could not be detected in the nucleus and involvement of the protein in transcription is therefore unlikely, I performed two biological independent

RNA decay experiments with each wild-type or LAM-mutant SLF1 overexpressed in slf1∆ cells. I harvested cells at various time points after addition of 3µg/ml thiolutin, a transcriptional inhibitor shown to interact with all three eukaryotic RNA Polymerases

(Figure 3.17 A, Tipper 1973). RNA isolation from the different samples and subsequent qRT-PCR analysis revealed that in LAM-overexpressing cells, the

Figure 3.16: Slf1p is localized to the cytoplasm. (A) Immunostainings of TAP-tagged Slf1p and -Sro9p in wild-type (Mex67) and mex67 mutant cells (mex67-5). At non-permissive temperature (37°C) mRNA export in mex67-5 cells is blocked and Sro9p accumulates in the nucleus (white arrows point to the accumulated nuclear protein). Slf1p, in contrast, resides in the cytoplasm at both permissive (30°C) and non-permissive temperatures indicating that, unlike Sro9p, Slf1p does not shuttle between nucleus and cytoplasm. DNA was stained with DAPI.

Slf1p target RPL19b and the two non-targets PMA1 and NUP2 decayed with rates comparable to previously determined half-lives. However, in cells overexpressing wild-type SLF1, RPL19b decayed 1.4 fold less fast (t1/2(wt) = 16.9min, t1/2(LAM) =

11.7min; Figure 3.17 B). Even though this result was not statistically significant, difference between wild-type and mutant was much less pronounced for both PMA1

(t1/2(wt) = 38.5min, t1/2(LAM) = 34.7min) and NUP2 (t1/2(wt) = 31.5min, t1/2(LAM) =

27.7min), which decayed 1.1 fold less fast in wild-type overexpressing cells. In addition to RPL19b, I measured copper and oxidative stress-related targets.

However, this was more difficult since I observed for all mRNAs assayed an initial up-regulation after addition of thiolutin. This can be explained by the fact that thiolutin and other transcriptional inhibitors are known to impose drastic stress on cells, which prompts residual transcriptional activity to induce stress responses (Grigull et al.

2004). Therefore, genes implicated in oxidative stress response are prone to become transcriptionally up-regulated at early time points after thiolutin addition, before onset of decay. Nevertheless, I was able to determine the relative decay, i.e. the change in abundance over time between wild-type and mutant overexpressing cells, for two oxidative stress related-targets, SOL4 and MCR1. With time after thiolutin addition the difference between target-RNA levels in wild-type and mutant overexpressing cells grew bigger, indicating that wild-type Slfp1 stabilizes its mRNA targets. For both targets the effect was pronounced yet the resulting half-life changes were not statistically significant (Figure 3.17 B).

Thus, both stainings and decay experiments suggest that the Slf1p-mediated positive regulation of target mRNA steady-state levels arises from specific, RNA- binding dependent interference with RNA-decay. This is in agreement with the fact that we could not detect an association of Slf1p with chromatin as investigated in chromatin immunoprecipitation (CHIP) experiments (D. Meinel and K. Straesser, personal communication).

Figure 3.17: Slf1p stabilizes specific mRNA targets. (A) Scheme of RNA decay measurements. Transcription was halted by the addition of thiolutin to slf1∆ cells expressing either WT (pSLF1) or mutant (pLAM-m) Slf1 as a control. (B) Difference of remaining mRNA levels (pSLF1/pLAM-m expressing cells) of Slf1p targets (black) and non-targets (white) at various time points in minutes after thiolutin addition. Representative experiments are shown with standard deviations from three replicate measurements. Resulting half-lives for wildtype (black) and mutant (grey) overexpression are indicated.

3.2.3 Analysis of potential Slf1p-mediated effects on translation

It has previously been shown that Slf1p associates with ribosomes and that slf1

knock-out cells show increased sensitivity to certain translational inhibitors. I

confirmed the ribosome association and found that Slf1p target RNAs display high

ribosome occupancy (Figure 3.13 B and Figure 3.10). In addition, several Larps have

recently been implicated in translation (see introduction). Taken together, these data

indicate that Slf1p might play a role in specific or unspecific regulation of mRNA

translation. In order to investigate such a role, I employed a dual approach: on the

one hand, I performed immunoblot analysis of protein levels of Slf1p targets in slf1

knock-out or SLF1 overexpressing cells; on the other hand, I investigated the

distribution of target and non-target mRNAs in polysomal profiles of slf1 knock-out cells.

Since antibodies against yeast proteins are rather scarce, I could measure the levels of only two targets, Rpl35p and Ctr2p with antibodies developed against the endogenous proteins. For both proteins, I did not observe altered protein levels between wild-type and slf1∆ cells (Figure 3.18), indicating that Slf1p has no measurable effect on the translation of these two targets. Similar results were obtained for Cup1p, which I essayed in SLF1 overexpressing cells and measured protein levels of C-terminally TAP-tagged Cup1p. As described above, a potential regulation via the 3’ UTR of the Cup1 messages is not possible with these TAP- tagged protein versions. Moreover, I performed the same experiments under excess copper conditions and could not detect a change in protein levels either (data not shown). I observed a strong up-regulation of Cup1p upon copper addition, which is in

agreement with previous data and most likely reflects Ace1p-mediated transcriptional

regulation, however, no Slf1p-mediated effects.

In polysomal profile experiments, cell extract is applied to sucrose gradients

and ultracentrifuged similar to the sucrose cushion experiment described earlier

(Figure 3.13 A). Cellular components will settle according to their density and can be

analyzed after recovery of the different gradient fractions. During the whole process

of fractionation, rRNA levels are being monitored at 254 nm allowing for the

localization of ribosomal subunits, monosomes and polysomes in the gradient.

Subsequent qRT-PCR analysis of different fractions detects with how many

ribosomes a certain mRNA has sedimented. In two independent experiments I did not observe a difference between the profiles of wild-type and slf1∆ cells regarding

the amounts of polysomes formed, indicating that both cell types have functional

ribosomal apparatus available and that Slf1p is not required for the assembly of

ribosomes and polysomes (Figure 3.19 A). Also, qRT-PCR analysis of the recovered

RNA revealed no significant difference between target RNA distribution in wild-type

and mutant cells (Figure 3.19 B).

Since I could not detect altered mRNA distributions under steady-state

conditions, I repeated the experiments in high copper medium, as I reasoned that

Slf1p-mediated effects might only be visible under conditions when also the copper

phenotype becomes apparent, i.e. in elevated copper concentrations. However, also these conditions did not reveal differences in mRNA distribution in the profile (Figure

3.19 C). Nevertheless, I made the interesting observation that the targets HSP12,

SOL4, CUP1 and MCR1 shifted into the polysomal fractions as compared to non-

copper treated cells, indicating that they are translationally regulated in response to elevated copper concentrations. This has not been reported previously and might underscore a potential role of these targets in copper homeostasis. However, so far I have not directly compared non- versus copper treated cells, these data are therefore preliminary. Moreover, messages not associated with copper- and oxidative stress need to be analyzed to determine if these effects are specific.

In summary, these results suggest that Slf1p is not involved in translational regulation. However, it cannot be excluded at this point, that a potential role in translation could be measured in SLF1 overexpressing cells, which I am currently investigating.

Figure 3.18: Protein level analysis of targets in Slf1p depleted or overexpressing cells. Rpl35p (A) and Ctr2p (B) were measured in slf1∆ cells with antibodies directed against the endogenous protein. (C) TAP-tagged Cup1 levels were analyzed in SLF1 overexpressing cells using anti-PAP antibodies. Zwf1 served as loading control. Note: as described in the text, a potential Slf1p regulation via CUP1 3 ’UTR is not possible due to replacement of the UTR with the TAP sequence. WT: wild-type, ∆: slf1∆, v: vector.

Figure 3.19: Polysomal fractionation of wild-type and slf1∆ cells. Polysomal profile of wild-type (WT, left panel) and slf1∆ cells. Bottom panels: ethidium bromide stained agarose gel visualizing ribosomal RNA. (B) and (C) Polysomal distribution of Slf1p target mRNAs in wild-type (blue) and slf1∆ (violet) cells. Number of ribosomes are indicated at the top of the bars, see text for details. Cells were either grown in rich media (B) or in rich media supplemented with 4 mM CuSO4 (C). Mark that all targets shift into the polysomal fractions in response to copper treatment. Note: x-axis scaling for CUP1 and MCR1 were adjusted to get higher resolution.

3.3 Author’s contribution and affiliation

All experiments were performed by Luca Schenk1, 2 under the supervision of Dr.

André Gerber1 in the group of Prof. Dr. Detmar1, except for indirect immunofluorescence, which was performed by Dominik Meinel3 under the

supervision of Katja Sträßer3. The strains SLF1-TAP MEX67 and SLF1-TAP mex67-

5 were also produced by Dominik Meinel.

1 Institute of Pharmaceutical Sciences, Department of Chemistry and Applied

Biosciences, ETH Zürich, Zürich, Switzerland.

2 Ph.D. Program in Molecular Life Sciences, University and ETH Zürich, Zürich,

Switzerland.

3 Gene Center and Center for Integrated Protein Science Munich (CIPSM),

Department of Biochemistry, Ludwig-Maximilians-University Munich, Munich,

Germany.

4 Discussion

100

4.1 Overview

I have undertaken a global approach to study the roles of Slf1p and Sro9p in copper

physiology. Moreover, I elucidated the RNA binding potential of the ubiquitous and

highly conserved La motif in vivo. Both Slf1p and Sro9p contain no other annotated

domains and bind to largely overlapping sets of hundreds of RNAs almost

exclusively consisting of mRNAs. These transcripts code for functionally-related

proteins, among them are most mRNAs encoding ribosomal proteins and all

transcripts of histone genes. The observed RNA binding is in line with results from in

vitro binding assays suggesting that the RBP directly interacts with RNA. Mutational analysis of the LAM further revealed that the association with RNA is most likely mediated by the LAM, since residues previously shown to be crucial for terminal uridine recognition of non-coding RNAs by bona fide La are critical for mRNA binding

of Larps.

The data also demonstrate that the domain and thus presumably RNA

binding activity is crucial for Slf1p biology, since overexpression of LAM-mutant Slf1p

proved incapable of conferring increased copper resistance, as observed for the

wild-type protein. More detailed analysis of Slf1p target mRNAs revealed that the

protein associates with messages critical for the response to copper and oxidative

stress. In mRNA profiling experiments with SLF1 overexpressing cells I could show

that Slf1p positively affects the steady-state mRNA levels of this group and of other

functionally-related transcripts, in a LAM-dependent manner. Many of the changed

transcripts are potential Slf1p targets. Moreover, I could show that this effect is

presumably exerted by Slf1p-mediated specific protection of target messages from

RNA decay, which is consistent with the absence of Slf1p from nucleus as

101

determined by immunofluorescent staining. Consistently, I suggest that Slf1p

controls a posttranscriptional operon coordinating an integrated cellular response to

elevated copper concentrations.

4.2 The role of the LAM in mRNA binding

4.2.1 The La-motif: important for unspecific in vivo RNA binding?

Based on our in vivo study it could not be clearly determined whether LAM-mutated

Slf1p was indeed RNA-binding impaired or if the introduced mutations affected

critical interactions with potentially associated other RBPs, which might have

resulted in the observed RNA binding deficiency. However, the in vitro binding

experiments with isolated wild-type Slf1p showed that the protein is capable of direct

binding to target RNAs without the assistance of potential interacting partners.

Provided that is also the case in vivo, it strongly argues for a direct RNA binding

defect of the LAM-mutant, since mutated LAM profoundly impaired in vivo RNA binding. This would be in agreement with data from genuine La proteins, where these residues were shown to interact with RNA and not protein. Moreover, sucrose cushion centrifugation analysis indicated that both wild-type and mutant are capable of associating with ribosomes which further suggests that the altered residues are not important for protein-protein but protein-RNA interactions. In a next step, it will be

interesting to analyze the in vitro RNA binding potential of isolated LAM-mutant

Slf1p. This would clarify whether the mutant still possesses residual RNA binding

102

activity. Based on the notice that reliable CT-values were obtained for LAM-mutant

associated RNAs, this might be the case; however, qRT-PCR is a highly sensitive

method and these signals may well represent background noise. A non-RNA

binding protein such as Fpr1p would serve as a good negative control to address this

issue. However, the fact that I did not observe differences between wild-type and

mutant for the two non-targets (negative control) clearly speaks in favor of a serious

RNA-binding impairment of the mutant; in case it still associates with RNA, the

invariance between wild-type and mutant for non-targets would argue that the altered

residues are specificity determinants.

Surprisingly, I could not detect specific RNA binding of isolated recombinant

Slf1p in biotin pull-down experiments. This stands in contrast to our in vivo RNA

studiy where I reproducibly enriched for specific subsets of mRNA and demonstrated that distinct target preference is linked to RNA binding activity. There are several possible explanations for this observation: First, it might well be that the used C- terminal FLAG-6His tag of the protein interfered with specificity. Malfunction of

proteins due to fused tags is a common problem in biological research. It was

recently published that C-terminal hexahistidine tags, like I used in this study, can

impair enzymatic activity of tropinone reductases (Freydank et al. 2008). It can also

not be excluded that the protein was not properly folded due to the tag, which might

have lead to protein aggregation. Such aggregates are prone to unspecifically trap

RNAs within the formed protein clumps, however, aggregate forming proteins are

usually difficult to express. I did not encounter problems when I expressed Slf1p in

E.coli. Moreover, it is conceivable that the negative control RNA I used bore

elements in its structure or sequence that were recognized by Slf1p. Finally, it could

103

also be that the artificial in vitro conditions favored unspecific binding. Even though I

tested several conditions and different amounts of RNA, it might be, e.g., that the

protein RNA ratio was not optimal to detect specific but instead promoted unspecific binding. On the other hand, it possible that Slf1p indeed relies on interacting partners

in order to confer target-specific RNA binding. In this case, the fact that mutant Slf1p

did not bind RNA in vivo would suggest that the LAM mediates unspecific or partially

unspecific RNA binding as it has been reported for various RNA binding domains

such as the DEAD-box domains of RNA helicases or the widespread RRMs (Glisovic

et al. 2008). Such a model would be in agreement with the observation that the vast

majority of LAM-containing proteins contain other domains in addition to the LAM

(Bousquet-Antonelli and Deragon 2009), which might promote specific RNA binding

in association with the unspecific binding module La. It would also be in line with

several reports stating that C-terminal Larp regions of unknown function are involved

in RNA binding (O'Connor and Collins 2006; Nykamp et al. 2008). A detailed and

comprehensive in vitro study with differently tagged wild-type and LAM-mutant

versions of Slf1p would shed light on this matter.

4.2.2 Highly conserved residues mediate mRNA binding

The fact that Slf1p and Sro9p bind to messenger and not ncRNAs is

consistent with growing evidence that the majority of Larps is implicated in mRNA

metabolism. However, it is surprising regarding the fact that both yeast Larps

comprise the LAM as their sole domain. The LAM has been shown to be an

important factor in 3’ UUU-OH recognition and binding of RNPol III transcripts by La

104

proteins. In the case of Larps it has been speculated that motifs other than La could account for mRNA interactions or that the LAM uses yet undiscovered RNA binding surfaces for association with mRNA. The involvement of La proteins in translation of cellular and viral RNAs has been linked to the fact that nonphosphorylated, i.e. cytoplasmic La can recognize the 5’ GpppN cap of mRNAs (Bhattacharya et al.

2002). This could potentially inhibit cap-dependent translation and promote IRES- mediated translational initiation (Bayfield et al 2010). However, La binding to the oncogenic murine double minute mRNA (MDM2), which results in enhanced MDM2 translation, has been mapped to a 27nt long sequence just upstream of the start codon (Trotta et al. 2003). Our data suggest that Slf1p and Sro9p bind to their mRNA targets by means of the LAM, since mutations introduced in the motif drastically impaired association with target RNAs. Thus, it appears that the LAM has the potential to bind RNAs not ending in 3’ UUU-OH, which could help explain interactions reported between mRNA and both bona fide La proteins and Larps.

Our RIP-data of LAM-mutant Slf1p suggest that the mRNA-LAM interactions are at least partially mediated by the same residues that are crucial for 3’ UUU-OH -

LAM binding, namely by F22, F43 and Y11 (Figure 1B). In co-crystal structures of N- terminal domain of La, i.e. LAM and adjacent RRM, bound to different RNA oligos ending in 3’ UUU-OH, these residues were shown to make stacking interactions to the base and sugar of the last uridine (F22 and F43, respectively) and to hydrogen- bond to the phosphate group linking the preultimate and the last uridine (Y11,

Teplova et al. 2006; Kotik-Kogan et al. 2008). While these interactions were reported to be non-uridine specific and predicted to happen with other nucleotides as well,

Slf1p and Sro9p also comprise the two LAM residues shown to specifically recognize

105

3’ UUU-OH-ends, id est D20 and Q07 (Teplova et al. 2006; Kotik-Kogan et al. 2008).

Aspartic acid 20 was suggested to be the major factor recognizing 3’ OH-ends and discriminating against continuous stretches of RNA, since it hydrogen bonds to the 3’

OH and, importantly, because it does not allow for the presence of a 3’phosphate due to sterical hindrance. It could theoretically be that Slf1p and Sro9p bind to mRNAs at their 3’ end recognizing the 2’ OH of poly(A) tails; however, I consider this unlikely since Slf1p was shown to have very low affinity to homopolymeric adenine

RNA (Sobel and Wolin 1999) in vitro and since poly(A) tails are usually heavily occupied by cytoplasmic PABP (Mangus et al. 2003). Moreover, such an interaction would predict unspecific binding to poly(A) RNA and could not explain the observed

LAM-dependent specificity of Slf1p-mRNA binding. The fact that the yeast Larp-

LAMs presumably harbor mRNAs not ending in 3’ OH is also consistent with a very recent report on human Larp 4, where it was addressed in vitro whether the protein would show a preference for 3’ OH ends versus 3’ phosphates (Yang et al. 2010). hLarp 4 showed no difference in binding between the two. However, it was not addressed whether the reported RNA binding activity was mediated by the LAM or other domains. In order to shed light into the exact mechanisms of how the La-motif binds to mRNA molecules, the structure of such a complex would need to be solved.

Nevertheless, in this respect it is important to note previous data demonstrating that high affinity in vitro binding of La to 3’ oligo(U) RNAs needs the concerted action of both the LAM and the adjacent RRM (Goodier et al. 1997;

Ohndorf et al. 2001; Alfano et al. 2004; Dong et al. 2004). However, these data were challenged by the mentioned co-crystal structures as it was shown that the RRM forms only one specific hydrogen bond with the bound RNA. Moreover, the

106

structures revealed a surprising paucity of contacts restricting the spatial orientation of the RRM to both the LAM and the RNA. Therefore, given the various interactions detected between the LAM and the RNA, it was concluded that the LAM is the main

3’ UUU-OH specificity factor. In addition, the apparent lack of substantial protein-

RNA contacts between RRM and substrate lead to the assumption that the interplay between LAM and RRM is rather dynamic and that different LAM-containing proteins could accommodate distinct target RNAs based on the relative orientation of the

RRM to the LAM. Thus, it is possible that in the absence of a RRM, the La-motif employs a different mode of RNA binding as compared to the situation in bona fide

La proteins, using the conserved residues proven useful for RNA binding but not the ones specifically contacting the 3’ OH moiety of RNPol III transcript ends.

4.2.2 Do yeast Larps bind to uridine-rich structural motifs?

In both Slf1p and Sro9p Q7 is conserved, a major uridine-specificity conferring residue which hydrogen bonds to the O2 and O4 atoms of the pyrimidine of the preultimate uridine. It is therefore tempting to speculate that the two RBPs have a preference for uridine-containing RNA stretches. This would be in agreement with reports showing that both Slf1p and Sro9p, as well as the related CeLarp 1 are biased towards association with poly(U) over poly(A) and poly(C) RNA in vitro (Sobel and Wolin 1999; Nykamp et al. 2008). Indeed, in a search for potential (U)3 enrichment in the 3’ UTRs of Slf1p targets, I found that 90% of Slf1p-associated mRNAs contain at least one uridine triplet. However, I also detected (U)3 in 85% of

the non-target 3’ UTRs. Similar results were obtained for 5’ UTRs and (U)4 stretches.

107

It is conceivable that Slf1p and Sro9p bind to a subset of uridine-rich mRNAs, which

provides access to the poly(U) in the right secondary structure context. It is well-

known that many RBPs have preferences for both sequence-and structural

properties (Buckanovich and Darnell 1997; Hackermuller et al. 2005; Hiller et al.

2006). Vts1p for example, a protein involved in Okazaki fragment processing (Lee et

al. 2010), has high affinity to the CNGG motif; however, only if it is present within loops of RNA hairpins (Aviv et al. 2006). Moreover, a recent comprehensive study by

Hogan and coworkers, who determined the RNA targets of 40 RBPs, revealed that for half of the RBPs no sequence motif can be discovered applying standard sequence prediction algorithms. This is most likely due to the fact that these RBPs recognize RNA properties distinct from simple sequence motifs. Recognition of structural or partly structural RREs by yeast Larps would be in agreement with the fact that I could not detect a sequence motif using various strategies and motif prediction programs (such as MEME, data not shown). In order to uncover trans- acting elements among Slf1p and Sro9p targets, it would be promising to apply PAR-

Clip, a method which allows for simultaneous identification of RNA targets and - recognition elements (Hafner et al. 2010).

4.3 Slf1p functions in copper homeostasis

4.3.1 Slf1p positively affects the stability of target mRNAs

In a global search for changed steady-state levels of individual mRNAs upon SLF1

overexpression, I found that subgroups of mRNA were up-regulated which affiliate to

similar GO terms significantly overrepresented among Slf1p targets. Consistent with

108

this, I realized that mRNA abundance of targets was generally higher in SLF1

overexpressing cells and that this effect is potentially dosage-dependent, since

cellular Slf1p concentrations correlated with target mRNA levels. I also found a

substantial overlap between Slf1p targets and messages that were more than 1.5

fold up-regulated (199 out of 541 targets). I therefore consider it likely that the

observed steady-state changes are mediated by direct association of the RBP with

its target messages and are not brought about by secondary effects, such as

regulation of other RBPs or transcription factors that influence the mRNA levels of

similar functionally-related groups.

In a further analysis I addressed whether the changed mRNA levels are due

to transcriptional and / or mRNA stabilizing effects. Interestingly, it was previously

reported that Sro9p has a general effect on both transcription and stability of Poly(A)-

RNA (Tan et al. 2000). In mRNA export deficient cells we observed nuclear

accumulation of Sro9p, which is consistent with a previous report (Röther et al.

2010), but detected Slf1p exclusively in the cytoplasm. This is in accordance with earlier work by Sobel et al. demonstrating that Slf1p is cytoplasmic under standard conditions (Sobel and Wolin 1999). These experiments suggest that Slf1p may interfere with mRNA target decay, however, they cannot exclude the possibility that secondary, indirect transcriptional effects account for the changed target mRNA steady-state levels. A potential regulation of RNPol II transcripts, e.g., could influence RNPol II-mediated transcription and lead to mRNA up-regulation of certain or all mRNAs. As previously discussed, I found many transcripts encoding for RNPol

I subunits to be both associated with and up-regulated upon Slf1p overexpression.

However, in mRNA decay experiments I detected a slight but specific effect on target

109

mRNA half-lives upon Slf1p overexpression, indicating that Slf1p stabilizes its

targets. Moreover, I could show that the effect depends on a functional LAM, which I previously confirmed is required for RNA binding, even though it cannot be excluded that it mediates DNA binding, too. In line with a stabilizing role of Slf1p, our Chip experiments did not reveal an association of Slf1p with chromatin (Meinel &

Straesser, data not shown). In summary, I gathered several pieces of evidence suggesting that Slf1p plays neither direct nor indirect roles in RNPol II transcription but protects target mRNAs from degradation.

4.3.2 Slf1p might control a posttranscriptional operon important for copper detoxification

In accordance with previous work I found that overexpression of Slf1p leads to

increased resistance against elevated copper concentrations (Yu et al. 1996). In

addition, I showed that Slf1p is the only LAM-containing yeast protein that seems to

be implicated in copper metabolism. However, in contrast to the data published by

Yu et al. I could not confirm either the reported enhanced brownish coloration of SLF

overexpressing cells, which was suggested to result from the formation of copper

sulfide lattices on the cell wall, nor the hypersensitivity of slf1 knock-out cells to

excess copper concentrations. The latter could be due to strain background

differences, however, I tested three different slf1 knock-out strains and was not able

to reproduce this result (data not shown). Whilst Yu et al. did not show a direct

involvement of Slf1p in copper sulfide formation but deduced this role from indirect

hints, I could demonstrated that the Slf1p copper function depends on an intact LAM

110

which enables the protein to specifically associate with distinct mRNAs (Figure 3.12

C).

In agreement with previous work showing that SLF1 mRNA levels remain

invariant during changing copper concentrations (Yu et al. 1996), I did not find

changes of Slf1p levels upon copper addition to media. Unfortunately, our system did

not allow for measuring a potential SLF1-3’ UTR-mediated regulation as I used C-

terminally TAP-tagged Slf1p for our analysis, which is depleted of its endogenous 3’

UTR. Thus, in case Slf1p is postranscriptionally regulated trough cis-acting elements

in its 3’ UTR, I would not have been able to detect this. It remains elusive at this

point how or whether the suggested Slf1p-mediated response to toxic copper

concentrations is controlled at the molecular level. It is conceivable that there is no

cellular need for changed expression of Slf1p during copper stress since Slf1p

steady-state concentrations are sufficient for the cell to deal with excess copper.

However, it might well be that Slf1p is regulated postranslationally. Phosphorylation

is a prominent means to regulate the function of bona fide La proteins. They have

been shown to shuttle between nucleus and cytoplasm in a phosphorylation dependent manner and, thus, to be controlled by differential compartmentalization

(Bachmann et al. 1990; Intine et al. 2003). Interestingly, the phosida phosphorylation-site prediction program identified S42 of Slf1p as a potential site

(www.phosida.com). It will be interesting to further characterize this region in respect to a potential copper-regulation of Slf1p. Moreover, it is possible that Slf1p activity is regulated directly by copper binding, as it has been shown for the two copper- metabolism regulating transcription factors Ace1p and Mac1p, which are able to sense intracellular copper levels (Brown et al. 2002).

111

With regard to the obvious role of Slf1p in copper detoxification, I

systematically searched for target RNAs important for copper homeostasis and

compiled a list of all yeast genes annotated to be involved in copper metabolism and

/ or response to oxidative stress, which is one of the main causative effects for copper toxicity. In total I found 14 listed messages among the Slf1p targets, five of them were previously shown to be directly linked to or regulated by copper response mechanisms: ACE1, CUP1, HSP12, CTR2 and SOL4. Moreover, two of them, CUP1

and HSP12, are not associated with Sro9p (see also 4.3.3). Intriguingly, CUP1 and

ACE1 are the two main factors in copper protection, CUP1 encoding a metallotheionin sequestering intracellular copper and ACE1 coding for the copper-

sensing transcription factor regulating the expression of CUP1. In agreement with a mRNA stabilizing role of Slf1p all these targets code for proteins engaged in protective mechanisms against elevated copper concentration, with the possible exception of the poorly characterized copper transporter Ctr2p, which is believed to

mobilize vacuolar copper stores (Rees et al. 2004). Importantly, I did not find

association with any message critical in conditions of copper deprivation, such as

transcripts of the copper importers Ctr1p or Ctr3p, or MAC1, which controls transcription of several proteins engaged in copper uptake (see introduction). In addition to the reproducible association of copper and oxidative stress-relevant messages with Slf1p, I observed Slf1p-mediated, positive regulation of mRNA steady-states for many of these transcripts. In fact, 9 of the 14 listed Slf1p targets were more than 1.5 fold up-regulated on average in highly SLF1 overexpressing

cells; and mRNAs from the whole list of copper and oxidative stress related

messages were even more prominent among the medial 1.5-fold up-regulated

mRNAs (p < 0.0001) as compared to the targets (p = 0.045). A possible explanation

112

for this could be that our arbitrary cut-off settings were still too stringent to capture all physiologically relevant RNA-protein interactions. In follow-up experiments with

CUP1, HSP12, SOL4 and MCR1, I could confirm both mRNA association with Slf1p

(Figure 3.12) and RBP-mediated effects on transcript abundance (Figure 3.14), even if the effects on CUP1 message were milder as compared to the global mRNA profiling (2.5 fold versus 1.3 fold, p = 0.42). Since I used the LAM-mutant version of

Slf1p as negative control, I could conclude that the observed regulation is RNA

binding dependent.

Unexpectedly, in my experiments investigating a role of Slf1p in translation, it

appeared that the four Slf1p targets CUP1, HSP12, SOL4 and MCR1 were

translationally regulated upon copper addition. When comparing the polysomal

profiles between copper-treated and untreated cells, I observed a shift of the

messages from fractions with lower into fractions with higher ribosome occupancy.

Even though the indications are preliminary, they suggest that these messages are

more efficiently translated in conditions of high copper concentration. To my

knowledge, a copper induced translational regulation of these messages has not

been reported so far. This is of particular interest for MCR1, which encodes for the

mitochondrial NADH-cytochrome b5 reductase strongly implicated in response to

oxidative stress (Lee et al. 2001) but never shown to be directly regulated in

changing copper concentrations. The observation that these transcripts might

change to higher ribosome occupancy states in elevated copper concentrations

could provide further evidence that they play important roles in copper metabolism.

Translational regulation of mRNAs upon stress treatment has been well-

documented (Shenton et al. 2006; Halbeisen and Gerber 2009) and the observed

113

effect in response to elevated copper concentrations is in line with work published by

Shenton et al., who showed that peroxide-induced oxidative stress resulted in increased ribosome association of distinct subgroups of mRNA, including messages involved in ribosome biogenesis and ribosomal RNA processing. Interestingly, translation-associated GO terms have been extensively assigned to Slf1p-bound mRNAs. I found 39 out of 64 messages coding for the large (p < 0.0001) and 61 out of 98 coding the small ribosomal subunits (p < 0.0001). Moreover, also the GO term

“ribosome biogenesis” is significantly overrepresented among the targets (p = 0.02).

In addition to association of these groups of mRNAs with Slf1p I also detected Slf1p- mediated regulation. Transcripts coding for large and small subunits were significantly overrepresented among the messages that were than 1.5 fold up- regulated (p < 0.0001 for both groups). Moreover, the only for follow-up experiments selected representative of this group, RPL19b, appeared to have prolonged mRNA half-lives in Slf1p overexpressing cells. Thus, it seems that Slf1p binds and regulates mRNAs coding for molecules assembling and constituting the ribosomal apparatus, which might help the relief of copper-induced oxidative-stress damage caused to proteins involved in translation (Shenton et al. 2006).

The picture emerges that Slf1p specifically stabilizes mRNAs important during copper stress, including messages critical for translation. These Slf1p-protected mRNAs may represent pools of “translation-ready” transcripts relevant for cellular protection against toxic copper concentrations. In such a model, Slf1p acts upstream of factors that, depending on current copper concentrations, regulate the translation of mRNAs residing in these copper-protective RNA-pools. The fact that I did not find enhanced resistance of SLF1 overexpressing cells growing on cadmium plates

114

speaks in favor of the specificity of this copper detoxification system and is in agreement with the notion that there is no significant enrichment of mRNAs affiliated with GO terms describing cadmium homeostasis amongst Slf1p targets (table 2).

A Slf1p controlled posttranscriptional copper-response operon would be in analogy to a previously identified yeast RBP network triggering coordinated responses to iron deficiency. Puig et al. showed that under conditions of low iron, the

RBP Cth2 down regulates mRNAs encoding proteins that participate in iron- dependent processes, assuring that the availability of limited iron is optimized (Puig et al. 2005). Lately, this model was expanded by the discovery that Cth2p relocalizes to the nucleus during iron-deprivation where it associates with AU-rich elements of target RNAs and guides them to the cytoplasm for degradation (Vergara et al. 2010).

As a similar system has been conserved during evolution and is also present in humans, it will be interesting to determine whether Larp-regulated networks for protection against elevated copper concentrations are present in higher eukaryotes, especially since many other copper-homeostasis related mechanisms are common to yeast and humans. It generally appears that posttranscriptional control of cellular programs dealing with changing concentrations of transition metals are a widespread, yet poorly understood physiological phenomenon.

4.3.3 Differences between Sro9p and Slf1p regarding copper physiology

Slf1p and Sro9p are paralogs and show sequence similarity throughout their length.

Given that Sro9p plays no role in copper physiology, comparison of Sro9p-

115

associated RNA with Slf1p targets appears to be a valuable source to identify messages important for the copper detoxification role of Slf1p. I found five messages implicated in response to oxidative and copper stress to be exclusively associated with Slf1p: CUP1, HSP12,TRR2, URM1 and LOT6. As discussed, CUP1 and HSP12 were up-regulated more than 1.5 fold on average upon SLF1 overexpression.

Considering that both genes yield decreased resistance upon deletion (Thiele et al.

1987; van Bakel et al. 2005), an mRNA stabilizing effect of Slf1p could potentially explain the Slf1p copper phenotype. In this respect it would be interesting to test the outcome of SRO9 overexpression regarding mRNA levels of these messages.

However, such experiments are potentially hampered by the fact that SRO9 overexpression results in general up-regulation of poly(A)-RNA levels (Tan et al.

2000). Moreover, based on the notice that the function of Slf1p in copper homeostasis is dependent on the regulation of groups of messages rather than on control of individual transcripts (Figure 3.15), it might be difficult to discern the critical messages.

A major difference between Slf1p and Sro9p becomes evident when looking at engagement in transcription. Sro9p has recently been shown to shuttle between nucleus and cytoplasm and to associate with actively transcribed chromatin (Röther et al. 2010). In this project we investigated both nuclear localization of Slf1p (Figure

3.16) and association with chromatin (Dominik Meinel, personal communication).

Neither experiments pointed towards a role of Slf1p in transcription. Given the apparent involvement in distinct steps of the eukaryotic gene expression program, it is conceivable that the two paralogs have different effects on shared targets.

Similarly, it is possible that they interact with different proteins resulting in distinct

116

outcomes for associated targets. The translational repressor D.melanogaster Pumilio has been shown bind directly the mRNA encoding the voltage-gated sodium channel

Paralytic (Para). However, repression of para mRNA depends on the cofactor

Nanos, whereas the requirement for Brain Tumor (Brat) is cell type specific (Muraro

et al. 2008). Thus, the interaction partners of Pumilio are decisive for the fate of para

mRNA. In this respect it is important to note that the Saccharomyces Genome

Database (www.sgd.com) lists 65 physical interactions of proteins with Sro9p

whereas only 7 interaction have been reported with Slf1p (SGD, December 2010).

This points toward differential association of the paralogs with other proteins.

However, most of these data stem from large scale proteomics analysis where it was

not addressed whether the interactions are RNA-dependent or not.

Interestingly, SLF1 and SRO9 appear to be differentially regulated in

response to oxidative stress. In a genome-wide study Molina-Navarro and

colleagues determined both the transcription rate and mRNA steady-state changes

in response to hydroperoxide (Molina-Navarro et al. 2008). Whereas SRO9

remained unchanged, the abundance of SLF1 mRNA increased by two-fold

immediately after onset of treatment. SLF1 levels stayed high until 30 minutes after

oxidative stress was induced. Intriguingly, during the whole time the transcription rate

of SLF1 was unchanged, indicating that the increase in SLF1 mRNA concentrations

was induced by posttranscriptional regulation. In this regard, it appears even more

important to monitor Slf1p levels of endogenous or endogenous 3’ UTR containing

SLF1 in changing copper concentrations (see Figure 3.3). However, similar studies

analyzing alterations of mRNA levels in response to copper treatment did not reveal

changing SLF1 or SRO9 concentrations (van Bakel et al. 2005; Jin et al. 2008).

117

Interestingly, SRO9 levels were significantly changed after exposure to several other transition metals such as silver, zinc, mercury and arsenic, whereas SLF1 remained invariant. Thus, it appears that the two Larps share mRNA targets but are differentially regulated, which could help explain the distinct phenotypes of the paralogs.

4.3.4 An additional role of Slf1p in translation?

There are several indications that Slf1p might play a role in global or specific regulation of translation: Firstly, I and others have shown that the protein associates with polysomes (Sobel and Wolin 1999) and our sucrose cushion experiments demonstrated that this interaction is direct since also mRNA binding-impaired mutant

Slf1p sedimented with ribosomes. Secondly, Sobel et al found that slf1∆ cells are less sensitive to several drugs affecting translation and, thirdly, our Slf1p target analysis revealed that Slf1p-associated RNA is extensively occupied with ribosomes, indicating that Slf1p-targets are more efficiently translated than the average yeast mRNA. Moreover, Slf1p associates with many mRNAs encoding for ribosomal proteins or molecules important for protein assembly. In our polysomal profiling analysis I employed Slf1p depleted cells as I reasoned that knock-out cells constitute a better system to study polysomes since overexpression is known to impose stress on the protein synthesis machinery and therefore might negatively affect studies on translation (Sopko et al. 2006). However, it should be noted that I have never observed an effect of SLF1 knock-out on copper sensitivity, whereas overexpression yields drastic effects. In analogy, SLF1 overexpression results in a clearly

118

measurable up-regulation of target mRNA steady-state levels while my recent

analysis with slf1∆ strain revealed no difference on mRNA profiles (data not shown).

Thus, it appears that overexpression induces different physiological behavior as

compared to knock-out. Interestingly, similar results were obtained with the Slf1p

paralog: A study by Tan et al. demonstrated that overexpression of SRO9 results in a general up-regulation of poly(A)-RNA level whilst Röther et al. published that sro9∆ cells do not display altered mRNA levels as compared to wild-type cells (Kagami et al. 1997; Röther et al. 2010). There are several explanations possible for these effects, which I will discuss in the following section. Considering these differences between knock-out and overexpression it appears that studies on a potential role of

Slf1p in translation might give more valuable insights when conducted in an overexpression system. Indeed, in my current investigation with Slf1p overexpressing cells I have indications that Slf1p might affect translation. However, these results are preliminary and need to be confirmed in order to draw conclusions.

It is attractive to consider that Slf1p might not only protect its targets from decay, but also has a stimulating role on translation. This would be in accordance with the many reports suggesting functions for LAM-containing proteins in translation. A recent publication by Schaffler et al. showed that human Larp 4 enhances mRNA translation and interacts with both cytoplasmic PABP (as it was reported for drosophila Larp 1) and the receptor for activated C kinase 1 (Rack1), a protein known to associate with 40S ribosomal subunit (Schaffler et al. 2010;

Burrows et al. 2010). Due to these RNA-independent interactions, Larp 4 was suggested to help the circularization of actively translated mRNAs leading to

facilitated reloading of 3’ end-ribosomes back onto the 5’ UTR. Interestingly, also

119

Slf1p was shown to interact with both 5’- and 3’ end binding factors, namely with

Nab2p, the nuclear poly(A) binding protein which shuttles between nucleus and

cytoplasm (Anderson et al. 1993; Batisse et al. 2009), and the cap-binding protein eIF4E (Krogan et al. 2006). It is therefore tempting to speculate that Slf1p could act through a mechanism similar to Larp 4-enhanced translation. The fact that Slf1p targets are generally short in length would fit such a model, since short mRNAs could support circularization and facilitate a potential bridging of 3’ end binding proteins and initiating ribosomes. Therefore, future research will focus on the investigation of a potential role for Slf1p in mRNA translation.

4.3 Impeding redundancy of regulatory networks in RBP research

As alluded to above, I observed considerable differences during my studies on Slf1p

between experiments with overexpressing and Slf1p-depleted cells. It is conceivable

that pronounced discrepancies in the experimental outcome between overexpression

and knock-out are a common yet underappreciated theme in RBP research. Given

the high redundancy of posttranscriptional regulatory networks (Hogan et al, 2010) it

is reasonable to assume that, under standard laboratory conditions, certain

regulatory functions can be exerted by different RBPs without major consequences

for the cells. For example, it has been revealed that paralogous RBPs often share

common targets as demonstrated for Slf1p and Sro9p (present study) or for human

pumilio 1 and 2 (Galgano et al. 2008) and Pat1a and b (Marnef et al. 2010). The

120

resulting potential for redundant regulation might therefore be exploited by cellular

systems to correct for certain “disturbances”, such as changed levels of individual

RBPs, and adapt to the new situation by adjusting the impact of other regulators.

The achieved rebalancing of the system could easily lead to the dilution of effects associated with the RBP under investigation. Considering that the cellular adaption to an altered RBP concentration takes time, it is reasonable to assume that the effects of relatively short boosts of RBP overexpression are less prone to be washed out as compared to long-lasting or even permanent situations like knock-outs. In addition, it is likely that also the transcriptional system is adjusted with time, further obscuring possibly detectable functions of RBPs. Of note, such crosstalk between transcriptional and posttranscriptional regulation is not mutual. RBPs cannot easily compensate the lack of a specific transcription factor since their “working place”, the mRNA, might not be produced due to the much less pronounced redundancy of transcriptional networks. Therefore, knock-out is usually an effective means to study transcription factor function, possibly in contrast to research on RBPs. It might be a valuable project to systematically investigate the differences between overexpression and knock-out effects of RBPs with already known functions.

4.4 Concluding remarks

The appreciation of posttranscriptional gene regulation among the scientific

community has increased continuously during the last decade. Important discoveries

in the field of RBP and non-coding RNA research have shown that messenger RNAs

121

are more than simple “messengers” that deliver protein information to the place of

synthesis. They constitute an integral control entity of the gene expression program

which allows cells to quickly respond to environmental cues and efficiently shape the

proteome according to their momentary needs. The growing knowledge about roles

and functioning of RBPs and non-coding RNAs has also increased the awareness of

what might go wrong in the human disease state. However, despite recent advances, much remains elusive about the dense regulatory networks between DNA and protein.

In this work, the role of RBP-mediated regulation on copper physiology has been investigated. I found that the highly conserved and widely spread La motif can mediate mRNA binding, which stands in contrast to the interpretation of several co- crystal structures of the domain bound to terminal uridines of non-coding RNAs.

However, it is in line with growing evidence that both La and Larps associate with mRNAs. Importantly, it has also been shown that copper detoxification in

Saccharomyces Cerevisiae is not only controlled at the DNA level by transcription factors such as Ace1, but can be mediated by the RBP Slf1p. Mutations in the La motif drastically reduced both resistance to copper salt and the ability of Slf1p to specifically associate with mRNAs. Target RNA analysis revealed that Slf1p binds to several messages important for copper detoxification, including ACE1 and CUP1, the primary target of Ace1p. The work further showed that Slf1p positively affects target mRNA levels, presumably by protection from mRNA decay. This has lead to the model of a Slf1p-controlled posttranscriptional operon which coordinates responses to copper stress. In this model, Slf1p provides cells with “translation- ready” mRNAs coding for proteins important for copper detoxification.

122

To my knowledge, RBP-controlled copper physiology has not been described

before. However, considering the fact that both Slf1p and important copper detoxification factors have homologs in higher eukaryotes, it is conceivable that similar systems exists in humans. This would be important to investigate since

malfunctioning of copper homeostasis can lead to severe disorders such as

Alzheimer’s, Menke’s and Wilson disease.

123

124

5 Materials and methods

125

126

5.1 Yeast strains and media

TAP-tagged SLF1 (YDR515W), SRO9 (YCL037C), FPR1 (YNL135C) and CUP1

(YHR053C) cells (Ghaemmaghami et al. 2003), the isogenic wild-type strain BY4741

(MATα; his3∆1; leu2∆0; met15∆0; ura3∆0) and SLF1 deletion strain (slf1∆) were

obtained from Open Biosystems (Winzeler et al. 1999). Strains SRO9-TAP MEX67

and SRO9-TAP mex67-5 were described earlier (Röther et al. 2010) and strains

SLF1-TAP MEX67 (MATα; ura3-52; ade2-1; his3-11,15; leu2-3,112; trp1-1; SLF1-

TAP::TRP1-KL, mex67::HIS3; pUN100-MEX67) and SLF1-TAP mex67-5 (MATα;

ura3-52; ade2-1; his3-11,15; leu2-3,112; trp1-1; SLF1-TAP::TRP1-KL, mex67::HIS3;

pUN100-mex67-5) were obtained by integration of the TAP tag C-terminally of SLF1

into the genome of the MEX67 shuffle strain by homologous recombination

according to Puig et al. (Puig et al. 2001). After verification of correct insertion of the

TAP tag, the strain was transformed with plasmid pUN100-MEX67 or pUN100-

mex67-5. pRS316-MEX67 was shuffled out on FOA containing plates.

For an overview of the different strains and media used in the various

experiments see table 4. Three different growth media were used: synthetic

complete medium (SC, Sherman 2002), YPD (for non-transformed cells) and SC

medium lacking uracil (SC-Ura) and containing 3% galactose and 1% glucose (for

overexpression). Overexpression was induced for 24h, except for the cells used for

mRNA profiling of moderately overexpressing SLF1 cells which were induced for 6

hours (see below).

127

Experiment Figures Strains Medium RIP Chip 1 3.7 SLF1-TAP SC SRO9-TAP SC FPR1 -TAP SC

RIP Chip 2 3.12 slf1∆ + SLF1 SC -URA 3% Gal slf1∆ + La-m SC -URA 3% Gal sucrose cushion 3.13 SLF1-TAP SC slf1∆ + SLF1 SC -URA 3% Gal slf1∆ + La-m SC -URA 3% Gal phenotype studies 3.1/3.2/3.15 WT + vector SC -URA 3% Gal + different concentrations of CuSO4, CdCl2 or H2O2 WT + SLF1 SC -URA 3% Gal + different concentrations of CuSO4, CdCl2 or H2O2 WT + SRO9 SC -URA 3% Gal + different concentrations of CuSO4 WT + LHP1 SC -URA 3% Gal + different concentrations of CuSO4 WT + La-m SC -URA 3% Gal + different concentrations of CuSO4

SLF1 expression in high copper 3.3 SLF1-TAP YPD + different concentrations of CuSO4 mRNA profiling (microarray) 3.14 A WT + vector SC -URA 3% Gal WT + SLF1 SC -URA 3% Gal mRNA profiling (qPCR) 3.14 C slf1∆ + SLF1 SC -URA 3% Gal slf1∆ + La-m SC -URA 3% Gal

Indirect immunofluorescence 3.16 SLF1-TAP MEX67 SC SLF1-TAP mex67-5 SC SRO9-TAP MEX67 SC SRO9-TAP mex67-5 SC mRNA decay experiments 3.17 slf1∆ + SLF1 SC -URA 3% Gal slf1∆ + La-m SC -URA 3% Gal sucrose density fractination 3.19 WT YPD +/- 4 mM CuSO4 slf1∆ YPD +/- 4 mM CuSO4 immunoblots (Slf1p targets) 3.18 WT YPD slf1∆ YPD CUP1 -TAP + SLF1 SC -URA 3% Gal CUP1 -TAP + vector SC -URA 3% Gal

Table 4: Overview of media used in different experiments (see table 1 for abbreviations)

5.2 Plasmids

Plasmids pBG1805-SLF1, pBG1805-SRO9 and pBG1850-LHP1 for expression of C-

terminally hexa-histidine- (6His), hemagglutinin- (HA) and ZZ domain (ZZ) tagged

128

proteins under the control of a galactose inducible promoter (GAL1, Gelperin et al.

2005) were obtained from Open Biosystems. The plasmid containing the LAM- mutant version of SLF1 (pBG1805-Slf1-LAM-mut) was generated by subcloning the mutated part of the LAM (synthesized at Mr.Gene, see supplemental table S4 for sequence) into pBG1805-SLF1 via Eag1 and EcoR1 sites, replacing the wild-type sequence. The empty vector control plasmid pBG1805 was obtained by removal of the SLF1 CDS via BsrG1 sites. pBG1805-SLF1-LAM∆ was generated using overhang extension PCR: The primers shown in table S4 were used to amplify a N- and a C-terminal fragment of SLF1 (megaprimers) which bore complementary sequences at their C- and N-terminal ends, respectively (31 nt overhang). pBG1805-

SLF1 served as a template for the PCR reaction. Equimolar amounts of the gel- purified megaprimers were used in a 20 cycles PCR-reaction which gave rise to a

LAM-deleted version of SLF1 that lacks 153 nucleotides of the LAM (approx. 80% of the domain, corresponding to nucleotides 852-1002 of SLF1). After 20 PCR cycles, the flanking primers were added to the reaction which continued for additional 30 cycles. The obtained product was cloned into pBG1805 via BsrG1 sites and the correct sequence of SLF1-LAM∆ was verified by sequencing. pTRC-FLAG-SLF1-

6His for expression of Slf1p in E.coli was generated as follows: The CDS of SLF1 was amplified by PCR from genomic DNA with primers bearing Spe1 restriction sites. PCR products were gel-purified, cloned into pCR 2.1-TOPO vector (Invitrogen) and sequenced, which revealed the correct sequence. The CDS was excised and subcloned into E.coli expression vector pTRC-FLAG-6His (Gerber and Keller 1999) via Spe1 sites. The correct orientation of the insert was verified by restriction digest.

129

5.3 Phenotype studies

Slf1∆ or WT cells were transformed with either pBG1805 (control), pBG1805-SLF1, pBG1805-SLF1-LAM-mut, pBG1805-SRO9 or pBG1805-LHP1 and were grown over night in SC-Ura at 30°C. Cells equivalent to an optical density at 600 nm (OD600) of 1

were then serial diluted (1:10) and spotted onto SC-Ura Gal plates containing

different concentrations of CuSO4, H2O2 or CdCl2. Pictures were taken after 3-5 days.

5.4 RNA affinity isolations

Affinity purification of endogenously expressed Slf1-, Sro9- and Fpr1-TAP proteins

and of overexpressed wild-type and LAM-mutant Slf1-6His-HA-ZZ was carried out

essentially as described (Gerber et al. 2004). 1 liter cultures of cells expressing

SLF1-, SRO9- or FPR1-TAP (negative control), or overexpressing wild-type and

LAM-mutant Slf1-6His-HA-ZZ were grown to OD600 of 0.6-0.9 in SC or SC-Ura Gal,

respectively, at 30 °C. Cells were harvested by centrifugation, washed twice with 25 ml of ice cold buffer A (20 mM Tris-HCL[pH 8.0], 140 mM KCl, 20 mM EDTA, 0.1% nonidet P-40, 0.02 mg/ml heparin), snap-frozen in liquid nitrogen and stored at -80

°C. For mechanical lysis pellets were thawed on ice, resuspended in 5 ml of buffer B

(buffer A plus 0.5 mM DTT, 1 mM phenylmethanesulphonylfluoride (PMSF), 0.5

μg/ml leupeptin (Sigma, Cat#075K86034), 0.8 μg/ml pepstatin (Sigma, Cat#

085K8602), 20 U/ml DNase I [Roche Cat# 04-716-728 001], 50 U/ml RNasin

[Promega Cat# N2511], and 0.2 mg/ml heparin), glass beads were added and cells were put in a tissue lyser (Qiagen) for 12 min at 300 Hz and 4 °C. Supernatants were then sequentially centrifuged at 2,000 g, 12,000 g, and 16,000 g, each for 5 min and

130

at 4 °C. The extract volume was adjusted to 5 ml with buffer B and a 100 μl aliquot was removed for total RNA isolation. The rest was incubated with 400 μl of an equilibrated 50% (v/v) suspension of IgG-agarose beads (Sigma Cat# A2909) in buffer A, gently rotating for 2 h at 4 °C. Beads were washed once with 5 ml buffer B for 15 min, and three times with 12 ml buffer C (20 mM Tris-HCL[pH 8.0], 140 mM

KCl, 1.8 mM MgCl2, 10% glycerol, 0.5 mM DTT, 0.01% NP-40, 10 U/ml RNasin

[Promega Cat# N2511]) for 15 min with gentle rotation. Slf1-, Sro9- and Fpr1-TAP- elution: Beads were transferred to 1.2 ml micro-spin columns (BioRad Cat# 732-

6204) and centrifuged for 2 min at 6,000 g in a table-top centrifuge. The supernatant was removed and the beads resuspended in 450 µl of buffer C. TAP-tagged proteins were released from the beads by incubation with 80 U of acTEV protease (Invitrogen

Cat# 12575023) for 2 h at 16 °C. Wild-type and LAM-mutant Slf1-6His-HA-ZZ- elution: Beads were resuspended in 500 µl of SDS-EDTA solution (50 mM Tris-

HCL[pH 8.0], 140 mM KCl, 10 mM EDTA, 1% SDS) and heated at 65 °C for 10 min with strong agitation (1,400 Rpm). Suspension was transformed to 1.2 ml micro-spin columns (BioRad Cat# 732-6204), centrifuged for 4 min at 2000 g and the eluate was recovered. For both RIP-procedures, RNA from the extract (input) and from the affinity isolates was purified with the RNeasy Mini/Micro Kit (Qiagen).

5.5 DNA microarray analysis

Procession of yeast oligo microarrays and hybridization with fluorescently labeled

cDNAs was essentially performed as previously described (Halbeisen and Gerber

2009). In the presence of 5-(3-aminoallyl)-dUTP and natural dNTPs, 50% (~500 ng)

131

of affinity purified RNA and 5 µg of total RNA from the extract (input) were reverse transcribed with a mixture of N9 and dT20V primers. cDNA was covalently linked to

Cy3 (input RNA) and Cy5 (eluted RNA) NHS-monoesters (GE HealthSciences Cat#

RPN5661), and competitively hybridized to yeast oligo arrays at 42 °C for 14 hours in hybridization buffer (formamide-based). Microarrays were scanned with an

Axonscanner 4200, analyzed with GenePix Pro 5.1 (Molecular devices) and the data were deposited at the Stanford Microarray Database (Demeter et al. 2007). Log2 median ratios from three independent affinity isolations of each Slf1p, Sro9p and

Fpr1p were normalized and retrieved from SMD. After filtering for signal over background (> 2.5) in the channel measuring total RNA, the data was imported into

Microsoft Excel. To identify transcripts that were specifically enriched with either

Slf1p or Sro9p, I used t-test statistics and average log2-value filters: Features that had statistically significant differences in log2 ratios between Slf1p / Sro9p- and Fpr1

RIPs, an average log2 ratio > 0.6 in Slf1p- and / or Sro9p- RIPs and an average log2 ratio in Fpr1-RIPs < 0.2 were considered to be significantly enriched with Slf1p and / or Sro9p.

5.6 Sucrose cushion experiments

0.1 mg/ml cycloheximide (Sigma) was added to 100 ml of exponentially growing yeast cells (OD600 = 0.5-0.7) expressing TAP-tagged Slf1p or overexpressing wild- type and LAM-mutant Slf1-6His-HA-ZZ. They were washed in 10 ml of ice-cold buffer

A (20 mM Tris-HCL[pH 8.0], 140 mM KCl, 2 mM MgCl2, 1% Triton X-100, 0.2 mg/ml heparin, 0.1mg/ml cycloheximide) and pellets frozen in liquid nitrogen. Cells were

132

resuspended in 1 ml buffer B (buffer A plus 0.5 mM DTT, 1 mM PMSF, 0.5 μg/ml

leupeptin, 0.8 μg/ml pepstatin, 20 U/ml DNase I [Roche Cat# 04-716-728 001]).

Mechanical lysis was essentially performed as described above. 600 µl of extract

was layered over 2 ml of 0.5 M sucrose containing buffer B and ultracentrifuged at

100,000 Rpm for 90 min (4°C). Supernatants and pellets (resuspended in 200 µl of

1x Lämmli-buffer) were analyzed in western blots.

5.7 Expression of FLAG-Slf1-6His in E. coli

E. coli strain BL-21 (DE3) bearing the plasmid pTRC-FLAG-SLF1-6His was grown to

mid-log phase in 2YT medium supplemented with 100 µg/ml ampicillin (Sigma) at

37°C. Expression of the tagged protein was induced by the addition of 1 mM

isopropyl-thiogalactopyranosid (IPTG, Sigma) for 2.5 h at 30°C before cells were

harvested and the pellet was frozen in liquid nitrogen. Cells were resuspended in

100 ml of ice-cold GTK buffer (50 mM Tris-HCL[pH 8.0], 150 mM NaCl, 0.1 M MgCl2,

0.01% nonidet P-40, 10% glycerol, 1 mM PMSF, 0.5 μg/ml leupeptin, 0.8 μg/ml pepstatin, 20 U/ml DNase I [Roche Cat# 04-716-728 001]) and lysed on ice using a sonicator (4×25 sec, 40% power). 1 ml of equilibrated 50% slurry Ni-Sepharose beads (GE Healthcare, Cat#17-5318-06) was added to cleared extract. The suspension was incubated for 1 h at 4°C and loaded onto a 1 cm diameter glass

column (Biorad). After two washing steps with 25 ml of GTK buffer containing 5 mM

and 10 mM of imidazol, respectively, the protein was eluted in ten 1.5 ml fractions

with 250 mM of imidazol.

133

5.8 Biotin pull-down experiments

DNA templates for biotin-RNA synthesis were prepared by PCR from S. cerevisiae genomic DNA with oligonucleotides bearing a T7 RNA polymerase promotor sequence at their 5’ ends (For primer sequences see table S4). The templates comprised the complete CDS and approximately 200 bp up- and 300 bp downstream sequences. Biotin-labeled RNA was prepared with the Biotin RNA Labeling Mix

(Roche Cat# 11685597910) and T7 RNA polymerase (Promega Cat# P2075). The bitotinylated transcripts were treated with RNase-free DNase I and purified with

RNeasy Mini columns (Qiagen). RNA integrity was controlled by agarose gel

electrophoresis and quantity was determined by UV-spectrometry with a Nanodrop

device (Witek). Biotinylated negative control RNA was available in the laboratory and

consisted of partial drosophila PARA CDS.

Pull-down experiments were performed essentially as described (Gerber et

al. 2006). 4 pmol of biotinylated RNAs were combined with 10 ng/ul of recombinant

Slf1p in IP-buffer (20 mM Tris-HCl [pH=8.0], 100 mM NaCl, 2 mM MgCl2, 5%

glycerol, 1 mM EDTA [pH=8.0], 0.1% Triton X-100, 1 mg/ml BSA, 0.1 mg/ml heparin,

0.1 mg/ml E. coli tRNA, 1 mM DTT, 1 mM PMSF, 1 μg/ml leupeptin, 0.8 μg/ml pepstatin, 40 Units/ml RNasin (Promega, Cat# N261A)). Streptavidin-captured RNA- protein complexes were resolved by SDS polyacrylamide gel electrophoresis and visualized by immunoblot analysis using anti-His antibodies.

134

5.9 Sucrose density fractionation

Cells were grown, harvested and lysed as described above (see 5.6). 10 to 50% sucrose gradients were prepared in buffer A without Triton X-100 and 0.7 ml of

extract was loaded on top. Samples were centrifuged in a Beckman SW-41 rotor for

160 min at 35,000 Rpm and 4°C, and fractionated. During fractionation the

absorbance at 254 nm (A254) was continuously recorded with a flow cell UV detector

(ISCO). Eleven 900 µl fractions were collected for each experiment. 50 ng LysA RNA

(Bacillus subtilis, Wang et al. 2002) was added to 100 µl of each fraction, and total

RNA was isolated with RNeasy Mini columns (Qiagen) including on-column DNase I

digestion. Total RNA was then precipitated with 1.5 M LiCl and washed with ethanol

to remove residual heparin.

5.10 Immunoblot analysis

SDS-polyacrylamide gel electrophoresis (PAGE) separated proteins were transferred

to nitrocellulose membranes (BioRad) with a semi-dry electrophoretic transfer cell

(BioRad). Membranes were blocked in phosphate-buffered saline-0.05% Tween-20

(PBST) containing 5% low fat milk and probed with designated antibodies. After

incubation with horse radish peroxidase (HRP)-coupled secondary antibodies blots

were developed with the ECL Plus Western Blotting Detection System (Amersham).

The following antibodies were applied (dilution indicated in brackets): peroxidase

anti-peroxidase soluble complex (PAP) reagent (Sigma; 1:5,000) for detection of the

ZZ-tag, rabbit anti-Rps3p (1:100,000), rabbit anti-Zwf1p (Sigma, 1:5,000), rabbit anti-

Rpl35p (1:20,000), rabbit anti-Ctr2p (1:500) and rabbit anti-His antibodies (1:1000;

135

Qiagen Cat#34660). Bands on membranes were quantified with Quantity One software (BioRad).

5.11 Indirect immunofluorescence

The subcellular localization of Slf1p and Sro9p under conditions where mRNA export

is inhibited was analyzed using strains SLF1-TAP MEX67, SLF1-TAP mex67-5,

SRO9-TAP MEX67 and SRO9-TAP mex67-5 by indirect immunofluorescence

according to Röther et al. (Röther et al. 2010). DAPI and fluorescent staining were

analyzed using a Leica DMI6000B fluorescence microscope (Leica).

5.12 mRNA steady-state measurements

BY4741 or BY4741slf∆ cells bearing plasmid pBG1805-SLF1, pBG1805-LAM-mut,

or the empty plasmid pBG1805 were grown in 100 ml SC-Ura 3% galactose at 30 °C for 24 hours or for 6 hours (low SLF1 overexpression). The morning before

harvesting, cells were set to OD600 = 0.1 and grown to an OD600 of 0.5 - 0.7 in 60 ml

medium. They were harvested by centrifugation and washed twice with 600 µl of

bidistilled water (ddH2O). 200 ul were used for hot phenol isolation of RNA, which

was subjected to microarray- or qRT-PCR analysis (Kohrer and Domdey 1991). The

residual cells (400 µl) were used for western blot analysis to check for proper

expression of wild-type or mutant Slf1p. The extracts were frozen in liquid nitrogen

and stored at -80 °C. Two biological replicates each were performed for both high and low SLF1 overexpression profiling. Microarray analysis was conducted as

136

follows: 7.5 µg of total RNA isolated from the corresponding cells were reverse-

transcribed, labeled with Cy3 (empty vector) and Cy5 (wild-type), hybridized to

arrays and signals were analyzed with GenePix Pro 5.1 and Acuity 4.0 software

(Molecular devices). Log2 median ratios from two biological replicates each (high

and low SLF1 overexpression) were filtered for regression correlation < 0.5 and

signal over background > 2.5 in both channels.

5.13 mRNA decay experiments

mRNA levels of target and non-target messages in wild-type and LAM-mutant Slf1-

6His-HA-ZZ overexpressing cells (100 ml) were determined by qRT-PCR at various

time points (see Figure 3.17) after addition of 3 µg/ml thiolutin to exponentially

growing cells (OD600 = 0.5-0.7). RNA was isolated from the different samples (5 ml)

with hot-phenol. Target and non-target mRNAs were normalized to 21S ribosomal

RNA and exponential decay curves were fit to points (Excel) representing the means of two biological replicates. Half-lives were calculated based on the equations

describing these best-fit curves.

5.14 SYBR green real-time RT-PCR analysis

Reverse transcription was performed with High-Capacity cDNA Reverse

Transcription Kit (Applied Biosystem) using 3 - 10 ng of affinity purified RNA, 50 ng

RNA isolated from extracts (mRNA steady-state measurements and decay-

experiments) and 5 - 500 ng RNA recovered from fractions of the sucrose density

137

gradients. qRT-PCR was performed with the SYBR Green PCR Master Mix (Applied

Biosystems) in an Applied Biosystems 7900HT fast real-time PCR system. The sequences of the specific primers used can be found in supplemental table S4. The following temperature program was applied: 50 °C for 2 min; 95 °C for 15 min; 35 cycles of the sequence 95 °C for 15 s; 58 °C for 1 min. Ct-values were normalized to

21S ribosomal RNA or to the LysA control RNA (LYSA) that was added to each fraction from polysomal gradients. Fold changes and standard deviations were calculated according to the ∆∆ct method. T-tests were performed using ∆ct -values.

5.15 Bioinformatics tools and data processing

Multiple alignments of Slf1p and Sro9p with Larp 1- and genuine La representatives were performed using COBALT (NCBI), with full sequences downloaded from the

Saccharomyces Genome Database (SGD).

Significantly enriched Gene ontology (GO) terms among target RNAs (RIPs) and more than 1.5 fold up-regulated mRNAs in the mRNA profiling experiments

(average of 2 biological replicates) were identified with the GO term finder at SGD

(version October 2010) considering all SGD annotated gene sets as background.

The list of genes implicated in response to copper- and oxidative stress was compiled by downloading all genes affiliated with the GO terms “copper ion binding, response to copper ion, cellular copper ion homeostasis, copper ion import, copper ion transport, cellular response to oxidative stress” and “pentose-phosphate shunt, oxidative branch” (see supplemental table S2). Significant overrepresentation of messages affiliated with this list and with the GO term “response to copper ion” was

138

determined applying Fisher exact test using all coding (RIPs) or all coding and non- coding genes (mRNA profiling) for which I obtained reliable measurements as background.

139

140

6 Supplemental data

141

142

Supplemental table S1: Slf1p and Sro9p target list

Filtering criteria were p-value < 0.05 (t-test); average log2 ratios of RNA enrichment (RBP) > 0.6; average log2 of RNA enrichment (Fpr1p) < 0.2. Oligo ID: Feature name on array, Slf1p / Sro9p / Fpr1p: average log2 ratios of three biological replicates. Cu/Ox: Copper and oxidative stress related mRNAs.

Slf1p Sro9p Oligo ID Name Slf1p Sro9p Fpr1p p(Slf1) p(Sro9) target target Cu/Ox YHR053C_01 CUP1‐1 0.87 0.26 ‐0.08 0 0.33 yes ‐ yes YFL014W_01 HSP12 0.87 ‐0.16 ‐0.23 0 0.88 yes ‐ yes YLR011W_01 LOT6 0.73 0.38 ‐0.77 0.01 0.04 yes ‐ yes YHR106W_01 TRR2 0.83 0.13 ‐0.87 0 0.02 yes ‐ yes YIL008W_01 URM1 0.62 0.33 ‐0.41 0 0.16 yes ‐ yes YNL141W_01 AAH1 0.71 0.27 ‐0.13 0 0.06 yes ‐ - YCR082W_01 AHC2 0.76 0.45 ‐1.21 0 0 yes ‐ - YJL122W_01 ALB1 0.95 ‐0.18 ‐0.03 0 0.82 yes ‐ - YBR149W_01 ARA1 0.6 0.5 ‐0.09 0.02 0.12 yes ‐ - YLR157C_01 ASP3‐2 0.6 ‐0.78 ‐0.61 0 0.73 yes ‐ - YLR431C_01 ATG23 0.95 0.4 ‐0.19 0.01 0.19 yes ‐ - YNR002C_01 ATO2 0.92 0.34 0 0.02 0.23 yes ‐ - YML081CA01 ATP18 0.64 0.44 ‐0.72 0.02 0 yes ‐ - YML077W_01 BET5 0.61 0.54 ‐1.05 0.03 0.01 yes ‐ - YNL269W_01 BSC4 1.64 0.22 ‐0.33 0 0.21 yes ‐ - YNR027W_01 BUD17 1.18 0.17 ‐0.24 0.01 0.14 yes ‐ - YDL099W_01 BUG1 0.67 0.27 ‐0.04 0.01 0 yes ‐ - YBOX_INT1000035 CDC21 0.7 ‐0.06 ‐0.39 0.02 0.14 yes ‐ - YBOX_AAA1000015 CIS3 0.67 0.58 ‐0.5 0 0 yes ‐ - YGR120C_01 COG2 0.81 0.43 ‐0.4 0.02 0.07 yes ‐ - YBOX_AAA1000038 COX14 0.62 ‐0.22 ‐0.24 0.04 0.95 yes ‐ - YLR216C_01 CPR6 0.86 0.48 0.11 0.01 0.3 yes ‐ - YNL130C_01 CPT1 0.63 0.45 0.17 0.04 0.46 yes ‐ - YDR016C_01 DAD1 0.64 0.49 ‐0.66 0.05 0.09 yes ‐ - YPL266W_01 DIM1 0.91 0.3 ‐0.05 0.03 0.51 yes ‐ - YDR284C_01 DPP1 0.83 0.36 ‐0.38 0 0.01 yes ‐ - YKR004C_01 ECM9 0.61 ‐0.35 ‐0.82 0.01 0.02 yes ‐ - YOL071W_01 EMI5 0.65 0.41 ‐0.6 0.02 0.04 yes ‐ - YBL040C_01 ERD2 0.83 0.38 ‐0.55 0.01 0.04 yes ‐ - YFR041C_01 ERJ5 0.67 0.38 ‐0.21 0.03 0 yes ‐ - YHR110W_01 ERP5 1.02 0.76 ‐0.14 0.02 0.09 yes ‐ - YBOX_JXN1000052 ERV1 1.35 1.1 0.07 0.05 0.2 yes ‐ - YBR210W_01 ERV15 1.13 0.88 ‐0.08 0.03 0.11 yes ‐ - YER183C_01 FAU1 0.9 0.36 ‐0.45 0.02 0.05 yes ‐ - YIL098C_01 FMC1 0.97 0.18 ‐0.48 0 0.2 yes ‐ - YKR049C_01 FMP46 1.03 0.82 ‐0.33 0.01 0.06 yes ‐ - YOR280C_01 FSH3 0.87 0.51 ‐0.19 0.03 0.03 yes ‐ - YKR026C_01 GCN3 0.91 0.27 ‐0.46 0 0.08 yes ‐ - YBOX_AAA1000111 GCN4 0.72 ‐0.22 ‐1.02 0 0.01 yes ‐ - YNL038W_01 GPI15 1 0.2 ‐0.51 0.03 0.05 yes ‐ - YBR010W_01 HHT1 1.15 1.12 ‐0.31 0 0.01 yes ‐ - YDR174W_01 HMO1 0.75 0.91 ‐0.01 0.01 0.08 yes ‐ - YCR097W_01 HMRA1 0.64 ‐0.5 ‐1.05 0 0.35 yes ‐ - YKL084W_01 HOT13 0.93 0.13 ‐0.47 0 0.22 yes ‐ - YBR072W_01 HSP26 0.72 0.48 ‐0.26 0.01 0.14 yes ‐ - YBOX_OCH1000136 HTA1 1.1 0.46 ‐0.72 0 0 yes ‐ - YBL003C_01 HTA2 1.46 0.75 ‐0.02 0 0.06 yes ‐ - YBL002W_01 HTB2 1.35 0.46 0.03 0 0.03 yes ‐ - YMR195W_01 ICY1 0.61 0.45 ‐0.94 0 0 yes ‐ - YOR189W_01 IES4 1.19 0.72 ‐0.3 0 0.05 yes ‐ - YER092W_01 IES5 0.81 ‐0.02 ‐0.85 0.01 0.13 yes ‐ - YJR118C_01 ILM1 0.95 0.6 ‐0.11 0.01 0.13 yes ‐ - YBR107C_01 IML3 0.79 0.39 ‐0.2 0.02 0.14 yes ‐ - YHR148W_01 IMP3 0.72 ‐0.12 ‐0.63 0 0.06 yes ‐ -

143

YER112W_01 LSM4 0.87 0.93 ‐0.36 0.04 0.05 yes ‐ - YNR017W_01 MAS6 0.81 0.61 0.18 0.02 0.14 yes ‐ - YPR046W_01 MCM16 0.61 0.03 ‐0.91 0.02 0 yes ‐ - YLR017W_01 MEU1 0.75 0.52 0.03 0.04 0.28 yes ‐ - YKL138C_01 MRPL31 0.67 0.56 ‐0.08 0 0.18 yes ‐ - YML009C_01 MRPL39 0.76 0.47 ‐0.42 0 0.05 yes ‐ - YBOX_OCH1000100 MRPL44 0.6 0.42 ‐0.3 0.02 0.06 yes ‐ - YHR147C_01 MRPL6 0.89 0.55 ‐0.45 0.02 0.05 yes ‐ - YGR220C_01 MRPL9 0.89 0.57 ‐0.21 0 0.01 yes ‐ - YNL063W_01 MTQ1 0.62 0.55 ‐0.39 0.01 0 yes ‐ - YMR069W_01 NAT4 0.74 0.57 ‐0.25 0.01 0.02 yes ‐ - YLR254C_01 NDL1 0.73 0.22 ‐0.71 0.01 0.26 yes ‐ - YBR089CA01 NHP6B 1.22 1 0.16 0 0.06 yes ‐ - YJR112W_01 NNF1 1.3 0.5 0.02 0.04 0.28 yes ‐ - YBOX_IGR1000005 no name 1 0.95 ‐0.36 0.01 0.08 yes ‐ - YBOX_IGR1000081 no name 1.04 0.44 0.14 0.02 0.15 yes ‐ - YDL213C_01 NOP6 0.76 0.55 ‐0.58 0 0 yes ‐ - YBR188C_01 NTC20 0.95 0.12 ‐0.33 0 0.31 yes ‐ - YER009W_01 NTF2 0.74 0.09 ‐1.03 0 0.05 yes ‐ - YNL056W_01 OCA2 1.03 0.35 ‐0.48 0 0.03 yes ‐ - YBOX_ONO1000069 PCC1 0.6 0.24 ‐0.94 0.01 0.05 yes ‐ - YGL134W_01 PCL10 0.66 0.26 ‐0.23 0.03 0.08 yes ‐ - YGR222W_01 PET54 0.85 0.49 ‐0.4 0 0 yes ‐ - YGR004W_01 PEX31 0.61 ‐0.01 ‐0.59 0.01 0 yes ‐ - YDR459C_01 PFA5 0.7 0.23 ‐0.31 0.03 0.13 yes ‐ - YOR281C_01 PLP2 0.65 0.4 ‐0.74 0 0 yes ‐ - YCR024CA01 PMP1 0.92 0 ‐0.15 0.02 0.64 yes ‐ - YBOX_JXN1000059 PRE3 0.96 0.75 ‐0.2 0.01 0.21 yes ‐ - YGR169C_01 PUS6 0.92 0.21 ‐0.35 0 0.01 yes ‐ - YLR204W_01 QRI5 1.01 0.76 ‐0.38 0 0.08 yes ‐ - YMR022W_01 QRI8 1.19 0.07 ‐1.79 0.01 0 yes ‐ - YGR258C_01 RAD2 0.64 0.28 ‐0.22 0.03 0.08 yes ‐ - YML011C_01 RAD33 0.95 0.34 ‐0.45 0 0.02 yes ‐ - YOR265W_01 RBL2 0.98 0.54 ‐0.46 0 0.01 yes ‐ - YCR027C_01 RHB1 0.75 ‐0.01 ‐0.22 0 0.62 yes ‐ - YLR154C_01 RNH203 0.84 0.05 ‐0.7 0 0.03 yes ‐ - YJR063W_01 RPA12 0.68 0.37 ‐0.38 0.01 0.14 yes ‐ - YDR156W_01 RPA14 0.75 0.52 ‐0.62 0.01 0.19 yes ‐ - YNL113W_01 RPC19 0.7 0.09 ‐0.69 0.02 0.21 yes ‐ - YKL144C_01 RPC25 1.01 0.07 ‐0.22 0.02 0.36 yes ‐ - YHL001W_01 RPL14B 1 0.77 ‐0.06 0 0.01 yes ‐ - YNL069C_01 RPL16B 0.99 1.74 ‐0.26 0 0 yes ‐ - YPL079W_01 RPL21B 0.77 0.93 ‐0.54 0.01 0.02 yes ‐ - YBOX_OCH1000186 RPL23B 0.71 0.11 ‐0.93 0 0.07 yes ‐ - YBOX_OCH1000195 RPL33B 0.68 0.02 ‐0.78 0.01 0.03 yes ‐ - YER056CA01 RPL34A 1.25 1.11 ‐0.26 0 0.01 yes ‐ - YBOX_OCH1000131 RPL35A 0.82 0.45 ‐1.32 0 0 yes ‐ - YBOX_OCH1000224 RPL35B 0.79 0.57 ‐1.08 0 0 yes ‐ - YBOX_OCH1000099 RPL36A 0.78 0.57 ‐0.42 0 0.03 yes ‐ - YLR185W_01 RPL37A 1.56 0.75 ‐0.41 0 0.02 yes ‐ - YBOX_OCH1000161 RPL40B 0.92 0.55 ‐1.47 0 0 yes ‐ - YBOX_OCH1000225 RPL41A 1.22 0.59 ‐0.94 0 0 yes ‐ - YBOX_OCH1000223 RPL41B 0.7 ‐0.35 ‐1.31 0 0.28 yes ‐ - YHR141C_01 RPL42B 0.74 1.68 ‐1 0 0 yes ‐ - YNL067W_01 RPL9B 0.73 0.54 ‐0.65 0 0.03 yes ‐ - YDL130W_01 RPP1B 0.68 0.43 ‐0.3 0 0.02 yes ‐ - YGR214W_01 RPS0A 1.34 1.12 0.03 0.02 0 yes ‐ - YBOX_OCH1000179 RPS10A 0.94 0.6 ‐1.26 0 0 yes ‐ - YBOX_INT1000183 RPS14B 0.69 0.19 0.18 0.02 0.94 yes ‐ - YBOX_OCH1000191 RPS17A 1.05 0.28 ‐0.94 0 0.1 yes ‐ - YBOX_OCH1000137 RPS17B 1.06 0.47 ‐1.28 0 0 yes ‐ - YBOX_OCH1000096 RPS1B 0.98 0.29 ‐0.58 0 0.14 yes ‐ - YBOX_OCH1000140 RPS24A 1.16 0.6 ‐1.35 0 0 yes ‐ - YGL189C_01 RPS26A 1.2 0.96 ‐0.34 0 0 yes ‐ - YER131W_01 RPS26B 1.2 1.31 0.19 0 0.01 yes ‐ - YOR167C_01 RPS28A 0.7 0.58 ‐0.47 0.01 0.05 yes ‐ - YBL072C_01 RPS8A 1.5 1.36 ‐0.4 0.01 0.06 yes ‐ -

144

YBR189W_01 RPS9B 0.92 0.6 ‐0.3 0 0.07 yes ‐ - YIL153W_01 RRD1 0.72 0.45 ‐0.39 0.03 0.02 yes ‐ - YPL152W_01 RRD2 0.82 0.25 ‐0.26 0.01 0.07 yes ‐ - YCR035C_01 RRP43 0.6 ‐0.09 ‐0.94 0.01 0.06 yes ‐ - YGR215W_01 RSM27 0.66 0.23 ‐0.69 0.01 0.06 yes ‐ - YBOX_JXN1000034 RUB1 0.63 0.18 ‐0.94 0 0 yes ‐ - YDL076C_01 RXT3 0.65 0.33 ‐0.32 0.01 0.03 yes ‐ - YBL091CA01 SCS22 0.93 0.87 ‐0.42 0 0.1 yes ‐ - YLR268W_01 SEC22 0.65 0.09 ‐0.51 0.01 0.45 yes ‐ - YLR105C_01 SEN2 0.89 0.3 ‐0.5 0 0.06 yes ‐ - YDL168W_01 SFA1 0.61 0.58 ‐0.52 0 0.01 yes ‐ - YKL122C_01 SRP21 0.74 0 ‐0.6 0.01 0.04 yes ‐ - YBOX_ONO1000130 SUS1 0.85 ‐0.07 ‐0.39 0.01 0.27 yes ‐ - YGL243W_01 TAD1 0.83 ‐0.37 ‐0.96 0 0.29 yes ‐ - YGL232W_01 TAN1 0.69 0.45 ‐0.7 0.01 0.09 yes ‐ - YGR024C_01 THG1 0.92 0.56 ‐0.55 0 0.01 yes ‐ - YJR135WA01 TIM8 0.84 0.57 ‐0.39 0.02 0.09 yes ‐ - YEL020WA01 TIM9 0.74 0.22 ‐0.52 0.01 0.06 yes ‐ - YPR040W_01 TIP41 0.64 0.59 ‐0.42 0.01 0 yes ‐ - YDR468C_01 TLG1 0.74 0.23 ‐0.56 0 0.1 yes ‐ - YLR327C_01 TMA10 0.63 ‐0.35 ‐0.48 0 0.75 yes ‐ - YNL131W_01 TOM22 1 0.67 0.19 0.02 0.1 yes ‐ - YDR246W_01 TRS23 0.79 0.47 ‐0.63 0 0 yes ‐ - YOR115C_01 TRS33 0.77 0.35 ‐0.45 0.01 0.06 yes ‐ - YMR071C_01 TVP18 0.86 0.68 ‐0.18 0.04 0.08 yes ‐ - YGR019W_01 UGA1 0.85 0.51 ‐0.08 0.01 0.02 yes ‐ - YBOX_OCH1000052 VEL1 0.96 0.59 ‐0.14 0 0.07 yes ‐ - YHR060W_01 VMA22 0.66 0.43 ‐0.67 0.03 0.02 yes ‐ - YGR020C_01 VMA7 1.31 0.76 ‐0.05 0 0.05 yes ‐ - YBOX_JXN1000022 VMA9 0.96 0.07 ‐0.4 0.02 0.29 yes ‐ - YMR077C_01 VPS20 0.78 0.44 ‐0.1 0.03 0 yes ‐ - YBL107C_01 YBL107C_ORF 0.65 0.44 ‐0.54 0.05 0.09 yes ‐ - YBR013C_01 YBR013C_ORF 0.8 0.51 ‐1.23 0.04 0.03 yes ‐ - YBR016W_01 YBR016W_ORF 0.79 0.52 ‐0.11 0.01 0.06 yes ‐ - YBR047W_01 YBR047W_ORF 1.53 0.06 ‐0.98 0.04 0.08 yes ‐ - YBR090C_01 YBR090C_ORF 1.44 1.04 ‐0.09 0 0 yes ‐ - YPL087W_01 YDC1 0.93 0.51 ‐0.3 0 0.02 yes ‐ - YDL133W_01 YDL133W_ORF 0.67 0.24 ‐1.01 0 0.1 yes ‐ - YDL172C_01 YDL172C_ORF 1.29 ‐0.22 0.19 0.01 0.38 yes ‐ - YDR008C_01 YDR008C_ORF 0.72 ‐0.14 ‐1.43 0.01 0.03 yes ‐ - YDR090C_01 YDR090C_ORF 0.64 0.3 ‐0.23 0.02 0.13 yes ‐ - YDR114C_01 YDR114C_ORF 1.27 0.27 ‐2.29 0.01 0.01 yes ‐ - YBOX_OCH1000034 YDR134C_OCH__ORF 0.8 ‐0.1 0.04 0.04 0.71 yes ‐ - YDR196C_01 YDR196C_ORF 0.65 0.56 ‐0.67 0 0.1 yes ‐ - YDR367W_01 YDR367W_ORF 1.09 0.2 ‐0.55 0 0.01 yes ‐ - YER010C_01 YER010C_ORF 0.8 0.56 ‐0.55 0 0 yes ‐ - YFL046W_01 YFL046W_ORF 0.66 0.46 ‐0.6 0.02 0.01 yes ‐ - YGL072C_01 YGL072C_ORF 1.34 0.49 ‐0.02 0.02 0.2 yes ‐ - YGL080W_01 YGL080W_ORF 1.28 0.12 0 0 0.77 yes ‐ - YGL108C_01 YGL108C_ORF 0.77 0.25 ‐0.19 0.03 0.42 yes ‐ - YGR001C_01 YGR001C_ORF 0.6 0.09 ‐0.87 0 0 yes ‐ - YGR035C_01 YGR035C_ORF 0.83 0.58 ‐0.5 0.03 0.09 yes ‐ - YGR045C_01 YGR045C_ORF 0.76 0.42 ‐0.14 0 0 yes ‐ - YGR102C_01 YGR102C_ORF 0.69 0.21 ‐0.62 0.02 0.13 yes ‐ - YBOX_ONO1000043 YGR204C‐A_ONO_ORF 1.21 ‐0.01 ‐0.52 0.01 0.1 yes ‐ - YGR272C_01 YGR272C_ORF 0.67 0.3 ‐0.39 0.02 0.09 yes ‐ - YBOX_OCH1000260 YHL048C‐A_OCH__ORF 0.69 ‐0.01 ‐1.15 0 0 yes ‐ - YIR016W_01 YIR016W_ORF 0.6 0.63 ‐0.35 0.03 0.23 yes ‐ - YJL161W_01 YJL161W_ORF 0.73 0.23 ‐0.69 0.02 0.01 yes ‐ - YJR012C_01 YJR012C_ORF 0.84 0.48 ‐0.51 0.01 0 yes ‐ - YBOX_INT1000263 YJR112W‐A_INT_1 0.9 0.29 ‐0.79 0 0.01 yes ‐ - YKL018CA_01 YKL018C‐A_ORF 0.97 0.51 ‐1.09 0 0 yes ‐ - YKL083W_01 YKL083W_ORF 0.78 ‐0.36 0.04 0.01 0.44 yes ‐ - YKR074W_01 YKR074W_ORF 0.68 0.64 ‐0.28 0.01 0.06 yes ‐ - YLR232W_01 YLR232W_ORF 0.61 0.21 ‐0.54 0.01 0.08 yes ‐ - YLR326W_01 YLR326W_ORF 0.69 0.77 ‐0.34 0 0.06 yes ‐ - YML009CA_01 YML009C‐A_ORF 0.6 0.34 ‐0.11 0.04 0.04 yes ‐ -

145

YML030W_01 YML030W_ORF 0.69 0.42 ‐0.48 0 0.05 yes ‐ - YMR148W_01 YMR148W_ORF 0.67 0.32 ‐0.17 0.01 0.12 yes ‐ - YBOX_AAA1000049 YMR295C_AAA_15_NCR 0.61 ‐0.15 ‐1.01 0.04 0.08 yes ‐ - YBOX_TIL1000115 YMR31 0.91 0.79 ‐0.05 0.01 0.19 yes ‐ - YNL024C_01 YNL024C_ORF 0.81 0.32 ‐0.43 0.02 0.01 yes ‐ - YNL067WA_01 YNL067W‐A_ORF 1.66 0.17 0.14 0.01 0.95 yes ‐ - YNL165W_01 YNL165W_ORF 0.85 0.07 ‐0.71 0 0 yes ‐ - YNL200C_01 YNL200C_ORF 1.18 1.71 0.15 0 0.06 yes ‐ - YNL217W_01 YNL217W_ORF 0.85 0.53 ‐0.55 0 0 yes ‐ - YBOX_TIL1000113 YNL300W_TIL_4_134__ORF 0.69 ‐1.16 ‐1.85 0 0.45 yes ‐ - YNR036C_01 YNR036C_ORF 0.74 0.53 0.16 0.01 0.25 yes ‐ - YOL159C_01 YOL159C_ORF 0.64 0.27 ‐0.69 0.05 0.03 yes ‐ - YPR028W_01 YOP1 0.86 0.99 0.12 0 0.03 yes ‐ - YOR111W_01 YOR111W_ORF 0.76 0.39 ‐0.36 0.01 0.12 yes ‐ - YOR164C_01 YOR164C_ORF 0.71 0.39 0.12 0.03 0.27 yes ‐ - YOR218C_01 YOR218C_ORF 0.86 ‐0.12 ‐0.41 0 0.04 yes ‐ - YOR304CA01 YOR304C‐A_ORF 0.66 0.37 ‐0.76 0 0.02 yes ‐ - YOR387C_01 YOR387C_ORF 1.25 0.92 ‐0.14 0 0 yes ‐ - YPL071C_01 YPL071C_ORF 0.85 0.48 ‐0.63 0 0 yes ‐ - YBOX_ONO1000126 YPL189C‐A_ONO_ORF 0.85 ‐0.14 0.05 0.05 0.66 yes ‐ - YPR071W_01 YPR071W_ORF 1.15 0.53 ‐1 0 0.02 yes ‐ - YBR264C_01 YPT10 0.71 0.57 ‐0.31 0 0 yes ‐ - YLR130C_01 ZRT2 0.63 0.61 ‐0.44 0 0.05 yes ‐ - YLR109W_01 AHP1 1.04 0.68 ‐0.12 0 0.03 yes yes yes YHR175W_01 CTR2 1.22 1.15 ‐0.28 0 0 yes yes yes YGL166W_01 ACE1 0.68 1.05 ‐0.24 0.02 0.02 yes yes yes YIR037W_01 HYR1 1.41 1.87 0.14 0.02 0.01 yes yes yes YKL150W_01 MCR1 0.8 1.02 0.13 0.04 0.01 yes yes yes YGR248W_01 SOL4 0.82 1 0.01 0.03 0 yes yes yes YKL056C_01 TMA19 1.41 1.54 0.03 0 0 yes yes yes YCL033C_01 YCL033C_ORF 0.75 0.91 ‐0.8 0.02 0 yes yes yes YBR046C_01 ZTA1 1.08 0.72 ‐0.07 0 0.01 yes yes yes YKL192C_01 ACP1 0.68 0.84 ‐0.42 0.01 0 yes yes - YKL206C_01 ADD66 0.81 0.65 ‐0.21 0.02 0.01 yes yes - YMR318C_01 ADH6 0.6 0.65 0.01 0.04 0.03 yes yes - YDR226W_01 ADK1 1.26 1.15 ‐0.02 0 0 yes yes - YBR070C_01 ALG14 0.76 1.16 ‐0.33 0.03 0 yes yes - YJR058C_01 APS2 0.91 0.67 ‐0.01 0.01 0.03 yes yes - YJL024C_01 APS3 0.91 0.69 ‐0.12 0.03 0.03 yes yes - YIL062C_01 ARC15 0.9 1.51 ‐0.74 0.01 0 yes yes - YLR370C_01 ARC18 0.9 0.89 ‐0.28 0 0 yes yes - YDL192W_01 ARF1 1.23 1.05 ‐0.24 0.01 0.01 yes yes - YDL029W_01 ARP2 1.13 0.87 0.19 0.01 0 yes yes - YBOX_ACM1000004 ARS302‐HML_ARS 0.98 0.67 ‐0.35 0 0 yes yes - YKL052C_01 ASK1 1.21 0.97 0.06 0.01 0 yes yes - YDR384C_01 ATO3 0.73 0.76 ‐0.36 0.01 0.01 yes yes - YNL315C_01 ATP11 0.74 0.74 ‐0.17 0.04 0.03 yes yes - YPL271W_01 ATP15 0.72 0.93 ‐0.63 0.03 0.01 yes yes - YPR020W_01 ATP20 1.27 1.24 ‐1.03 0.01 0 yes yes - YIL124W_01 AYR1 1.58 1.38 ‐0.08 0 0 yes yes - YCR047C_01 BUD23 1.12 0.96 ‐0.29 0 0.02 yes yes - YGR262C_01 BUD32 0.63 1 ‐0.45 0.05 0.02 yes yes - YDL165W_01 CDC36 0.62 0.73 ‐0.75 0 0 yes yes - YBR109C_01 CMD1 0.93 1.08 ‐0.35 0 0 yes yes - YLL050C_01 COF1 0.89 0.96 ‐0.26 0 0 yes yes - YHL048W_01 COS8 0.61 0.64 ‐0.03 0.04 0.05 yes yes - YLR038C_01 COX12 0.78 0.75 ‐0.08 0.01 0.01 yes yes - YER141W_01 COX15 0.8 0.74 ‐0.23 0.01 0 yes yes - YMR256C_01 COX7 0.79 1.13 ‐0.36 0 0 yes yes - YBOX_OCH1000203 CPR1 0.71 1.01 0 0.05 0 yes yes - YHR057C_01 CPR2 0.69 1.07 ‐0.17 0 0 yes yes - YBR291C_01 CTP1 1.03 1.37 0.19 0.04 0 yes yes - YMR264W_01 CUE1 0.81 1.75 ‐0.36 0.05 0 yes yes - YKR083C_01 DAD2 0.93 1.18 ‐0.4 0 0 yes yes - YPL170W_01 DAP1 0.88 1.2 ‐0.54 0.01 0.01 yes yes - YOR163W_01 DDP1 1.23 1.44 ‐0.16 0 0 yes yes - YDR411C_01 DFM1 0.54 0.89 ‐0.02 0.14 0.02 yes yes -

146

YJL065C_01 DLS1 0.96 1.09 ‐0.63 0 0 yes yes - YPR183W_01 DPM1 0.84 1.24 ‐0.28 0 0.01 yes yes - YJR082C_01 EAF6 0.8 0.96 ‐0.64 0.04 0.01 yes yes - YBL001C_01 ECM15 1.03 1.14 ‐1.21 0 0 yes yes - YPL095C_01 EEB1 0.74 0.87 0.01 0.01 0.02 yes yes - YHR193C_01 EGD2 0.74 0.94 0.04 0 0.05 yes yes - YLR186W_01 EMG1 1.13 1.31 0.17 0.01 0.01 yes yes - YER044C_01 ERG28 0.74 1.07 ‐0.43 0.04 0.03 yes yes - YMR220W_01 ERG8 0.74 0.61 ‐0.09 0.01 0 yes yes - YBOX_JXN1000099 ERV1 1.22 1.26 ‐0.04 0.01 0 yes yes - YGL054C_01 ERV14 0.65 0.6 ‐0.51 0.01 0.01 yes yes - YJR017C_01 ESS1 1.27 1.06 ‐0.1 0 0.01 yes yes - YPR062W_01 FCY1 1.78 1.23 ‐0.32 0 0 yes yes - YNL135C_01 FPR1 1.24 1.13 0.05 0 0.02 yes yes - YMR222C_01 FSH2 0.95 1.07 ‐0.25 0.02 0 yes yes - YFL017C_01 GNA1 0.88 1.73 ‐0.54 0.03 0 yes yes - YJL184W_01 GON7 0.81 1.15 ‐0.05 0.04 0.03 yes yes - YHL031C_01 GOS1 0.67 0.69 ‐0.63 0 0 yes yes - YBOX_OCH1000088 GSP1 1.06 1.01 0.18 0.03 0.01 yes yes - YBOX_OCH1000112 GSP2 0.94 0.98 ‐0.27 0.01 0.01 yes yes - YML121W_01 GTR1 0.69 0.8 ‐0.11 0.02 0.02 yes yes - YBOX_OCH1000126 HHF1 1.09 1 ‐0.64 0 0 yes yes - YBOX_OCH1000171 HHF2 1.02 0.62 ‐0.87 0 0 yes yes - YBOX_OCH1000172 HHT2 1.59 1.11 ‐0.45 0 0.01 yes yes - YER055C_01 HIS1 0.84 1.31 ‐0.3 0 0 yes yes - YER057C_01 HMF1 1.39 1.21 ‐0.13 0 0 yes yes - YBOX_INT1000087 HNT1 0.62 1 ‐0.28 0 0 yes yes - YEL066W_01 HPA3 1.37 1.22 ‐0.55 0 0 yes yes - YBOX_OCH1000124 HTA2 0.73 1.03 ‐0.64 0.02 0.01 yes yes - YBOX_OCH1000035 HTB1 1.08 0.82 ‐0.16 0 0.03 yes yes - YOL012C_01 HTZ1 0.9 0.74 ‐0.58 0.01 0 yes yes - YNR032CA01 HUB1 0.73 1.3 ‐0.74 0.02 0.01 yes yes - YLR052W_01 IES3 0.81 0.84 ‐0.47 0.02 0.01 yes yes - YEL044W_01 IES6 1.43 0.8 ‐0.25 0 0 yes yes - YCL009C_01 ILV6 0.95 1.07 0.09 0.01 0 yes yes - YCR071C_01 IMG2 0.77 1.07 ‐0.26 0.01 0 yes yes - YLL049W_01 LDB18 0.87 0.65 ‐0.87 0 0 yes yes - YBL006C_01 LDB7 1.44 1.78 ‐0.04 0 0.01 yes yes - YCL034W_01 LSB5 0.81 1.22 0.06 0.01 0.02 yes yes - YJL124C_01 LSM1 0.78 0.98 ‐0.18 0.03 0.04 yes yes - YLR438CA01 LSM3 1.24 1.24 ‐0.53 0 0 yes yes - YER146W_01 LSM5 0.64 0.66 ‐0.63 0 0.01 yes yes - YJL030W_01 MAD2 1.26 0.99 0.11 0.02 0.01 yes yes - YKL053CA01 MDM35 0.81 1.1 ‐0.11 0 0 yes yes - YKL001C_01 MET14 0.91 0.79 ‐0.19 0.01 0.05 yes yes - YDR461W_01 MFA1 1.28 0.82 ‐0.41 0.01 0 yes yes - YOR232W_01 MGE1 0.86 1.15 ‐0.01 0 0.02 yes yes - YDR296W_01 MHR1 0.82 1.33 0.07 0.02 0 yes yes - YGL106W_01 MLC1 1.04 1.7 ‐0.24 0.02 0 yes yes - YIL051C_01 MMF1 1.58 1.21 0.02 0 0.01 yes yes - YGL087C_01 MMS2 0.73 0.74 ‐0.47 0 0 yes yes - YDL045WA01 MRP10 0.82 1.1 ‐0.34 0.02 0 yes yes - YGR084C_01 MRP13 0.78 1.08 ‐0.11 0.01 0 yes yes - YKL167C_01 MRP49 0.99 0.93 ‐0.12 0 0.01 yes yes - YCR003W_01 MRPL32 0.87 0.89 ‐0.25 0.02 0.01 yes yes - YMR286W_01 MRPL33 0.82 1.13 ‐0.61 0.02 0.01 yes yes - YBR268W_01 MRPL37 0.85 1.23 ‐0.1 0.01 0 yes yes - YNR022C_01 MRPL50 0.79 0.81 ‐0.39 0.01 0 yes yes - YAR033W_01 MST28 1.08 0.83 ‐0.93 0 0.01 yes yes - YGR147C_01 NAT2 0.95 0.69 ‐0.17 0.02 0.05 yes yes - YPL211W_01 NIP7 0.82 0.65 ‐1.01 0 0 yes yes - YBOX_IGR1000063 no name 0.85 1 ‐0.7 0 0 yes yes - YBOX_IGR1000143 no name 0.84 0.78 ‐0.52 0.02 0.01 yes yes - YBOX_IGX1000017 no name 0.79 0.96 ‐0.36 0.04 0 yes yes - YCL049C_01 no name 0.89 0.65 0.11 0.02 0.04 yes yes - YHR072WA01 NOP10 0.91 0.76 ‐0.95 0.01 0 yes yes - YDL046W_01 NPC2 0.79 0.9 ‐0.06 0.02 0 yes yes -

147

YNL156C_01 NSG2 1.01 0.63 ‐0.45 0 0 yes yes - YOL032W_01 OPI10 0.93 0.87 ‐0.01 0 0 yes yes - YJR073C_01 OPI3 1.46 1.46 ‐0.17 0 0 yes yes - YOR130C_01 ORT1 0.64 0.84 ‐0.33 0.01 0 yes yes - YGL226CA01 OST5 0.92 1.9 ‐0.36 0.05 0.01 yes yes - YDR071C_01 PAA1 1.37 1.07 ‐0.46 0 0.01 yes yes - YJL104W_01 PAM16 1.04 0.93 ‐0.55 0 0.01 yes yes - YLR008C_01 PAM18 1 0.84 ‐0.41 0.01 0.02 yes yes - YCL052C_01 PBN1 0.81 0.69 ‐0.09 0 0 yes yes - YDL053C_01 PBP4 1.1 1.2 ‐0.01 0.01 0.01 yes yes - YCR044C_01 PER1 1.18 1.28 0.19 0 0 yes yes - YJL210W_01 PEX2 0.7 1.23 ‐0.06 0.03 0 yes yes - YJL179W_01 PFD1 1.48 0.83 ‐1.19 0 0 yes yes - YOR122C_01 PFY1 0.71 0.91 ‐0.09 0.03 0 yes yes - YNL149C_01 PGA2 0.84 1.96 ‐0.47 0.04 0 yes yes - YML125C_01 PGA3 0.84 1.43 ‐0.63 0 0 yes yes - YBR106W_01 PHO88 1.7 1.59 0.04 0 0 yes yes - YBOX_AAA1000120 PIL1 0.72 0.61 ‐0.34 0.01 0 yes yes - YMR314W_01 PRE5 1.08 0.95 0.14 0.01 0.01 yes yes - YHL011C_01 PRS3 1.02 1.1 0.03 0.03 0.01 yes yes - YBL068W_01 PRS4 0.92 0.84 ‐0.15 0.01 0.01 yes yes - YHR076W_01 PTC7 0.65 0.97 ‐0.19 0 0 yes yes - YDR529C_01 QCR7 0.93 0.97 ‐0.52 0 0.01 yes yes - YDL103C_01 QRI1 0.98 1.05 0.1 0.02 0.03 yes yes - YDL189W_01 RBS1 1.12 0.66 ‐0.33 0 0.01 yes yes - YCL001W_01 RER1 0.84 0.9 ‐0.14 0.01 0.04 yes yes - YNL290W_01 RFC3 0.72 0.67 ‐0.21 0.02 0.02 yes yes - YBR256C_01 RIB5 1.01 0.68 ‐0.31 0.01 0.02 yes yes - YBOX_JXN1000024 RIM1 0.89 0.97 ‐0.06 0.01 0.01 yes yes - YMR154C_01 RIM13 0.82 0.72 ‐0.48 0 0.02 yes yes - YOR210W_01 RPB10 0.71 0.8 ‐1.04 0 0 yes yes - YOL005C_01 RPB11 0.93 1.33 ‐0.55 0 0 yes yes - YBR154C_01 RPB5 0.71 0.78 ‐0.47 0.03 0.02 yes yes - YHR143WA01 RPC10 0.61 0.86 ‐1.29 0 0 yes yes - YBOX_OCH1000229 RPL11B 0.99 1.07 ‐0.91 0 0 yes yes - YBOX_OCH1000003 RPL12A 0.87 1.14 ‐0.75 0 0 yes yes - YBOX_OCH1000226 RPL12B 0.84 0.94 ‐1.3 0 0 yes yes - YBOX_OCH1000168 RPL13B 0.8 0.91 ‐0.82 0 0 yes yes - YKL006W_01 RPL14A 0.99 1.24 ‐0.28 0.01 0 yes yes - YBOX_OCH1000159 RPL17A 0.66 0.63 ‐0.81 0.02 0.01 yes yes - YBOX_OCH1000074 RPL17B 1.05 0.83 ‐0.23 0.01 0 yes yes - YBOX_OCH1000107 RPL18A 0.83 0.93 ‐0.01 0 0 yes yes - YBOX_OCH1000104 RPL18B 0.89 0.83 ‐0.28 0.02 0.02 yes yes - YBOX_OCH1000219 RPL19A 1.19 1.96 ‐1.2 0 0 yes yes - YBL027W_01 RPL19B 1.55 2.03 0.02 0 0 yes yes - YBOX_OCH1000227 RPL1B 0.79 1.51 ‐0.75 0 0 yes yes - YBOX_OCH1000101 RPL20A 1.33 1.36 0.18 0 0 yes yes - YBOX_OCH1000180 RPL20B 1.49 1.68 ‐1.25 0 0 yes yes - YFL034CA01 RPL22B 0.65 0.76 ‐0.78 0 0 yes yes - YBL087C_01 RPL23A 1.23 1.47 ‐0.5 0 0 yes yes - YER117W_01 RPL23B 1.11 1.21 ‐0.49 0 0 yes yes - YGR148C_01 RPL24B 1.06 1.06 ‐0.17 0.01 0 yes yes - YBOX_OCH1000232 RPL26A 1.19 1.11 ‐0.78 0 0 yes yes - YBOX_OCH1000147 RPL26B 1.35 1.49 ‐1.12 0.01 0 yes yes - YBOX_OCH1000059 RPL27A 0.7 1.22 ‐0.51 0.02 0 yes yes - YBOX_OCH1000039 RPL27B 0.82 0.66 ‐0.63 0 0.02 yes yes - YGL103W_01 RPL28 1.6 1.44 ‐0.4 0 0 yes yes - YFR032CA01 RPL29 0.68 0.69 ‐1.15 0.01 0.01 yes yes - YBOX_OCH1000144 RPL2A 0.96 1.47 0 0.03 0.03 yes yes - YBOX_OCH1000189 RPL2B 0.71 0.64 ‐0.31 0.02 0 yes yes - YGL030W_01 RPL30 1.59 1.59 ‐0.04 0.03 0 yes yes - YDL075W_01 RPL31A 0.94 1.15 ‐0.5 0 0 yes yes - YBOX_OCH1000091 RPL31B 1.08 1.54 ‐0.38 0.01 0 yes yes - YBL092W_01 RPL32 0.89 1.15 0.05 0.01 0 yes yes - YBOX_OCH1000182 RPL33A 0.77 1.19 ‐1.22 0 0 yes yes - YOR234C_01 RPL33B 0.9 1.23 ‐0.66 0 0 yes yes - YIL052C_01 RPL34B 1 1.4 ‐0.7 0.01 0 yes yes -

148

YDL191W_01 RPL35A 1.04 0.74 ‐0.43 0.01 0 yes yes - YBOX_OCH1000040 RPL37B 1.04 1.22 ‐1.23 0 0 yes yes - YLR325C_01 RPL38 1.3 0.83 ‐0.91 0 0 yes yes - YBOX_OCH1000174 RPL42A 0.98 1.87 ‐1.46 0.01 0 yes yes - YBOX_OCH1000118 RPL43A 0.71 1.02 ‐0.54 0.01 0 yes yes - YBOX_OCH1000077 RPL43B 0.7 0.65 ‐1.22 0.01 0.01 yes yes - YBOX_OCH1000134 RPL4B 0.7 0.81 ‐0.38 0.01 0 yes yes - YPL131W_01 RPL5 0.91 1.8 0.1 0.02 0.01 yes yes - YBOX_OCH1000097 RPL6A 0.85 0.84 ‐0.1 0.01 0.02 yes yes - YBOX_OCH1000145 RPL7A 0.89 1.27 ‐0.74 0.03 0 yes yes - YBOX_JXN1000012 RPL7B 0.62 0.92 ‐0.42 0 0 yes yes - YHL033C_01 RPL8A 1.12 1.43 0.18 0 0 yes yes - YBOX_OCH1000163 RPL8B 1.58 1.75 ‐0.56 0 0 yes yes - YBOX_OCH1000228 RPL9A 0.72 0.7 ‐1.53 0 0 yes yes - YHR200W_01 RPN10 0.82 1.02 ‐0.31 0.01 0 yes yes - YPR187W_01 RPO26 0.83 0.93 ‐0.41 0.03 0.02 yes yes - YBOX_OCH1000170 RPS10B 0.84 0.64 ‐1.29 0 0 yes yes - YDR025W_01 RPS11A 1.2 1.24 ‐0.09 0 0 yes yes - YBOX_OCH1000128 RPS11B 0.99 0.89 ‐0.71 0 0.02 yes yes - YCR031C_01 RPS14A 1.51 1.45 ‐0.13 0.01 0 yes yes - YBOX_OCH1000076 RPS14B 1.6 1.5 ‐0.36 0 0.01 yes yes - YBOX_OCH1000169 RPS16A 1.25 0.83 ‐0.64 0 0 yes yes - YBOX_OCH1000030 RPS16B 1.13 1.07 ‐0.19 0 0 yes yes - YML024W_01 RPS17A 0.96 1.27 ‐0.26 0.01 0 yes yes - YBOX_OCH1000038 RPS18A 0.99 1.17 ‐0.15 0 0 yes yes - YBOX_OCH1000094 RPS18B 1.21 1.23 0.16 0 0.02 yes yes - YBOX_OCH1000177 RPS19A 0.99 0.96 ‐1.83 0.01 0 yes yes - YBOX_OCH1000176 RPS19B 1 1.19 ‐1.51 0 0 yes yes - YBOX_OCH1000093 RPS1A 0.83 0.95 ‐0.16 0 0 yes yes - YHL015W_01 RPS20 1.84 1.49 ‐0.2 0 0 yes yes - YBOX_OCH1000160 RPS21A 1.05 0.83 ‐1.3 0 0.01 yes yes - YBOX_OCH1000072 RPS21B 1.21 1.06 ‐0.78 0 0 yes yes - YBOX_OCH1000075 RPS22A 0.98 0.91 ‐0.82 0 0 yes yes - YBOX_JXN1000069 RPS22B 0.6 0.65 ‐0.94 0 0.01 yes yes - YBOX_OCH1000148 RPS23A 1.27 1.46 ‐0.4 0 0 yes yes - YBOX_OCH1000183 RPS23B 0.71 1.04 ‐1.07 0.02 0 yes yes - YER074W_01 RPS24A 1.24 0.71 ‐0.01 0.01 0.02 yes yes - YBOX_OCH1000153 RPS24B 0.68 0.9 ‐0.09 0.02 0.02 yes yes - YBOX_OCH1000089 RPS25B 0.95 0.84 ‐0.45 0 0.03 yes yes - YLR264W_01 RPS28B 0.71 0.66 ‐0.46 0.03 0.03 yes yes - YLR388W_01 RPS29A 0.99 0.72 ‐1.04 0 0.02 yes yes - YDL061C_01 RPS29B 0.67 1.22 ‐0.92 0 0 yes yes - YBOX_OCH1000231 RPS4A 1.31 1.43 ‐0.74 0 0.01 yes yes - YHR203C_01 RPS4B 1.43 1.84 0.06 0.01 0.01 yes yes - YBOX_OCH1000221 RPS6B 0.98 1.22 ‐0.61 0 0 yes yes - YBOX_OCH1000217 RPS8A 1.62 1.72 ‐0.25 0.01 0.01 yes yes - YBOX_OCH1000116 RPS9A 1.16 1.05 ‐0.02 0 0 yes yes - YNR037C_01 RSM19 1.27 1.6 0.02 0.03 0 yes yes - YLR180W_01 SAM1 0.91 0.78 0.01 0.04 0.03 yes yes - YHR083W_01 SAM35 0.62 0.71 ‐0.83 0 0 yes yes - YMR263W_01 SAP30 1.22 1.07 ‐0.41 0.02 0 yes yes - YPL218W_01 SAR1 0.98 1.14 ‐0.1 0 0.03 yes yes - YER019CA01 SBH2 0.77 1.02 ‐0.91 0 0 yes yes - YOR367W_01 SCP1 0.76 0.9 ‐0.19 0 0 yes yes - YGL126W_01 SCS3 0.77 1.88 0 0.03 0 yes yes - YIR022W_01 SEC11 0.87 0.75 ‐0.07 0.01 0 yes yes - YLR208W_01 SEC13 0.7 1.24 ‐0.1 0.01 0.01 yes yes - YPL094C_01 SEC62 0.9 1.07 ‐0.09 0 0 yes yes - YDR363WA01 SEM1 0.85 0.72 ‐0.84 0.01 0 yes yes - YKL006CA01 SFT1 0.67 0.69 ‐0.37 0.03 0.01 yes yes - YKL130C_01 SHE2 0.83 0.63 ‐0.52 0 0.01 yes yes - YDL212W_01 SHR3 1.4 1.78 0.04 0.01 0 yes yes - YOL110W_01 SHR5 0.97 0.64 0.14 0.04 0.02 yes yes - YDR328C_01 SKP1 0.76 1.38 ‐0.08 0.13 0 yes yes - YDL052C_01 SLC1 0.73 0.97 ‐0.26 0 0 yes yes - YML058W_01 SML1 0.63 0.74 ‐0.38 0.02 0.03 yes yes - YDR510W_01 SMT3 1.42 1.24 ‐0.37 0.03 0 yes yes -

149

YPR182W_01 SMX3 0.96 1 ‐1.05 0.01 0 yes yes - YJL151C_01 SNA3 0.88 1.66 ‐0.42 0.01 0 yes yes - YAL030W_01 SNC1 0.74 1.48 ‐0.34 0.04 0 yes yes - YOR327C_01 SNC2 1.18 0.9 ‐0.43 0 0 yes yes - YGR197C_01 SNG1 0.74 0.77 ‐0.01 0.02 0.01 yes yes - YEL026W_01 SNU13 0.92 0.72 0.03 0.02 0.02 yes yes - YCR073WA01 SOL2 0.97 0.83 0.17 0.04 0 yes yes - YER018C_01 SPC25 0.98 0.92 ‐0.09 0.01 0 yes yes - YKL154W_01 SRP102 0.7 1 ‐0.17 0.01 0 yes yes - YDL092W_01 SRP14 1.08 1.5 ‐0.06 0.03 0.02 yes yes - YBOX_OCH1000132 SSB1 0.81 0.76 ‐0.44 0 0.01 yes yes - YDR086C_01 SSS1 1.17 1.42 ‐0.21 0.04 0.01 yes yes - YDL130WA01 STF1 0.86 0.88 ‐0.2 0.01 0 yes yes - YMR149W_01 SWP1 0.68 0.92 ‐0.09 0.01 0.01 yes yes - YML098W_01 TAF13 0.8 0.78 ‐0.59 0 0 yes yes - YMR236W_01 TAF9 1.01 1.01 ‐0.53 0 0 yes yes - YPL234C_01 TFP3 0.79 1.71 ‐0.69 0.05 0 yes yes - YLR178C_01 TFS1 1.03 1.55 0.13 0 0 yes yes - YMR260C_01 TIF11 1.51 1.42 ‐0.24 0 0 yes yes - YBOX_OCH1000230 TIF2 0.45 0.77 ‐0.41 0.02 0 yes yes - YMR146C_01 TIF34 0.68 0.87 ‐0.18 0 0 yes yes - YJR014W_01 TMA22 1.1 1.03 ‐0.24 0.01 0.01 yes yes - YLR262CA01 TMA7 0.71 0.9 ‐0.2 0.01 0 yes yes - YOR045W_01 TOM6 0.75 0.86 ‐0.43 0.02 0 yes yes - YKR088C_01 TVP38 0.81 1.09 ‐0.48 0.03 0 yes yes - YBOX_JXN1000031 UBC9 0.82 1.09 ‐0.19 0 0 yes yes - YAR027W_01 UIP3 0.93 0.65 ‐0.05 0.02 0.02 yes yes - YOR332W_01 VMA4 0.98 0.93 ‐0.24 0 0.01 yes yes - YEL051W_01 VMA8 0.97 1 0.19 0.03 0.03 yes yes - YKL119C_01 VPH2 0.65 1.19 ‐0.86 0.01 0 yes yes - YKR020W_01 VPS51 0.84 0.87 ‐0.32 0.04 0.01 yes yes - YER072W_01 VTC1 1.16 1.06 ‐0.29 0 0.04 yes yes - YJR133W_01 XPT1 0.68 0.83 ‐0.57 0 0 yes yes - YBL028C_01 YBL028C_ORF 1.19 1.16 ‐0.34 0.01 0 yes yes - YBL059W_01 YBL059W_ORF 1.19 1.16 ‐0.91 0 0 yes yes - YBR014C_01 YBR014C_ORF 0.95 0.98 ‐0.72 0 0 yes yes - YBR261C_01 YBR261C_ORF 1.14 1.33 ‐0.17 0.01 0.02 yes yes - YBR262C_01 YBR262C_ORF 0.84 0.62 ‐0.41 0.02 0 yes yes - YBR269C_01 YBR269C_ORF 1.21 1.46 ‐0.28 0 0 yes yes - YCL057CA_01 YCL057C‐A_ORF 0.94 1.25 ‐0.4 0 0 yes yes - YCR043C_01 YCR043C_ORF 0.94 0.67 ‐0.73 0 0.02 yes yes - YCR051W_01 YCR051W_ORF 1.12 1.89 ‐0.22 0 0.01 yes yes - YCR076C_01 YCR076C_ORF 1.16 0.98 ‐0.77 0 0 yes yes - YDL012C_01 YDL012C_ORF 0.71 0.6 ‐0.16 0.01 0.03 yes yes - YDL114WA_01 YDL114W‐A_ORF 1.05 0.6 ‐0.95 0 0.01 yes yes - YBOX_AAA1000102 YDR115W_AAA_10_NCR 1.21 1.13 ‐0.53 0 0 yes yes - YDR154C_01 YDR154C_ORF 0.98 0.92 ‐0.83 0.01 0.03 yes yes - YDR248C_01 YDR248C_ORF 0.97 0.7 ‐0.26 0.03 0 yes yes - YDR391C_01 YDR391C_ORF 0.65 0.83 ‐0.57 0 0 yes yes - YER119CA01 YER119C‐A_ORF 0.49 0.87 ‐0.78 0.02 0.01 yes yes - YDL072C_01 YET3 1.09 1.18 ‐0.27 0 0 yes yes - YFR042W_01 YFR042W_ORF 0.65 0.99 ‐0.96 0.01 0.01 yes yes - YGL079W_01 YGL079W_ORF 0.75 0.73 ‐0.65 0.01 0 yes yes - YGL188C_01 YGL188C_ORF 1.09 1.06 ‐0.3 0.01 0.01 yes yes - YGL220W_01 YGL220W_ORF 0.91 1.06 ‐0.35 0 0 yes yes - YGL231C_01 YGL231C_ORF 0.78 0.91 ‐0.31 0.01 0 yes yes - YBOX_ONO1000050 YHR175W‐A_ONO_ORF 0.93 0.95 ‐0.38 0.04 0 yes yes - YHR192W_01 YHR192W_ORF 1.26 1.42 0.08 0 0 yes yes - YNL044W_01 YIP3 0.61 0.77 ‐0.25 0.02 0 yes yes - YGL161C_01 YIP5 0.91 0.69 ‐0.77 0 0.01 yes yes - YJL217W_01 YJL217W_ORF 1.1 0.94 0.11 0 0.04 yes yes - YLR200W_01 YKE2 1.23 0.84 ‐0.85 0 0 yes yes - YKL027W_01 YKL027W_ORF 0.72 0.64 ‐0.37 0.03 0 yes yes - YKL033WA01 YKL033W‐A_ORF 0.92 1.07 ‐0.06 0 0 yes yes - YKL106CA_01 YKL106C‐A_ORF 1.14 1.07 ‐0.59 0 0 yes yes - YKL151C_01 YKL151C_ORF 0.75 1.13 ‐0.27 0.03 0.03 yes yes - YKL207W_01 YKL207W_ORF 1.15 1.91 ‐0.4 0.01 0.01 yes yes -

150

YKL196C_01 YKT6 0.73 0.66 ‐0.5 0 0.01 yes yes - YLR065C_01 YLR065C_ORF 1.02 0.78 ‐0.42 0 0 yes yes - YLR112W_01 YLR112W_ORF 0.77 0.92 ‐0.24 0.03 0.02 yes yes - YLR179C_01 YLR179C_ORF 1.19 1.41 0.11 0.03 0 yes yes - YLR218C_01 YLR218C_ORF 0.81 1.54 ‐0.18 0.03 0 yes yes - YLR257W_01 YLR257W_ORF 0.62 0.73 ‐0.33 0.01 0.01 yes yes - YLR294C_01 YLR294C_ORF 0.62 0.79 ‐1.2 0.03 0 yes yes - YLR414C_01 YLR414C_ORF 0.77 0.9 ‐0.05 0.01 0.02 yes yes - YML079W_01 YML079W_ORF 0.63 0.93 ‐0.53 0.01 0 yes yes - YMR074C_01 YMR074C_ORF 0.92 1.31 ‐0.57 0 0 yes yes - YMR090W_01 YMR090W_ORF 0.69 1.02 ‐0.16 0.01 0 yes yes - YBOX_TIL1000116 YMR31 0.99 1.03 ‐0.2 0 0 yes yes - YNL010W_01 YNL010W_ORF 1.15 1.69 ‐0.08 0 0 yes yes - YOR200W_01 YOR200W_ORF 0.55 0.72 0.08 0.28 0.05 yes yes - YOR215C_01 YOR215C_ORF 1.25 1.23 ‐0.05 0 0 yes yes - YOR251C_01 YOR251C_ORF 0.52 1.29 ‐0.43 0.04 0.03 yes yes - YOR277C_01 YOR277C_ORF 0.84 0.81 ‐0.34 0.02 0 yes yes - YOR282W_01 YOR282W_ORF 0.88 0.6 ‐0.46 0 0.01 yes yes - YOR285W_01 YOR285W_ORF 1.08 1.21 ‐0.37 0 0 yes yes - YPL225W_01 YPL225W_ORF 1.12 0.92 ‐0.91 0 0 yes yes - YBOX_OCH1000119 YPR063C_OCH__ORF 0.79 1.15 ‐0.04 0.04 0 yes yes - YFL038C_01 YPT1 1.71 1.13 0.08 0 0 yes yes - YER031C_01 YPT31 1.09 1.21 ‐0.14 0.03 0 yes yes - YGL210W_01 YPT32 0.71 0.97 ‐0.6 0.01 0 yes yes - YHR017W_01 YSC83 0.76 0.77 ‐0.38 0 0 yes yes - YNL310C_01 ZIM17 1.19 1.15 ‐0.11 0.02 0 yes yes - YOL154W_01 ZPS1 0.98 0.91 ‐0.11 0.02 0 yes yes - YNL259C_01 ATX1 0.46 0.71 ‐1.35 0.01 0.01 - yes yes YKR066C_01 CCP1 ‐0.08 1.12 0.2 0.63 0 - yes yes YLL009C_01 COX17 0.67 1.08 ‐0.31 0.07 0 - yes yes YEL027W_01 CUP5 0.59 0.92 0.06 0.11 0.02 - yes yes YIL010W_01 DOT5 0.62 1.42 0 0.31 0 - yes yes YPL091W_01 GLR1 0.54 0.81 ‐0.19 0.04 0 - yes yes YBR244W_01 GPX2 0.49 0.91 ‐0.7 0.01 0 - yes yes YCL035C_01 GRX1 0.48 1.3 ‐0.51 0.07 0 - yes yes YER042W_01 MXR1 0.34 0.66 ‐0.26 0.11 0.01 - yes yes YLR248W_01 RCK2 ‐0.57 0.68 ‐0.6 0.96 0 - yes yes YJR104C_01 SOD1 0.55 0.77 0.12 0.17 0 - yes yes YGR209C_01 TRX2 0.57 0.65 ‐0.77 0.02 0 - yes yes YCR083W_01 TRX3 ‐0.25 0.66 ‐0.8 0.31 0.01 - yes yes YML028W_01 TSA1 0.72 1.17 0.2 0.27 0 - yes yes YDR453C_01 TSA2 ‐0.28 0.9 ‐0.52 0.75 0.01 - yes yes YML007W_01 YAP1 ‐0.42 0.64 ‐0.67 0.61 0.01 - yes yes YJR096W_01 YJR096W_ORF 0.18 0.76 ‐0.21 0.49 0.03 - yes yes YNL241C_01 ZWF1 0.23 0.94 0.17 0.69 0.01 - yes yes YCR088W_01 ABP1 ‐0.44 0.93 ‐0.69 0.65 0 - yes - YGR037C_01 ACB1 0.72 1.23 ‐0.04 0.31 0 - yes - YMR184W_01 ADD37 0.43 1.14 ‐0.2 0.11 0.01 - yes - YMR083W_01 ADH3 0.33 0.88 0.08 0.59 0.02 - yes - YGL256W_01 ADH4 0.52 0.72 0.12 0.22 0.02 - yes - YMR009W_01 ADI1 0.04 0.78 ‐0.4 0.13 0 - yes - YOR002W_01 ALG6 0.14 0.69 ‐0.04 0.68 0 - yes - YBR243C_01 ALG7 0.1 0.88 ‐0.07 0.75 0 - yes - YBR151W_01 APD1 0.36 0.79 0.14 0.74 0 - yes - YNL065W_01 AQR1 0.06 0.64 ‐0.54 0.03 0.04 - yes - YCR048W_01 ARE1 0.39 0.87 ‐0.07 0.15 0 - yes - YOR094W_01 ARF3 0.33 0.9 ‐0.09 0.24 0.03 - yes - YOL140W_01 ARG8 ‐0.93 1 ‐0.65 0.43 0 - yes - YGL202W_01 ARO8 ‐0.57 0.95 0.17 0.29 0.01 - yes - YPR199C_01 ARR1 0.4 0.78 ‐0.23 0.05 0.01 - yes - YJL170C_01 ASG7 0 0.81 ‐0.46 0.11 0.01 - yes - YPR145W_01 ASN1 ‐0.15 0.64 ‐0.33 0.67 0 - yes - YBOX_OCH1000015 AST1 0.25 0.89 ‐0.34 0.23 0.01 - yes - YLR295C_01 ATP14 0.4 1.1 ‐0.45 0.23 0.01 - yes - YDL004W_01 ATP16 0.2 0.64 ‐0.46 0.24 0 - yes - YER119C_01 AVT6 ‐0.13 1.17 0.05 0.73 0.03 - yes - YJR148W_01 BAT2 0.34 1.15 ‐0.02 0.58 0.03 - yes -

151

YDR361C_01 BCP1 0.14 1.02 ‐0.2 0.65 0.01 - yes - YPR176C_01 BET2 0.55 0.66 ‐0.44 0.03 0.02 - yes - YJR025C_01 BNA1 0.34 1.27 ‐0.34 0.3 0 - yes - YBL098W_01 BNA4 0.29 1.07 0.01 0.58 0 - yes - YNL278W_01 CAF120 ‐0.67 0.6 ‐0.59 0.88 0.04 - yes - YGR134W_01 CAF130 ‐0.45 1.01 ‐0.21 0.65 0.01 - yes - YOR276W_01 CAF20 0.07 0.76 ‐0.38 0.21 0 - yes - YER048C_01 CAJ1 0.16 1.22 ‐0.67 0.1 0 - yes - YNL161W_01 CBK1 0.42 0.94 ‐0.84 0 0 - yes - YBR120C_01 CBP6 0.32 0.96 ‐0.65 0.2 0.01 - yes - YIL142W_01 CCT2 ‐0.1 1.32 ‐0.61 0.36 0 - yes - YDL143W_01 CCT4 0.1 0.84 ‐0.33 0.21 0 - yes - YHR107C_01 CDC12 0.03 0.61 ‐0.05 0.73 0 - yes - YOL139C_01 CDC33 0.44 1.36 ‐0.44 0.03 0 - yes - YLR229C_01 CDC42 0.81 1.11 0.08 0.35 0.01 - yes - YLR418C_01 CDC73 0.19 1.12 0.03 0.73 0 - yes - YIL003W_01 CFD1 0.39 0.64 ‐0.76 0.03 0.01 - yes - YNR001C_01 CIT1 0.29 0.62 ‐0.05 0.37 0.04 - yes - YKL190W_01 CNB1 0.85 1.36 ‐0.32 0.06 0.01 - yes - YGL223C_01 COG1 0.05 0.66 ‐0.8 0.18 0.01 - yes - YOL096C_01 COQ3 0.02 0.8 0 0.9 0.01 - yes - YDR204W_01 COQ4 0.38 0.94 ‐0.43 0 0 - yes - YBOX_TIL1000017 COX17 0.66 1.12 ‐0.06 0.38 0.01 - yes - YDR231C_01 COX20 0.64 1.33 0.02 0.25 0 - yes - YNL052W_01 COX5A 0.44 1.48 ‐0.07 0.4 0.02 - yes - YIL111W_01 COX5B 0.46 0.67 ‐0.49 0.11 0.01 - yes - YLR395C_01 COX8 0.22 1.61 ‐0.05 0.54 0 - yes - YDR304C_01 CPR5 0.75 1.13 0.12 0.06 0.02 - yes - YNR028W_01 CPR8 0.46 0.79 ‐0.47 0.05 0 - yes - YML101C_01 CUE4 0.46 1.1 ‐1.21 0 0 - yes - YDR482C_01 CWC21 0.34 0.71 ‐0.61 0.1 0 - yes - YJR048W_01 CYC1 0.03 0.96 ‐0.45 0.5 0 - yes - YIR032C_01 DAL3 ‐0.29 1.45 ‐1.7 0.07 0.03 - yes - YGR113W_01 DAM1 0.3 0.66 ‐0.24 0.06 0 - yes - YLR128W_01 DCN1 0.31 0.7 0 0.31 0.05 - yes - YOR236W_01 DFR1 0.42 1.33 ‐0.88 0.01 0 - yes - YPR082C_01 DIB1 0.29 0.77 ‐0.26 0.21 0.01 - yes - YDL178W_01 DLD2 0.1 0.66 0.13 0.96 0.05 - yes - YHR044C_01 DOG1 0.93 0.95 0.05 0.09 0.03 - yes - YNL001W_01 DOM34 0.12 0.74 ‐0.2 0.61 0.01 - yes - YBR278W_01 DPB3 0.77 1.1 ‐0.07 0.27 0.01 - yes - YLR172C_01 DPH5 0.73 0.9 0.15 0.28 0 - yes - YMR276W_01 DSK2 ‐0.01 1.31 ‐0.16 0.52 0 - yes - YPR017C_01 DSS4 0.18 1.18 ‐0.54 0.12 0 - yes - YPR023C_01 EAF3 0.34 0.68 ‐0.14 0.22 0.02 - yes - YLR443W_01 ECM7 0.07 0.73 ‐0.43 0.17 0.01 - yes - YGL222C_01 EDC1 0 1.28 ‐0.38 0.47 0.02 - yes - YPL037C_01 EGD1 0.59 1.08 ‐0.29 0.08 0 - yes - YNL327W_01 EGT2 ‐0.24 0.68 ‐1.11 0.07 0 - yes - YKL160W_01 ELF1 0.79 0.84 ‐0.06 0.08 0 - yes - YGL200C_01 EMP24 1.17 1.45 0.19 0.11 0.01 - yes - YHR123W_01 EPT1 0.02 0.81 ‐0.51 0.09 0 - yes - YMR208W_01 ERG12 0.35 0.91 ‐0.18 0.23 0.01 - yes - YLR100W_01 ERG27 0.36 1.33 ‐0.09 0.17 0.01 - yes - YAR002CA01 ERP1 0.8 1.42 ‐0.05 0.12 0.01 - yes - YAL007C_01 ERP2 0.67 0.8 ‐0.18 0.13 0.02 - yes - YGL002W_01 ERP6 0.52 0.78 ‐0.28 0.07 0.02 - yes - YGR284C_01 ERV29 0.7 1 ‐0.06 0.21 0.01 - yes - YBR026C_01 ETR1 0.71 0.93 ‐0.26 0.14 0.02 - yes - YDR130C_01 FIN1 0 0.67 ‐0.78 0.13 0 - yes - YIL065C_01 FIS1 0.4 1.4 ‐0.23 0.29 0.01 - yes - YOR382W_01 FIT2 0.13 0.91 ‐0.85 0.05 0 - yes - YNL068C_01 FKH2 ‐0.35 0.67 ‐1.15 0.06 0 - yes - YIL134W_01 FLX1 0.14 0.61 ‐0.62 0.1 0.01 - yes - YHR176W_01 FMO1 0.39 0.69 ‐0.71 0.01 0.02 - yes - YMR020W_01 FMS1 ‐0.15 0.7 0.06 0.39 0.04 - yes - YDR519W_01 FPR2 0.73 1.21 ‐0.3 0.06 0.01 - yes -

152

YML074C_01 FPR3 ‐0.57 0.61 ‐0.39 0.58 0.05 - yes - YOR324C_01 FRT1 0.38 1.16 ‐0.75 0.09 0 - yes - YAL008W_01 FUN14 0.12 0.96 ‐0.83 0.1 0.01 - yes - YAL044C_01 GCV3 0.94 1.95 0.04 0.11 0 - yes - YOR375C_01 GDH1 0.25 1.16 ‐0.07 0.58 0.01 - yes - YNL255C_01 GIS2 ‐0.24 0.68 ‐0.21 0.92 0.01 - yes - YDR272W_01 GLO2 ‐0.18 1.01 0.1 0.45 0.02 - yes - YDL022W_01 GPD1 0.61 0.62 0.19 0.19 0 - yes - YGL181W_01 GTS1 0.5 0.61 ‐0.3 0.01 0.05 - yes - YDR454C_01 GUK1 1.04 2.12 ‐0.15 0.06 0.01 - yes - YIL041W_01 GVP36 ‐0.26 0.82 ‐0.83 0.15 0.02 - yes - YNL281W_01 HCH1 1.05 1.66 0.1 0.09 0 - yes - YDL205C_01 HEM3 0.24 0.67 0.04 0.5 0.02 - yes - YBOX_OCH1000016 HHT1 0.73 0.89 ‐0.31 0.13 0.04 - yes - YFR025C_01 HIS2 0.56 0.99 ‐0.21 0.06 0.01 - yes - YOR202W_01 HIS3 1.04 1.34 ‐0.16 0.06 0 - yes - YCL030C_01 HIS4 ‐0.17 0.6 ‐0.97 0.02 0 - yes - YIL116W_01 HIS5 0.35 0.84 ‐0.26 0.1 0.03 - yes - YLR450W_01 HMG2 ‐0.59 0.97 ‐0.26 0.42 0.01 - yes - YER062C_01 HOR2 0.3 0.71 ‐0.58 0.05 0.05 - yes - YOL133W_01 HRT1 1.24 1.21 0.11 0.1 0 - yes - YGL073W_01 HSF1 ‐0.51 0.63 ‐1.31 0.04 0 - yes - YPL015C_01 HST2 ‐0.16 0.98 ‐0.63 0.41 0.02 - yes - YBOX_OCH1000013 HTB2 0.44 0.91 ‐0.23 0.21 0 - yes - YPL244C_01 HUT1 0.41 0.74 ‐0.49 0.05 0.03 - yes - YBOX_OCH1000041 HYP2 0.84 0.72 0.13 0.09 0 - yes - YOR126C_01 IAH1 0.48 0.95 ‐0.21 0.12 0.02 - yes - YBOX_OCH1000019 ICS2 0.66 0.92 ‐0.14 0.17 0.01 - yes - YBOX_TIL1000316 ICY2 0.51 0.88 0.17 0.38 0.03 - yes - YDL181W_01 INH1 0.01 1.25 ‐0.26 0.65 0 - yes - YOR109W_01 INP53 ‐0.45 0.88 ‐0.83 0.31 0 - yes - YOL065C_01 INP54 ‐0.3 0.8 ‐0.46 0.67 0 - yes - YBR011C_01 IPP1 0.6 0.97 0.04 0.07 0.01 - yes - YOR226C_01 ISU2 0.51 1.33 ‐0.5 0.09 0.01 - yes - YKR038C_01 KAE1 0.1 0.76 ‐0.27 0.39 0 - yes - YDL049C_01 KNH1 0.2 0.65 ‐0.47 0.01 0.01 - yes - YOR099W_01 KTR1 0 0.68 ‐0.28 0.56 0.03 - yes - YNL071W_01 LAT1 ‐0.41 0.95 0.12 0.49 0.02 - yes - YPL213W_01 LEA1 0.46 0.71 ‐0.51 0.08 0.01 - yes - YDL051W_01 LHP1 0.43 0.76 ‐0.4 0.11 0 - yes - YFR001W_01 LOC1 0.56 0.69 ‐0.7 0.01 0 - yes - YNR008W_01 LRO1 ‐0.29 0.83 ‐0.72 0.54 0 - yes - YGR136W_01 LSB1 0.09 1 ‐0.28 0.2 0 - yes - YOR142W_01 LSC1 0.05 0.9 0.19 0.43 0 - yes - YGR244C_01 LSC2 0.02 0.64 ‐0.15 0.65 0.02 - yes - YGL099W_01 LSG1 0.11 0.83 ‐0.21 0.49 0.01 - yes - YPR073C_01 LTP1 0.22 0.87 ‐0.04 0.57 0.04 - yes - YIL094C_01 LYS12 0.44 0.89 0.04 0.46 0.04 - yes - YBR115C_01 LYS2 ‐0.78 0.79 ‐0.43 0.48 0.03 - yes - YDR234W_01 LYS4 0.18 1.37 0.12 0.9 0 - yes - YAL025C_01 MAK16 0.32 0.62 ‐0.77 0.08 0.02 - yes - YPR051W_01 MAK3 0.57 1.28 ‐0.39 0 0.01 - yes - YCR020CA01 MAK31 0.45 0.61 ‐0.82 0.01 0.02 - yes - YBL091C_01 MAP2 0.53 0.86 ‐0.17 0.09 0.01 - yes - YOR298CA01 MBF1 0.19 0.7 0.04 0.73 0.02 - yes - YOL111C_01 MDY2 0.19 0.96 ‐0.36 0.11 0 - yes - YNL142W_01 MEP2 ‐0.33 0.75 ‐0.06 0.55 0 - yes - YOL064C_01 MET22 0.51 0.75 ‐0.33 0.02 0.01 - yes - YIR017C_01 MET28 0.75 0.88 ‐0.27 0.13 0.03 - yes - YOR241W_01 MET7 ‐0.17 0.79 ‐0.14 0.92 0 - yes - YJR144W_01 MGM101 0.25 1.22 ‐0.52 0.24 0.01 - yes - YDR031W_01 MIC14 0.56 0.8 ‐0.34 0.09 0.04 - yes - YOL026C_01 MIM1 1.07 1.75 0 0.11 0.04 - yes - YPR188C_01 MLC2 0.62 1.05 ‐0.23 0.08 0 - yes - YNL005C_01 MRP7 ‐0.24 0.62 ‐0.48 0.73 0.01 - yes - YKL142W_01 MRP8 0.7 1.58 ‐0.35 0.08 0 - yes - YDL202W_01 MRPL11 0.71 0.69 ‐0.56 0.05 0.05 - yes -

153

YKR006C_01 MRPL13 0.53 0.73 ‐0.41 0 0 - yes - YLR312WA01 MRPL15 0.22 0.66 ‐0.45 0.28 0.01 - yes - YBL038W_01 MRPL16 0.37 1.15 0.04 0.47 0.01 - yes - YNL177C_01 MRPL22 0.22 0.89 ‐0.52 0.26 0.02 - yes - YBR122C_01 MRPL36 1.04 1.35 0.18 0.1 0.05 - yes - YKL170W_01 MRPL38 0.31 0.71 ‐0.56 0.01 0 - yes - YMR225C_01 MRPL44 0.52 0.77 ‐0.15 0.12 0.02 - yes - YPR100W_01 MRPL51 0.61 0.71 ‐0.49 0.11 0.04 - yes - YNL306W_01 MRPS18 0.63 1.1 ‐0.28 0.14 0 - yes - YMR158W_01 MRPS8 0.43 1.21 ‐0.06 0.19 0 - yes - YHR005CA01 MRS11 0.05 1.12 ‐0.41 0.48 0 - yes - YBR091C_01 MRS5 0.26 0.96 ‐0.36 0.32 0.02 - yes - YOR370C_01 MRS6 0.25 0.75 ‐0.65 0 0 - yes - YNR049C_01 MSO1 0.57 0.73 ‐0.84 0 0 - yes - YGR257C_01 MTM1 0.51 0.83 ‐0.1 0.11 0.03 - yes - YGR055W_01 MUP1 ‐0.47 1.05 0.11 0.43 0 - yes - YGR007W_01 MUQ1 0.29 0.83 ‐0.14 0.39 0.02 - yes - YKL129C_01 MYO3 0.34 0.63 ‐0.58 0.01 0 - yes - YKR048C_01 NAP1 0.78 1.19 0.2 0.25 0.01 - yes - YNL240C_01 NAR1 0.09 0.86 ‐0.05 0.24 0 - yes - YGR232W_01 NAS6 0.46 1.56 0.02 0.33 0 - yes - YBOX_JXN1000038 NCB2 0.45 0.85 ‐0.56 0.02 0 - yes - YDL002C_01 NHP10 0.27 0.95 ‐0.62 0.03 0.01 - yes - YDR456W_01 NHX1 0.11 0.87 0.13 0.96 0.05 - yes - YLR195C_01 NMT1 0.53 0.74 0.1 0.11 0.01 - yes - YBOX_IGR1000002 no name 0.37 0.97 0.12 0.78 0.04 - yes - YBOX_IGR1000049 no name 0.71 0.92 ‐0.14 0.05 0.02 - yes - YBOX_IGR1000065 no name 0.41 0.83 ‐0.71 0 0.02 - yes - YBOX_IGR1000080 no name 0.36 0.76 ‐0.94 0.07 0.03 - yes - YBOX_IGR1000108 no name ‐0.71 0.81 ‐0.48 0.7 0.01 - yes - YBOX_IGR1000210 no name 0.28 0.6 ‐0.28 0 0.02 - yes - YBOX_IGX1000046 no name 0.61 1.34 ‐0.14 0.06 0 - yes - YOL041C_01 NOP12 0.38 0.87 ‐0.22 0 0.01 - yes - YER126C_01 NSA2 0.23 0.84 ‐0.14 0.53 0 - yes - YMR153W_01 NUP53 0.25 0.81 ‐0.81 0.02 0 - yes - YDL193W_01 NUS1 0.65 0.89 0 0.09 0 - yes - YPL134C_01 ODC1 0.56 0.93 ‐0.65 0.05 0 - yes - YJL002C_01 OST1 0.49 0.93 ‐0.49 0 0 - yes - YOR103C_01 OST2 0.28 1.02 ‐0.56 0.06 0.02 - yes - YOR085W_01 OST3 0.52 0.82 ‐0.37 0.01 0.01 - yes - YGR078C_01 PAC10 0.11 0.75 ‐0.4 0.24 0.01 - yes - YHR063C_01 PAN5 0.38 0.79 ‐0.08 0.3 0.05 - yes - YNL015W_01 PBI2 0.55 1.01 ‐0.69 0.09 0 - yes - YNL289W_01 PCL1 0.76 0.65 0.04 0.18 0.04 - yes - YGR202C_01 PCT1 ‐0.1 0.69 ‐0.77 0.23 0.01 - yes - YER178W_01 PDA1 0.55 0.94 ‐0.03 0.08 0 - yes - YBR221C_01 PDB1 0.25 0.87 0.14 0.68 0 - yes - YGL248W_01 PDE1 0.19 0.87 ‐0.38 0.21 0.02 - yes - YNL231C_01 PDR16 ‐0.4 0.81 ‐0.47 0.8 0 - yes - YBR035C_01 PDX3 0.82 1.48 0.14 0.15 0 - yes - YKR046C_01 PET10 0.15 0.71 0.05 0.85 0.02 - yes - YDR079W_01 PET100 ‐0.1 1.32 ‐0.62 0.49 0 - yes - YNL003C_01 PET8 0.45 0.66 ‐0.72 0.01 0 - yes - YAL055W_01 PEX22 0.43 1 ‐0.4 0.02 0.03 - yes - YPL112C_01 PEX25 0.67 1.11 ‐0.37 0.11 0.02 - yes - YKL127W_01 PGM1 0.38 0.88 0.11 0.23 0.02 - yes - YBOX_OCH1000056 PHB2 0.77 0.85 0.14 0.11 0.04 - yes - YNL097C_01 PHO23 0.22 0.66 ‐0.44 0.05 0 - yes - YDR481C_01 PHO8 0.36 0.88 ‐0.15 0.12 0.03 - yes - YPR113W_01 PIS1 0.76 0.91 0.01 0.09 0.03 - yes - YAL023C_01 PMT2 ‐0.01 0.83 ‐0.02 1 0.01 - yes - YBR022W_01 POA1 0.48 0.62 ‐0.94 0.05 0.02 - yes - YBR088C_01 POL30 0.51 0.77 ‐0.21 0.02 0.02 - yes - YAL033W_01 POP5 0.41 1.05 ‐1.09 0.05 0.02 - yes - YDR452W_01 PPN1 ‐0.34 0.65 ‐0.38 0.9 0 - yes - YCL057W_01 PRD1 ‐0.65 0.73 ‐0.23 0.53 0.03 - yes - YBOX_JXN1000102 PRE3 0.46 1.05 ‐0.53 0.01 0 - yes -

154

YOL038W_01 PRE6 0.16 1.07 ‐0.44 0 0 - yes - YGR135W_01 PRE9 0.71 1.04 ‐0.12 0.13 0.04 - yes - YIR008C_01 PRI1 ‐0.38 0.64 ‐0.96 0.32 0 - yes - YKL045W_01 PRI2 ‐0.37 0.75 ‐0.2 0.55 0.03 - yes - YER023W_01 PRO3 0.56 0.89 0.18 0.26 0.04 - yes - YAL032C_01 PRP45 ‐0.06 1.08 ‐0.3 0.64 0.04 - yes - YER099C_01 PRS2 ‐0.16 0.78 ‐0.47 0.64 0.01 - yes - YBR125C_01 PTC4 0.51 0.84 ‐0.13 0.24 0.04 - yes - YER094C_01 PUP3 0.15 1.42 0.06 0.82 0.02 - yes - YOR243C_01 PUS7 0.03 0.63 ‐0.98 0.01 0 - yes - YHR037W_01 PUT2 ‐0.32 1 0.11 0.45 0 - yes - YJL166W_01 QCR8 0.43 0.68 ‐0.28 0.18 0 - yes - YGL246C_01 RAI1 ‐0.14 0.69 ‐0.49 0.64 0 - yes - YDL090C_01 RAM1 ‐0.09 1.23 0.09 0.78 0.01 - yes - YNL098C_01 RAS2 0.02 0.9 ‐0.06 0.9 0.02 - yes - YAL036C_01 RBG1 0.21 0.78 ‐0.3 0.27 0.01 - yes - YBR002C_01 RER2 0.44 0.94 ‐0.66 0.07 0.04 - yes - YLR059C_01 REX2 0.6 1.26 ‐0.26 0.06 0 - yes - YAR007C_01 RFA1 ‐0.04 0.77 ‐1.03 0.21 0.02 - yes - YJL173C_01 RFA3 0.32 1.15 ‐0.9 0.05 0 - yes - YBR087W_01 RFC5 0.58 0.69 ‐0.19 0.01 0.01 - yes - YIL118W_01 RHO3 0.45 0.95 ‐0.44 0.23 0.03 - yes - YKR055W_01 RHO4 0.55 0.69 ‐0.27 0 0 - yes - YDR487C_01 RIB3 0.54 0.99 ‐0.4 0 0 - yes - YBR153W_01 RIB7 ‐0.35 0.68 ‐0.66 0.41 0.01 - yes - YMR139W_01 RIM11 0.19 0.75 0.07 0.84 0.04 - yes - YNL207W_01 RIO2 0.05 0.76 0.16 0.78 0.01 - yes - YLR145W_01 RMP1 0.04 0.81 ‐0.91 0.13 0.01 - yes - YNL072W_01 RNH201 ‐0.08 0.92 ‐0.47 0.55 0.01 - yes - YIL021W_01 RPB3 ‐0.16 0.65 ‐0.11 0.91 0.02 - yes - YJL140W_01 RPB4 0.32 0.91 ‐0.64 0.13 0.01 - yes - YDR404C_01 RPB7 0.72 0.87 ‐0.25 0.06 0.05 - yes - YOR224C_01 RPB8 0.1 0.81 ‐0.37 0.46 0 - yes - YNL330C_01 RPD3 0.07 1.01 ‐0.28 0.42 0 - yes - YPR102C_01 RPL11A 0.65 1.26 ‐0.1 0.06 0.01 - yes - YBOX_OCH1000185 RPL13A 0.48 0.66 ‐0.09 0.14 0.02 - yes - YBOX_OCH1000205 RPL14B 0.57 0.96 ‐0.09 0.13 0 - yes - YBOX_OCH1000208 RPL15A 0.44 0.96 ‐0.19 0.34 0.04 - yes - YBOX_OCH1000066 RPL16A 0.59 1 ‐0.58 0.01 0 - yes - YBOX_OCH1000102 RPL16B 0.41 1.2 ‐0.41 0.03 0 - yes - YPL220W_01 RPL1A 0.56 1.63 ‐0.3 0 0 - yes - YBOX_OCH1000181 RPL21B 0.45 0.87 ‐1.29 0.01 0 - yes - YBOX_OCH1000048 RPL24A 0.97 1.63 0 0.18 0.01 - yes - YBOX_OCH1000044 RPL34A 0.29 0.92 ‐0.81 0.13 0 - yes - YDL136W_01 RPL35B 0.54 1.12 ‐0.39 0.05 0 - yes - YPL249CA01 RPL36B 0.58 0.71 ‐0.4 0.01 0.01 - yes - YBOX_OCH1000085 RPL37A 0.48 0.91 ‐1.18 0.01 0 - yes - YKR094C_01 RPL40B 0.41 0.61 ‐0.51 0.12 0 - yes - YBOX_OCH1000152 RPL42B 0.53 0.67 ‐1.23 0.01 0.02 - yes - YBOX_OCH1000167 RPL6B 0.54 1.3 ‐0.29 0.07 0 - yes - YLR421C_01 RPN13 0.41 0.87 0.04 0.43 0.04 - yes - YDL081C_01 RPP1A 0.07 0.94 ‐0.04 0.62 0.01 - yes - YOL039W_01 RPP2A 0.59 1.16 ‐0.58 0.06 0.01 - yes - YDR382W_01 RPP2B 0.44 1.26 ‐0.18 0.3 0 - yes - YBOX_OCH1000150 RPS0A 0.26 0.81 ‐0.99 0.06 0.01 - yes - YOR369C_01 RPS12 0.56 0.78 ‐0.48 0.03 0 - yes - YDR064W_01 RPS13 0.57 1.02 ‐0.23 0.16 0 - yes - YOL040C_01 RPS15 1.12 1.62 ‐0.14 0.06 0 - yes - YDR447C_01 RPS17B 0.73 0.88 ‐0.4 0.16 0.01 - yes - YBOX_OCH1000053 RPS25A 0.44 0.61 ‐0.73 0.03 0.03 - yes - YBOX_OCH1000049 RPS26A 0.69 1.13 ‐0.28 0.21 0.01 - yes - YBOX_OCH1000046 RPS26B 0.82 1.35 ‐0.63 0.09 0 - yes - YBOX_OCH1000111 RPS28A 0.41 0.65 ‐0.51 0.14 0.01 - yes - YLR167W_01 RPS31 0.44 0.77 ‐0.75 0.07 0 - yes - YBOX_OCH1000110 RPS7A 0.47 1.32 0.07 0.42 0 - yes - YER102W_01 RPS8B 0.66 1.76 ‐0.45 0.17 0.01 - yes - YBOX_OCH1000020 RPS9B 0.56 0.89 0.02 0.23 0.04 - yes -

155

YBL025W_01 RRN10 0.58 0.77 ‐0.37 0.09 0.03 - yes - YPR143W_01 RRP15 0.02 0.77 ‐0.11 0.77 0.01 - yes - YLR221C_01 RSA3 0.06 0.96 ‐0.43 0.38 0 - yes - YFR037C_01 RSC8 ‐0.82 0.62 ‐0.73 0.82 0 - yes - YDR041W_01 RSM10 0.38 0.91 ‐0.03 0.6 0.03 - yes - YDR233C_01 RTN1 0.41 0.96 ‐0.39 0.23 0 - yes - YER104W_01 RTT105 0.5 0.71 ‐0.58 0.15 0.02 - yes - YPL235W_01 RVB2 0.22 0.63 ‐0.14 0.35 0.02 - yes - YCR009C_01 RVS161 ‐0.55 0.69 ‐0.36 0.71 0 - yes - YPR129W_01 SCD6 ‐0.26 0.7 ‐0.59 0.5 0 - yes - YER120W_01 SCS2 0.7 1.8 ‐0.17 0.13 0 - yes - YDR469W_01 SDC1 ‐0.24 0.83 ‐0.84 0.24 0.01 - yes - YBL050W_01 SEC17 0.39 0.84 ‐0.6 0.03 0 - yes - YDR498C_01 SEC20 0.36 1.07 ‐0.27 0.21 0.01 - yes - YDR238C_01 SEC26 ‐0.53 0.7 ‐0.57 0.95 0 - yes - YML105C_01 SEC65 0.69 0.76 0.09 0.17 0.02 - yes - YBR171W_01 SEC66 0.47 0.89 ‐0.52 0.06 0 - yes - YLR292C_01 SEC72 0.34 0.68 ‐0.43 0.15 0 - yes - YLR026C_01 SED5 0.07 0.65 ‐0.15 0.67 0.03 - yes - YMR059W_01 SEN15 0.26 0.89 ‐0.35 0.19 0 - yes - YGR208W_01 SER2 0.65 1.42 ‐0.19 0.11 0.02 - yes - YER096W_01 SHC1 0.28 0.84 0.15 0.82 0.04 - yes - YBR263W_01 SHM1 ‐0.09 1.04 0.18 0.36 0.01 - yes - YLR058C_01 SHM2 0.53 0.79 0.12 0.06 0.01 - yes - YGL208W_01 SIP2 0.22 0.8 ‐0.59 0.15 0 - yes - YPR189W_01 SKI3 ‐0.71 0.91 ‐0.79 0.87 0 - yes - YBR077C_01 SLM4 0.84 1.31 ‐0.01 0.19 0.02 - yes - YER029C_01 SMB1 0.04 0.84 ‐0.8 0.09 0.04 - yes - YLR147C_01 SMD3 0.45 0.88 ‐0.83 0.02 0 - yes - YOR159C_01 SME1 0.58 0.72 ‐0.67 0.01 0 - yes - YHL025W_01 SNF6 0.56 0.99 0.09 0.17 0 - yes - YDL098C_01 SNU23 0.44 0.82 ‐0.73 0.02 0 - yes - YHR008C_01 SOD2 0.87 1.64 ‐0.11 0.13 0.01 - yes - YGL127C_01 SOH1 0.48 0.72 ‐0.39 0.03 0 - yes - YLR066W_01 SPC3 0.45 0.71 ‐0.96 0.01 0 - yes - YOL052C_01 SPE2 0.26 0.74 ‐0.4 0.04 0.01 - yes - YOR148C_01 SPP2 0.24 1.2 ‐1.18 0.01 0 - yes - YLR055C_01 SPT8 ‐0.11 0.74 ‐1.16 0.11 0.01 - yes - YHR041C_01 SRB2 ‐0.04 0.72 ‐0.17 0.54 0.01 - yes - YLR119W_01 SRN2 0.63 0.72 0.13 0.14 0.02 - yes - YKL218C_01 SRY1 0.15 0.92 ‐0.04 0.72 0.03 - yes - YNL209W_01 SSB2 0.38 1.1 0.13 0.62 0.03 - yes - YCR073C_01 SSK22 0.28 0.74 ‐0.84 0.02 0 - yes - YMR183C_01 SSO2 ‐0.11 0.65 0.09 0.48 0.05 - yes - YCL032W_01 STE50 0.06 0.66 ‐0.41 0.3 0.05 - yes - YGR008C_01 STF2 0.48 1.01 ‐0.54 0.1 0.02 - yes - YLR375W_01 STP3 0.29 1.28 0.16 0.78 0.03 - yes - YDL048C_01 STP4 0.2 0.73 ‐0.85 0.01 0 - yes - YBOX_TIL1000058 SUN4 ‐0.09 0.64 ‐0.07 0.97 0.03 - yes - YBOX_TIL1000059 SUN4 0.24 0.81 ‐0.29 0.34 0.01 - yes - YLR372W_01 SUR4 0.26 0.66 ‐0.21 0.26 0.03 - yes - YML052W_01 SUR7 0.46 1.46 ‐0.23 0.08 0 - yes - YBR175W_01 SWD3 ‐0.05 0.83 ‐0.5 0.37 0.03 - yes - YBOX_TIL1000092 SWS2 0.29 0.75 ‐0.32 0.09 0 - yes - YNL081C_01 SWS2 0.12 1.11 ‐0.6 0.28 0 - yes - YOR179C_01 SYC1 0.44 0.95 ‐0.7 0.06 0 - yes - YPL129W_01 TAF14 0.33 1.37 ‐0.28 0.36 0 - yes - YPL011C_01 TAF3 ‐0.38 1.1 0.1 0.2 0.01 - yes - YCR060W_01 TAH1 0.06 1.1 ‐0.07 0.78 0.03 - yes - YPR140W_01 TAZ1 0.31 1.06 ‐0.54 0.03 0 - yes - YBOX_OCH1000220 TEF2 0.86 1.48 0.03 0.07 0.03 - yes - YBOX_AAA1000022 TEF4 0.48 1.05 ‐0.26 0.27 0 - yes - YKR062W_01 TFA2 ‐0.55 0.72 0.04 0.52 0 - yes - YOR110W_01 TFC7 0.51 0.6 ‐0.32 0.01 0.01 - yes - YDL080C_01 THI3 0.55 0.73 ‐0.06 0.05 0.02 - yes - YER063W_01 THO1 0.33 0.79 ‐0.3 0.08 0 - yes - YOL072W_01 THP1 0.22 0.68 ‐0.26 0.25 0.01 - yes -

156

YHR025W_01 THR1 0.46 1.04 0.01 0.15 0.02 - yes - YKR059W_01 TIF1 0.57 0.75 0.07 0.1 0.01 - yes - YDR429C_01 TIF35 0.68 1.54 ‐0.14 0.06 0 - yes - YGR033C_01 TIM21 0.28 0.83 ‐0.42 0.23 0.01 - yes - YBOX_TIL1000255 TIM44 0.28 0.73 ‐0.56 0.01 0.01 - yes - YGR260W_01 TNA1 ‐0.29 0.71 ‐0.03 0.67 0 - yes - YHR117W_01 TOM71 ‐0.6 0.72 ‐0.54 0.93 0.01 - yes - YKL166C_01 TPK3 ‐0.25 0.83 ‐0.27 0.95 0.03 - yes - YNL079C_01 TPM1 0.26 0.94 ‐0.65 0.14 0 - yes - YIL138C_01 TPM2 0.2 1.42 ‐0.67 0.26 0.01 - yes - YGL186C_01 TPN1 0.28 0.76 ‐0.64 0.03 0 - yes - YOR273C_01 TPO4 0.24 0.88 ‐0.19 0.11 0 - yes - YOL093W_01 TRM10 ‐0.23 0.64 ‐0.52 0.21 0 - yes - YNR046W_01 TRM112 0.61 1.07 ‐0.41 0.06 0 - yes - YER090W_01 TRP2 0.43 0.65 ‐0.14 0.07 0.01 - yes - YDR354W_01 TRP4 0.23 1.29 0.03 0.71 0.01 - yes - YML124C_01 TUB3 0.36 1.4 0.06 0.54 0 - yes - YGR080W_01 TWF1 0.32 0.66 ‐0.26 0.15 0.01 - yes - YDR177W_01 UBC1 0.29 0.74 ‐0.58 0.01 0 - yes - YBR082C_01 UBC4 0.67 0.72 ‐0.39 0.06 0.05 - yes - YDR059C_01 UBC5 0.53 1 ‐0.77 0.06 0 - yes - YBOX_TIL1000155 UTH1 ‐0.07 0.65 ‐0.35 0.6 0.02 - yes - YKL099C_01 UTP11 0.46 1.1 ‐0.46 0.03 0.02 - yes - YLR373C_01 VID22 ‐0.29 1.19 ‐0.05 0.46 0 - yes - YLR447C_01 VMA6 0.13 1.3 ‐0.07 0.5 0 - yes - YBOX_JXN1000117 VMA9 0.24 0.75 ‐0.37 0.02 0.01 - yes - YOR089C_01 VPS21 0.41 0.71 ‐0.71 0 0 - yes - YLR396C_01 VPS33 ‐0.37 1.14 ‐0.04 0.54 0.01 - yes - YGL095C_01 VPS45 ‐0.12 0.86 0.05 0.48 0.05 - yes - YDR486C_01 VPS60 0.33 0.87 ‐0.54 0.02 0 - yes - YNL246W_01 VPS75 0.71 1.02 0.07 0.22 0.01 - yes - YOR229W_01 WTM2 0.09 0.89 ‐0.46 0.41 0.02 - yes - YFL010C_01 WWM1 0.72 1.12 0.16 0.13 0.01 - yes - YPL252C_01 YAH1 0.69 1 ‐0.22 0.19 0 - yes - YAL027W_01 YAL027W_ORF 0.22 1.22 0.03 0.75 0.01 - yes - YAL044WA_01 YAL044W‐A_ORF 0.6 0.94 ‐0.55 0.01 0 - yes - YAL049C_01 YAL049C_ORF 0.5 1.49 0.08 0.23 0.04 - yes - YIR018W_01 YAP5 0.34 0.99 ‐0.51 0.06 0.01 - yes - YBL010C_01 YBL010C_ORF 0.4 0.66 ‐0.53 0.09 0.04 - yes - YBL095W_01 YBL095W_ORF 0.65 0.96 0.02 0.11 0.01 - yes - YBOX_OCH1000017 YBR090C_OCH__ORF 1.04 1.13 ‐0.43 0.07 0.05 - yes - YBR096W_01 YBR096W_ORF 0.62 0.94 ‐0.51 0.07 0.01 - yes - YBR103CA_01 YBR103C‐A_ORF 0.46 0.73 ‐1.43 0 0.01 - yes - YBR137W_01 YBR137W_ORF 0.67 1.46 0.16 0.42 0.01 - yes - YBR147W_01 YBR147W_ORF 0.47 0.79 ‐0.14 0.12 0.02 - yes - YBR187W_01 YBR187W_ORF 0.75 0.87 0.14 0.08 0.02 - yes - YBR190W_01 YBR190W_ORF 0.19 1.11 ‐0.67 0.22 0 - yes - YBR206W_01 YBR206W_ORF 0.25 1.12 ‐0.3 0.29 0 - yes - YCR090C_01 YCR090C_ORF ‐0.26 0.89 ‐0.58 0.7 0.03 - yes - YDL144C_01 YDL144C_ORF ‐0.21 0.65 ‐0.65 0.33 0.01 - yes - YDL237W_01 YDL237W_ORF 0.57 1.34 0.08 0.43 0.02 - yes - YDL240CA_01 YDL240C‐A_ORF 0.59 0.64 ‐0.66 0.02 0.01 - yes - YBOX_ONO1000022 YDR003W‐A_ONO_ORF 0.52 1.3 ‐0.08 0.39 0.01 - yes - YDR061W_01 YDR061W_ORF ‐0.13 0.82 ‐0.12 0.98 0.01 - yes - YDR357C_01 YDR357C_ORF 0.53 0.76 ‐1.35 0.02 0 - yes - YBOX_OCH1000043 YEL073C_OCH__ORF 0.59 0.82 ‐0.13 0 0 - yes - YER030W_01 YER030W_ORF ‐0.16 0.78 ‐1.04 0.08 0.01 - yes - YER067W_01 YER067W_ORF ‐0.02 0.66 ‐0.2 0.66 0.02 - yes - YER071C_01 YER071C_ORF 0.46 0.98 ‐0.65 0.02 0.02 - yes - YER134C_01 YER134C_ORF 0.64 0.86 ‐0.14 0.07 0.01 - yes - YER163C_01 YER163C_ORF 0.73 1.49 ‐0.43 0.06 0.01 - yes - YFR017C_01 YFR017C_ORF 0.72 1.05 ‐0.09 0.15 0 - yes - YFR044C_01 YFR044C_ORF 0.12 0.81 ‐0.07 0.37 0.02 - yes - YGL157W_01 YGL157W_ORF 0.69 1.29 0.14 0.09 0.01 - yes - YGL159W_01 YGL159W_ORF 0.7 1 ‐0.27 0.09 0 - yes - YGL226W_01 YGL226W_ORF 0.65 1.24 ‐0.25 0.11 0.05 - yes - YGR015C_01 YGR015C_ORF 0.01 0.8 ‐0.31 0.7 0.03 - yes -

157

YGR137W_01 YGR137W_ORF 0.62 1.23 0.2 0.16 0.02 - yes - YGR201C_01 YGR201C_ORF ‐0.01 1.06 ‐0.19 0.78 0.03 - yes - YGR203W_01 YGR203W_ORF 0.48 1.16 ‐0.23 0.24 0 - yes - YGR207C_01 YGR207C_ORF 0.05 1.14 ‐0.1 0.79 0 - yes - YGR210C_01 YGR210C_ORF ‐0.02 1.19 ‐0.4 0.61 0 - yes - YHR029C_01 YHI9 0.3 1.34 0.17 0.78 0.02 - yes - YMR241W_01 YHM2 0.34 0.81 ‐0.27 0.25 0 - yes - YDR451C_01 YHP1 ‐0.04 0.74 ‐0.47 0.49 0 - yes - YHR162W_01 YHR162W_ORF 0.73 1.37 0.08 0.13 0 - yes - YHR199C_01 YHR199C_ORF 0.67 1.01 0.07 0.06 0 - yes - YBOX_ONO1000054 YIL002W‐A_ONO_ORF 0.4 0.74 ‐1.13 0.06 0.01 - yes - YIL087C_01 YIL087C_ORF 0.5 1.02 ‐0.07 0.31 0.04 - yes - YIL158W_01 YIL158W_ORF 0.33 0.74 ‐0.05 0.34 0.04 - yes - YGL198W_01 YIP4 0.31 2.02 ‐0.27 0.25 0.01 - yes - YIR035C_01 YIR035C_ORF ‐0.04 0.93 ‐0.01 0.95 0 - yes - YIR036C_01 YIR036C_ORF 0.44 1.85 0.18 0.66 0 - yes - YJR024C_01 YJR024C_ORF 0.28 0.96 0.02 0.64 0.01 - yes - YJR142W_01 YJR142W_ORF ‐0.17 0.75 ‐0.44 0.69 0.03 - yes - YKL107W_01 YKL107W_ORF 0.44 0.87 ‐0.12 0.02 0 - yes - YKR070W_01 YKR070W_ORF ‐0.52 0.8 0.02 0.54 0.02 - yes - YLL014W_01 YLL014W_ORF 0.5 0.91 ‐0.14 0.25 0 - yes - YLR077W_01 YLR077W_ORF ‐0.36 0.7 ‐0.07 0.56 0.02 - yes - YLR132C_01 YLR132C_ORF 0.14 0.62 ‐0.73 0 0 - yes - YLR168C_01 YLR168C_ORF 0.6 1.2 ‐0.14 0.12 0.02 - yes - YLR199C_01 YLR199C_ORF 0.12 0.78 ‐0.36 0.56 0.01 - yes - YLR202C_01 YLR202C_ORF 0.02 0.76 ‐0.69 0.11 0 - yes - YLR224W_01 YLR224W_ORF ‐0.13 0.82 ‐0.31 0.68 0.04 - yes - YLR252W_01 YLR252W_ORF ‐0.05 0.72 ‐0.59 0.27 0.01 - yes - YBOX_ONO1000083 YLR361C‐A_ONO_ORF 0.28 1.04 ‐0.61 0.25 0.01 - yes - YLR404W_01 YLR404W_ORF 0.21 0.78 0 0.81 0.04 - yes - YML025C_01 YML6 0.7 1.05 ‐0.08 0.09 0.05 - yes - YMR130W_01 YMR130W_ORF ‐0.02 1.21 ‐0.91 0.19 0.04 - yes - YMR244CA01 YMR244C‐A_ORF 0.43 0.69 ‐0.71 0.02 0.01 - yes - YFR049W_01 YMR31 0.93 1.09 0.06 0.08 0.01 - yes - YNL168C_01 YNL168C_ORF 0.76 1.16 ‐0.09 0.08 0.03 - yes - YNL181W_01 YNL181W_ORF 0.07 0.72 ‐0.35 0.35 0.01 - yes - YNL184C_01 YNL184C_ORF 0.62 1.12 0.11 0.18 0.01 - yes - YNL274C_01 YNL274C_ORF 0.16 1.41 0.16 1 0.01 - yes - YBOX_JXN1000015 YOP1 0.84 1.36 ‐0.22 0.06 0.01 - yes - YBOX_ONO1000114 YOR020W‐A_ONO_ORF 0 1.16 ‐0.57 0.32 0 - yes - YOR021C_01 YOR021C_ORF 0.87 1.21 0.01 0.05 0.01 - yes - YOR051C_01 YOR051C_ORF 0.08 0.81 0.09 0.97 0.03 - yes - YOR201C_01 YOR201C_ORF 0.15 0.85 0.02 0.78 0.01 - yes - YOR220W_01 YOR220W_ORF 0.24 0.71 ‐0.38 0.27 0 - yes - YOR238W_01 YOR238W_ORF 0.5 0.94 ‐0.51 0.01 0.01 - yes - YBOX_OCH1000114 YOR387C_OCH__ORF 0.75 0.86 0.01 0.11 0.02 - yes - YFR003C_01 YPI1 0.63 1.06 ‐0.42 0.06 0 - yes - YPL067C_01 YPL067C_ORF 0.75 0.83 ‐0.08 0.07 0.02 - yes - YPL107W_01 YPL107W_ORF ‐0.14 0.75 ‐0.17 0.94 0.01 - yes - YPR053C_01 YPR053C_ORF 0.35 0.66 0.15 0.58 0.03 - yes - YPR109W_01 YPR109W_ORF 0.34 0.62 ‐0.24 0.02 0.05 - yes - YPR148C_01 YPR148C_ORF ‐0.15 0.81 ‐0.52 0.34 0.01 - yes - YPR158W_01 YPR158W_ORF 0.57 0.6 ‐0.62 0.06 0.03 - yes - YPR172W_01 YPR172W_ORF ‐0.43 0.65 ‐0.47 0.92 0 - yes - YLR121C_01 YPS3 0.2 0.61 ‐0.46 0.1 0 - yes - YML001W_01 YPT7 0.7 1.48 0.03 0.08 0 - yes - YDR381W_01 YRA1 0.11 1.29 0.19 0.87 0.02 - yes - YHR016C_01 YSC84 ‐0.09 0.93 ‐0.56 0.36 0 - yes - YGR285C_01 ZUO1 0.17 0.81 ‐0.28 0.5 0 - yes -

158

Supplemental table S2: List of genes implicated in response to copper- and oxidative stress

The list was compiled by downloading all genes affiliated with the GO terms “copper ion binding, response to copper ion, cellular copper ion homeostasis, copper ion import, copper ion transport, cellular response to oxidative stress” and “pentose- phosphate shunt, oxidative branch" (Source: SGD, December 2010). A total of 101 genes were retrieved.

Gene ORF Description COX1 Q0045 cytochrome c oxidase subunit I COX2 Q0250 cytochrome c oxidase subunit II YBL055C YBL055C Hypothetical ORF PRX1 YBL064C also called mTPx I, a mitochondrial isoform of thioredoxin peroxidase UGA2 YBR006W succinate semialdehyde dehydrogenase SCO2 YBR024W Originally identified as a multicopy suppressor of a respiratory defective mutant SCO1 YBR037C inner membrane protein ZTA1 YBR046C Zeta‐crystallin homolog, YBP1 YBR216C redox regulator Phospholipid hydroperoxide glutathione peroxidase induced during oxidative GPX2 YBR244W stress PCA1 YBR295W P‐type ATPase Cu(2+)‐transporting (putative) YCL033C YCL033C Hypothetical ORF GRX1 YCL035C glutaredoxin|EC 1.20.4.1 TRX3 YCR083W thioredoxin YCR102C YCR102C S000000699 SIT4 YDL047W similar to catalytic subunit of bovine type 2A protein phosphatase YDL124W YDL124W Hypothetical ORF FAP7 YDL166C Essential nuclear protein, involved in the oxidative stress response GRX3 YDR098C glutaredoxin copper‐transporting P‐type ATPase with similarity to human Menkes and CCC2 YDR270W Wilsons genes Involved in the diauxic switch; function substituted by human Bcl‐XL; involved in SVF1 YDR346C cell survival TRR1 YDR353W thioredoxin reductase|EC 1.6.4.5 YPR1 YDR368W homologous to the aldo‐keto reductase protein family TSA2 YDR453C thioredoxin‐peroxidase (TPx); reduces H2O2 and alkyl hydroperoxides YDR506C YDR506C Hypothetical ORF GRX2 YDR513W glutaredoxin|thioltransferase/glutathione reductase|EC 1.20.4.1 CUP5 YEL027W vacuolar ATP synthase proteolipid C AFG1 YEL052W ATPase family MXR1 YER042W peptide methionine sulfoxide reductase

159

GRX4 YER174C Glutaredoxin HSP12 YFL014W heat shock protein 12 ACT1 YFL039C S000001855 FET5 YFL041W multicopper oxidase|type 1 integral membrane protein YFR055W YFR055W Hypothetical ORF ACE1 YGL166W transcriptional activator ERV1 YGR029W S000003261 transcriptional activator of the SKN7 mediated 'two‐component' regulatory ASK10 YGR097W system TRX2 YGR209C thioredoxin|EC 1.8.4.8 SOL4 YGR248W 6‐phosphogluconolactonase GND2 YGR256W 6‐phosphogluconate dehydrogenase GRE3 YHR104W aldose reductase TRR2 YHR106W thioredoxin reductase UBA4 YHR111W Protein that activates Urm1p before its conjugation to proteins (urmylation) SOL3 YHR163W weak multicopy suppressor of los1‐1 CTR2 YHR175W Putative low‐affinity copper transporter of the vacuolar membrane STB5 YHR178W binds Sin3p in two‐hybrid assay GND1 YHR183W 6‐phosphogluconate dehydrogenase SKN7 YHR206W Protein with similarity to DNA‐binding region of heat shock transcription factors URM1 YIL008W ubiquitin‐like protein DOT5 YIL010W ‐ HYR1 YIR037W glutathione‐peroxidase (putative) GEF1 YJR040W transport protein involved in intracellular iron metabolism (putative) YJR096W YJR096W Protein with similarity to aldo‐keto reductases SOD1 YJR104C Cu, Zn superoxide dismutase GPX1 YKL026C Phospholipid hydroperoxide glutathione peroxidase TMA19 YKL056C Hypothetical ORF YKL069W YKL069W Hypothetical ORF SRX1 YKL086W ATP‐dependent cysteine sulfinic acid reductase YKL137W YKL137W Hypothetical ORF LTV1 YKL143W Protein required for viability at low temperature MCR1 YKL150W NADH‐cytochrome b5 reductase FRE2 YKL220C ferric reductase CCP1 YKR066C cytochrome c peroxidase COX17 YLL009C S000003932 FRE6 YLL051C S000003974 LOT6 YLR011W LOw Temperature responsive TRX1 YLR043C thioredoxin|EC 1.8.4.8 AHP1 YLR109W alkyl hydroperoxide reductase|EC 1.11.1.‐ YLR126C YLR126C Hypothetical ORF FRE1 YLR214W cupric reductase|ferric reductase RCK2 YLR248W Serine/threonine protein kinase CTR3 YLR411W copper transporter YAP1 YML007W jun‐like transcription factor TSA1 YML028W thioredoxin‐peroxidase (TPx); reduces H2O2 and alkyl hydroperoxides

160

ALO1 YML086C D‐arabinono‐1,4‐lactone oxidase MAC1 YMR021C metal‐binding transcriptional activator CCS1 YMR038C copper chaperone for superoxide dismutase Sod1p FET3 YMR058W multicopper oxidase GAD1 YMR250W glutamate decarboxylase FET4 YMR319C low affinity Fe2+ transport protein NCE103 YNL036W carbonic anhydrase‐like protein EOS1 YNL080C Deletion causes slight growth defect, similar to U. maydis myp1 protein Putative protein tyrosine phosphatase, required in response to oxidative OCA1 YNL099C damage ZWF1 YNL241C glucose‐6‐phosphate dehydrogenase ATX1 YNL259C copper binding homeostasis protein (putative) SMF1 YOL122C plasma membrane/mitochondrial membrane protein FRE7 YOL152W Putative ferric reductase with similarity to Fre2p; CRS5 YOR031W metallothionein‐like protein GCY1 YOR120W Galactose‐induced transcript TIM18 YOR297C translocase GRX5 YPL059W glutaredoxin GLR1 YPL091W glutathione oxidoreductase|EC 1.6.4.2 Mitochondrial membrane protein required for assembly of active cytochrome c COX11 YPL132W oxidase CUP9 YPL177C DNA binding protein (putative) POS5 YPL188W involved in oxidative stress OXR1 YPL196W OXidation Resistance AFT2 YPL202C Activator of Iron (Fe) Transcription YAR1 YPL239W 200‐amino‐acid protein with two ANK repeat motifs Transcriptional activator involved in the transcription of TPO2, HSP30 and other HAA1 YPR008W genes CTR1 YPR124W copper transporter

161

Supplemental table S3: Genes that were > 1.5 fold up-regulated on average upon SLF1 overexpression (24 hours)

Oligo ID: Feature name on the array, exp.1 / 2: log2 ratios of the two SLF1 24 h - overexpression experiments. Average log2 6 h: average log2 ratio of the change in two biological replicates afer 6 h - SLF1 overexpression, Cu/Ox: Copper and oxidative stress related mRNAs.

avg Slf1 Sro9 Oligo ID Name exp.1 exp.2 log2 6h target target Cu/Ox YKL192C_01 ACP1 1.23 1.15 0.31 yes yes ‐ YKL206C_01 ADD66 0.78 0.84 0.23 yes yes ‐ YLR109W_01 AHP1 1.51 1.57 0.09 yes yes yes YJL122W_01 ALB1 0.67 1.05 0.05 yes ‐ ‐ YJL024C_01 APS3 0.55 0.78 0.2 yes yes ‐ YBR149W_01 ARA1 0.84 0.8 0.1 yes ‐ ‐ YIL062C_01 ARC15 1.14 1.01 ‐0.06 yes yes ‐ YLR370C_01 ARC18 1.27 1.19 0.63 yes yes ‐ YPL271W_01 ATP15 0.69 1.02 0.41 yes yes ‐ YML081CA01 ATP18 0.9 0.9 0.51 yes ‐ ‐ YPR020W_01 ATP20 1.02 1.03 0.41 yes yes ‐ YIL124W_01 AYR1 0.84 0.65 0.33 yes yes ‐ YML077W_01 BET5 0.56 0.65 0.35 yes ‐ ‐ YNL269W_01 BSC4 0.82 0.41 ‐0.24 yes ‐ ‐ YBOX_JXN1000009 CDC21 0.61 0.57 ‐0.52 yes ‐ ‐ YDL165W_01 CDC36 0.92 1.05 0.19 yes yes ‐ YLL050C_01 COF1 0.57 0.78 0.56 yes yes ‐ YBOX_OCH1000058 COS8 0 0.77 ‐0.02 yes yes ‐ YLR038C_01 COX12 0.83 0.89 ‐0.04 yes yes ‐ YMR256C_01 COX7 0.75 1.19 0.52 yes yes ‐ YHR057C_01 CPR2 0.59 0.84 0.3 yes yes ‐ YLR216C_01 CPR6 0.92 1 0.49 yes ‐ ‐ YBOX_JXN1000112 CPT1 0.87 1.19 0.7 yes ‐ ‐ YHR053C_01 CUP1‐1 1.42 1.24 ‐0.37 yes ‐ yes YOR163W_01 DDP1 0.81 0.9 0.37 yes yes ‐ YBL001C_01 ECM15 0.98 0.95 0.5 yes yes ‐ YLR186W_01 EMG1 0.48 0.93 0.32 yes yes ‐ YOL071W_01 EMI5 1.2 1.38 0.19 yes ‐ ‐ YER044C_01 ERG28 0 0.74 0.48 yes yes ‐ YBOX_JXN1000051 ERV1 0.97 0.88 0.32 yes yes yes YGR029W_01 ERV1 0.91 0.88 ‐0.37 yes yes yes YPR062W_01 FCY1 0.47 0.76 ‐0.14 yes yes ‐ YIL098C_01 FMC1 0.62 0.97 0.04 yes ‐ ‐ YKR049C_01 FMP46 1.05 0.23 0.21 yes ‐ ‐ YMR222C_01 FSH2 1.14 0.8 0.35 yes yes ‐ YOR280C_01 FSH3 0 0.63 ‐0.14 yes ‐ ‐ YKR026C_01 GCN3 0.89 0 0.41 yes ‐ ‐ YFL017C_01 GNA1 0.63 0 ‐0.32 yes yes ‐ YHL031C_01 GOS1 0.48 0.71 0.28 yes yes ‐ YLR293C_01 GSP1 0.41 0.85 ‐0.19 yes yes ‐ YOR185C_01 GSP2 0.57 0.66 0.35 yes yes ‐ YML121W_01 GTR1 0.74 0.57 0.41 yes yes ‐ YER055C_01 HIS1 0.79 0.67 0.48 yes yes ‐ YBOX_OCH1000027 HMRA1 0.61 0.8 0.71 yes ‐ ‐ YFL014W_01 HSP12 3.03 3.84 0.66 yes ‐ yes YBR072W_01 HSP26 2.03 2.08 0.49 yes ‐ ‐ YIR037W_01 HYR1 1.19 1.02 0.13 yes yes yes

162

YOR189W_01 IES4 0.57 0.69 0.3 yes ‐ ‐ YCR071C_01 IMG2 0.85 0.97 0.29 yes yes ‐ YHR148W_01 IMP3 0.92 0.8 ‐0.38 yes ‐ ‐ YLR438CA01 LSM3 0.61 0.76 ‐0.14 yes yes ‐ YER146W_01 LSM5 0.92 0.78 0.25 yes yes ‐ YKL150W_01 MCR1 1.09 1.33 0.57 yes yes yes YKL053CA01 MDM35 0.85 1.14 0.24 yes yes ‐ YGL087C_01 MMS2 1.14 1.16 0.13 yes yes ‐ YDL045WA01 MRP10 0.85 1.12 0.33 yes yes ‐ YGR084C_01 MRP13 0.71 0.54 ‐0.17 yes yes ‐ YKL167C_01 MRP49 0.61 0.85 0.35 yes yes ‐ YCR003W_01 MRPL32 0.46 0.77 0.35 yes yes ‐ YMR286W_01 MRPL33 1.44 1.31 0.01 yes yes ‐ YBR268W_01 MRPL37 1 0.96 0.3 yes yes ‐ YML009C_01 MRPL39 0.61 0.91 ‐0.02 yes ‐ ‐ YBOX_OCH1000100 MRPL44 0.97 1.13 0.72 yes ‐ ‐ YNR022C_01 MRPL50 0.87 0.86 0.05 yes yes ‐ YHR147C_01 MRPL6 0.66 0.63 ‐0.02 yes ‐ ‐ YPL211W_01 NIP7 0.68 0.67 ####### yes yes ‐ YBR188C_01 NTC20 0.84 0.67 ‐0.1 yes ‐ ‐ YNL056W_01 OCA2 0.92 0.56 ‐0.14 yes ‐ ‐ YJR073C_01 OPI3 0.82 0.56 0.17 yes yes ‐ YJL104W_01 PAM16 1 1.1 0.28 yes yes ‐ YBOX_ONO1000069 PCC1 0.59 0.65 0.26 yes ‐ ‐ YJL179W_01 PFD1 1.06 0.89 0.5 yes yes ‐ YNL149C_01 PGA2 0 0.95 ‐0.13 yes yes ‐ YML125C_01 PGA3 1.27 0.87 ‐0.45 yes yes ‐ YBOX_AAA1000120 PIL1 0.87 0.35 0.26 yes yes ‐ YBOX_OCH1000129 PMP1 0.42 0.82 0.6 yes ‐ ‐ YBOX_JXN1000059 PRE3 0.64 0.95 0.29 yes ‐ ‐ YJL001W_01 PRE3 0.84 0.74 0.31 yes ‐ ‐ YMR314W_01 PRE5 1.13 0.49 0.51 yes yes ‐ YHR076W_01 PTC7 0.83 0.51 0.08 yes yes ‐ YDR529C_01 QCR7 0.79 1.19 0.25 yes yes ‐ YLR204W_01 QRI5 1.26 1.03 0.3 yes ‐ ‐ YMR022W_01 QRI8 1 1.67 ‐0.07 yes ‐ ‐ YOR265W_01 RBL2 0.66 0.79 0.16 yes ‐ ‐ YJR063W_01 RPA12 1.15 1.49 0.36 yes ‐ ‐ YDR156W_01 RPA14 1.13 0.98 0.09 yes ‐ ‐ YOL005C_01 RPB11 0.65 0.83 0.17 yes yes ‐ YHR143WA01 RPC10 0.4 0.78 0.06 yes yes ‐ YNL113W_01 RPC19 0.65 0.55 0.24 yes ‐ ‐ YKL006W_01 RPL14A 0.84 1.22 0.27 yes yes ‐ YHL001W_01 RPL14B 0.4 0.92 0.24 yes ‐ ‐ YBOX_OCH1000159 RPL17A 0.51 0.7 0.77 yes yes ‐ YJL177W_01 RPL17B 0.83 0.45 0.02 yes yes ‐ YNL301C_01 RPL18B 0.74 0.44 0.31 yes yes ‐ YBL027W_01 RPL19B 0.79 0.7 0.26 yes yes ‐ YMR242C_01 RPL20A 0.61 0.69 0.32 yes yes ‐ YBOX_OCH1000180 RPL20B 0.85 0.57 0.36 yes yes ‐ YBL087C_01 RPL23A 0.46 1.1 0.45 yes yes ‐ YBOX_OCH1000055 RPL24B 0.83 1.02 0.41 yes yes ‐ YBOX_OCH1000232 RPL26A 0.72 0.86 0.38 yes yes ‐ YBOX_OCH1000147 RPL26B 0.8 0.49 0.13 yes yes ‐ YHR010W_01 RPL27A 0.69 0.88 0.15 yes yes ‐ YDR471W_01 RPL27B 0.74 0.65 0.11 yes yes ‐ YMR194W_01 RPL36A 0.67 0.92 ‐0.11 yes ‐ ‐ YLR185W_01 RPL37A 0.26 1.31 0.03 yes ‐ ‐ YDR500C_01 RPL37B 1.12 0.73 0.07 yes yes ‐ YBOX_OCH1000225 RPL41A 0.49 0.86 0.04 yes ‐ ‐ YBOX_OCH1000174 RPL42A 0.53 0.76 0.32 yes yes ‐ YJR094WA01 RPL43B 1.05 0.72 0.32 yes yes ‐

163

YHR200W_01 RPN10 1.43 0.8 0.15 yes yes ‐ YPR187W_01 RPO26 0.47 0.78 0.4 yes yes ‐ YBR048W_01 RPS11B 1.1 0.26 0.37 yes yes ‐ YBOX_OCH1000137 RPS17B 0.46 0.81 0.59 yes ‐ ‐ YML063W_01 RPS1B 0.73 0.46 0.48 yes ‐ ‐ YBOX_INT1000227 RPS22B 1.16 1.18 0.59 yes yes ‐ YBOX_OCH1000148 RPS23A 1.11 0.9 0.43 yes yes ‐ YBOX_OCH1000153 RPS24B 0.51 0.77 0.39 yes yes ‐ YBOX_OCH1000049 RPS26A 0.9 0.73 0.06 yes ‐ ‐ YJR145C_01 RPS4A 0.9 0.91 0.08 yes yes ‐ YBOX_INT1000171 RPS4B 1.17 0 0.2 yes yes ‐ YBOX_OCH1000221 RPS6B 0.52 0.71 0.05 yes yes ‐ YBL072C_01 RPS8A 0.95 0.54 ‐0.12 yes yes ‐ YBOX_OCH1000116 RPS9A 1.11 0 0.25 yes yes ‐ YNR037C_01 RSM19 0.63 0.78 0.27 yes yes ‐ YGR215W_01 RSM27 0.76 1.07 0.38 yes ‐ ‐ YOR367W_01 SCP1 0.7 0.56 0.27 yes yes ‐ YBL091CA01 SCS22 1.29 0.95 ‐0.19 yes ‐ ‐ YBOX_INT1000107 SCS22 0.68 0 ‐0.08 yes ‐ ‐ YLR268W_01 SEC22 1.44 1.14 0.48 yes ‐ ‐ YDR363WA01 SEM1 0.59 0.61 0.17 yes yes ‐ YKL006CA01 SFT1 1.03 1.1 ‐0.28 yes yes ‐ YJL151C_01 SNA3 1.08 1.34 0.55 yes yes ‐ YAL030W_01 SNC1 0.82 0.71 0.38 yes yes ‐ YBOX_JXN1000001 SNC1 0.71 1.04 0.12 yes yes ‐ YGR248W_01 SOL4 2.2 2.24 0.34 yes yes yes YER018C_01 SPC25 0.77 0.43 ‐0.5 yes yes ‐ YDL092W_01 SRP14 0.71 0.82 0.84 yes yes ‐ YKL122C_01 SRP21 0.6 0.92 0.5 yes ‐ ‐ YDR086C_01 SSS1 0.79 0.87 0.36 yes yes ‐ YDL130WA01 STF1 1.24 1.29 0.39 yes yes ‐ YBOX_JXN1000070 SUS1 0.76 0.75 0.05 yes ‐ ‐ YMR236W_01 TAF9 0.81 0.64 0.07 yes yes ‐ YGL232W_01 TAN1 1.19 0.4 0.46 yes ‐ ‐ YLR178C_01 TFS1 1.65 1.86 0.13 yes yes ‐ YMR260C_01 TIF11 0.73 0.85 0.62 yes yes ‐ YJR135WA01 TIM8 0.84 1.02 0.42 yes ‐ ‐ YEL020WA01 TIM9 1.54 1.47 0.32 yes ‐ ‐ YOR045W_01 TOM6 0.74 1.06 0.08 yes yes ‐ YBOX_JXN1000031 UBC9 0.98 0.95 0.17 yes yes ‐ YHR060W_01 VMA22 1.03 0.78 0.02 yes ‐ ‐ YBOX_ONO1000131 VMA9 0.5 0.79 0.55 yes ‐ ‐ YKR020W_01 VPS51 0.82 0.67 ‐0.04 yes yes ‐ YBR261C_01 YBR261C_ORF 1.25 0.92 0.57 yes yes ‐ YBR262C_01 YBR262C_ORF 1.1 1.25 0.27 yes yes ‐ YBR269C_01 YBR269C_ORF 1.92 1.08 0.09 yes yes ‐ YCL033C_01 YCL033C_ORF 1.16 1 0.51 yes yes yes YCL057CA_01 YCL057C‐A_ORF 1.04 1.17 ‐0.08 yes yes ‐ YCR043C_01 YCR043C_ORF 0.51 0.76 0.31 yes yes ‐ YDL012C_01 YDL012C_ORF 0.77 0.77 0.02 yes yes ‐ YDL114WA_01 YDL114W‐A_ORF 0.66 0.59 ‐0.14 yes yes ‐ YDL172C_01 YDL172C_ORF 1.19 0.56 ‐0.14 yes ‐ ‐ YBOX_AAA1000102 YDR115W_AAA_10_NCR 0.69 0 0.41 yes yes ‐ YDR391C_01 YDR391C_ORF 0.61 0.91 0.17 yes yes ‐ YER010C_01 YER010C_ORF 1.17 0.8 ‐0.39 yes ‐ ‐ YDL072C_01 YET3 0.69 0.61 0.39 yes yes ‐ YFL046W_01 YFL046W_ORF 0.79 0.76 0.18 yes ‐ ‐ YGL080W_01 YGL080W_ORF 0.93 0.83 0.14 yes ‐ ‐ YGL108C_01 YGL108C_ORF 0.72 0.72 0.09 yes ‐ ‐ YGL231C_01 YGL231C_ORF 0.95 0.75 0.04 yes yes ‐ YGR001C_01 YGR001C_ORF 0.92 0.82 0.35 yes ‐ ‐ YGR035C_01 YGR035C_ORF 1.89 1.44 0.04 yes ‐ ‐

164

YGL161C_01 YIP5 0.96 0.45 0.08 yes yes ‐ YJL161W_01 YJL161W_ORF 1.71 1.64 ‐0.97 yes ‐ ‐ YLR200W_01 YKE2 1 0.93 0.35 yes yes ‐ YKL151C_01 YKL151C_ORF 1.21 0.8 0.34 yes yes ‐ YKR074W_01 YKR074W_ORF 0 0.74 0.14 yes ‐ ‐ YKL196C_01 YKT6 0.87 1 0.23 yes yes ‐ YLR294C_01 YLR294C_ORF 1.28 1.4 0.02 yes yes ‐ YML009CA_01 YML009C‐A_ORF 0.56 0.87 ‐0.05 yes ‐ ‐ YML030W_01 YML030W_ORF 0.76 0.94 0.32 yes ‐ ‐ YML079W_01 YML079W_ORF 0.46 0.77 0.32 yes yes ‐ YMR090W_01 YMR090W_ORF 0.78 0.82 0.11 yes yes ‐ YBOX_TIL1000115 YMR31 0.99 0.84 0.21 yes yes ‐ YFR049W_01 YMR31 0.75 0.82 0.05 yes yes ‐ YNL010W_01 YNL010W_ORF 0.88 0.68 0.51 yes yes ‐ YNL024C_01 YNL024C_ORF 0.86 0.67 ‐0.54 yes ‐ ‐ YNL067WA_01 YNL067W‐A_ORF 0.76 0 ‐0.04 yes ‐ ‐ YNL200C_01 YNL200C_ORF 1 0.91 0.07 yes ‐ ‐ YBOX_TIL1000113 YNL300W_TIL_4_134__ORF 0.68 0.97 ‐0.34 yes ‐ ‐ YNR036C_01 YNR036C_ORF 0.87 1.17 0.22 yes ‐ ‐ YOR215C_01 YOR215C_ORF 0.69 0.88 0.59 yes yes ‐ YOR251C_01 YOR251C_ORF 0.81 0.9 0.12 yes yes ‐ YOR277C_01 YOR277C_ORF 0.71 0.85 ‐0.02 yes yes ‐ YOR285W_01 YOR285W_ORF 0.66 0.94 0.58 yes yes ‐ YBOX_ONO1000126 YPL189C‐A_ONO_ORF 0.81 0.9 0.33 yes ‐ ‐ YPL225W_01 YPL225W_ORF 0.64 0.91 0.72 yes yes ‐ YBOX_OCH1000119 YPR063C_OCH__ORF 0.42 0.81 0.42 yes yes ‐ YBR264C_01 YPT10 0.77 0.58 0.04 yes ‐ ‐ YNL310C_01 ZIM17 0.87 0 0.2 yes yes ‐ YBOX_RRN1000009 15S_RRNA 1.18 0.68 0.54 ‐ ‐ ‐ YBOX_RRN1000013 18S_ETS_JXN_RRNA 1.88 ‐0.18 ‐1.68 ‐ ‐ ‐ YKL106W_01 AAT1 1.08 0.34 0.02 ‐ ‐ ‐ YNR033W_01 ABZ1 0.71 0.69 0.21 ‐ ‐ ‐ YGR037C_01 ACB1 0.72 1.13 ‐0.04 ‐ yes ‐ YDR511W_01 ACN9 1 1.35 0.38 ‐ ‐ ‐ YOL086C_01 ADH1 0.79 1.21 ‐0.24 ‐ ‐ ‐ YMR303C_01 ADH2 1.31 1.31 ‐0.06 ‐ ‐ ‐ YMR083W_01 ADH3 0.76 0.64 0.08 ‐ yes ‐ YMR009W_01 ADI1 0.89 0.72 ‐0.43 ‐ yes ‐ YGL032C_01 AGA2 0.59 0.62 ‐0.06 ‐ ‐ ‐ YFL030W_01 AGX1 0.77 0.93 0.27 ‐ ‐ ‐ YMR169C_01 ALD3 2.18 2.63 0.17 ‐ ‐ ‐ YOR374W_01 ALD4 0.96 0.94 0.34 ‐ ‐ ‐ YBL082C_01 ALG3 0.74 0 ####### ‐ ‐ ‐ YJR047C_01 ANB1 0.66 0.83 ‐0.19 ‐ ‐ ‐ YDL008W_01 APC11 1.05 1.06 ‐0.29 ‐ ‐ ‐ YIL040W_01 APQ12 1.15 0.84 0.11 ‐ ‐ ‐ YGL105W_01 ARC1 0.65 0.56 0.19 ‐ ‐ ‐ YKL013C_01 ARC19 1.16 1.04 0.18 ‐ ‐ ‐ YNR035C_01 ARC35 0.69 0.99 0.36 ‐ ‐ ‐ YDR376W_01 ARH1 0.59 0 ‐0.14 ‐ ‐ ‐ YDR380W_01 ARO10 0.87 0.48 0.07 ‐ ‐ ‐ YBL069W_01 AST1 0.7 0.53 0 ‐ yes ‐ YDR184C_01 ATC1 0 0.68 0.45 ‐ ‐ ‐ YOL082W_01 ATG19 1.67 1.43 ‐0.22 ‐ ‐ ‐ YJL178C_01 ATG27 0.95 0.73 0.2 ‐ ‐ ‐ YBL099W_01 ATP1 0.68 0.76 0.15 ‐ ‐ ‐ YJL180C_01 ATP12 0.71 0.65 0.03 ‐ ‐ ‐ YLR295C_01 ATP14 1.3 1.62 0.54 ‐ yes ‐ YDL004W_01 ATP16 0.81 0.86 0.31 ‐ yes ‐ YDR377W_01 ATP17 0.68 0.77 0.22 ‐ ‐ ‐ YOL077WA01 ATP19 0.54 0.77 0.39 ‐ ‐ ‐ YER119C_01 AVT6 0.57 0.65 ‐0.11 ‐ yes ‐

165

YOR134W_01 BAG7 0.89 1.09 ####### ‐ ‐ ‐ YBR068C_01 BAP2 0.78 0.9 0.41 ‐ ‐ ‐ YHR208W_01 BAT1 0.82 1.07 0.51 ‐ ‐ ‐ YDR361C_01 BCP1 0.72 0.7 0.25 ‐ yes ‐ YKR068C_01 BET3 0.61 0.7 ‐0.07 ‐ ‐ ‐ YGL247W_01 BRR6 0.99 1.04 0.08 ‐ ‐ ‐ YLR074C_01 BUD20 0 0.98 0.48 ‐ ‐ ‐ YDL151C_01 BUD30 0.65 0.75 0.65 ‐ ‐ ‐ YIL034C_01 CAP2 0.6 0.78 0.47 ‐ ‐ ‐ YGR174C_01 CBP4 0.77 0.72 0.43 ‐ ‐ ‐ YDL143W_01 CCT4 0.78 0.65 0.16 ‐ yes ‐ YBOX_OCH1000082 CCW12 1.85 1.46 ‐0.66 ‐ ‐ ‐ YFR036W_01 CDC26 1.02 1.35 0.11 ‐ ‐ ‐ YBOX_TRN1000020 CDC65 0.62 0.82 ‐0.45 ‐ ‐ ‐ YJR057W_01 CDC8 0.78 0.51 ‐0.22 ‐ ‐ ‐ YBR029C_01 CDS1 0.71 0 0.17 ‐ ‐ ‐ YER026C_01 CHO1 0.73 0.52 0.87 ‐ ‐ ‐ YHR052W_01 CIC1 0.86 0.91 ‐0.06 ‐ ‐ ‐ YOR028C_01 CIN5 0 0.83 ‐0.55 ‐ ‐ ‐ YGL019W_01 CKB1 0.65 0.82 0.25 ‐ ‐ ‐ YNR041C_01 COQ2 1.06 0.95 0.07 ‐ ‐ ‐ YDR204W_01 COQ4 0.53 0.73 0.27 ‐ yes ‐ YBOX_OCH1000251 COS1 0.81 0.88 0.65 ‐ ‐ ‐ YNR075W_01 COS10 0.96 0.57 0.06 ‐ ‐ ‐ YBOX_OCH1000240 COS2 0.9 0.81 0.11 ‐ ‐ ‐ YML132W_01 COS3 0.59 0.93 0.2 ‐ ‐ ‐ YFL062W_01 COS4 0.59 0.71 ‐0.08 ‐ ‐ ‐ YGR295C_01 COS6 0.47 0.79 0 ‐ ‐ ‐ YKL219W_01 COS9 1.41 0 ####### ‐ ‐ ‐ YGL191W_01 COX13 0.65 0.99 0.24 ‐ ‐ ‐ YBOX_TIL1000017 COX17 0.34 0.86 ‐0.18 ‐ yes yes YLL009C_01 COX17 1.35 1.53 ‐0.12 ‐ yes yes YDR231C_01 COX20 0.8 0.8 0.27 ‐ yes ‐ YNL052W_01 COX5A 1.04 1.07 ‐0.01 ‐ yes ‐ YLR395C_01 COX8 0.57 0.95 0.48 ‐ yes ‐ YGR189C_01 CRH1 0.7 0.63 0.04 ‐ ‐ ‐ YBR036C_01 CSG2 0.55 0.78 0.68 ‐ ‐ ‐ YPR124W_01 CTR1 0.84 0.75 ‐0.18 ‐ ‐ yes YGR088W_01 CTT1 2.56 2.74 0.86 ‐ ‐ ‐ YML101C_01 CUE4 0.62 0.65 0.12 ‐ yes ‐ YKL096W_01 CWP1 0.73 0.53 0.62 ‐ ‐ ‐ YJR048W_01 CYC1 0.88 0.75 ‐0.28 ‐ yes ‐ YEL039C_01 CYC7 1.68 1.76 1.35 ‐ ‐ ‐ YBOX_TIL1000189 CYT2 0.75 0.7 ‐0.04 ‐ ‐ ‐ YBOX_ACM1000017 D_2UM 0.64 0.85 ‐0.13 ‐ ‐ ‐ YBR233WA_01 DAD3 0.74 1.08 0.49 ‐ ‐ ‐ YOL052CA01 DDR2 2.4 2.82 0.69 ‐ ‐ ‐ YDR403W_01 DIT1 0.78 0 ‐0.2 ‐ ‐ ‐ YDR093W_01 DNF2 0.31 1 0.38 ‐ ‐ ‐ YIL010W_01 DOT5 0.63 0.82 0.3 ‐ yes yes YDR424C_01 DYN2 1.23 1.09 0.6 ‐ ‐ ‐ YNL136W_01 EAF7 0.76 0.67 0.2 ‐ ‐ ‐ YAL059W_01 ECM1 0.81 1.08 0.44 ‐ ‐ ‐ YLR390W_01 ECM19 0.64 0.74 ‐0.04 ‐ ‐ ‐ YBOX_INT1000210 EFB1 0.47 0.88 0.12 ‐ ‐ ‐ YPL037C_01 EGD1 0.45 0.85 0.22 ‐ yes ‐ YKL160W_01 ELF1 0.78 1.04 0.23 ‐ yes ‐ YJL196C_01 ELO1 0.58 0.89 0.43 ‐ ‐ ‐ YMR312W_01 ELP6 0.9 0.81 0.09 ‐ ‐ ‐ YFL048C_01 EMP47 0.89 0.53 0.36 ‐ ‐ ‐ YNL080C_01 EOS1 0.65 0.72 ‐0.07 ‐ ‐ yes YLR246W_01 ERF2 0.6 0 ####### ‐ ‐ ‐

166

YPL028W_01 ERG10 0.55 0.64 0.28 ‐ ‐ ‐ YGL012W_01 ERG4 0.72 0.46 0.17 ‐ ‐ ‐ YAL007C_01 ERP2 0.63 0.55 0.53 ‐ yes ‐ YOR016C_01 ERP4 0.58 0.65 0.19 ‐ ‐ ‐ YBR026C_01 ETR1 1.03 0.81 0.29 ‐ yes ‐ YBOX_RRN1000010 ETS1‐1 1.51 0.36 ‐0.24 ‐ ‐ ‐ YLR051C_01 FCF2 0.92 0.77 0.29 ‐ ‐ ‐ YIL065C_01 FIS1 1.29 1.12 0.23 ‐ yes ‐ YOR382W_01 FIT2 2.2 2.6 0.92 ‐ yes ‐ YOR383C_01 FIT3 0.87 0.79 0.31 ‐ ‐ ‐ YIL134W_01 FLX1 0.55 0.7 ‐0.37 ‐ yes ‐ YDL222C_01 FMP45 0 1.09 0.82 ‐ ‐ ‐ YAL008W_01 FUN14 1.18 1.57 0.61 ‐ yes ‐ YLR068W_01 FYV7 0.44 0.86 0.11 ‐ ‐ ‐ YMR250W_01 GAD1 0.71 1.04 0.09 ‐ ‐ yes YBR020W_01 GAL1 0.39 0.88 ‐0.01 ‐ ‐ ‐ YLR081W_01 GAL2 0.68 0.84 0 ‐ ‐ ‐ YBR018C_01 GAL7 1.1 1.07 0.29 ‐ ‐ ‐ YDR019C_01 GCV1 0.62 0.6 ‐0.05 ‐ ‐ ‐ YER083C_01 GET2 0.66 0.67 0.14 ‐ ‐ ‐ YNL153C_01 GIM3 0 1.04 ‐0.07 ‐ ‐ ‐ YML094W_01 GIM5 0.5 0.74 0.24 ‐ ‐ ‐ YDR152W_01 GIR2 0.79 0.61 0.28 ‐ ‐ ‐ YNL255C_01 GIS2 0.52 0.83 0.29 ‐ yes ‐ YCL040W_01 GLK1 0.8 0.72 ‐0.14 ‐ ‐ ‐ YOR040W_01 GLO4 0 0.75 ‐0.38 ‐ ‐ ‐ YGR256W_01 GND2 1.32 1.4 0.1 ‐ ‐ yes YMR292W_01 GOT1 0.69 0.86 0.42 ‐ ‐ ‐ YDL022W_01 GPD1 0.78 0.89 0.04 ‐ yes ‐ YGL121C_01 GPG1 0.82 1.09 ####### ‐ ‐ ‐ YBR244W_01 GPX2 1.02 0.7 0.25 ‐ yes yes YOL151W_01 GRE2 1.25 1.57 0.03 ‐ ‐ ‐ YHR104W_01 GRE3 0.83 0.71 0.21 ‐ ‐ yes YCL035C_01 GRX1 1.61 1.71 0.07 ‐ yes yes YDR513W_01 GRX2 1.01 0.91 0.47 ‐ ‐ yes YIR038C_01 GTT1 1.22 1.07 0.31 ‐ ‐ ‐ YNL281W_01 HCH1 0.57 0.78 0.47 ‐ yes ‐ YER014W_01 HEM14 0.82 0.52 ‐0.08 ‐ ‐ ‐ YMR251WA01 HOR7 0.6 0.83 ‐0.14 ‐ ‐ ‐ YDR399W_01 HPT1 0.87 0.45 ‐0.04 ‐ ‐ ‐ YBOX_OCH1000073 HSP150 1.26 1.11 0.02 ‐ ‐ ‐ YDR533C_01 HSP31 1.26 1.49 0.53 ‐ ‐ ‐ YBOX_TRN1000025 HSX1 0.38 1.01 ‐0.56 ‐ ‐ ‐ YDL245C_01 HXT15 0.83 0.64 ‐0.09 ‐ ‐ ‐ YDR345C_01 HXT3 0.37 0.9 0.6 ‐ ‐ ‐ YHR092C_01 HXT4 0.74 0.57 0.53 ‐ ‐ ‐ YDR343C_01 HXT6 0.49 0.69 0.59 ‐ ‐ ‐ YDR342C_01 HXT7 0.66 0.75 0.57 ‐ ‐ ‐ YBOX_OCH1000041 HYP2 0.95 0.86 0.19 ‐ yes ‐ YLR355C_01 ILV5 0.68 0.72 0.13 ‐ ‐ ‐ YBOX_INT1000236 IMD4 0.73 0.66 ‐0.02 ‐ ‐ ‐ YMR035W_01 IMP2 0.95 0 ‐0.19 ‐ ‐ ‐ YER048WA01 ISD11 0.66 0.67 0.52 ‐ ‐ ‐ YIR005W_01 IST3 0.64 0.74 0.01 ‐ ‐ ‐ YOR226C_01 ISU2 1.33 1.25 ‐0.25 ‐ yes ‐ YBOX_RRN1000004 ITS1‐1 0.97 0.81 ‐0.46 ‐ ‐ ‐ YBOX_RRN1000008 ITS2‐1 1.81 1.66 ‐1.31 ‐ ‐ ‐ YOL101C_01 IZH4 0.58 1.14 ####### ‐ ‐ ‐ YGR166W_01 KRE11 0.71 0 ‐0.13 ‐ ‐ ‐ YCL059C_01 KRR1 0.95 0.61 0.25 ‐ ‐ ‐ YBL071WA_01 KTI11 0.38 0.85 0.16 ‐ ‐ ‐ YOR181W_01 LAS17 0.99 0.58 0.21 ‐ ‐ ‐

167

YJL134W_01 LCB3 0.64 0.66 0.09 ‐ ‐ ‐ YER127W_01 LCP5 0.66 0.66 ‐0.42 ‐ ‐ ‐ YMR298W_01 LIP1 0.48 0.71 0.37 ‐ ‐ ‐ YFR001W_01 LOC1 0.6 0.7 0.39 ‐ yes ‐ YFL018C_01 LPD1 0.75 0.52 0.03 ‐ ‐ ‐ YGR136W_01 LSB1 0.58 0.75 0.31 ‐ yes ‐ YBOX_JXN1000083 LSM2 0.71 0.59 0.54 ‐ ‐ ‐ YDR378C_01 LSM6 0.8 0.59 0.2 ‐ ‐ ‐ YPL004C_01 LSP1 1.06 1.27 0.54 ‐ ‐ ‐ YBOX_SNR1000005 LSR1 1.55 1.57 0.09 ‐ ‐ ‐ YER142C_01 MAG1 1.05 0.68 0.21 ‐ ‐ ‐ YAL025C_01 MAK16 0.45 0.83 0.56 ‐ yes ‐ YER106W_01 MAM1 0.67 0 ‐0.11 ‐ ‐ ‐ YIL070C_01 MAM33 0.86 0.54 0.15 ‐ ‐ ‐ YBL091C_01 MAP2 0.81 0.75 ‐0.11 ‐ yes ‐ YOR197W_01 MCA1 0.65 0.52 ‐0.12 ‐ ‐ ‐ YKL221W_01 MCH2 1.34 0 ####### ‐ ‐ ‐ YMR112C_01 MED11 0.64 0.89 0.04 ‐ ‐ ‐ YPL187W_01 MF(ALPHA)1 0.88 0 0.15 ‐ ‐ ‐ YJR144W_01 MGM101 0.65 0.55 ‐0.11 ‐ yes ‐ YPL098C_01 MGR2 0.93 0.86 0.18 ‐ ‐ ‐ YLL062C_01 MHT1 0.91 0.34 ‐0.27 ‐ ‐ ‐ YDR031W_01 MIC14 1.25 0 0.3 ‐ yes ‐ YMR002W_01 MIC17 1.09 1.32 0.35 ‐ ‐ ‐ YGL209W_01 MIG2 1.11 0.35 0.02 ‐ ‐ ‐ YHR015W_01 MIP6 0.64 0 ‐0.3 ‐ ‐ ‐ YJR077C_01 MIR1 0.82 0.7 0.13 ‐ ‐ ‐ YPR188C_01 MLC2 0.66 0.71 0.06 ‐ yes ‐ YGL068W_01 MNP1 0.56 0.7 0.5 ‐ ‐ ‐ YJR074W_01 MOG1 0.61 0.81 0.25 ‐ ‐ ‐ YBL049W_01 MOH1 0.83 0.87 ‐0.26 ‐ ‐ ‐ YJL066C_01 MPM1 1.16 1.09 0.17 ‐ ‐ ‐ YBOX_INT1000139 MPT5 0.68 0.88 0.51 ‐ ‐ ‐ YBOX_TIL1000141 MRH1 0 0.66 ####### ‐ ‐ ‐ YDR033W_01 MRH1 0.51 0.66 0.7 ‐ ‐ ‐ YBOX_AAA1000106 MRP1 0 0.6 0.08 ‐ ‐ ‐ YKL003C_01 MRP17 0.73 0.67 0.26 ‐ ‐ ‐ YBL090W_01 MRP21 0 0.87 0.72 ‐ ‐ ‐ YNL005C_01 MRP7 0.98 0.51 0.23 ‐ yes ‐ YLR312WA01 MRPL15 1.08 0.92 0.03 ‐ yes ‐ YNL185C_01 MRPL19 1.48 1.21 0.48 ‐ ‐ ‐ YKR085C_01 MRPL20 0.87 0.93 0.6 ‐ ‐ ‐ YNL177C_01 MRPL22 1 0 0.12 ‐ yes ‐ YOR150W_01 MRPL23 0.76 0.73 0.1 ‐ ‐ ‐ YBR282W_01 MRPL27 0.95 1.07 0.11 ‐ ‐ ‐ YBR122C_01 MRPL36 1.02 0.21 0.47 ‐ yes ‐ YPR100W_01 MRPL51 0.73 1.27 0.33 ‐ yes ‐ YJL063C_01 MRPL8 0.85 0.6 ‐0.14 ‐ ‐ ‐ YMR188C_01 MRPS17 0.63 0.82 0.54 ‐ ‐ ‐ YNL306W_01 MRPS18 0.63 0.9 0.32 ‐ yes ‐ YGR165W_01 MRPS35 0.85 0.38 ‐0.06 ‐ ‐ ‐ YHR005CA01 MRS11 0.47 0.94 0.17 ‐ yes ‐ YBR091C_01 MRS5 0 1.39 0.05 ‐ yes ‐ YKL009W_01 MRT4 0.6 0.62 ‐0.04 ‐ ‐ ‐ YML128C_01 MSC1 1.54 1.52 0.47 ‐ ‐ ‐ YHR039C_01 MSC7 0.82 0.69 0.44 ‐ ‐ ‐ YPR047W_01 MSF1 1.02 0.3 ‐0.3 ‐ ‐ ‐ YDL107W_01 MSS2 0.67 0.69 0.05 ‐ ‐ ‐ YLR203C_01 MSS51 0.76 0.63 0.16 ‐ ‐ ‐ YKL194C_01 MST1 1.13 0.6 0.22 ‐ ‐ ‐ YHL036W_01 MUP3 0.79 0.43 0.62 ‐ ‐ ‐ YGR007W_01 MUQ1 1.01 0.63 ‐0.18 ‐ yes ‐

168

YGR232W_01 NAS6 0.99 0.82 0.66 ‐ yes ‐ YJL116C_01 NCA3 0.43 0.74 0.22 ‐ ‐ ‐ YBOX_JXN1000038 NCB2 0.46 0.77 ‐0.01 ‐ yes ‐ YJL205CA01 NCE101 0.49 0.69 0.05 ‐ ‐ ‐ YNL036W_01 NCE103 1.05 1.37 0.24 ‐ ‐ yes YMR145C_01 NDE1 1.01 1.37 0.11 ‐ ‐ ‐ YHR124W_01 NDT80 0 0.6 ‐0.3 ‐ ‐ ‐ YGL221C_01 NIF3 0.55 0.81 0.29 ‐ ‐ ‐ YBOX_NCR1000001 NME1 1.21 1.14 1.33 ‐ ‐ ‐ YBOX_INT1000030 NOG2 0.79 0.54 0.23 ‐ ‐ ‐ YOL041C_01 NOP12 0.76 0.52 0.33 ‐ yes ‐ YNL110C_01 NOP15 0.57 0.92 0.57 ‐ ‐ ‐ YER002W_01 NOP16 0.52 0.84 0.45 ‐ ‐ ‐ YKR022C_01 NTR2 0.68 0 0.26 ‐ ‐ ‐ YBR230C_01 OM14 0.62 0.95 0.17 ‐ ‐ ‐ YIL136W_01 OM45 1.1 0.77 ‐0.14 ‐ ‐ ‐ YKR087C_01 OMA1 0.62 0.64 ‐0.11 ‐ ‐ ‐ YJL212C_01 OPT1 0.5 0.9 0.05 ‐ ‐ ‐ YNL261W_01 ORC5 0.7 0.82 0.47 ‐ ‐ ‐ YMR174C_01 PAI3 0.9 1.1 ‐0.02 ‐ ‐ ‐ YKR065C_01 PAM17 1.42 0 0.57 ‐ ‐ ‐ YNL015W_01 PBI2 1 1.2 0.4 ‐ yes ‐ YBOX_OCH1000080 PDC1 0.44 0.73 ‐0.46 ‐ ‐ ‐ YPL058C_01 PDR12 0.66 0.93 0.57 ‐ ‐ ‐ YBR035C_01 PDX3 0.62 0.72 0.19 ‐ yes ‐ YKR046C_01 PET10 1.71 1.71 ‐0.14 ‐ yes ‐ YDR079W_01 PET100 0.68 0.84 0.06 ‐ yes ‐ YER058W_01 PET117 0 1.17 0.68 ‐ ‐ ‐ YJR034W_01 PET191 1.3 1 ‐0.9 ‐ ‐ ‐ YGL153W_01 PEX14 0.68 0 0.34 ‐ ‐ ‐ YCR012W_01 PGK1 1.09 0.47 ‐0.29 ‐ ‐ ‐ YGR132C_01 PHB1 0.53 0.81 0.58 ‐ ‐ ‐ YBOX_OCH1000056 PHB2 0.8 1.13 0.54 ‐ yes ‐ YER037W_01 PHM8 0.79 0.74 0.35 ‐ ‐ ‐ YBR092C_01 PHO3 0.59 0.66 0.09 ‐ ‐ ‐ YJL097W_01 PHS1 0.69 0.61 0.52 ‐ ‐ ‐ YHR034C_01 PIH1 0.76 0 ‐0.03 ‐ ‐ ‐ YMR123W_01 PKR1 0.61 0.73 0.01 ‐ ‐ ‐ YGL037C_01 PNC1 1.61 1.27 0.25 ‐ ‐ ‐ YBR022W_01 POA1 1.07 0.64 ‐0.09 ‐ yes ‐ YAL033W_01 POP5 0.99 0.34 0.34 ‐ yes ‐ YNL055C_01 POR1 0.78 0.87 0 ‐ ‐ ‐ YHR075C_01 PPE1 0.82 0.71 0.03 ‐ ‐ ‐ YER012W_01 PRE1 0.78 0.92 0.46 ‐ ‐ ‐ YPR103W_01 PRE2 0.47 0.71 0.25 ‐ ‐ ‐ YFR050C_01 PRE4 0.88 0.89 0.26 ‐ ‐ ‐ YOL038W_01 PRE6 1.17 1.25 ‐0.17 ‐ yes ‐ YML092C_01 PRE8 0.57 0.72 0.14 ‐ ‐ ‐ YBL064C_01 PRX1 0.84 1.07 0.53 ‐ ‐ yes YNL169C_01 PSD1 0.72 0.56 ‐0.13 ‐ ‐ ‐ YDL230W_01 PTP1 0 0.66 0.52 ‐ ‐ ‐ YDR496C_01 PUF6 1 0.81 0.42 ‐ ‐ ‐ YER094C_01 PUP3 1.1 1.05 ‐0.02 ‐ yes ‐ YBOX_TIL1000082 PXR1 0.88 1 0.02 ‐ ‐ ‐ YPR191W_01 QCR2 0.42 0.83 0.5 ‐ ‐ ‐ YJL166W_01 QCR8 0.68 0.79 0.33 ‐ yes ‐ YKL113C_01 RAD27 0 0.64 0.29 ‐ ‐ ‐ YCR036W_01 RBK1 1.08 0 0.75 ‐ ‐ ‐ YBOX_RRN1000001 RDN18‐1 1.95 1.26 ‐1.61 ‐ ‐ ‐ YBOX_RRN1000012 RDN25‐1 2.38 1.94 ‐1.26 ‐ ‐ ‐ YBOX_RRN1000003 RDN5‐1 4.35 2.45 ‐0.1 ‐ ‐ ‐ YBOX_RRN1000006 RDN58‐1 0.84 1.06 ‐0.44 ‐ ‐ ‐

169

YBR267W_01 REI1 1.12 0.97 ‐0.07 ‐ ‐ ‐ YBOX_ACM1000018 REP2_2UM 0.7 0.86 ‐0.26 ‐ ‐ ‐ YOL080C_01 REX4 0.4 0.85 ‐0.12 ‐ ‐ ‐ YJL173C_01 RFA3 0.42 0.81 0.55 ‐ yes ‐ YBR052C_01 RFS1 0.88 0.4 0.14 ‐ ‐ ‐ YEL024W_01 RIP1 0.74 0.63 0.6 ‐ ‐ ‐ YLL034C_01 RIX7 0 0.66 0.27 ‐ ‐ ‐ YLR009W_01 RLP24 0.57 0.6 0.01 ‐ ‐ ‐ YNL002C_01 RLP7 1.03 1.06 0.63 ‐ ‐ ‐ YNL072W_01 RNH201 0.53 0.75 ‐0.53 ‐ yes ‐ YIL066C_01 RNR3 0.74 0.47 ‐0.2 ‐ ‐ ‐ YBL093C_01 ROX3 0.81 0 0.43 ‐ ‐ ‐ YDR404C_01 RPB7 1.05 0 0.07 ‐ yes ‐ YOR224C_01 RPB8 0.6 1.06 0.05 ‐ yes ‐ YKR025W_01 RPC37 0.81 0.57 ‐0.03 ‐ ‐ ‐ YBOX_OCH1000048 RPL24A 0.53 0.79 ‐0.05 ‐ yes ‐ YBOX_NCR1000009 RPM1 0.77 0 0.15 ‐ ‐ ‐ YFR004W_01 RPN11 1.09 0.85 0.17 ‐ ‐ ‐ YLR421C_01 RPN13 0.71 0.92 0.47 ‐ yes ‐ YDR427W_01 RPN9 0.88 0.43 ‐0.17 ‐ ‐ ‐ YBOX_NCR1000005 RPR1 0.7 1 0.69 ‐ ‐ ‐ YBOX_OCH1000081 RPS0B 0.55 0.74 0.04 ‐ ‐ ‐ YOL040C_01 RPS15 0.73 0.6 0.13 ‐ yes ‐ YBOX_OCH1000053 RPS25A 0.45 0.75 0.1 ‐ yes ‐ YKL156W_01 RPS27A 0.66 0.67 0.47 ‐ ‐ ‐ YHR021C_01 RPS27B 0.53 0.64 0.4 ‐ ‐ ‐ YNL096C_01 RPS7B 0.92 0.81 ‐0.08 ‐ ‐ ‐ YPR143W_01 RRP15 0.44 1.02 0.46 ‐ yes ‐ YDL111C_01 RRP42 0.6 0.92 0.48 ‐ ‐ ‐ YLR221C_01 RSA3 0.52 0.67 ‐0.07 ‐ yes ‐ YHR056C_01 RSC30 0.82 0.64 ‐0.34 ‐ ‐ ‐ YML127W_01 RSC9 0.76 0 ‐0.09 ‐ ‐ ‐ YER050C_01 RSM18 0 1.16 0.55 ‐ ‐ ‐ YJR101W_01 RSM26 0.75 0.78 0.11 ‐ ‐ ‐ YJR113C_01 RSM7 0.58 0.71 0.2 ‐ ‐ ‐ YDL204W_01 RTN2 0.96 1.52 0.58 ‐ ‐ ‐ YDR289C_01 RTT103 0.61 0.58 ‐0.2 ‐ ‐ ‐ YBOX_NCR1000004 RUF5‐2 0.84 0.84 ‐0.07 ‐ ‐ ‐ YDR388W_01 RVS167 0.72 0.68 0.17 ‐ ‐ ‐ YMR060C_01 SAM37 1.17 0.82 0.2 ‐ ‐ ‐ YNL026W_01 SAM50 1.01 0.75 ‐0.16 ‐ ‐ ‐ YKL117W_01 SBA1 0 1.05 0.67 ‐ ‐ ‐ YHL034C_01 SBP1 0.83 0.5 ‐0.19 ‐ ‐ ‐ YGL011C_01 SCL1 0.85 0.82 0.23 ‐ ‐ ‐ YGR049W_01 SCM4 0.85 0.85 0.67 ‐ ‐ ‐ YBOX_NCR1000002 SCR1 2.33 1.03 0.35 ‐ ‐ ‐ YER120W_01 SCS2 0.99 1.04 ‐0.08 ‐ yes ‐ YBOX_TIL1000120 SCW4 0 0.73 0.39 ‐ ‐ ‐ YKL141W_01 SDH3 0.44 0.86 0.49 ‐ ‐ ‐ YDR178W_01 SDH4 0.86 1.13 0.59 ‐ ‐ ‐ YBL050W_01 SEC17 0.63 0.63 0.25 ‐ yes ‐ YFL005W_01 SEC4 0.99 0.58 0.22 ‐ ‐ ‐ YML105C_01 SEC65 1.16 0.78 0.26 ‐ yes ‐ YBR171W_01 SEC66 0.7 0.73 0.15 ‐ yes ‐ YLR292C_01 SEC72 0.57 0.73 ‐0.04 ‐ yes ‐ YBOX_OCH1000002 SED1 0.6 0.59 0.02 ‐ ‐ ‐ YMR059W_01 SEN15 0.85 0.82 ‐0.27 ‐ yes ‐ YER096W_01 SHC1 1.2 0.46 0.06 ‐ yes ‐ YGL228W_01 SHE10 1.05 0.47 0.41 ‐ ‐ ‐ YLR058C_01 SHM2 1.02 0.53 0.04 ‐ yes ‐ YMR175W_01 SIP18 1.03 1.53 0.11 ‐ ‐ ‐ YDR515W_01 SLF1 4.5 4.96 0.99 ‐ ‐ ‐

170

YER029C_01 SMB1 0 0.73 0.1 ‐ yes ‐ YLR275W_01 SMD2 1.08 0.82 ‐0.44 ‐ ‐ ‐ YLR147C_01 SMD3 0.63 0.99 0.3 ‐ yes ‐ YFL017WA01 SMX2 0.79 1.29 ‐0.14 ‐ ‐ ‐ YDR525WA01 SNA2 1.13 1.39 0.36 ‐ ‐ ‐ YIL016W_01 SNL1 1.04 0.66 0.42 ‐ ‐ ‐ YBOX_SNO1000003 SNR11 1.7 1.61 1.01 ‐ ‐ ‐ YBOX_SNO1000028 SNR128 1.28 1.54 ‐0.07 ‐ ‐ ‐ YBOX_SNO1000004 SNR13 2.25 2.29 0.87 ‐ ‐ ‐ YBOX_SNR1000004 SNR14 1.02 1.1 1.2 ‐ ‐ ‐ YBOX_SNO1000067 SNR17A 1.59 1.78 ‐0.3 ‐ ‐ ‐ YBOX_SNO1000068 SNR17B 1.47 1.54 ‐0.18 ‐ ‐ ‐ YBOX_SNO1000001 SNR189 0.85 0.81 0.38 ‐ ‐ ‐ YBOX_SNR1000003 SNR19 0.95 0.98 0.69 ‐ ‐ ‐ YBOX_SNO1000016 SNR190 2.07 1.54 0.45 ‐ ‐ ‐ YBOX_SNO1000017 SNR191 0.95 0.57 0.41 ‐ ‐ ‐ YBOX_SNO1000031 SNR30 1.36 0.83 0.17 ‐ ‐ ‐ YBOX_SNO1000032 SNR31 0.82 0.39 0.55 ‐ ‐ ‐ YBOX_SNO1000033 SNR32 1.03 0.99 0.49 ‐ ‐ ‐ YBOX_SNO1000034 SNR33 1.47 0 0.53 ‐ ‐ ‐ YBOX_SNO1000035 SNR34 1.45 1.57 0.65 ‐ ‐ ‐ YBOX_SNO1000036 SNR35 1.04 1.01 ####### ‐ ‐ ‐ YBOX_SNO1000037 SNR36 1.86 1.64 ####### ‐ ‐ ‐ YBOX_SNO1000038 SNR37 0.98 0.91 0.29 ‐ ‐ ‐ YBOX_SNO1000044 SNR4 0.69 0.92 0.5 ‐ ‐ ‐ YBOX_SNO1000056 SNR40 1.28 1.25 0.28 ‐ ‐ ‐ YBOX_SNO1000057 SNR41 0.88 0.89 0.68 ‐ ‐ ‐ YBOX_SNO1000058 SNR42 0 1.06 0.25 ‐ ‐ ‐ YBOX_SNO1000059 SNR43 0.93 1.11 0.08 ‐ ‐ ‐ YBOX_SNO1000060 SNR44 1.2 1.27 ‐0.1 ‐ ‐ ‐ YBOX_SNO1000061 SNR45 1.23 1.49 0.09 ‐ ‐ ‐ YBOX_SNO1000062 SNR46 1.2 1.12 0.67 ‐ ‐ ‐ YBOX_SNO1000063 SNR47 0.91 0.52 0.66 ‐ ‐ ‐ YBOX_SNO1000064 SNR48 1.2 1.41 0.67 ‐ ‐ ‐ YBOX_SNO1000065 SNR49 2.36 2.32 1.04 ‐ ‐ ‐ YBOX_SNO1000046 SNR5 1.33 1.35 0.56 ‐ ‐ ‐ YBOX_SNO1000007 SNR51 1.14 1.4 0.66 ‐ ‐ ‐ YBOX_SNO1000008 SNR52 1.57 1.5 0.53 ‐ ‐ ‐ YBOX_SNO1000010 SNR54 1.26 1.26 0.41 ‐ ‐ ‐ YBOX_SNO1000011 SNR55 1.33 1.57 0.29 ‐ ‐ ‐ YBOX_SNO1000012 SNR56 1.16 1.44 0.38 ‐ ‐ ‐ YBOX_SNO1000013 SNR57 0.48 1.38 0.75 ‐ ‐ ‐ YBOX_SNR1000002 SNR6 0.68 0.9 0.95 ‐ ‐ ‐ YBOX_SNO1000020 SNR60 1.46 1.41 0.27 ‐ ‐ ‐ YBOX_SNO1000021 SNR61 1.06 1.05 0.56 ‐ ‐ ‐ YBOX_SNO1000022 SNR62 1.38 1.55 1.12 ‐ ‐ ‐ YBOX_SNO1000023 SNR63 0.68 0.82 0.6 ‐ ‐ ‐ YBOX_SNO1000024 SNR64 0.52 0.74 0.44 ‐ ‐ ‐ YBOX_SNO1000026 SNR66 0.7 0.64 0.24 ‐ ‐ ‐ YBOX_SNO1000027 SNR67 0.51 0.86 0.02 ‐ ‐ ‐ YBOX_SNO1000029 SNR68 0.81 0.86 0.4 ‐ ‐ ‐ YBOX_SNO1000030 SNR69 1.26 1.19 0.14 ‐ ‐ ‐ YBOX_SNO1000040 SNR70 1.42 1.29 0.65 ‐ ‐ ‐ YBOX_SNO1000043 SNR71 1.45 1.63 0.89 ‐ ‐ ‐ YBOX_SNO1000045 SNR72 1.7 1.78 0.75 ‐ ‐ ‐ YBOX_SNO1000047 SNR73 1.25 1.68 0.73 ‐ ‐ ‐ YBOX_SNO1000048 SNR74 0.49 0.72 0.4 ‐ ‐ ‐ YBOX_SNO1000049 SNR75 0.92 0.94 0.54 ‐ ‐ ‐ YBOX_SNO1000053 SNR77 1.42 1.21 0.28 ‐ ‐ ‐ YBOX_SNO1000054 SNR78 0.99 0.99 0.56 ‐ ‐ ‐ YBOX_SNO1000055 SNR79 1.28 1.25 0.21 ‐ ‐ ‐ YBOX_SNR1000001 SNR7‐L 1.76 2.39 0.61 ‐ ‐ ‐

171

YBOX_SNR1000006 SNR7‐S 1.8 2.35 0.75 ‐ ‐ ‐ YBOX_SNO1000050 SNR8 1.39 1.47 0.26 ‐ ‐ ‐ YBOX_SNO1000018 SNR82 1.53 1.6 0.41 ‐ ‐ ‐ YBOX_NCR1000008 SNR83 1.36 1.35 0.4 ‐ ‐ ‐ YBOX_SNO1000051 SNR9 1.3 1.11 0.85 ‐ ‐ ‐ YPR101W_01 SNT309 0.45 0.81 0.3 ‐ ‐ ‐ YHR008C_01 SOD2 1.25 1.23 0.28 ‐ yes ‐ YLL011W_01 SOF1 0.84 0.79 0.23 ‐ ‐ ‐ YGL127C_01 SOH1 0.98 0.81 ‐0.06 ‐ yes ‐ YMR107W_01 SPG4 1 0.79 0.24 ‐ ‐ ‐ YNL202W_01 SPS19 0.75 1.03 0.29 ‐ ‐ ‐ YGR063C_01 SPT4 0.64 0.91 0.1 ‐ ‐ ‐ YDR308C_01 SRB7 0.82 0.52 ‐0.07 ‐ ‐ ‐ YKR092C_01 SRP40 0.85 0.93 0 ‐ ‐ ‐ YMR101C_01 SRT1 1.34 0.87 ‐0.03 ‐ ‐ ‐ YAL005C_01 SSA1 0.41 0.8 ‐0.21 ‐ ‐ ‐ YBL075C_01 SSA3 0.55 0.71 ‐0.26 ‐ ‐ ‐ YBR169C_01 SSE2 1.14 0.58 0.47 ‐ ‐ ‐ YLR250W_01 SSP120 1.61 1.1 0.16 ‐ ‐ ‐ YGR008C_01 STF2 0.9 1.19 0.08 ‐ yes ‐ YMR039C_01 SUB1 0.87 0 0.09 ‐ ‐ ‐ YBOX_TRN1000032 SUF2 0.6 0.96 ‐0.06 ‐ ‐ ‐ YPL237W_01 SUI3 0.81 0.71 0.05 ‐ ‐ ‐ YBOX_TRN1000043 SUP19 1.44 1.31 0.06 ‐ ‐ ‐ YBOX_TRN1000033 SUP56 0.76 1.66 0.06 ‐ ‐ ‐ YBR231C_01 SWC5 0.75 1.13 0.48 ‐ ‐ ‐ YBOX_TIL1000092 SWS2 0.98 0 0.72 ‐ yes ‐ YNL081C_01 SWS2 1.6 1.41 0.33 ‐ yes ‐ YBOX_TRN1000057 TA(UGC)Q_TRNA 1.37 1.84 ‐0.33 ‐ ‐ ‐ YGR274C_01 TAF1 0.87 0.65 0.23 ‐ ‐ ‐ YBR069C_01 TAT1 0.96 1.22 0.18 ‐ ‐ ‐ YBOX_TRN1000022 TD(GUC)B_TRNA 0.74 2.02 ‐0.54 ‐ ‐ ‐ YBOX_OCH1000149 TDH3 1.12 0.67 ‐0.38 ‐ ‐ ‐ YBOX_TRN1000044 TE(CUC)D_TRNA 0.7 0.82 ‐0.21 ‐ ‐ ‐ YBR118W_01 TEF2 0.88 0.45 ‐0.71 ‐ yes ‐ YBOX_TRN1000006 TF(GAA)B_TRNA 0.3 0.87 ‐0.26 ‐ ‐ ‐ YBOX_TRN1000010 TF(GAA)D_TRNA 0.64 0 ‐0.22 ‐ ‐ ‐ YBOX_TRN1000028 TF(GAA)Q_TRNA 1.51 2.37 0.49 ‐ ‐ ‐ YKR062W_01 TFA2 0.51 0.75 ‐0.03 ‐ yes ‐ YDR058C_01 TGL2 1.06 0 0.77 ‐ ‐ ‐ YBOX_TRN1000042 TH(GUG)E1_TRNA 0.92 1.52 0.49 ‐ ‐ ‐ YJR156C_01 THI11 0.65 0.64 ‐0.22 ‐ ‐ ‐ YDL244W_01 THI13 0.97 1.14 ‐0.46 ‐ ‐ ‐ YBOX_OCH1000086 THI7 0.53 0.82 0.13 ‐ ‐ ‐ YBOX_TRN1000009 TI(GAU)Q_TRNA 1.16 2.45 ‐0.19 ‐ ‐ ‐ YBOX_INT1000258 TI(UAU)D_INT_1 0.92 1.04 0.68 ‐ ‐ ‐ YBOX_TRN1000001 TI(UAU)D_TRNA 0.73 0.69 0.39 ‐ ‐ ‐ YBOX_INT1000266 TI(UAU)L_INT_1 0.99 1.07 0.73 ‐ ‐ ‐ YDR429C_01 TIF35 0.56 0.65 0.2 ‐ yes ‐ YGR181W_01 TIM13 0.68 0.71 ‐0.23 ‐ ‐ ‐ YBOX_TIL1000256 TIM44 0.55 0.75 0.2 ‐ yes ‐ YPL063W_01 TIM50 0.81 0.72 ‐0.5 ‐ ‐ ‐ YER011W_01 TIR1 1.08 0.95 0.31 ‐ ‐ ‐ YOR010C_01 TIR2 1.06 1.35 ‐0.14 ‐ ‐ ‐ YBOX_TRN1000038 TK(UUU)D_TRNA 0.49 0.88 ‐0.14 ‐ ‐ ‐ YBOX_TRN1000052 TK(UUU)Q_TRNA 0.71 0 ‐0.1 ‐ ‐ ‐ YBR117C_01 TKL2 1.6 1.83 0.24 ‐ ‐ ‐ YOR252W_01 TMA16 0.57 0.9 ‐0.4 ‐ ‐ ‐ YBOX_TRN1000016 TN(GUU)C_TRNA 0.69 0.95 ‐0.24 ‐ ‐ ‐ YMR203W_01 TOM40 1.12 0.29 0.27 ‐ ‐ ‐ YNL121C_01 TOM70 0.73 0 0.67 ‐ ‐ ‐ YIL138C_01 TPM2 1.06 1.23 0.2 ‐ yes ‐

172

YGR138C_01 TPO2 0.99 0.61 0.66 ‐ ‐ ‐ YBOX_TRN1000051 TQ(UUG)Q_TRNA 0.99 1.31 ‐0.05 ‐ ‐ ‐ YBOX_TRN1000045 TR(UCU)B_TRNA 0 0.97 0.07 ‐ ‐ ‐ YNR046W_01 TRM112 1.09 0.85 0.02 ‐ yes ‐ YBOX_TRN1000054 TRT2 0.52 0.95 ‐0.56 ‐ ‐ ‐ YGR209C_01 TRX2 0.93 1.05 0.29 ‐ yes yes YCR083W_01 TRX3 0.6 1.13 ‐0.04 ‐ yes yes YBOX_TRN1000059 TS(AGA)A_TRNA 1.53 1.95 ‐0.32 ‐ ‐ ‐ YBOX_TRN1000013 TS(GCU)F_TRNA 0.67 0.58 0.37 ‐ ‐ ‐ YML028W_01 TSA1 0.74 0.8 0.19 ‐ yes yes YDR453C_01 TSA2 1.3 1.4 0.14 ‐ yes yes YBOX_TRN1000039 TT(AGU)B_TRNA 0.5 0.75 ‐0.19 ‐ ‐ ‐ YBOX_TIL1000311 TUF1 0.64 0 0.3 ‐ ‐ ‐ YOR187W_01 TUF1 0.55 0.76 0.32 ‐ ‐ ‐ YBOX_TRN1000058 TV(AAC)E1_TRNA 0.61 0.76 ‐0.58 ‐ ‐ ‐ YDR100W_01 TVP15 0.67 0.66 0.42 ‐ ‐ ‐ YBOX_TRN1000027 TW(CCA)G1_TRNA 0.57 0.63 ‐0.48 ‐ ‐ ‐ YBOX_TRN1000040 TX(XXX)D_TRNA 1.52 1.53 0.31 ‐ ‐ ‐ YBOX_TRN1000015 TY(GUA)Q_TRNA 0.82 0.64 0.25 ‐ ‐ ‐ YDR092W_01 UBC13 0.4 0.8 0.48 ‐ ‐ ‐ YDR059C_01 UBC5 0.98 0.83 ‐0.22 ‐ yes ‐ YER100W_01 UBC6 1.01 0.31 0.18 ‐ ‐ ‐ YBR173C_01 UMP1 1.42 1.07 0.28 ‐ ‐ ‐ YMR271C_01 URA10 0.81 0.93 0.82 ‐ ‐ ‐ YDR400W_01 URH1 1.47 0 0.51 ‐ ‐ ‐ YKL099C_01 UTP11 0.81 0.7 0.34 ‐ yes ‐ YEL038W_01 UTR4 0.68 0.82 0.17 ‐ ‐ ‐ YEL013W_01 VAC8 0.74 0.52 0.38 ‐ ‐ ‐ YLR373C_01 VID22 0.47 0.84 0.59 ‐ yes ‐ YHR012W_01 VPS29 0.98 0.47 0 ‐ ‐ ‐ YJR044C_01 VPS55 0.78 0.94 0.45 ‐ ‐ ‐ YLR322W_01 VPS65 0.67 0 0.02 ‐ ‐ ‐ YPR087W_01 VPS69 1 0.69 0.01 ‐ ‐ ‐ YGL104C_01 VPS73 0.71 0.52 ‐0.05 ‐ ‐ ‐ YAL046C_01 YAL046C_ORF 0 0.85 0.32 ‐ ‐ ‐ YAL069W_01 YAL069W_ORF 0 0.59 0.2 ‐ ‐ ‐ YPL239W_01 YAR1 0.81 0.71 0.36 ‐ ‐ yes YBOX_OCH1000239 YBL113C_OCH__ORF 0.37 0.9 ‐0.59 ‐ ‐ ‐ YBR096W_01 YBR096W_ORF 1.17 0.91 0.26 ‐ yes ‐ YBR116C_01 YBR116C_ORF 0 0.89 ‐0.37 ‐ ‐ ‐ YBR255CA_01 YBR255C‐A_ORF 0.66 0.74 ‐0.05 ‐ ‐ ‐ YCL042W_01 YCL042W_ORF 0.7 0.54 0.11 ‐ ‐ ‐ YBOX_OCH1000021 YCL049C_OCH__ORF 0.81 1.19 0.23 ‐ ‐ ‐ YCR016W_01 YCR016W_ORF 0.63 0.8 0.32 ‐ ‐ ‐ YBOX_ONO1000018 YCR024C‐B_ONO_ORF 0.64 1.14 0.33 ‐ ‐ ‐ YCR061W_01 YCR061W_ORF 1.09 1.11 0.24 ‐ ‐ ‐ YCR087CA01 YCR087C‐A_ORF 0.88 1.25 ‐0.38 ‐ ‐ ‐ YDL086W_01 YDL086W_ORF 0.91 0.91 0.37 ‐ ‐ ‐ YDL124W_01 YDL124W_ORF 0.92 0.9 0.58 ‐ ‐ yes YDL159WA_01 YDL159W‐A_ORF 0.77 0.85 0 ‐ ‐ ‐ YDL241W_01 YDL241W_ORF 0.95 0 ####### ‐ ‐ ‐ YDR056C_01 YDR056C_ORF 0.85 0.45 0.01 ‐ ‐ ‐ YDR070C_01 YDR070C_ORF 1.84 0 0.68 ‐ ‐ ‐ YDR199W_01 YDR199W_ORF 1.28 0.94 ‐0.34 ‐ ‐ ‐ YDR379CA_01 YDR379C‐A_ORF 0.84 0.88 0.19 ‐ ‐ ‐ YDR412W_01 YDR412W_ORF 0.57 0.67 0.4 ‐ ‐ ‐ YDR413C_01 YDR413C_ORF 0.56 0.85 0.1 ‐ ‐ ‐ YDR445C_01 YDR445C_ORF 0.81 0 ‐0.54 ‐ ‐ ‐ YDR476C_01 YDR476C_ORF 1.18 0.79 ‐0.34 ‐ ‐ ‐ YBOX_ONO1000027 YDR524C‐B_ONO_ORF 0.44 1.31 ‐0.65 ‐ ‐ ‐ YDR544C_01 YDR544C_ORF 0.64 0.64 ‐0.38 ‐ ‐ ‐ YEL001C_01 YEL001C_ORF 0.58 0.61 0.34 ‐ ‐ ‐

173

YEL045C_01 YEL045C_ORF 0.81 0.61 0.27 ‐ ‐ ‐ YEL074W_01 YEL074W_ORF 0.8 0.77 ‐0.42 ‐ ‐ ‐ YDL120W_01 YFH1 1.02 0.88 0.36 ‐ ‐ ‐ YFL063W_01 YFL063W_ORF 0.72 0.86 ‐0.33 ‐ ‐ ‐ YFL068W_01 YFL068W_ORF 1.37 0.76 ‐0.71 ‐ ‐ ‐ YFR011C_01 YFR011C_ORF 1.27 1.28 0.71 ‐ ‐ ‐ YGL088W_01 YGL088W_ORF 1.77 1.59 0.8 ‐ ‐ ‐ YGL101W_01 YGL101W_ORF 0 0.67 0.31 ‐ ‐ ‐ YGL157W_01 YGL157W_ORF 1.32 0.78 0.46 ‐ yes ‐ YGL177W_01 YGL177W_ORF 0.92 0 0.52 ‐ ‐ ‐ YGL204C_01 YGL204C_ORF 0.78 0.56 ‐0.32 ‐ ‐ ‐ YGL226W_01 YGL226W_ORF 0.82 0.95 ‐0.35 ‐ yes ‐ YNL160W_01 YGP1 1.96 2.09 0.9 ‐ ‐ ‐ YGR043C_01 YGR043C_ORF 0 1.73 0.34 ‐ ‐ ‐ YGR137W_01 YGR137W_ORF 0.6 0.67 0.57 ‐ yes ‐ YGR207C_01 YGR207C_ORF 0.61 0.68 0.35 ‐ yes ‐ YGR235C_01 YGR235C_ORF 0 0.64 0.28 ‐ ‐ ‐ YGR259C_01 YGR259C_ORF 0.73 0 ####### ‐ ‐ ‐ YGR263C_01 YGR263C_ORF 0.46 0.76 ‐0.48 ‐ ‐ ‐ YGR277C_01 YGR277C_ORF 0.93 0.9 0.62 ‐ ‐ ‐ YHL044W_01 YHL044W_ORF 1.31 0 0.06 ‐ ‐ ‐ YHR033W_01 YHR033W_ORF 0.88 1.44 ‐0.01 ‐ ‐ ‐ YHR035W_01 YHR035W_ORF 0.69 0 ####### ‐ ‐ ‐ YHR087W_01 YHR087W_ORF 0 1.5 0.88 ‐ ‐ ‐ YHR113W_01 YHR113W_ORF 0.48 0.91 0.19 ‐ ‐ ‐ YHR138C_01 YHR138C_ORF 0.63 1.12 0.83 ‐ ‐ ‐ YHR198C_01 YHR198C_ORF 0.74 0.63 ‐0.23 ‐ ‐ ‐ YHR217C_01 YHR217C_ORF 0 0.68 0.03 ‐ ‐ ‐ YBOX_ONO1000055 YIL046W‐A_ONO_ORF 0.6 0 ‐0.86 ‐ ‐ ‐ YIL087C_01 YIL087C_ORF 1.05 1.22 0 ‐ yes ‐ YIL096C_01 YIL096C_ORF 1.14 0.26 0.02 ‐ ‐ ‐ YBOX_RET1000005 YILWTY3‐1_RET 0.54 0.64 0.08 ‐ ‐ ‐ YBOX_OCH1000050 YIP4 1.15 0.72 0.13 ‐ yes ‐ YIR036C_01 YIR036C_ORF 0.88 0.94 ‐0.06 ‐ yes ‐ YIR044C_01 YIR044C_ORF 0.7 0.76 0.76 ‐ ‐ ‐ YJL010C_01 YJL010C_ORF 0.84 0.54 0.18 ‐ ‐ ‐ YJL037W_01 YJL037W_ORF 0 0.83 0 ‐ ‐ ‐ YJL062WA_01 YJL062W‐A_ORF 0.81 0.63 ‐0.36 ‐ ‐ ‐ YJL068C_01 YJL068C_ORF 0.65 0.54 0.1 ‐ ‐ ‐ YBOX_ONO1000062 YJL133C‐A_ONO_ORF 0.59 0.65 0.08 ‐ ‐ ‐ YJL156WA_01 YJL156W‐A_ORF 1.23 1.27 0.19 ‐ ‐ ‐ YJL160C_01 YJL160C_ORF 0.66 0.93 ‐0.05 ‐ ‐ ‐ YJL163C_01 YJL163C_ORF 0.68 0 0.53 ‐ ‐ ‐ YJL218W_01 YJL218W_ORF 1 0.99 0.19 ‐ ‐ ‐ YJR003C_01 YJR003C_ORF 0.64 0 ‐0.06 ‐ ‐ ‐ YJR056C_01 YJR056C_ORF 0.55 0.63 ‐0.32 ‐ ‐ ‐ YBOX_INT1000193 YJR079W_INT_1 1.27 0.97 0.1 ‐ ‐ ‐ YJR080C_01 YJR080C_ORF 0.65 0.77 0.01 ‐ ‐ ‐ YJR096W_01 YJR096W_ORF 1.05 0.51 0.16 ‐ yes yes YJR124C_01 YJR124C_ORF 0.51 0.82 ‐0.26 ‐ ‐ ‐ YBOX_ONO1000066 YKL068W‐A_ONO_ORF 0.55 0.78 0.11 ‐ ‐ ‐ YKL107W_01 YKL107W_ORF 0.59 0 ‐0.04 ‐ yes ‐ YKL137W_01 YKL137W_ORF 0.88 1.16 0.69 ‐ ‐ yes YKL225W_01 YKL225W_ORF 0.91 1.15 ‐0.38 ‐ ‐ ‐ YKR012C_01 YKR012C_ORF 0 0.65 ‐0.4 ‐ ‐ ‐ YKR016W_01 YKR016W_ORF 0.77 0.62 0.01 ‐ ‐ ‐ YKR047W_01 YKR047W_ORF 0.73 0.57 ‐0.28 ‐ ‐ ‐ YKR073C_01 YKR073C_ORF 0.65 0.96 0.21 ‐ ‐ ‐ YHL014C_01 YLF2 0.64 0.69 ‐0.2 ‐ ‐ ‐ YLL023C_01 YLL023C_ORF 1.02 1.3 0.45 ‐ ‐ ‐ YLL054C_01 YLL054C_ORF 0.82 0 ‐0.18 ‐ ‐ ‐ YLL058W_01 YLL058W_ORF 0.96 0.75 ‐0.25 ‐ ‐ ‐

174

YLR022C_01 YLR022C_ORF 0.58 1.04 0.45 ‐ ‐ ‐ YLR040C_01 YLR040C_ORF 0.63 1.18 ‐0.07 ‐ ‐ ‐ YLR050C_01 YLR050C_ORF 0 0.64 0.65 ‐ ‐ ‐ YLR104W_01 YLR104W_ORF 0.69 0.76 ‐0.33 ‐ ‐ ‐ YBOX_ONO1000071 YLR154C‐G_ONO_ORF 1.86 1.44 ‐0.84 ‐ ‐ ‐ YLR154WA_01 YLR154W‐A_ORF 1.13 0 0.29 ‐ ‐ ‐ YBOX_ONO1000075 YLR154W‐F_ONO_ORF 0.85 0.79 ‐0.77 ‐ ‐ ‐ YBOX_OCH1000261 YLR156C‐A_OCH__ORF 2.29 2.33 ‐0.25 ‐ ‐ ‐ YLR199C_01 YLR199C_ORF 1.01 1.02 0.02 ‐ yes ‐ YLR202C_01 YLR202C_ORF 0.7 0.55 0.29 ‐ yes ‐ YLR346C_01 YLR346C_ORF 1.01 0.37 ‐0.05 ‐ ‐ ‐ YLR356W_01 YLR356W_ORF 0.82 1.13 0.43 ‐ ‐ ‐ YBOX_ONO1000083 YLR361C‐A_ONO_ORF 1.69 1.39 0.03 ‐ yes ‐ YLR363WA_01 YLR363W‐A_ORF 0.43 0.81 0.07 ‐ ‐ ‐ YLR413W_01 YLR413W_ORF 0.82 1.32 0.35 ‐ ‐ ‐ YLR463C_01 YLR463C_ORF 0.85 0.93 ‐0.74 ‐ ‐ ‐ YML057CA_01 YML057C‐A_ORF 0 0.91 0.26 ‐ ‐ ‐ YML102CA01 YML101C‐A_ORF 0 0.68 ‐0.2 ‐ ‐ ‐ YMR013WA_01 YMR013W‐A_ORF 1.28 1.77 0.54 ‐ ‐ ‐ YMR087W_01 YMR087W_ORF 0.77 0 0.14 ‐ ‐ ‐ YMR122WA_01 YMR122W‐A_ORF 0.85 1.16 0.19 ‐ ‐ ‐ YMR130W_01 YMR130W_ORF 0.7 0.71 ‐0.19 ‐ yes ‐ YMR134W_01 YMR134W_ORF 0.7 0.75 0.13 ‐ ‐ ‐ YBOX_TIL1000089 YMR181C_TIL_4_29__ORF 0.79 1.15 0.83 ‐ ‐ ‐ YMR294WA01 YMR294W‐A_ORF 1.54 1.11 0.2 ‐ ‐ ‐ YMR310C_01 YMR310C_ORF 0.84 0.48 0.2 ‐ ‐ ‐ YNL184C_01 YNL184C_ORF 1.29 1.44 0.44 ‐ yes ‐ YBOX_AAA1000053 YNL195C_AAA_11_NCR 0.76 0.43 ‐0.58 ‐ ‐ ‐ YNL208W_01 YNL208W_ORF 1.14 1.15 0.42 ‐ ‐ ‐ YNL274C_01 YNL274C_ORF 0.49 1.21 0.3 ‐ yes ‐ YNL305C_01 YNL305C_ORF 0.89 0.94 0.15 ‐ ‐ ‐ YNL337W_01 YNL337W_ORF 0.79 1.02 ‐0.2 ‐ ‐ ‐ YNR018W_01 YNR018W_ORF 0.91 1 ‐0.07 ‐ ‐ ‐ YNR025C_01 YNR025C_ORF 0 0.67 ‐0.08 ‐ ‐ ‐ YNR042W_01 YNR042W_ORF 0.78 0.6 ‐0.42 ‐ ‐ ‐ YBOX_OCH1000264 YOL166W‐A_OCH__ORF 0.91 0.96 ‐0.27 ‐ ‐ ‐ YBOX_ONO1000114 YOR020W‐A_ONO_ORF 1.32 1.31 0.07 ‐ yes ‐ YOR021C_01 YOR021C_ORF 0.7 0.64 0.3 ‐ yes ‐ YOR201C_01 YOR201C_ORF 0.85 0.55 ‐0.01 ‐ yes ‐ YOR235W_01 YOR235W_ORF 0.84 0.95 0.74 ‐ ‐ ‐ YOR286W_01 YOR286W_ORF 0.64 1.01 0.17 ‐ ‐ ‐ YBOX_OCH1000266 YOR394C‐A_OCH__ORF 1.16 1.06 ‐0.17 ‐ ‐ ‐ YFR003C_01 YPI1 1.21 1.46 ‐0.45 ‐ yes ‐ YPL041C_01 YPL041C_ORF 1.01 0.67 0.17 ‐ ‐ ‐ YPL056C_01 YPL056C_ORF 0.59 0 0.25 ‐ ‐ ‐ YPL183WA01 YPL183W‐A_ORF 1.85 1.12 0.65 ‐ ‐ ‐ YPL185W_01 YPL185W_ORF 0 1.13 ‐0.46 ‐ ‐ ‐ YPL206C_01 YPL206C_ORF 0.97 0.61 0.26 ‐ ‐ ‐ YPL229W_01 YPL229W_ORF 0.83 0.85 ‐0.13 ‐ ‐ ‐ YPR015C_01 YPR015C_ORF 0.78 0.5 ‐0.36 ‐ ‐ ‐ YBOX_ONO1000127 YPR036W‐A_ONO_ORF 0.66 0.84 0.06 ‐ ‐ ‐ YPR172W_01 YPR172W_ORF 0.55 0.67 0.19 ‐ yes ‐ YLR121C_01 YPS3 0 0.71 0.17 ‐ yes ‐ YBOX_OCH1000070 YPS6 0 0.72 ‐0.07 ‐ ‐ ‐ YML001W_01 YPT7 0.59 0.8 0.6 ‐ yes ‐ YDR002W_01 YRB1 0.58 0.93 0.73 ‐ ‐ ‐ YBR054W_01 YRO2 2.06 1.9 0.3 ‐ ‐ ‐ YHR016C_01 YSC84 0.76 0.52 ‐0.1 ‐ yes ‐ YBOX_ONO1000104 YSF3 0.59 0 0.47 ‐ ‐ ‐ YOL109W_01 ZEO1 0.67 0.77 ‐0.05 ‐ ‐ ‐ YGL255W_01 ZRT1 0.64 0.54 0.06 ‐ ‐ ‐

175

Supplemental table S4: primers and sequences used

Primers for qRT-PCR analysis: They were designed at http://frodo.wi.mit.edu/ and blasted at http://seq.yeastgenome.org (cutoff score 90). All primers give rise to products between 100 and 180 nt in lenght and target the central region of the RNA.

RPL19b forward AGACTTGCCGCTTCTGTTGT RPL19b reverse ACGATGGTTCCGTTCTTGAC

HSP12 forward AAGGTCGCTGGTAAGGTTCA HSP12 reverse GCTTGGTCTGCCAAAGATTC

HSP26 forward GACTTGTCCCTGTTCCCATC HSP26 reverse GACACCAGGAACCACGACTT

SOL4 forward ATCTTACTCGGATGCGGAGA SOL4 reverse GCCTTGGGCGAATTATTACA

MCR1 forward CAGCTGGTCGTCAAGCATTA MCR1 reverse GGTTGCCACTTCCATTTCAT

CUP1 forward TGAAGGTCATGAGTGCCAAT CUP1 reverse ATTTCCCAGAGCAGCATGAC

NUP2 forward ACATTTGGCTCCTCTGCACT NUP2 reverse TTTCCGAATGAGAAGGATGG

PMA1 forward GGTTACTGCCGTTGTCGAAT PMA1 reverse TTCCCAGTGACCTTCACCTC

21s rRNA forward ATAATTGAGGTCCCGCATGA 21s rRNA reverse CTTTCCGTCTTGCTGAAGGT

176

Primers for overhang extension PCR to generate pBG1805-SLF1-LAM-mut: Overlapping regions are bold and underlined.

Ext-Slf1 for 1 TAACGTCAAGGAGAAGGAATTATCAAC

Ext-Slf1 rev 1 TGTAAAACTTCTCTCTAGAATTCAATTTGGTTTTTGATAC

Ext-Slf1 for 1 CCAAATTGAATTCTAGAGAGAAGTTTTACAACATA

Ext-Slf1 for 1 GATGATGATGTCTAGACACATCAACC

Primers for cloning of wild-type SLF1 into pTRC-FLAG-6His: Spe1 sites are bold.

SLF1 for CGACTAGTG TCATCGCAAAACCTCA

SLF1 rev CGACTAGTACATCATTTATTTGTAA

Primers to generate templates for in vitro transcription: T7 promoter is underlined, BY4741 strain was used as template for PCR with Taq Polymerase (GoTaq, Promega).

CTR2 T7forw TAATACGACTCACTATAGGGCGGTGACAAGTTGTAAAGTGC

CTR2 rev CGACGCAGAAGTTAATGATATAG cup1 T7forw2 TAATACGACTCACTATAGGGCTTAGCCTTGTTACTAGTTAG

Cup1 rev2 GGATTCTATACAGAGTTGTAAG

177

Mutations introduced in La-motif: The sequence below was synthesized at Mr.Gene (www.mrgene.com) and cloned into pBG1805-SLF1 via EcoR1and Eag1 sites, replacing the WT-sequence. In grey and lowercase: Alanines replacing aromatic residues, bold: Nucleotides 816-1351of SLF1 coding sequence, not bold: C-terminal tag and backbone in pBG1805.

GAAAGTATCAAAAACCAAATTGAATTCgcaTTTAGTGAAGAGAACTTGAAAACAGATGAAgcaTTAAGATCTAAATTCAAA AAAGCCAATGACGGATTTATCCCCATGAGTTTGATAGGGAAAgcaTACCGTATGGTTAATTTATCTCTTGGTGGAGACCC AAATTTAATTTTGGCATCTATGAGAGAAGTTTTACAACATAAAGAAACAAACCATTTGGAAATTGCCCTTGGAAGCATAG AAGGTGCTCAGAAGAACATGGCAGATGATTTCAATCCATTGGAAAACTATTTTATTAGGCGCGAAAATTGGGCTGAATA CGCTATGGAAAGTAATTTTGATGAAAATGATGACGAAACTGAAAAATACAACATTGAGAAACTATTGGGACCGAACGATTT AGACAATTATTCTTATATGGGCTATCCAAACTTCTTTCCCAGTAATGAAAATGGGAAAAAGAGTCAGAGCTATGACCAAGGT GAAATTAGCAGGCAGTTTGAACAAAACTTACAAATAAATGATAACCCAGCTTTCTTGTACAAAGTGGTTGATGTGTCTAGAC ATCATCATCACCATCATGGTAGAATCTTTTATCCATACGATGTTCCTGATTATGCTGGTTTAGAAGTTCTTTTTCAAGGTCCT GGACCATCGGCCGTGGACA

178

7 Acknowledgements

179

180

Acknowledgements

I am heartily thankful to my supervisor, André Gerber. Without his constant support and encouraging guidance this work would not have been possible. His creative and innovative mind have inspired me throughout my PhD and will continue do so in the future.

I also would like to express my sincere gratitude to Michael Detmar, who gave me the opportunity to work in a highly motivating scientific environment. Both his scientific input during lab- and thesis committee meetings and his personal support as my “Doktorvater” have been truly valuable.

I am grateful to Cornelia Halin Winter for being co-referee of this thesis and the PhD defense, and for very useful input during lab-meetings. Her warm-hearted character has always added to a pleasant atmosphere.

My thanks also go to Bernhard Dichtl and Witold Filipowicz, for being members of my thesis committee and for both scientifically valuable and encouraging input.

It is a great pleasure to thank my dear former and present labmembers Alex and Tanja who have been very important for me in many ways and greatly helped making my time as a PhD student unforgettable.

181

Importantly, my thanks also go to all other members of the Detmar lab. The atmosphere in this lab has always been great and supportive, I very much appreciate this.

And I am very thankful to my parents, who have always supported me. They are the best parents I can imagine.

Finally, I would like to thank my gorgeous girlfriend Lea.

182

8 References

183

184

Aigner S, Cech TR (2004) The Euplotes telomerase subunit p43 stimulates enzymatic activity and processivity in vitro. Rna 10(7): 1108-1118.

Aigner S, Postberg J, Lipps HJ, Cech TR (2003) The Euplotes La motif protein p43 has properties of a telomerase-specific subunit. Biochemistry 42(19): 5736- 5747.

Aigner S, Lingner J, Goodrich KJ, Grosshans CA, Shevchenko A et al. (2000) Euplotes telomerase contains an La motif protein produced by apparent translational frameshifting. Embo J 19(22): 6230-6239.

Al-Ejeh F, Darby JM, Brown MP (2007) The La autoantigen is a malignancy- associated cell death target that is induced by DNA-damaging drugs. Clin Cancer Res 13(18 Pt 2): 5509s-5518s.

Alfano C, Sanfelice D, Babon J, Kelly G, Jacks A et al. (2004) Structural analysis of cooperative RNA binding by the La motif and central RRM domain of human La protein. Nat Struct Mol Biol 11(4): 323-329.

Ali N, Pruijn GJ, Kenan DJ, Keene JD, Siddiqui A (2000) Human La antigen is required for the hepatitis C virus internal ribosome entry site-mediated translation. J Biol Chem 275(36): 27531-27540.

Anderson J, Phan L, Cuesta R, Carlson BA, Pak M et al. (1998) The essential Gcd10p-Gcd14p nuclear complex is required for 1-methyladenosine modification and maturation of initiator methionyl-tRNA. Genes Dev 12(23): 3650-3662.

Anderson JT, Wilson SM, Datar KV, Swanson MS (1993) NAB2: a yeast nuclear polyadenylated RNA-binding protein essential for cell viability. Mol Cell Biol 13(5): 2730-2741.

Aratani S, Fujii R, Fujita H, Fukamizu A, Nakajima T (2003) Aromatic residues are required for RNA helicase A mediated transactivation. Int J Mol Med 12(2): 175-180.

Arevalo-Rodriguez M, Wu X, Hanes SD, Heitman J (2004) Prolyl isomerases in yeast. Front Biosci 9: 2420-2446.

Avery SV (2001) Metal toxicity in yeasts and the role of oxidative stress. Adv Appl Microbiol 49: 111-142.

Aviv T, Lin Z, Ben-Ari G, Smibert CA, Sicheri F (2006) Sequence-specific recognition of RNA hairpins by the SAM domain of Vts1p. Nat Struct Mol Biol 13(2): 168- 176.

185

Bachmann M, Chang S, Slor H, Kukulies J, Muller WE (1990) Shuttling of the autoantigen La between nucleus and cell surface after uv irradiation of human keratinocytes. Exp Cell Res 191(2): 171-180.

Bartel DP (2009) MicroRNAs: target recognition and regulatory functions. Cell 136(2): 215-233.

Batisse J, Batisse C, Budd A, Bottcher B, Hurt E (2009) Purification of nuclear poly(A)-binding protein Nab2 reveals association with the yeast transcriptome and a messenger ribonucleoprotein core structure. J Biol Chem 284(50): 34911-34917.

Bayfield MA, Yang R, Maraia RJ (2010) Conserved and divergent features of the structure and function of La and La-related proteins (LARPs). Biochim Biophys Acta 1799(5-6): 365-378.

Bhattacharya R, Perumal K, Sinha K, Maraia R, Reddy R (2002) Methylphosphate cap structure in small RNAs reduces the affinity of RNAs to La protein. Gene Expr 10(5-6): 243-253.

Birney E, Stamatoyannopoulos JA, Dutta A, Guigo R, Gingeras TR et al. (2007) Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project. Nature 447(7146): 799-816.

Blagden SP, Gatt MK, Archambault V, Lada K, Ichihara K et al. (2009) Drosophila Larp associates with poly(A)-binding protein and is required for male fertility and syncytial embryo development. Dev Biol 334(1): 186-197.

Bousquet-Antonelli C, Deragon JM (2009) A comprehensive analysis of the La-motif protein superfamily. Rna 15(5): 750-764.

Brenet F, Socci ND, Sonenberg N, Holland EC (2009) Akt phosphorylation of La regulates specific mRNA translation in glial progenitors. Oncogene 28(1): 128- 139.

Brewer GJ, Hill GM, Dick RD, Prasad AS, Cossack ZT (1985) Interactions of trace elements: clinical significance. J Am Coll Nutr 4(1): 33-38.

Brown KR, Keller GL, Pickering IJ, Harris HH, George GN et al. (2002) Structures of the cuprous-thiolate clusters of the Mac1 and Ace1 transcriptional activators. Biochemistry 41(20): 6469-6476.

Buckanovich RJ, Darnell RB (1997) The neuronal RNA binding protein Nova-1 recognizes specific RNA targets in vitro and in vivo. Mol Cell Biol 17(6): 3194- 3201.

Burd CG, Dreyfuss G (1994) Conserved structures and diversity of functions of RNA- binding proteins. Science 265(5172): 615-621.

186

Burrows C, Abd Latip N, Lam SJ, Carpenter L, Sawicka K et al. (2010) The RNA binding protein Larp1 regulates cell division, apoptosis and cell migration. Nucleic Acids Res 38(16): 5542-5553.

Cadenas E (1989) Biochemistry of oxygen toxicity. Annu Rev Biochem 58: 79-110.

Cai L, Fritz D, Stefanovic L, Stefanovic B (2010) Binding of LARP6 to the conserved 5' stem-loop regulates translation of mRNAs encoding type I collagen. J Mol Biol 395(2): 309-326.

Camblong J, Iglesias N, Fickentscher C, Dieppois G, Stutz F (2007) Antisense RNA stabilization induces transcriptional gene silencing via histone deacetylation in S. cerevisiae. Cell 131(4): 706-717.

Camblong J, Beyrouthy N, Guffanti E, Schlaepfer G, Steinmetz LM et al. (2009) Trans-acting antisense RNAs mediate transcriptional gene cosuppression in S. cerevisiae. Genes Dev 23(13): 1534-1545.

Carninci P, Kasukawa T, Katayama S, Gough J, Frith MC et al. (2005) The transcriptional landscape of the mammalian genome. Science 309(5740): 1559-1563.

Cerny J, Hobza P (2007) Non-covalent interactions in biomacromolecules. Phys Chem Chem Phys 9(39): 5291-5303.

Chauvet S, Maurel-Zaffran C, Miassod R, Jullien N, Pradel J et al. (2000) dlarp, a new candidate Hox target in Drosophila whose orthologue in mouse is expressed at sites of epithelium/mesenchymal interactions. Dev Dyn 218(3): 401-413.

Clark KL, Halay ED, Lai E, Burley SK (1993) Co-crystal structure of the HNF-3/fork head DNA-recognition motif resembles histone H5. Nature 364(6436): 412- 420.

Copela LA, Chakshusmathi G, Sherrer RL, Wolin SL (2006) The La protein functions redundantly with tRNA modification enzymes to ensure tRNA structural stability. Rna 12(4): 644-654.

Culotta VC, Lin SJ, Schmidt P, Klomp LW, Casareno RL et al. (1999) Intracellular pathways of copper trafficking in yeast and humans. Adv Exp Med Biol 448: 247-254.

Dancis A, Haile D, Yuan DS, Klausner RD (1994a) The Saccharomyces cerevisiae copper transport protein (Ctr1p). Biochemical characterization, regulation by copper, and physiologic role in copper uptake. J Biol Chem 269(41): 25660- 25667.

187

Dancis A, Yuan DS, Haile D, Askwith C, Eide D et al. (1994b) Molecular characterization of a copper transport protein in S. cerevisiae: an unexpected role for copper in iron transport. Cell 76(2): 393-402.

David L, Huber W, Granovskaia M, Toedling J, Palm CJ et al. (2006) A high- resolution map of transcription in the yeast genome. Proc Natl Acad Sci U S A 103(14): 5320-5325.

Demeter J, Beauheim C, Gollub J, Hernandez-Boussard T, Jin H et al. (2007) The Stanford Microarray Database: implementation of new analysis tools and open source release of software. Nucleic Acids Res 35(Database issue): D766-770.

Dong G, Chakshusmathi G, Wolin SL, Reinisch KM (2004) Structure of the La motif: a winged helix domain mediates RNA binding via a conserved aromatic patch. Embo J 23(5): 1000-1007.

Dreyfuss G, Kim VN, Kataoka N (2002) Messenger-RNA-binding proteins and the messages they carry. Nat Rev Mol Cell Biol 3(3): 195-205.

Fan H, Sakulich AL, Goodier JL, Zhang X, Qin J et al. (1997) Phosphorylation of the human La antigen on serine 366 can regulate recycling of RNA polymerase III transcription complexes. Cell 88(5): 707-715.

Filipowicz W, Bhattacharyya SN, Sonenberg N (2008) Mechanisms of posttranscriptional regulation by microRNAs: are the answers in sight? Nat Rev Genet 9(2): 102-114.

Finn RD, Mistry J, Schuster-Bockler B, Griffiths-Jones S, Hollich V et al. (2006) Pfam: clans, web tools and services. Nucleic Acids Res 34(Database issue): D247-251.

Fok V, Friend K, Steitz JA (2006) Epstein-Barr virus noncoding RNAs are confined to the nucleus, whereas their partner, the human La protein, undergoes nucleocytoplasmic shuttling. J Cell Biol 173(3): 319-325.

Freydank AC, Brandt W, Drager B (2008) Protein structure modeling indicates hexahistidine-tag interference with enzyme activity. Proteins 72(1): 173-183.

Galgano A, Forrer M, Jaskiewicz L, Kanitz A, Zavolan M et al. (2008) Comparative analysis of mRNA targets for human PUF-family proteins suggests extensive interaction with the miRNA regulatory system. PLoS One 3(9): e3164.

Gancedo JM (1998) Yeast carbon catabolite repression. Microbiol Mol Biol Rev 62(2): 334-361.

188

Gao FB, Carson CC, Levine T, Keene JD (1994) Selection of a subset of mRNAs from combinatorial 3' untranslated region libraries using neuronal RNA- binding protein Hel-N1. Proc Natl Acad Sci U S A 91(23): 11207-11211.

Gebauer F, Hentze MW (2004) Molecular mechanisms of translational control. Nat Rev Mol Cell Biol 5(10): 827-835.

Gelperin DM, White MA, Wilkinson ML, Kon Y, Kung LA et al. (2005) Biochemical and genetic analysis of the yeast proteome with a movable ORF collection. Genes Dev 19(23): 2816-2826.

Gerber AP, Keller W (1999) An adenosine deaminase that generates inosine at the wobble position of tRNAs. Science 286(5442): 1146-1149.

Gerber AP, Herschlag D, Brown PO (2004) Extensive association of functionally and cytotopically related mRNAs with Puf family RNA-binding proteins in yeast. PLoS Biol 2(3): E79.

Gerber AP, Luschnig S, Krasnow MA, Brown PO, Herschlag D (2006) Genome-wide identification of mRNAs associated with the translational regulator PUMILIO in Drosophila melanogaster. Proc Natl Acad Sci U S A 103(12): 4487-4492.

Ghaemmaghami S, Huh WK, Bower K, Howson RW, Belle A et al. (2003) Global analysis of protein expression in yeast. Nature 425(6959): 737-741.

Glenn HL, Wang Z, Schwartz LM (2010) Acheron, a Lupus antigen family member, regulates integrin expression, adhesion, and motility in differentiating myoblasts. Am J Physiol Cell Physiol 298(1): C46-55.

Glisovic T, Bachorik JL, Yong J, Dreyfuss G (2008) RNA-binding proteins and posttranscriptional gene regulation. FEBS Lett 582(14): 1977-1986.

Godon C, Lagniel G, Lee J, Buhler JM, Kieffer S et al. (1998) The H2O2 stimulon in Saccharomyces cerevisiae. J Biol Chem 273(35): 22480-22489.

Goodier JL, Fan H, Maraia RJ (1997) A carboxy-terminal basic region controls RNA polymerase III transcription factor activity of human La protein. Mol Cell Biol 17(10): 5823-5832.

Gottlieb E, Steitz JA (1989) The RNA binding protein La influences both the accuracy and the efficiency of RNA polymerase III transcription in vitro. Embo J 8(3): 841-850.

Grant CM (2008) Metabolic reconfiguration is a regulated response to oxidative stress. J Biol 7(1): 1.

Greenberg JR (1979) Ultraviolet light-induced crosslinking of mRNA to proteins. Nucleic Acids Res 6(2): 715-732.

189

Grigull J, Mnaimneh S, Pootoolal J, Robinson MD, Hughes TR (2004) Genome-wide analysis of mRNA stability using transcription inhibitors and microarrays reveals posttranscriptional control of ribosome biogenesis factors. Mol Cell Biol 24(12): 5534-5547.

Hackermuller J, Meisner NC, Auer M, Jaritz M, Stadler PF (2005) The effect of RNA secondary structures on RNA-ligand binding and the modifier RNA mechanism: a quantitative model. Gene 345(1): 3-12.

Hafner M, Landthaler M, Burger L, Khorshid M, Hausser J et al. (2010) Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell 141(1): 129-141.

Halbeisen RE, Gerber AP (2009) Stress-Dependent Coordination of Transcriptome and Translatome in Yeast. PLoS Biol 7(5): e105.

Halbeisen RE, Scherrer T, Gerber AP (2009) Affinity purification of ribosomes to access the translatome. Methods 48(3): 306-310.

He N, Jahchan NS, Hong E, Li Q, Bayfield MA et al. (2008) A La-related protein modulates 7SK snRNP integrity to suppress P-TEFb-dependent transcriptional elongation and tumorigenesis. Mol Cell 29(5): 588-599.

Hiller M, Pudimat R, Busch A, Backofen R (2006) Using RNA secondary structures to guide sequence motif finding towards single-stranded regions. Nucleic Acids Res 34(17): e117.

Hogan DJ, Riordan DP, Gerber AP, Herschlag D, Brown PO (2008) Diverse RNA- binding proteins interact with functionally-related sets of RNAs, suggesting an extensive regulatory system. PLoS Biol 6(10): e255.

Horke S, Reumann K, Schulze C, Grosse F, Heise T (2004) The La motif and the RNA recognition motifs of human La autoantigen contribute individually to RNA recognition and subcellular localization. J Biol Chem 279(48): 50302- 50309.

Huang X, Atwood CS, Moir RD, Hartshorn MA, Tanzi RE et al. (2004) Trace metal contamination initiates the apparent auto-aggregation, amyloidosis, and oligomerization of Alzheimer's Abeta peptides. J Biol Inorg Chem 9(8): 954- 960.

Huang Y, Intine RV, Mozlin A, Hasson S, Maraia RJ (2005) Mutations in the RNA polymerase III subunit Rpc11p that decrease RNA 3' cleavage activity increase 3'-terminal oligo(U) length and La-dependent tRNA processing. Mol Cell Biol 25(2): 621-636.

Hurowitz EH, Brown PO (2003) Genome-wide analysis of mRNA lengths in Saccharomyces cerevisiae. Genome Biol 5(1): R2.

190

Hurowitz EH, Drori I, Stodden VC, Donoho DL, Brown PO (2007) Virtual Northern analysis of the human genome. PLoS One 2(5): e460.

Ichihara K, Shimizu H, Taguchi O, Yamaguchi M, Inoue YH (2007) A Drosophila orthologue of larp protein family is required for multiple processes in male meiosis. Cell Struct Funct 32(2): 89-100.

Imai J, Toh-e A, Matsui Y (1996) Genetic analysis of the Saccharomyces cerevisiae RHO3 gene, encoding a rho-type small GTPase, provides evidence for a role in bud formation. Genetics 142(2): 359-369.

Inada M, Guthrie C (2004) Identification of Lhp1p-associated RNAs by microarray analysis in Saccharomyces cerevisiae reveals association with coding and noncoding RNAs. Proc Natl Acad Sci U S A 101(2): 434-439.

Intine RV, Dundr M, Misteli T, Maraia RJ (2002) Aberrant nuclear trafficking of La protein leads to disordered processing of associated precursor tRNAs. Mol Cell 9(5): 1113-1123.

Intine RV, Tenenbaum SA, Sakulich AL, Keene JD, Maraia RJ (2003) Differential phosphorylation and subcellular localization of La RNPs associated with precursor tRNAs and translation-related mRNAs. Mol Cell 12(5): 1301-1307.

Jacob F, Monod J (1961) Genetic regulatory mechanisms in the synthesis of proteins. J Mol Biol 3: 318-356.

Jamieson DJ (1998) Oxidative stress responses of the yeast Saccharomyces cerevisiae. Yeast 14(16): 1511-1527.

Jeyaprakash A, Welch JW, Fogel S (1991) Multicopy CUP1 plasmids enhance cadmium and copper resistance levels in yeast. Mol Gen Genet 225(3): 363- 368.

Jin YH, Dunlap PE, McBride SJ, Al-Refai H, Bushel PR et al. (2008) Global transcriptome and deletome profiles of yeast exposed to transition metals. PLoS Genet 4(4): e1000053.

Johansson MJ, Bystrom AS (2002) Dual function of the tRNA(m(5)U54)methyltransferase in tRNA maturation. Rna 8(3): 324-335.

Kagami M, Toh-e A, Matsui Y (1997) SRO9, a multicopy suppressor of the bud growth defect in the Saccharomyces cerevisiae rho3-deficient cells, shows strong genetic interactions with tropomyosin genes, suggesting its role in organization of the actin cytoskeleton. Genetics 147(3): 1003-1016.

Kanitz A, Gerber AP (2010) Circuitry of mRNA regulation. Wiley Interdiscip Rev Syst Biol Med 2(2): 245-251.

191

Kedde M, Strasser MJ, Boldajipour B, Oude Vrielink JA, Slanchev K et al. (2007) RNA-binding protein Dnd1 inhibits microRNA access to target mRNA. Cell 131(7): 1273-1286.

Keene JD (2001) Ribonucleoprotein infrastructure regulating the flow of genetic information between the genome and the proteome. Proc Natl Acad Sci U S A 98(13): 7018-7024.

Keene JD (2010) Minireview: global regulation and dynamics of ribonucleic Acid. Endocrinology 151(4): 1391-1397.

Keene JD, Lager PJ (2005) Post-transcriptional operons and regulons co-ordinating gene expression. Chromosome Res 13(3): 327-337.

Kenan DJ, Query CC, Keene JD (1991) RNA recognition: towards identifying determinants of specificity. Trends Biochem Sci 16(6): 214-220.

Kohrer K, Domdey H (1991) Preparation of high molecular weight RNA. Methods Enzymol 194: 398-405.

Kotik-Kogan O, Valentine ER, Sanfelice D, Conte MR, Curry S (2008) Structural analysis reveals conformational plasticity in the recognition of RNA 3' ends by the human La protein. Structure 16(6): 852-862.

Krogan NJ, Cagney G, Yu H, Zhong G, Guo X et al. (2006) Global landscape of protein complexes in the yeast Saccharomyces cerevisiae. Nature 440(7084): 637-643.

Kuhn U, Wahle E (2004) Structure and function of poly(A) binding proteins. Biochim Biophys Acta 1678(2-3): 67-84.

Kulkarni M, Ozgur S, Stoecklin G (2010) On track with P-bodies. Biochem Soc Trans 38(Pt 1): 242-251.

Kurilla MG, Keene JD (1983) The leader RNA of vesicular stomatitis virus is bound by a cellular protein reactive with anti-La lupus antibodies. Cell 34(3): 837- 845.

Kurilla MG, Cabradilla CD, Holloway BP, Keene JD (1984) Nucleotide sequence and host La protein interactions of rabies virus leader RNA. J Virol 50(3): 773-778.

La Fontaine S, Ackland ML, Mercer JF (2010) Mammalian copper-transporting P- type ATPases, ATP7A and ATP7B: emerging roles. Int J Biochem Cell Biol 42(2): 206-209.

Lasko P (2000) The drosophila melanogaster genome: translation factors and RNA binding proteins. J Cell Biol 150(2): F51-56.

192

Lee CH, Shin YK, Phung TT, Bae JS, Kang YH et al. (2010) Involvement of Vts1, a structure-specific RNA-binding protein, in Okazaki fragment processing in yeast. Nucleic Acids Res 38(5): 1583-1595.

Lee JS, Huh WK, Lee BH, Baek YU, Hwang CS et al. (2001) Mitochondrial NADH- cytochrome b(5) reductase plays a crucial role in the reduction of D- erythroascorbyl free radical in Saccharomyces cerevisiae. Biochim Biophys Acta 1527(1-2): 31-38.

Lee MH, Schedl T (2006) RNA-binding proteins. WormBook: 1-13.

Lee WC, Xue ZX, Melese T (1991) The NSR1 gene encodes a protein that specifically binds nuclear localization sequences and has two RNA recognition motifs. J Cell Biol 113(1): 1-12.

Lerner MR, Boyle JA, Hardin JA, Steitz JA (1981) Two novel classes of small ribonucleoproteins detected by antibodies associated with lupus erythematosus. Science 211(4480): 400-402.

Levine TD, Gao F, King PH, Andrews LG, Keene JD (1993) Hel-N1: an autoimmune RNA-binding protein with specificity for 3' uridylate-rich untranslated regions of growth factor mRNAs. Mol Cell Biol 13(6): 3494-3504.

Lopez de Silanes I, Zhan M, Lal A, Yang X, Gorospe M (2004) Identification of a target RNA motif for RNA-binding protein HuR. Proc Natl Acad Sci U S A 101(9): 2987-2992.

Luk E, Jensen LT, Culotta VC (2003) The many highways for intracellular trafficking of metals. J Biol Inorg Chem 8(8): 803-809.

Lutsenko S (2010) Human copper homeostasis: a network of interconnected pathways. Curr Opin Chem Biol 14(2): 211-217.

Mangus DA, Evans MC, Jacobson A (2003) Poly(A)-binding proteins: multifunctional scaffolds for the post-transcriptional control of gene expression. Genome Biol 4(7): 223.

Maniatis T, Reed R (2002) An extensive network of coupling among gene expression machines. Nature 416(6880): 499-506.

Mansfield KD, Keene JD (2009) The ribonome: a dominant force in co-ordinating gene expression. Biol Cell 101(3): 169-181.

Marnef A, Maldonado M, Bugaut A, Balasubramanian S, Kress M et al. (2010) Distinct functions of maternal and somatic Pat1 protein paralogs. Rna 16(11): 2094-2107.

193

Mathews MB, Francoeur AM (1984) La antigen recognizes and binds to the 3'- oligouridylate tail of a small RNA. Mol Cell Biol 4(6): 1134-1140.

Mattioli M, Reichlin M (1974) Heterogeneity of RNA protein antigens reactive with sera of patients with systemic lupus erythematosus. Description of a cytoplasmic nonribosomal antigen. Arthritis Rheum 17(4): 421-429.

McLaren RS, Caruccio N, Ross J (1997) Human La protein: a stabilizer of histone mRNA. Mol Cell Biol 17(6): 3028-3036.

Meerovitch K, Svitkin YV, Lee HS, Lejbkowicz F, Kenan DJ et al. (1993) La autoantigen enhances and corrects aberrant translation of poliovirus RNA in reticulocyte lysate. J Virol 67(7): 3798-3807.

Molina-Navarro MM, Castells-Roca L, Belli G, Garcia-Martinez J, Marin-Navarro J et al. (2008) Comprehensive transcriptional analysis of the oxidative response in yeast. J Biol Chem 283(26): 17908-17918.

Moore MJ (2005) From birth to death: the complex lives of eukaryotic mRNAs. Science 309(5740): 1514-1518.

Morris AR, Mukherjee N, Keene JD (2010) Systematic analysis of posttranscriptional gene expression. Wiley Interdiscip Rev Syst Biol Med 2(2): 162-180.

Muraro NI, Weston AJ, Gerber AP, Luschnig S, Moffat KG et al. (2008) Pumilio binds para mRNA and requires Nanos and Brat to regulate sodium current in Drosophila motoneurons. J Neurosci 28(9): 2099-2109.

Nykamp K, Lee MH, Kimble J (2008) C. elegans La-related protein, LARP-1, localizes to germline P bodies and attenuates Ras-MAPK signaling during oogenesis. Rna 14(7): 1378-1389.

O'Connor CM, Collins K (2006) A novel RNA binding domain in tetrahymena telomerase p65 initiates hierarchical assembly of telomerase holoenzyme. Mol Cell Biol 26(6): 2029-2036.

Ohndorf UM, Steegborn C, Knijff R, Sondermann P (2001) Contributions of the individual domains in human La protein to its RNA 3'-end binding activity. J Biol Chem 276(29): 27188-27196.

Orphanides G, Reinberg D (2002) A unified theory of gene expression. Cell 108(4): 439-451.

Parker R, Song H (2004) The enzymes and control of eukaryotic mRNA turnover. Nat Struct Mol Biol 11(2): 121-127.

Pellizzoni L, Cardinali B, Lin-Marq N, Mercanti D, Pierandrei-Amaldi P (1996) A Xenopus laevis homologue of the La autoantigen binds the pyrimidine tract of

194

the 5' UTR of ribosomal protein mRNAs in vitro: implication of a protein factor in complex formation. J Mol Biol 259(5): 904-915.

Pena MM, Lee J, Thiele DJ (1999) A delicate balance: homeostatic control of copper uptake and distribution. J Nutr 129(7): 1251-1260.

Penalva LO, Tenenbaum SA, Keene JD (2004) Gene expression analysis of messenger RNP complexes. Methods Mol Biol 257: 125-134.

Petrukhin K, Lutsenko S, Chernov I, Ross BM, Kaplan JH et al. (1994) Characterization of the Wilson disease gene encoding a P-type copper transporting ATPase: genomic organization, alternative splicing, and structure/function predictions. Hum Mol Genet 3(9): 1647-1656.

Petrukhin K, Fischer SG, Pirastu M, Tanzi RE, Chernov I et al. (1993) Mapping, cloning and genetic characterization of the region containing the Wilson disease gene. Nat Genet 5(4): 338-343.

Pudi R, Srinivasan P, Das S (2004) La protein binding at the GCAC site near the initiator AUG facilitates the ribosomal assembly on the hepatitis C virus RNA to influence internal ribosome entry site-mediated translation. J Biol Chem 279(29): 29879-29888.

Puig O, Caspary F, Rigaut G, Rutz B, Bouveret E et al. (2001) The tandem affinity purification (TAP) method: a general procedure of protein complex purification. Methods 24(3): 218-229.

Puig S, Askeland E, Thiele DJ (2005) Coordinated remodeling of cellular metabolism during iron deficiency through targeted mRNA degradation. Cell 120(1): 99- 110.

Puig S, Lee J, Lau M, Thiele DJ (2002) Biochemical and genetic analyses of yeast and human high affinity copper transporters suggest a conserved mechanism for copper uptake. J Biol Chem 277(29): 26021-26030.

Rae TD, Schmidt PJ, Pufahl RA, Culotta VC, O'Halloran TV (1999) Undetectable intracellular free copper: the requirement of a copper chaperone for superoxide dismutase. Science 284(5415): 805-808.

Reddy R, Henning D, Tan E, Busch H (1983) Identification of a La protein binding site in a RNA polymerase III transcript (4.5 I RNA). J Biol Chem 258(13): 8352-8356.

Rees EM, Lee J, Thiele DJ (2004) Mobilization of intracellular copper stores by the ctr2 vacuolar copper transporter. J Biol Chem 279(52): 54221-54229.

Reichlin M (1981) Current perspectives on serological reactions in SLE patients. Clin Exp Immunol 44(1): 1-10.

195

Roberts EA, Schilsky ML (2008) Diagnosis and treatment of Wilson disease: an update. Hepatology 47(6): 2089-2111.

Röther S, Burkert C, Brunger KM, Mayer A, Kieser A et al. (2010) Nucleocytoplasmic shuttling of the La motif-containing protein Sro9 might link its nuclear and cytoplasmic functions. Rna 16(7): 1393-1401.

Rougemaille M, Villa T, Gudipati RK, Libri D (2008) mRNA journey to the cytoplasm: attire required. Biol Cell 100(6): 327-342.

Schaffler K, Schulz K, Hirmer A, Wiesner J, Grimm M et al. (2010) A stimulatory role for the La-related protein 4B in translation. Rna 16(8): 1488-1499.

Scherrer T, Mittal N, Janga SC, Gerber AP (2010) A screen for RNA-binding proteins in yeast indicates dual functions for many enzymes. PLoS One 5(11): e15499.

Schleifer KH (2009) Classification of Bacteria and Archaea: past, present and future. Syst Appl Microbiol 32(8): 533-542.

Schwartz EI, Intine RV, Maraia RJ (2004) CK2 is responsible for phosphorylation of human La protein serine-366 and can modulate rpL37 5'-terminal oligopyrimidine mRNA metabolism. Mol Cell Biol 24(21): 9580-9591.

Segref A, Sharma K, Doye V, Hellwig A, Huber J et al. (1997) Mex67p, a novel factor for nuclear mRNA export, binds to both poly(A)+ RNA and nuclear pores. Embo J 16(11): 3256-3271.

Shanmuganathan A, Avery SV, Willetts SA, Houghton JE (2004) Copper-induced oxidative stress in Saccharomyces cerevisiae targets enzymes of the glycolytic pathway. FEBS Lett 556(1-3): 253-259.

Sharp PA (2009) The centrality of RNA. Cell 136(4): 577-580.

Shenton D, Smirnova JB, Selley JN, Carroll K, Hubbard SJ et al. (2006) Global translational responses to oxidative stress impact upon multiple levels of protein synthesis. J Biol Chem 281(39): 29011-29021.

Sherman F (2002) Getting started with yeast. Methods Enzymol 350: 3-41.

Shiels JC, Tuite JB, Nolan SJ, Baranger AM (2002) Investigation of a conserved stacking interaction in target site recognition by the U1A protein. Nucleic Acids Res 30(2): 550-558.

Sobel SG, Wolin SL (1999) Two yeast La motif-containing proteins are RNA-binding proteins that associate with polyribosomes. Mol Biol Cell 10(11): 3849-3862.

196

Sommer G, Dittmann J, Kuehnert J, Reumann K, Schwartz PE et al. (2010) The RNA-binding protein La contributes to cell proliferation and CCND1 expression. Oncogene.

Sopko R, Huang D, Preston N, Chua G, Papp B et al. (2006) Mapping pathways and phenotypes by systematic gene overexpression. Mol Cell 21(3): 319-330.

St Johnston D (2005) Moving messages: the intracellular localization of mRNAs. Nat Rev Mol Cell Biol 6(5): 363-375.

Stefano JE (1984) Purified lupus antigen La recognizes an oligouridylate stretch common to the 3' termini of RNA polymerase III transcripts. Cell 36(1): 145- 154.

Stone MD, Mihalusova M, O'Connor C M, Prathapam R, Collins K et al. (2007) Stepwise protein-mediated RNA folding directs assembly of telomerase ribonucleoprotein. Nature 446(7134): 458-461.

Svitkin YV, Pause A, Sonenberg N (1994) La autoantigen alleviates translational repression by the 5' leader sequence of the human immunodeficiency virus type 1 mRNA. J Virol 68(11): 7001-7007.

Tan Q, Li X, Sadhale PP, Miyao T, Woychik NA (2000) Multiple mechanisms of suppression circumvent transcription defects in an RNA polymerase mutant. Mol Cell Biol 20(21): 8124-8133.

Tapiero H, Townsend DM, Tew KD (2003) Trace elements in human physiology and pathology. Copper. Biomed Pharmacother 57(9): 386-398.

Tenenbaum SA, Carson CC, Lager PJ, Keene JD (2000) Identifying mRNA subsets in messenger ribonucleoprotein complexes by using cDNA arrays. Proc Natl Acad Sci U S A 97(26): 14085-14090.

Tenenbaum SA, Lager PJ, Carson CC, Keene JD (2002) Ribonomics: identifying mRNA subsets in mRNP complexes using antibodies to RNA-binding proteins and genomic arrays. Methods 26(2): 191-198.

Teplova M, Yuan YR, Phan AT, Malinina L, Ilin S et al. (2006) Structural basis for recognition and sequestration of UUU(OH) 3' temini of nascent RNA polymerase III transcripts by La, a rheumatic disease autoantigen. Mol Cell 21(1): 75-85.

Thiele DJ (1988) ACE1 regulates expression of the Saccharomyces cerevisiae metallothionein gene. Mol Cell Biol 8(7): 2745-2752.

Thiele DJ, Wright CF, Walling MJ, Hamer DH (1987) Function and regulation of yeast copperthionein. Experientia Suppl 52: 423-429.

197

Thomas M, Lieberman J, Lal A (2010) Desperately seeking microRNA targets. Nat Struct Mol Biol 17(10): 1169-1174.

Tipper DJ (1973) Inhibition of yeast ribonucleic acid polymerases by thiolutin. J Bacteriol 116(1): 245-256.

Tisato F, Marzano C, Porchia M, Pellei M, Santini C (2009) Copper in diseases and treatments, and copper-based anticancer strategies. Med Res Rev 30(4): 708-749.

Troeger R (1964) [the Effect of Copper Sulfate on the Respiration, Aerobic and Anaerobic Fermentation of Saccharomyces Cerevisiae]. Arch Mikrobiol 48: 282-290.

Trotta R, Vignudelli T, Candini O, Intine RV, Pecorari L et al. (2003) BCR/ABL activates mdm2 mRNA translation via the La antigen. Cancer Cell 3(2): 145- 160.

Tsukada M, Gallwitz D (1996) Isolation and characterization of SYS genes from yeast, multicopy suppressors of the functional loss of the transport GTPase Ypt6p. J Cell Sci 109 ( Pt 10): 2471-2481.

Tumer Z, Moller LB (2010) Menkes disease. Eur J Hum Genet 18(5): 511-518.

Ule J, Jensen K, Mele A, Darnell RB (2005) CLIP: a method for identifying protein- RNA interaction sites in living cells. Methods 37(4): 376-386.

Ule J, Jensen KB, Ruggiu M, Mele A, Ule A et al. (2003) CLIP identifies Nova- regulated RNA networks in the brain. Science 302(5648): 1212-1215.

Valavanis C, Wang Z, Sun D, Vaine M, Schwartz LM (2007) Acheron, a novel member of the Lupus Antigen family, is induced during the programmed cell death of skeletal muscles in the moth Manduca sexta. Gene 393(1-2): 101- 109. van Bakel H, Strengman E, Wijmenga C, Holstege FC (2005) Gene expression profiling and phenotype analyses of S. cerevisiae in response to changing copper reveals six genes with new roles in copper and iron metabolism. Physiol Genomics 22(3): 356-367.

Van Horn DJ, Yoo CJ, Xue D, Shi H, Wolin SL (1997) The La protein in Schizosaccharomyces pombe: a conserved yet dispensable phosphoprotein that functions in tRNA maturation. Rna 3(12): 1434-1443.

Vergara SV, Puig S, Thiele DJ (2010) Early recruitment of AU-rich Element (ARE)- containing mRNAs determines their cytosolic fate during iron deficiency. Mol Cell Biol.

198

Volz K (2008) The functional duality of iron regulatory protein 1. Curr Opin Struct Biol 18(1): 106-111.

Walden WE, Selezneva AI, Dupuy J, Volbeda A, Fontecilla-Camps JC et al. (2006) Structure of dual function iron regulatory protein 1 complexed with ferritin IRE- RNA. Science 314(5807): 1903-1908.

Wang Y, Liu CL, Storey JD, Tibshirani RJ, Herschlag D et al. (2002) Precision and functional specificity in mRNA decay. Proc Natl Acad Sci U S A 99(9): 5860- 5865.

Wang Z, Glenn H, Brown C, Valavanis C, Liu JX et al. (2009) Regulation of muscle differentiation and survival by Acheron. Mech Dev 126(8-9): 700-709.

Warner JR (1999) The economics of ribosome biosynthesis in yeast. Trends Biochem Sci 24(11): 437-440.

Welch J, Fogel S, Buchman C, Karin M (1989) The CUP2 gene product regulates the expression of the CUP1 gene, coding for yeast metallothionein. Embo J 8(1): 255-260.

Weng H, Kim C, Valavanis C, Wang Z, Schwartz LM (2009) Acheron, an novel LA antigen family member, binds to CASK and forms a complex with Id transcription factors. Cell Mol Biol Lett 14(2): 273-287.

Wilusz J, Kurilla MG, Keene JD (1983) A host protein (La) binds to a unique species of minus-sense leader RNA during replication of vesicular stomatitis virus. Proc Natl Acad Sci U S A 80(19): 5827-5831.

Winge DR, Nielson KB, Gray WR, Hamer DH (1985) Yeast metallothionein. Sequence and metal-binding properties. J Biol Chem 260(27): 14464-14470.

Winzeler EA, Shoemaker DD, Astromoff A, Liang H, Anderson K et al. (1999) Functional characterization of the S. cerevisiae genome by gene deletion and parallel analysis. Science 285(5429): 901-906.

Wolfe KH, Shields DC (1997) Molecular evidence for an ancient duplication of the entire yeast genome. Nature 387(6634): 708-713.

Wolin SL, Cedervall T (2002) The La protein. Annu Rev Biochem 71: 375-403.

Xu Z, Wei W, Gagneur J, Perocchi F, Clauder-Munster S et al. (2009) Bidirectional promoters generate pervasive transcription in yeast. Nature 457(7232): 1033- 1037.

Yang R, Gaidamakov SA, Xie J, Lee J, Martino L et al. (2010) LARP4 binds poly(A), interacts with poly(A)-binding protein MLLE domain via a variant PAM2w motif and can promote mRNA stability. Mol Cell Biol.

199

Yeo GW, Coufal NG, Liang TY, Peng GE, Fu XD et al. (2009) An RNA code for the FOX2 splicing regulator revealed by mapping RNA-protein interactions in stem cells. Nat Struct Mol Biol 16(2): 130-137.

Yoo CJ, Wolin SL (1997) The yeast La protein is required for the 3' endonucleolytic cleavage that matures tRNA precursors. Cell 89(3): 393-402.

Yoshizawa S, Rasubala L, Ose T, Kohda D, Fourmy D et al. (2005) Structural basis for mRNA recognition by elongation factor SelB. Nat Struct Mol Biol 12(2): 198-203.

Yu W, Farrell RA, Stillman DJ, Winge DR (1996) Identification of SLF1 as a new copper homeostasis gene involved in copper sulfide mineralization in Saccharomyces cerevisiae. Mol Cell Biol 16(5): 2464-2472.

Zanin E, Pacquelet A, Scheckel C, Ciosk R, Gotta M (2010) LARP-1 promotes oogenesis by repressing fem-3 in the C. elegans germline. J Cell Sci 123(Pt 16): 2717-2724.

Zhou P, Thiele DJ (1993) Copper and gene regulation in yeast. Biofactors 4(2): 105- 115.

Zimmerman AL, Wu S (2011) MicroRNAs, cancer and cancer stem cells. Cancer Lett 300(1): 10-19.

200

9 Curriculum vitae

201

202

CURRICULUM VITAE

Luca Schenk Lehensteig 21 - 8037 Zurich - Switzerland - +41 (0)78 733 92 10 - [email protected]

PERSONAL INFORMATION

Date of birth: January 02, 1980 Place of birth: Basel, Switzerland Nationality: Swiss Marital status: unmarried

EDUCATION

12/2006 – 01/2011 PhD studies in the group of Prof. Michael Detmar under the supervision of Dr. André Gerber Institute of Pharmaceutical Sciences, ETH Zurich, Switzerland 12/2006 – 01/2011 Member of the PhD Program in Molecular Life Sciences (MLS) University and ETH Zurich, Switzerland 09/2005 Diploma in Molecular Biology University of Basel, Switzerland 09/2000 – 09/2005 Undergraduate studies in Molecular Biology, Biozentrum Basel Subsidiary subject: Medical Biology University of Basel, Switzerland 09/1999 Matura typus B Progymansium Oberwil, Switzerland

PROFESSIONAL EXPERIENCE

12/2006 – 01/2011 PhD thesis in the group of Prof. Michael Detmar  Thesis entitled “Yeast La-related proteins and the La-motif: Defining RNA targets and roles in gene expression Control”  Teaching in the yearly one-week practical course in Medicinal Chemistry (Bachelor studies in Pharmaceutical Sciences, ETH Zurich)  Supervising semester and summer projects of students in the Institute of Pharmaceutical Sciences Institute of Pharmaceutical Sciences, ETH Zurich, Switzerland

203

04/2004 – 10/2005 Diploma thesis in the group of Prof. Dr. Witold Filipowicz  Diploma thesis entitled "Biochemical properties of PAZ domain of human Dicer" and "Identification of microRNA targets". Friedrich Miescher Institute of Biomedical Research, University of Basel, Switzerland 10/2002 – 02/2003 Practical training at biotechnology company Working language: French Innu-Science, Montréal, Canada 06/2001 Substitution as teacher in mathematics at secondary school Sekundarschule Therwil, Switzerland

ADDITIONAL EDUCATION

05/2000 – 09/2000 Language training in Australia (Certificate of Proficiency in English, Cambridge Exam)

ORAL AND POSTER PRESENTATIONS

12/2009 Oral presentation “Global identification of potential RNA targets for the paralogous La-related RNA binding proteins Slf1p and Sro9p“ RNA Club Zürich, Zürich 09/2009 Poster presentation “Global identification of potential RNA targets for the paralogous La-related RNA binding proteins Slf1p and Sro9p“ Translational Control Meeting, Heidelberg, Germany 09/2009 Oral presentation “Global identification of RNA targets for the paralogous La-related RNA binding Proteins Slf1p and Sro9p” Doktorandentag of the Institute of Pharmaceutical Sciences, ETH Zurich, Switzerland 07/2008 Poster presentation “Identification of mRNAs bound by ribosome-associated RNA binding proteins “ RNA Society Meeting, Berlin, Germany 09/2007 Poster presentation “Global identification of mRNAs that are translationally regulated by ribosome-associated RBPs“ Annual Retreat of the Zurich PhD Program in Molecular Life Sciences (MLS), Fiescheralp, Switzerland 01/2007 Poster presentation “Global identification of mRNAs that are translationally regulated by ribosome-associated RNA binding proteins“Swiss RNA workshop, University of Bern, Switzerland

204

PUBLICATIONS

Schenk L, Meinel DM, Sträßer K, Gerber AP. La-motif dependent mRNA binding of La- related proteins promotes copper detoxification in yeast. In preparation.

San Paolo S, Vanacova S, Schenk L, Scherrer T, Blank D, Keller W, Gerber AP (2009) Distinct roles of non-canonical poly(A) polymerases in RNA metabolism. PLoS Genet 5: e1000555.

205