Jones et al., Mitochondrial protein translation in Rb/p53-deficient TNBC
Targeting mitochondrial translation in RB1-deficient triple-negative breast cancer
Robert A. Jones1, §, Tyler J. Robinson1, §, Jeff C. Liu1, §, Mariusz Shrestha1,2, §, Veronique Voisin3,§, YoungJun Ju1, Philip E.D. Chung1,2, Giovanna Pellecchia2, Victoria L. Fell1, SooIn Bae4, Lakshmi Muthuswamy5, Alessandro Datti6.7, Sean E. Egan8,9, Zhe Jiang1, Gustavo Leone4, Gary D. Bader3,9, Aaron Schimmer10 and Eldad Zacksenhaus1,2,11*
SUPPLEMENTARY TABLES S1-S2 and FIGURES S1-S14
1 Supplemental Table S1. Chromatin-immunoprecipitation (ChIP) data on E2F1 recruitment to MPT and cell cycle promoters in MCF10A and MCF7 cells ChIP-Seq (MCF7) ChIP-Chip (MCF7, MCF10A)
Gene Chrom Peaks Encode Peaks Range Ave ePV MCF7 MCF10A *500bp SFXN1 chr5 169 169.149 (-165) -- (30) 0.02734 + - Yes SFXN2 chr10 -43 165.207 (-257) -- (445) 0.01818 + + Yes (-1258) – SMAD3 chr15 307 128.485 0.03377 + - No (-1113) MRPL37 chr1 -99 126.794 (-475) -- (340) 0.00976 + + Yes TTC19 chr17 143 100.876 (18) 0.00800 - + Yes HTRA2 chr2 200 99.748 (-382) -- (491) 0.02122 + + Yes PARK7 chr1 -12 79.489 (-239) -- (-144) 0.02434 + + Yes NSUN4 chr1 -342 77.904 (551) 0.00050 + + No MRPL40 chr22 -151 76.814 (233) -- (478) 0.02894 + + Yes CISD1 chr10 -460 57.495 (-523) -- (-143) 0.01591 + + Yes ETFDH chr4 -379 54.638 (-233) -- (-193) 0.01237 + + Yes MPV17 chr2 79 51.905 (-248) -- (-173) 0.02611 + + Yes PHB2 chr12 95 39.419 (-385) -- (116) 0.02034 + + Yes DUSP18 chr22 -155 38.338 (-241) -- (-36) 0.00849 + - Yes HIGD2A chr5 70 36.271 (-399) -- (224) 0.00360 + + Yes NDUFAB1 chr16 295 29.171 (-13) -- (127) 0.02427 + + Yes TOMM40 chr19 -216 27.798 (-645) -- (-525) 0.00360 + + Yes ATP5D chr19 -27 25.273 (-220) -- (-100) 0.01764 + + Yes MRPL43 chr10 165 15.703 (-206) -- (224) 0.01452 + + Yes DHFR chr5 350 4.057 (-605) -- (-415) 0.02249 + + No TK1 chr17 39 12.113 (-688) -- (-188) 0.00985 + + Yes POLA1 chrX -93 29.955 (-610) -- (-325) 0.00718 + + Yes CCNE1 chr19 128 73.359 (-954) 0.01000 + - No CDK1 chr10 -695 12.265 (-551) -- (-136) 0.01133 + + Yes ALB chr4 NA NA NA NA NA NA NA * Peaks detected by ChIP-Seq and ChIP-Chip are within 500 bp of each other
Supplemental Table S2. Correlation analysis of RB, E2F1 and E2F3 expression with those of indicated MPT vs known E2F-regulated cell cycle genes. Albumin was used as negative ctrl.
RB E2F1 E2F3
atp5d -0.11*** 0.06** 0.01 cisd1 0 0.10*** 0.08*** mprl37 -0.22*** 0.28*** 0.21*** ndufab1 -0.04* 0.06** -0.11 nsun4 -0.18*** 0.17*** 0.14*** phb2 -0.20*** 0.04* 0.16*** sfxn1 -0.01 0.05* -0.02 smad3 -0.03 0.18*** 0.05* tomm40 -0.26*** 0.20*** 0.37*** dhfr -0.04 0.08*** 0.13*** tk1 -0.17*** 0.22*** 0.21*** Pola1 -0.13*** 0.12*** 0.09*** Ccne1 -0.17*** 0.20*** 0.35*** cdc2 -0.02 0.13*** 0.17*** alb 0.03 0.01 -0.10*** +ve / -ve Correlation *p < 0.05; **p <0.005; ***p < 0.0005
MFS #Basal Patient Treatment GSE2034 52 Radiotherapy GSE2603 22 Radiotherapy GSE5327 35
Supplemental Figure S1 Jones et al., Mitochondrial protein translation in Rb/p53-deficient TNBC
Figure S1. Cohorts with Metastasis Free Survival (MFS) and RNA expression data used for bioinformatic analysis. These breast cancer datasets were combined for the bioinformatic analysis shown in Fig 1. Treatment and number of basal-like patients in each cohort (based on PAM50 classification) are indicated.
2 A Mammary Tumor Median Tumor Model Incidence Tumor Onset 6/8 donors (75%) MMTVcre:Rbf/f:p53f/f (Transplant) 275 19/26 transplants (73%)
MMTVcre:Rbf/f:p53f/f 16/21 (76%) 453
3/3 experiments (100%) Ad-CMVcre:Rbf/f:p53f/f 261 6/9 transplants (67%)
MMTVcre:Rbf/f:p53LSLR270H/+ 5/10 (50%) 429
B C F
D E G
WAPcre;Rbf/f;p53f/f H I J
H&E Desmin N-cadherin
Supplemental Figure S2 Jones et al., Mitochondrial protein translation in Rb/p53-deficient TNBC
Figure S2. Disruption of Rb and p53 in mammary epithelium via MMTV-cre or WAP-Cre induces spindle-cell tumors. (A) Incidence and onset of mammary tumor formation in indicated models following disruption of Rb and p53 in mammary epithelia. (B-C, F) Histology of rare solid mammary tumors that developed in two MMTVcre;Rbf/f;p53f/f mice and a corresponding lung metastases (F) from (B). (D-E, G) Locally invasive spindle cell tumors without lung metastases (G) from MMTVcre;Rbf/f;p53f/f mice. (H-J) Histology and expression of the mesenchymal markers desmin and N-cadherin in a spindle-cell tumor from WAPcre;Rbf/f;p53f/f mice. Scale bars in B-G, 200µm; H,
50µm.
3 4 Isolate mammary glands Dissociate into Sort luminal 10 luminal A f/f f/f 3 C from Rb :p53 mice single cells and basal cells 10 2 10 CD24 1 10 basal 0 10 0 1 2 3 4 10 10 10 10 10 CD49f Short-term
C Cleared fat pad infect with 3D culture transplantation Ad-Cre
B C D Cre
Rb∆ p53∆ E F Luminal Basal 100 Free - p=0.0093 50 %Tumor
0 Days 0 100 200 300 control (n=18) basal (n =13) luminal (n= 17)
#Tumors/#Mice G Experiment Luminal Basal Control 1 5/5 3/5 0/3 with support cells 2 2/3 1/3 0/3 3 3/3 1/3 0/3
4 1/2 1/2 N/A without 5 2/4 N/A N/A support cells Supplemental total 13/17 (76%) 6/13 (46%) 0/9 l Figure S3 Jones et al., Mitochondrial protein translation in Rb/p53-deficient TNBC
Figure S3. Disruption of Rb and p53 in enriched populations of either luminal or basal progenitors induce spindle-tumors. (A) Schematic of the experimental protocol used to delete Rb and p53 in luminal or basal progenitors. Primary mammary epithelial cells (MECs) were isolated from
Rbf/f;p53f/f mice and sorted into luminal and basal cell populations using fluorescent activated cell sorting (FACS). Sorted cells were then cultured in 3D to allow formation of sphere-like organoids.
After 5-8 days, organoids were dissociated into single cells, infected with Ad-cre-GFP and transplanted into cleared fat pads of immune-deficient mice. (B-D) Ex vivo deletion of Rb and p53.
Brightfield (B) and GFP fluorescent (C) photomicrographs of Ad-cre-GFP infected primary Rbf/f;p53f/f mammary epithelial cells cultured under non-adherent conditions. Scale bars 100µm. (D) PCR analysis for Rb and p53 recombination 72hrs post infection with Ad-cre-GFP or Ad-GFP. (E) Top, photomicrographs showing distinct morphologies of luminal and basal organoids in 3D conditions
(scale bars, 20µm). Bottom, histology of mammary tumors developed following Ad-cre-GFP mediated deletion of Rbf/f and p53f/f in luminal or basal progenitors. (F) Kaplan-Meier mammary tumor-free survival curves of mice transplanted with Rb/p53-deficient luminal or basal progenitors
(Fisher’s exact test, p=0.1322). Ad-GFP infected cells from wild type mice served as controls. (G)
Tumor incidence from the Ad-cre-GFP -infected Rbf/f;p53f/f luminal or basal progenitors.
4 A chromosome 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 100
50 Gains (%)
0
50 Losses(%) 100
B chromosome 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 100
50 Gains (%)
0
50 Losses(%) 100
C 6qA2 (MET) 56%
9qA1(BIRC2, BIRC3, YAP1, MMP Cluster) 22%
14qA1 (FHIT) 44%
15qD1 (MYC/Pvt1) 56%
AMP
Gain Homozygous Deletion
Supplemental Figure S4A-C D
Region Region'Length Cytoband'Location Event chr1:90,194,440:90,208,356 13916 qD CN'Gain chr2:77,709,806:77,867,695 157889 qC3 CN'Loss chr4:111,738,147:112,270,058 531911 qD1 CN'Gain chr4:112,468,339:112,481,282 12943 qD1 CN'Gain chr4:112,509,281:113,255,950 746669 qD1 CN'Gain chr4:113,544,283:113,585,504 41221 qD1 CN'Gain chr6:17,054,902:17,711,820 656918 qA2 CN'Gain chr6:17,849,280:18,003,078 153798 qA2 CN'Gain chr6:19,938,904:21,000,795 1061891 qA2 CN'Gain chr6:41,017,660:41,115,088 97428 qB1 CN'Gain chr6:70,448,376:70,628,523 180147 qC1 CN'Gain chr7:26,778,136:26,984,188 206052 qA3 CN'Loss chr7:38,963,263:38,985,946 22683 qB2 CN'Loss chr7:54,893,308:54,997,383 104075 qB4 CN'Gain chr9:6,557,813:8,368,369 1810556 qA1 CN'Gain chr9:9,153,878:9,190,123 36245 qA1 CN'Gain chr10:100,595,649:100,669,755 74106 qD1 CN'Gain chr11:70,982,720:71,111,487 128767 qB4 CN'Gain chr11:103,370,441:103,390,309 19868 qE1 CN'Gain chr11:116,602,137:116,629,157 27020 qE2 CN'Gain chr12:114,835,050:114,971,111 136061 qF1 CN'Gain chr12:115,303,388:115,378,652 75264 qF1 CN'Gain chr12:115,864,896:116,024,653 159757 qF2 CN'Gain chr12:116,264,299:116,299,818 35519 qF2 CN'Gain chr14:10,729,542:11,668,820 6063 qA1 CN'Loss chr14:52,575,120:52,593,014 17894 qC2 CN'Gain chr15:61,050,340:62,788,961 1738621 qD1 CN'Gain chr16:36,244,633:36,328,140 83507 qB3 CN'Gain chr16:44,830,484:44,868,563 38079 qB4 CN'Gain chr16:80,943,011:80,972,831 29820 qC3.3 CN'Gain chr17:38,441,884:38,514,425 72541 qB1 CN'Gain
Supplemental Figure S4D Jones et al., Mitochondrial protein translation in Rb/p53-deficient TNBC
Figure S4. Copy number alterations in Rb∆/∆;p53∆/∆ claudin-low tumors. (A-B) Frequency plots of copy number alterations (amplification or homozygous deletion) in Rb∆/∆;p53∆/∆ mammary tumors at low (A) and high (B) stringency. (C) Oncoprint of copy number changes involving the indicated oncogenes and tumor suppressors. (D) Summary of high-level amplifications and homozygous deletions.
5 A 120 120 100 100
80 80
60 60
(to control) 40 (to control) 40 % Cell Viability % Cell Viability 20 20
0 0
Crizotinib (μM) WAY 170523 (μM)
* * 100 100 B * 80 * 80
60 60
40 40
20 20
0 0 C
100 *
80 *
120 MDA-MB-231 60 100 MCF-7 80 40 60 control) 40
20 (to
% Cell Viability 20 0 0
WAY 17053 (μM)
Supplemental Figure S5 Jones et al., Mitochondrial protein translation in Rb/p53-deficient TNBC
Figure S5. Effects of drugs that target amplified genes identified by aCGH analysis of
Rb∆/∆;p53∆/∆ claudin low-like tumors. (A) Effect of the MET inhibitor crizotinib or the MMP13 inhibitor WAY170523 on Rb∆/∆;p53∆/∆ tumor cell viability (line# 1; MTT assay) 72 hr post treatment.
(B) Effect of doxorubicin (DOX) alone or in combination with Crizotinib or WAY170523 on
Rb∆/∆;p53∆/∆ tumor cell viability. (C) Effect of doxorubicin plus WAY170523 on viability of the claudin-low TNBC line, MDA-MB-231, and comparison to sensitivity of the luminal BC line, MCF7, showing increased sensitivity of TNBC cells.
6 A Gene ID(s) Ensembl ID(s) Chr Start End Strand Nearest TSS TFBS Start TFBS End TFBS Rel. Start TFBS Rel. End TFBS Strand Abs. Score Rel. Score TFBS Sequence Etfdh ENSMUSG00000027809 3 79407710 79432785 - 79432785 79433023 79433030 -245 -238 + 8.832 87.00% TTGGGCGC Htra2 ENSMUSG00000068329 6 83001260 83005267 - 83005267 83006604 83006611 -1344 -1337 - 9.128 88.00% TTTGTCGC 83005267 83007079 83007086 -1819 -1812 - 8.832 87.00% TTTGGGGC Sfxn1 ENSMUSG00000021474 13 54167214 54203715 + 54167214 54167625 54167632 412 419 - 8.329 85.30% TTGCGCGC Higd2a ENSMUSG00000025868 13 54691568 54692519 + 54691568 54691430 54691437 -138 -131 - 8.329 85.30% TTGCGCGC Rab3a ENSMUSG00000031840 8 73278578 73282576 + 73278578 73277291 73277298 -1287 -1280 + 8.832 87.00% ATTGGCGC Smad3 ENSMUSG00000032402 9 63494574 63605801 - 63559776 63560901 63560908 -1132 -1125 - 8.832 87.00% TTTGGGGC 63605801 63605852 63605859 -58 -51 + 8.832 87.00% TTTGGTGC 63605801 63605988 63605995 -194 -187 + 8.624 86.30% TTTCACGC Mtx1 ENSMUSG00000064068 3 89013003 89031010 - 89014758 89014787 89014794 -36 -29 + 8.832 87.00% TTTGGAGC 89031010 89031210 89031217 -207 -200 - 8.832 87.00% TCTGGCGC 89031010 89031433 89031440 -430 -423 + 8.832 87.00% TTTGGTGC Ndufab1 ENSMUSG00000030869 7 129228917 129245400 - 129245220 129245146 129245153 68 75 - 8.496 85.90% TTTGCCGG Mrpl43 ENSMUSG00000025208 19 45079504 45080932 - 45080932 45081394 45081401 -469 -462 - 8.469 85.80% TTTCGCGT 45080932 45081709 45081716 -784 -777 + 8.832 87.00% CTTGGCGC 45080932 45082026 45082033 -1101 -1094 - 8.832 87.00% TTTGGCCC 45080932 45082586 45082593 -1661 -1654 - 8.329 85.30% TTTCGAGC Atp5d ENSMUSG00000003072 10 79601377 79608563 + 79601377 79601715 79601722 339 346 - 8.329 85.30% TGTCGCGC Sfxn2 ENSMUSG00000025036 19 46647855 46671388 + 46647855 46647445 46647452 -410 -403 + 8.329 85.30% TTACGCGC 46647855 46647701 46647708 -154 -147 - 12.603 100.00% TTTGGCGC Nsun4 ENSMUSG00000028706 4 115704379 115726481 - 115726481 115725813 115725820 662 669 - 8.832 87.00% TGTGGCGC 115726481 115727690 115727697 -1216 -1209 - 8.832 87.00% TTTGGCTC Nsun4 ENSMUSG00000090697 4 115706512 115725985 - 115725985 115727690 115727697 -1712 -1705 - 8.832 87.00% TTTGGCTC Park7 ENSMUSG00000028964 4 150271242 150288546 - 150288315 150288400 150288407 -92 -85 - 8.329 85.30% GTTCGCGC Armcx3 ENSMUSG00000049047 X 131291134 131295994 + 131291186 131291630 131291637 445 452 - 10.444 92.60% TTTCCCGC Tomm40 ENSMUSG00000002984 7 20286662 20300787 - 20300787 20300802 20300809 -22 -15 + 10.444 92.60% TTTCCCGC 20300787 20301533 20301540 -753 -746 + 8.832 87.00% TTTGGCCC Phb2 ENSMUSG00000004264 6 124662340 124666968 + 124662340 124662161 124662168 -179 -172 - 8.329 85.30% TTTCGAGC Ttc19 ENSMUSG00000042298 11 62094975 62141953 + 62094975 62094760 62094767 -215 -208 + 8.329 85.30% TCTCGCGC Poldip2 ENSMUSG00000001100 11 78325695 78336238 + 78325695 78325569 78325576 -126 -119 - 8.329 85.30% GTTCGCGC Dusp18 ENSMUSG00000047205 11 3795243 3801299 + 3795243 3794364 3794371 -879 -872 - 8.832 87.00% TTTGGTGC Ppp1cc ENSMUSG00000004455 5 122608287 122625282 + 122608287 122608059 122608066 -228 -221 - 8.832 87.00% GTTGGCGC 122608287 122608114 122608121 -173 -166 + 10.152 91.60% TTTGGCGG Mrpl40 ENSMUSG00000022706 16 18872111 18876860 - 18876860 18877050 18877057 -197 -190 - 8.329 85.30% ATTCGCGC 18876860 18877284 18877291 -431 -424 + 10.444 92.60% TTTCCCGC Mpv17 ENSMUSG00000090262 5 31443033 31460526 - 31460526 31459790 31459797 730 737 + 8.832 87.00% TTTGGGGC 31460526 31461820 31461827 -1301 -1294 + 9.648 89.80% TTTCGCGG Cisd1 ENSMUSG00000037710 10 70793228 70807702 - 70807702 70807718 70807725 -23 -16 + 8.832 87.00% TTAGGCGC Slc25a22 ENSMUSG00000019082 7 148615638 148623791 - 148623791 148624691 148624698 -907 -900 + 8.832 87.00% TCTGGCGC 148623791 148625646 148625653 -1862 -1855 - 8.832 87.00% TTTGGCCC Mrpl37 ENSMUSG00000028622 4 106728479 106739473 - 106737962 106738439 106738446 -484 -477 + 8.832 87.00% TTTGGCTC Supplemental Figure S6A E2F mediated regulation B GST transferase TCA of DNAresults_E2F1_min2000plus1000 replication result_GST_transferase_min2000_plus1000 resultsTCA_min2000_plus1000 4
Pax5 4 Arnt::Ahr MIZF
ZEB1 4 ZNF354C FOXF2 3 3
NFIL3 3 ARID3A HIF1A::ARNT Zfx RREB1
2 TAL1::TCF3
Myb 2 NFYA Nkx2−5 MZF1_5−13 FOXD1 dat$Fisher.score dat$Fisher.score dat$Fisher.score 2 ELK4 NFKB1 CTCF HLF GABPA MZF1_1−4 NKX3−1 Arnt HOXA5 MYC::MAXRORA_1 Tcfcp2l1 znf143 TAL1::TCF3 NR4A2 ELF5 Nkx3−2 Mycn NFATC2 MEF2ATBP E2F1 Nobox Spz1 Myc 1
NR3C1 CTCF 1 NFE2L2YY1 AP1 Gfi IRF2 Myc NR4A2 Klf4 1 Mycn Myf Tal1::Gata1E2F1 Foxq1 Lhx3 STAT1INSM1Stat3 HNF1B Egr1 Sox17 Nkx3−2 SP1 ELF5 Arnt Esrrb Gfi Klf4 NFE2L2TEAD1NFATC2 ZfxNFYA MEF2A FOXD1 Zfx Myb TBP SOX9 Nkx2−5 Foxa2 FOXI1 E2F1 MAXPdx1 Nobox NKX3−1SoNkx3−2x5RORA_1 FOXA1 ELK1 CREB1 FOXO3 0 SP1 0 Mycn
0 Foxd3 Prrx2ARID3A SRY
−5 0 5 10 15 −5 0 5 10 15 20 25 −5 0 5 10 15
dat$Z.score dat$Z.score dat$Z.score
Supplemental Figure S6B C MRPL37
MRPL37 TRANSCRIPTION
H3K27Ac DNAse Clusters ENCODE HA-E2F1
MCF7 UCD
Supplemental Figure S6C D NSUN4 PHB2
TOMM40 ATP5D
Supplemental Figure S6D Jones et al., Mitochondrial protein translation in Rb/p53-deficient TNBC
Figure S6. Control of mitochondrial protein translation genes by RB and E2F1. (A) A list of 26
MPT genes that are upregulated in Rb/p53-deficient vs. p53-deficient claudin-low like mammary tumors, and contain consensus E2F1 binding motif(s) in their promoters within -2kb to +1kb of the transcription starting site as deduced from oPOSSUM 3.0. Locations, scores and E2F sequences are indicated. (B) oPOSSUM analysis of E2F regulated DNA replication, GST transferase and TCA cycle genes. Note that E2F1 scored high only in the former pathway. (C) UCSC analysis of the MRPL37 gene depicting transcription, H3K27acetylation (Ac), DNA hypersensitive regions, E2F1 consensus binding sites and ChIP-seq data. (D) UCSC analysis of additional MPT genes (NSUN4, PHB2,
TOMM40 and ATP5D) upregulated in Rb/p53 vs. p53 claudin-low like tumors and scored positive by
ENCODE analysis of MCF7 cells. Note transcription from RNA-seq data, E2F1 consensus sites,
DNase hypersensitive regions, ENCODE HA-E2F1 binding and H3K27acetylation mark suggesting active promoters.
7 A
-50 Myc -35 Tubulin
B
stable MDA231 E2F3B normalized to GAPDH
1.8
1.6
1.4
1.2
1
0.8
0.6
0.4
0.2
0
Cell Cycle Mitochondrial protein translation (MPT)
Supplemental Figure S7 Jones et al., Mitochondrial protein translation in Rb/p53-deficient TNBC
Figure S7. Moderate induction of MPT and cell cycle genes in MDA-MB-231 cells stably expressing E2F3b. (A) Immunoblot of MDA-MB-231 cells stably transduced by retroviruses encoding Myc-E2F3a and Myc-E2F3b, or empty vector (EV). Note very low expression of Myc-
E2F3a, and robust expression of the shorter, Myc-E2F3b protein. (B) Q-rt-PCR of indicated MPT and known E2F regulated cell cycle genes normalized for GAPDH in Myc-E2F3b-expressing MDA-MB-
231 cells.
8 Expt. 2 Expt. 1 Tubulin Tubulin Cox II Cox Cox II Cox MDA
GFP/BCL2 -MB -231 E2F1/BCL2 Supplemental Figure S8 Figure Supplemental HCC1937 GFP/BCL2
E2F1/BCL2 Jones et al., Mitochondrial protein translation in Rb/p53-deficient TNBC
Figure S8. E2F1 induction of COX II protein expression in BC cells. Two independent experiments showing the induction of the mitochondrially translated protein COX II in the indicated TNBC lines transduced by adenovirus vectors encoding E2F1 or GFP alone (control) together with Ad.Bcl-2.
9 Δ/Δ Δ/Δ Rb /p53 100 A cell line #1 B bortezomib 75 M μ 1
cells Chemo- at 50
mut therapeutics
;p53 25 Δ / Δ Δ/Δ Δ/Δ Δ/Δ mut Rb /p53 Rb /p53 Rb 0 cell line #2 cell line #3 Inhibition % -25
-50 -50 -25 0 25 50 75 100 % Inhibition at 1μM RbΔ/Δ;p53Δ/Δ cells
C
80 100 80
60 80 60 60 40 40 40 (to control) (to control) 20 (to control) 20 % Cell Viability % Cell Viability % Cell Viability 20 0 0 0 10 0.37 1.11 3.33 0.013 0.041 0.123 0.0043 Doxorubicin (μM) Epirubicin (μM) Idarubicin (μM)
120 120 120 100 100 100 80 80 80
60 60 60 (to control)
(to control) 40 (to control) 40 40 % Cell Viability % Cell Viability % Cell Viability 20 20 20
0 0 0
Sunitinib (μM) Salinomycin (μM) Tigecycline (μM)
Supplemental Figure S9A-C Jones et al., Mitochondrial protein translation in Rb/p53-deficient TNBC
Figure S9. High-throughput screen of FDA-approved drugs identifies potential therapeutic for claudin-low TNBC. (A) Photomicrographs of primary mammary tumor cell lines isolated from
Rb/p53-deficient (Rb∆/∆;p53∆/∆; cell lines #1-2) or Rb deficient/p53 mutant (Rb∆/∆;p53mut/+; cell line #3) tumors. Scale bars, 200µm. (B) Scatter plot of high-throughput screening data showing % inhibition of cell viability following treatment with compounds from the FDA-approved library at 1µM. (C)
Validation of drugs identified in the 10µM FDA-approved drug screen (Fig. 8C). Effects of doxorubicin, epirubicin, idarubicin, sunitinib, salinomycin and tigecycline on Rb/p53-deficient ( #1 (●) and #2 (■)) and Rb-deficient/p53 mutant (#3, ▲) primary mammary tumor cells lines.
10 Bt549 MDA-MB-436 A 100% 100% 90% 90% 80% 80% 70% 70% 60% TIG (1-8µM) 60% TIG (0.5-4µM) 50% Dox (62.5nM) 50% Dox (31.25nM) 40% 40% Dox+TIG Dox+TIG 30% 30% 20% 20% Viability(% of ctrl) Viability(% of Ctrl) 10% 10% 0% 0% 1µM TIG 2µM TIG 4µM TIG 8µM TIG 0.5µM TIG 1µM TIG 2µM TIG 4µM TIG
MDA-MB-231 MDA-MB-231 120% 120% B 100% 100% TIG (1-8µM) TIG (1-8µM) 80% 80% Dox (62.5nM) Dox (125nM) 60% 60% Dox+TIG Dox+TIG 40% TIG -> Dx 40% TIG -> Dx Viability (% of Ctrl) of (% Viability 20% Dx -> TIG Ctrl) of (% Viability 20% Dx -> TIG 0% 0% 1 2 4 8 1 2 4 8 Tigecycline Concentration (µM) Tigecycline Concentration (µM)
Bt549 Bt549 100% 100%
80% 80% TIG (1-8µM) TIG (1-8µM) 60% 60% Dox (125nM) Dox (62.5nM) 40% 40% Dox+TIG Dox+TIG TIG -> Dx 20% Viability (% of Ctrl) of (% Viability Viability (% of Ctrl) of (% Viability 20% TIG -> Dx Dx -> TIG 0% Dx -> TIG 0% 1 2 4 8 1 2 4 8 Supplemental Tigecycline Concentration (µM) Tigecycline Concentration (µM) Figure S10A-B C Viability Tigeclycline 90% Crizotinib 80% 70% Combination 60% 50% 40% 30% 20%
MTT Assay Assay MTT (% of ctrl) 10% 0% 2uM TIG/1uM CRIZ 2uM TIG/1.5uM CRIZ 4uM TIG/2uM CRIZ
D Tigecycline E Sulfasalazine
110% MDA-MB-436 120% 100% 110% 90% Du4475 100% 80% 90% Bt549 70% 80% 60% Hs578t 70% 60% 50% MDA-MB-231 50% 40% 40% 30% HCC38 Viability (% of ctrl) of(% Viability P < 0.0001 ctrl) of(% Viability 30% P > 0.05 20% RB -ve 20% 10% 10% 0% RB +ve 0% 100 1000 10000 100 1000 Concentration (nM) Concentration (µM) RB - vs RB +, p<0.0001 RB - vs RB +, p=0.1888
Supplemental Figure S10C-E Jones et al., Mitochondrial protein translation in Rb/p53-deficient TNBC
Figure S10. Effect of order-of-addition of TIG plus doxorubicin or SSZ on growth of TNBC cells.
(A) MDA-MB-231 and Bt549 cells treated with tigecycline and doxorubicin alone or in combination were analyzed by MTT assays showing minimal cooperation between tigecycline and doxorubicin. (B)
Effect of order-of-addition of tigecycline and/or doxorubicin on indicated TNBC lines. (C)
Cooperative effect of TIG and the MET inhibitor crizotinib in BT549 TNBC cells. (D-E) TIG vs. SSZ treatment of indicated TNBC lines. Note that as opposed to TIG (Fig. 8D shown here for comparison), SSZ has insignificantly differential effects on growth of RB+/p53- vs RB-/p53- TNBC.
11 A Untreated Sulfasalazine Tigecycline TIG + SSZ
MDA-MB-231
(Gated from their respective ESA+ populations) CD24
MDA-MB-436
CD44
B CSC Relative Ratio Untreated SSZ TIG T+S MDA-MB- 231(RB+) 1.00 0.88 2.88 2.82 MDA-MB-436 (RB-) 1.00 1.14 1.05 1.09 HCC38 (RB+) 1.00 n/a 1.82 n/a HCC1937 (RB-) 1.00 n/a 0.69 n/a
Supplemental Figure S11 Jones et al., Mitochondrial protein translation in Rb/p53-deficient TNBC
Figure S11. TIG treatment increases the CSC fraction in RB+ but not RB- TNBC cells. (A)
Representative flow cytometry analysis for the CD24-:CD44+:ESA+ CSC fraction in the RB+/p53-
MDA-MB-231 vs. RB-/p53- MDA-MB-436 TNBC lines after TIG +/- SSZ treatments. Shown are the
CD24 and CD44 profile after gating on the ESA+ cells. Note the increase in the CSC population after
TIG treatment in RB+ MDA-MB-231 cells. (B) Summary of the effects of TIG on the CSC fraction in
+ - - - two RB /p53 vs RB /p53 TNBC lines using IC50 drug concentrations.
12 MDA-MB-436 Xenografts in NSG (36 days treatment) Untreated TIG x 2 TIG + SSZ
H&E
PH3
Supplemental Figure S12 Jones et al., Mitochondrial protein translation in Rb/p53-deficient TNBC
Figure S12. Representative histology (A) and staining for the mitotic marker phospho-H3 (B) of sections from MDA-MB-436 xenografts treated or not with double dose of TIG or TIG + SSZ for
36 days. At day 36, T+S Ctrl n=4, T+S treatment n=4, TIGx2 ctrl n=4, TIGx2 treatment n=5. For each tumor 6 slides were analyzed. Note the reduced PH3 positive cells following TIG treatment. See quantification in Fig. 10F-G.
13 A MDA-MB-231 (RB+) MDA-MB-436 (RB-) ) 3 800 Control Tigecycline 600 P=0.0013 P<0.0001 400
200 Tumor Volume (mmVolume Tumor
10 20 30 10 20 30 Days of Treatment
B Control
TIG
0.8 P=0.214 0.66 P=0.0332
0.44
0.2
Tumor Weight Tumor (g) 0
Control TIG Control TIG
Supplemental Fig. S13 Jones et al., Mitochondrial protein translation in Rb/p53-deficient TNBC
Figure S13. Efficient suppression of RB-/p53- but not RB+/p53- TNBC xenograft growth by tigecycline. (A) NSG mice were injected with 1x106 MDA-MB-436 (RB-/p53-) or MDA-MB-231
(RB+/p53-) cells into their inguinal (#4) mammary gland. Once palpable tumors formed mice were treated with tigecycline (50mg/kg) (n=8) or PBS (Control) (n=6) twice daily. Tumor diameter was measured 5 days/week. p-values were calculated using the Wilcoxon method. (B) Tumors were excised, photographed and weighed. P values by student t-test.
14 MPT genes hATP5D forward TGGTCGTGGTGCATGCAG reverse CAACATGTCCAGCGTCACG hTOMM40 forward GAGTTTGAGGCCAGCACAAG reverse ACCCACGATCCAGTTGCTAT hCISD1 forward TACTGCCGTTGTTGGAGGTC reverse ATCAGAGGGCCCACATTGTC hDHFR forward AGCAGAGAACTCAAGGAACCT reverse GCCACCAACTATCCAGACCA hMRLP37 forward TGGACTGTAACGAGGGTGTC reverse TGTCTCTGGCTTGAAACCAAC hNDUFAB1 forward CAGCCGGCCTTAGTGCTC reverse GGTCCTGGATGCCCTCTAAC hNSUN4 forward CAGGGATGGAAATCAAGTTCGA reverse ATGAAGGGAGTGGCGGTC hPHB2 forward CTATGACATTCGGGCCAGAC reverse CATTGGGTCGAGACAACACTC Known E2F1 regulated genes hPOLalpha1 forward GAAGTTCAAGTCTAAGCCAGTGG reverse AGGCTAGATGTGTTGGTCCC hTK1 forward ATGCCAAAGACACTCGCTAC reverse TCGTCGATGCCTATGACAGC hCCNE1 forward CAAAATCGACAGGACGGCG reverse CTTGCACGTTGAGTTTGGGT hBBC3 Forward GATGGCGGACGACCTCAAC Reverse TGATGAGATTGTACAGGACCCTC others hGAPDH forward TGGAAGGACTCATGACCACAG reverse ATGATGTTCTGGAGAGCCCC
Supplemental Figure S14 Jones et al., Mitochondrial protein translation in Rb/p53-deficient TNBC
Figure S14. Q-rt-PCR primers used in this study for MPT, cell cycle, apoptosis and other genes.
15