DOCSLIB.ORG

Analysis of the TCRBV Repertoire of T Cells in Normal, Human Skin: Evidence for a Restricted Diversity

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Analysis of the TCRBV Repertoire of T Cells in Normal, Human Skin: Evidence for a Restricted Diversity View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Analysis of the TCRBV Repertoire of T Cells in Normal, Human Skin: Evidence for a Restricted Diversity Antje Menssen,1 Sigrid Vollmer, Paul Trommler, Christian Sander, and JoÈrg C. Prinz Department of Dermatology, Ludwig Maximilians-University, Munich, Germany ab T cells constitute an important component in the not detected in blood. Restricted T cell receptor ®rst line of immunologic defense in human skin. In diversity in terms of b-chain V gene preferences or order to determine the local selection forces driving clonal expansion was observed in skin samples of T cell diversity, we studied the T cell receptor reper- donors from all ages (0.5±87 y). Hence, the repertoire toire in normal human skin and compared it with of T cells in normal human skin is apparently sub- that of matched blood samples. Using semiquantit- jected to skin-speci®c selection throughout life. ative reverse transcription±polymerase chain reaction According to our data, this process could involve the expression of T cell receptor b-chain V genes superantigens, which favor polyclonal accumulation was determined. The majority of skin, but not blood of T cells using certain b-chain V genes, as well as T cells, revealed a bias towards usage of T cell recep- antigens, which induce clonal T cell expansion. Our tor b-chain V2 and V6. Whereas sequencing of T results furthermore indicate, that T cell receptor cell receptor b-chain V2 and V6 polymerase chain b-chain V repertoire restrictions do not necessarily reaction products showed a heterogeneous clonal result from disease-associated activation of the skin distribution within these b-chain V gene families, the immune system, but could re¯ect regular mechan- analysis of other selected either over- or under- isms of immunologic homeostasis within the epi- represented b-chain V gene families (BV3, BV12, thelial surface of the body. Key words: clonal BV13S1, BV17) revealed numerous identical T cell expansion/skin/T cell receptor diversity/T lymphocytes. J receptor b-chain V transcript sequences that were Invest Dermatol 115:66±73, 2000 s a physical barrier and as immune organ, the skin (Bos and Kapsenberg, 1993). According to their particular protects the bodyagainst infections and other hazards. organization and activitythe cellular components of the skin- Accordingly, skin resident T cells are confronted with associated lymphoid tissue (SALT) (Streilein, 1978) were recog- manydifferent immunologic challenges. Theyinclude nized as a separate functional entityof the immune systemand Abacterial and fungal infections as well as dermatotropic termed skin immune system (Bos and Kapsenberg, 1993). Within viruses such as human papilloma or herpes simplex viruses. Also, the skin immune system residing antigen-presenting cells, such as systemic viral infections like measles, varicella, rubeola, and epidermal Langerhans cells, dermal dendritic cells and macrophages parvovirus B19 manifest their lesions predominantlyin the skin. are endowed with a particularlyhigh capacityto capture antigens Another vital function of the skin T cells becomes evident in from the environment and circulation (Bos, 1997). Theyare carried immunosuppressed transplant patients. Here, the loss of tumor to draining lymph nodes where primary immune responses against immunosurveillance is often followed byrapid formation of these antigens occur, and where T cells become activated and aggressive cutaneous malignancies (Walder et al, 1971; Blohme acquire the selective abilityto enter the skin and initiate immune and Larko, 1984). The skin, furthermore, contacts and reacts to an responses (Picker et al, 1993; Butcher and Picker, 1996). extensive varietyof environmental allergens and systemically The majorityof the skin resident T cells express the skin- administered drugs. selective homing receptor, cutaneous lymphocyte associated In order to complywith this multitude of immunologic antigen (CLA) (Picker et al, 1990; Bos et al, 1993). Most of them challenges, the skin is equipped with a dense network of antigen- are found in an activated state in close association with antigen- presenting cells and with T cells, that seem to represent a select presenting cells (Bos et al, 1987; Foster et al, 1990; Cavani et al, population which has differentiated to meet the local requirements 1998). Except for the expression of CLA, little is known about the differentiation and speci®cityof the cutaneous T cell population. Elucidation of the mechanisms that promote selection and diversity Manuscript received June 10, 1999; revised March 2, 2000; accepted for of skin-homing T cells is essential to understand organization and publication March 5, 2000. function of the skin immune system under both healthy and Reprint requests to: Dr. JoÈrg Prinz, Department of Dermatology, Universityof Munich, Frauenlobstr. 9±11, 80337 Munich, Germany. pathologic conditions. Email: [email protected] Several mechanisms mayin¯uence T cell diversityin de®ned 1Current address: Department of Oncology, Johns Hopkins University, anatomical compartments. Stimulation byregional antigens may School of Medicine, Baltimore, Maryland, U.S.A. induce clonal T cell expansion (McHeyzer-Williams and Davis, Abbreviations: CDR3, complementaritydetermining region 3; SAG, 1995; Maryanski et al, 1996) whereas superantigens favor superantigen; TCRB, TCR b chain. accumulation of polyclonal T cell populations with preference for 0022-202X/00/$15.00 ´ Copyright # 2000 byThe Societyfor Investigative Dermatology,Inc. 66 VOL. 115, NO. 1 JULY 2000 T CELL RECEPTOR REPERTOIRE OF NORMAL SKIN T CELLS 67 particular b-chain V (BV) genes (Choi et al, 1989; Kappler et al, generated byreverse transcription using oligonucleotide primers speci®c for 1989). As T cell receptor (TCR) usage maydifferentiate between the TCRAB constant region mRNA: 3¢Ca (5¢ TCATAAATTCGG- these speci®c modes of T cell enrichment and regional selection GTAGGATCC 3¢) and 3¢Cb (5¢ TGTCCGAAGAAGGGGCTGGT 3¢) pressure, we analyzed the TCR usage in normal human skin to (Choi et al, 1989). cDNA was analyzed by duplex, semiquantitative TCRBV repertoire PCR using a common TCRBC 3¢ primer in determine potential skewing of the repertoire. conjunction with one of 26 different 5¢ TCRBV gene familyprimers. As T cells expressing ab TCR represent the vast majorityof skin the internal standard a second fragment was coampli®ed in each reaction by resident T cells in postnatal life (Foster et al, 1990). Whereas the the use of two primers corresponding to regions of the TCRAC cDNA hypervariable complementarity-determining region 2 (CDR2) of (3¢Ca:5¢ TCATAAATTCGGGTAGGATCC 3¢;5¢Ca:5¢ GAACCC- both the TCR a- and b-variable chains (TCRAV/BV) contact the TGACCCTGCCGTGTACC 3¢). TCRAC was chosen as it serves as a major histocompatibilitycomplex-molecule, the CDR3, and to a marker for TCR mRNA (Yamamura et al, 1991). TCRBV1±20, BC and lesser degree, CDR1, interact with the major histocompatibility AC oligonucleotide primer sequences corresponded to those described by complex bound peptide (Garboczi et al, 1996; Garcia et al, 1996). Choi et al (1989), and the TCRBV21±24 sequences to those described by Of these, it is the loop with the highest potential diversity, Steinle et al (1995). Comparison of the BV repertoires requires that similarlysized CDRb3, generated bysomatic recombination of the TCR populations of T cells be analyzed so that one sample is not on the variable (V), diversity(D), and joining (J) gene segments and nonlinear part of PCR ampli®cation. Therefore, before ampli®cation for further N-region diversi®cation (Davis and Bjorkman, 1988; TCRBV repertoire characterization, the cDNA of blood and skin samples Gellert, 1997), which buries more than half of the peptide surface were standardized byPCR analysisusing the TCRA constant region and herebycontributes substantiallyto antigen-speci®citybyits primers on serial cDNA dilutions. cDNA concentrations were normalized particular amino acid composition (Hedrick et al, 1988; Garboczi according to the lower end of the visible linear response range. This et al, 1996). approach facilitated that equivalent amounts of TCR cDNA were For determining cutaneous TCR diversity, it would have been employed for TCRBV gene repertoire quantitation in samples from skin desirable to isolate the T cells from skin biopsies as this would allow and blood. They usually corresponded to 2±15 ng (blood lymphocytes) or 0.2±1.2 mg (skin lesions) total cellular RNA. To validate that the reaction separation into subpopulations or analysis at a single cell level. conditions allowed for the analysis of PCR products in the linear range of Whereas about 2%±5% of the skin T cells are contained in the BV ampli®cation cDNA samples were seriallydiluted and subjected to epidermis, the majorityof the cutaneous T cells are located within PCR ampli®cation with a varietyof BV primers. For each primer set, linear the dermis, which consists of tight ®brous connective tissue and responses were obtained with similar slopes. This dose±response relation- stronglyresists direct T cell isolation (Bos et al, 1987; Foster et al, ship between initial amounts of cDNA and quantityof the ®nal products 1990). Although, when planted in culture, dermal T cells may ensured that primer ef®ciencies were actuallyequivalent at the conditions migrate out of biopsytissue fragments (Prinz et al, 1994; Horrocks chosen. After standardization of reaction
Load more

Recommended publications
  • Dynamics of Individual T Cell Repertoires: from Cord Blood to Centenarians Olga V
    Dynamics of Individual T Cell Repertoires: From Cord Blood to Centenarians Olga V. Britanova, Mikhail Shugay, Ekaterina M. Merzlyak, Dmitriy B. Staroverov, Ekaterina V. Putintseva, Maria A. This information is current as Turchaninova, Ilgar Z. Mamedov, Mikhail V. Pogorelyy, of September 27, 2021. Dmitriy A. Bolotin, Mark Izraelson, Alexey N. Davydov, Evgeny S. Egorov, Sofya A. Kasatskaya, Denis V. Rebrikov, Sergey Lukyanov and Dmitriy M. Chudakov J Immunol published online 13 May 2016 Downloaded from http://www.jimmunol.org/content/early/2016/05/12/jimmun ol.1600005 Supplementary http://www.jimmunol.org/content/suppl/2016/05/12/jimmunol.160000 http://www.jimmunol.org/ Material 5.DCSupplemental Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 27, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published May 13, 2016, doi:10.4049/jimmunol.1600005 The Journal of Immunology Dynamics of Individual T Cell Repertoires: From Cord Blood to Centenarians Olga V.
    [Show full text]
  • Characterization of the T Cell Receptor Repertoire of Neonatal T Cells by RT-PCR and Single Strand Conformation Polymorphism Analysis
    Bone Marrow Transplantation (2000) 26, 83–89 2000 Macmillan Publishers Ltd All rights reserved 0268–3369/00 $15.00 www.nature.com/bmt Characterization of the T cell receptor repertoire of neonatal T cells by RT-PCR and single strand conformation polymorphism analysis E Alfani1, AR Migliaccio2, M Sanchez1, AM Passarelli3 and G Migliaccio1 1Laboratory of Cell Biology and 2Clinical Biochemistry, Istituto Superiore di Sanita`, Rome; and 3Ospedale Civile Tivoli, Tivoli, Italy Summary: by other molecular mechanisms which include imprecise joining of V(D)J recombination,6 N-region diversification We have analyzed by reverse transcriptase-polymerase (random addition of nucleotides by terminal deoxy-ribonu- chain reaction (RT-PCR) the individual non-germ line cleotidyl transferase)7,8 and insertions of palindromic configurations of the T cell receptor (TCR) V␤ chains nucleotides9 at specific points of the VD, DJ and VJ junc- expressed by T cells from eight individual cord blood tions. As a result of allele exclusion,10 each T cell clone specimens. cDNA from each cord blood was amplified expresses one and only one specifically rearranged TCR using a common primer coupled with a primer specific V␤ chain. Therefore, the number of TCR V␤ chain for each of 22 variable elements of the V␤ chain family rearrangements expressed by a given population correlates and the amplified fragments were separated under high with its T cell clonality. resolution conditions. With cDNA from adult blood (as Cord blood (CB) has been proven to be a good source a control), all of the TCR chains were amplified as a of stem/progenitor cells for related and unrelated trans- smear consistent with the extensive polyclonality of plants.11,12 Successful engraftment with low graft-versus- adult T cells.
    [Show full text]
  • Distorted TCR Repertoires Define Multisystem Inflammatory Syndrome in Children
    medRxiv preprint doi: https://doi.org/10.1101/2021.04.12.21255098; this version posted April 15, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license . Distorted TCR repertoires define multisystem inflammatory syndrome in children Amna Malik* 1, Eszter N. Tóth* 2, Michelle S. Teng 2, Jacob Hurst 2, Eleanor Watt 3, Lauren Wise 4, Natalie Kent 4, Jack Bartram 5, Louis GranDjean 6, Margarita Dominguez-Villar 7, Stuart ADams† 4 anD Nichola Cooper† 1 1 Centre for Haematology, Department of Immunology anD Inflammation, Imperial College LonDon, LonDon, UniteD KingDom 2 Etcembly Ltd, MagDalen Centre, Robert Robinson Way, OxforD, UniteD KingDom 3 Molecular anD Cellular Immunology Department, UCL Great OrmonD Street Institute of ChilD Health, LonDon, UniteD KingDom 4 SIHMDS-Haematology, Great OrmonD Street Hospital for ChilDren, LonDon, UniteD Kingdom 5 Department of Haematology, Great OrmonD Street Hospital for ChilDren, LonDon, UniteD Kingdom 6 PaeDiatric Infectious Diseases, Great OrmonD Street Hospital for ChilDren, LonDon, UniteD Kingdom 7 Department of Infectious Diseases, Imperial College LonDon, LonDon, UniteD KingDom *These authors have contributed equally to this work †These authors have jointly supervised CorresponDing author: Nichola Cooper Tel: +44 20 3313 4017 E-mail: [email protected] KeyworDs: Sars-Cov2, coronavirus, COVID-19, multisystem inflammatory synDrome, MIS-C, superantigen, TCR, immune repertoire, sequencing NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice.
    [Show full text]
  • Defining Natural Antibodies
    PERSPECTIVE published: 26 July 2017 doi: 10.3389/fimmu.2017.00872 Defining Natural Antibodies Nichol E. Holodick1*, Nely Rodríguez-Zhurbenko2 and Ana María Hernández2* 1 Department of Biomedical Sciences, Center for Immunobiology, Western Michigan University Homer Stryker M.D. School of Medicine, Kalamazoo, MI, United States, 2 Natural Antibodies Group, Tumor Immunology Division, Center of Molecular Immunology, Havana, Cuba The traditional definition of natural antibodies (NAbs) states that these antibodies are present prior to the body encountering cognate antigen, providing a first line of defense against infection thereby, allowing time for a specific antibody response to be mounted. The literature has a seemingly common definition of NAbs; however, as our knowledge of antibodies and B cells is refined, re-evaluation of the common definition of NAbs may be required. Defining NAbs becomes important as the function of NAb production is used to define B cell subsets (1) and as these important molecules are shown to play numerous roles in the immune system (Figure 1). Herein, we aim to briefly summarize our current knowledge of NAbs in the context of initiating a discussion within the field of how such an important and multifaceted group of molecules should be defined. Edited by: Keywords: natural antibody, antibodies, natural antibody repertoire, B-1 cells, B cell subsets, B cells Harry W. Schroeder, University of Alabama at Birmingham, United States NATURAL ANTIBODY (NAb) PRODUCING CELLS Reviewed by: Andre M. Vale, Both murine and human NAbs have been discussed in detail since the late 1960s (2, 3); however, Federal University of Rio cells producing NAbs were not identified until 1983 in the murine system (4, 5).
    [Show full text]
  • U Klein Lecture 3
    Introduction to Immunology Antigen Receptors and Generation of Antibody and T-Cell Receptor Diversity Ulf Klein [email protected] Adaptive Immunity The Adaptive or Acquired Immune Respone: • Is the response of antigen-specific lymphocytes to antigen, including the development of immunological memory • Are mediated by the clonal selection of antigen-specific lymphocytes • Immunoglobulins and T-cell receptors are the highly variable recognition molecules of adaptive immunity Effector Molecules of Adaptive Immunity The Antibodies Made Against a Pathogen Are Highly Specific for That Pathogen The Diversity of Antibodies and T-Cell Receptors Is Generated by Gene Rearrangement Through Somatic DNA Recombination Gene Rearrangement Produces a Diversity of Antigen Receptors in Lymphocytes Clonal Selection of B and T Lymphocytes 1. 3. 2. 4. The Immunoglobulin Molecule: • Made up of 2 identical heavy chains and 2 identical light chains • The antibody molecule has 2 functional domains Features of the Immunoglobulin Molecule • The flexible hinge allows it to bind with both arms to antigens on the surfaces of pathogens • The heavy and light chains are made from a series of similar protein domains The Hypervariable Regions of Antibody V Domains Lie in Discrete Loops at One End of the Domain Structure • The hypervariable loops contribute much of the antigen specificity of the antigen-binding site Hypervariable Regions in Heavy and Light-Chains Antigen-Binding Sites Can Have Diverse Structures • Epitopes of antigens can bind to pockets, grooves, extended
    [Show full text]
  • HLA Class I-Associated Expansion of TRBV11-2 T Cells in Multisystem Inflammatory Syndrome in Children
    HLA class I-associated expansion of TRBV11-2 T cells in Multisystem Inflammatory Syndrome in Children Rebecca A. Porritt, … , Mascha Binder, Moshe Arditi J Clin Invest. 2021. https://doi.org/10.1172/JCI146614. Research In-Press Preview COVID-19 Immunology Graphical abstract Find the latest version: https://jci.me/146614/pdf HLA Class I-associated expansion of TRBV11-2 T cells in Multisystem Inflammatory Syndrome in Children Rebecca A Porritt1,2,*, Lisa Paschold3,*, Magali Noval Rivas1,2,4, Mary Hongying Cheng5, Lael M Yonker6, Harsha Chandnani7, Merrick Lopez7, Donjete Simnica3, Christoph Schultheiß3, Chintda Santiskulvong8, Jennifer Van Eyk9, John K. McCormick10, Alessio Fasano6, Ivet Bahar5,ǂ, Mascha Binder3,ǂ and Moshe Arditi1,2,4,9,ǂ,† 1 Departments of Pediatrics, Division of Infectious Diseases and Immunology, Infectious and Immunologic Diseases Research Center (IIDRC) and Department of Biomedical Sciences, Cedars-Sinai Medical Center, Los Angeles, CA, USA 2 Department of Biomedical Sciences, Cedars-Sinai Medical Center, Los Angeles, CA, USA 3 Department of Internal Medicine IV, Oncology/Hematology, Martin-Luther-University Halle- Wittenberg, 06120 Halle (Saale), Germany 4 Department of Pediatrics, David Geffen School of Medicine at UCLA, Los Angeles, CA, USA. 5 Department of Computational and Systems Biology, School of Medicine, University of Pittsburgh, Pittsburgh, PA 15213, USA 6 Mucosal Immunology and Biology Research Center and Department of Pediatrics, Boston, Massachusetts General Hospital, MA, USA 7 Department of Pediatrics, Loma Linda University Hospital, CA, USA 8 Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA, USA 9 Smidt Heart Institute, Cedars-Sinai Medical Center, Los Angeles, CA, USA 10 Department of Microbiology and Immunology, University of Western Ontario, London, Ontario, Canada.
    [Show full text]
  • Chapter 5 Genetic Models
    Chapter 5 1 2 Organization and Expression of Immunoglobulin Genes 3 4 5 6 Genetic Models Models to Explain Antibody Diversity 1) The Germ Line Theory : “genome posses • How to account for : the large repertoire of antibody genes to – 1) Vast diversity of antibody specificities account for all the antibody diversity” – 2) Presence of Variable regions at the amino end of Heavy and Light chains, and a 2) The Somatic Variation Theory : “genome Constant region at the carboxyl end posses a relatively small number of – 3) Existence of isotypes (different Heavy antibody genes and diversity is generated by chains) with same antigenic specificity mutation and recombination of these genes during somatic development” The two-gene model : Tonegawa (1976): Immunoglobulin gene rearrangement • Developed by Dreyer and Bennet in 1965 • Two separate genes code for the Heavy and Light chains. One codes for the V region and the other for the C region • These genes come together during at the DNA level to form a continuous message • There are thousands of V genes in germ - J Probe - Digested fragments line but only one gene for the C region 1 Three genetic loci encode immunoglobulin molecules: - Two loci encoding the light chains Multigene Families - kappa locus - lambda locus • Light Chains : V, J and C gene segments. - One locus encoding the heavy chain • Lambda : Humans (30V, 4J and 7C genes) These three loci are located on different chromosomes. • Kappa : Humans (40V, 5J and 1C genes) • Heavy Chains : V, D, J and C gene segments • Heavy Chains : Humans (50V, 25D, 6J and 8 C genes) The loci encoding immunoglobulins have a unique structure.
    [Show full text]
  • T-Cell Receptor CDR3 Sequence but Not Recognition Characteristics
    University of Tennessee Health Science Center UTHSC Digital Commons Theses and Dissertations (ETD) College of Graduate Health Sciences 5-2010 T-cell Receptor CDR3 Sequence but Not Recognition Characteristics Distinguish Autoreactive Effector and Foxp3+ Regulatory T- cells Xin Liu University of Tennessee Health Science Center Follow this and additional works at: https://dc.uthsc.edu/dissertations Part of the Medical Cell Biology Commons Recommended Citation Liu, Xin , "T-cell Receptor CDR3 Sequence but Not Recognition Characteristics Distinguish Autoreactive Effector and Foxp3+ Regulatory T-cells" (2010). Theses and Dissertations (ETD). Paper 154. http://dx.doi.org/10.21007/etd.cghs.2010.0188. This Dissertation is brought to you for free and open access by the College of Graduate Health Sciences at UTHSC Digital Commons. It has been accepted for inclusion in Theses and Dissertations (ETD) by an authorized administrator of UTHSC Digital Commons. For more information, please contact [email protected]. T-cell Receptor CDR3 Sequence but Not Recognition Characteristics Distinguish Autoreactive Effector and Foxp3+ Regulatory T-cells Document Type Dissertation Degree Name Doctor of Philosophy (PhD) Program Biomedical Sciences Track Microbial Pathogenesis, Immunology, and Inflammation Research Advisor Terrence L. Geiger, M.D., Ph.D. Committee Hongbo Chi, Ph.D. Elizabeth A. Fitzpatrick, Ph.D. David Nelson, Ph.D. Dario Vignali, Ph.D. DOI 10.21007/etd.cghs.2010.0188 This dissertation is available at UTHSC Digital Commons: https://dc.uthsc.edu/dissertations/154
    [Show full text]
  • Recombination N-Nucleotide Addition in V(D)
    Mutational Analysis of Terminal Deoxynucleotidyltransferase- Mediated N-Nucleotide Addition in V(D)J Recombination This information is current as of September 28, 2021. Jamie A. E. Repasky, Elizabeth Corbett, Cristian Boboila and David G. Schatz J Immunol 2004; 172:5478-5488; ; doi: 10.4049/jimmunol.172.9.5478 http://www.jimmunol.org/content/172/9/5478 Downloaded from References This article cites 45 articles, 17 of which you can access for free at: http://www.jimmunol.org/content/172/9/5478.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 28, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2004 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Mutational Analysis of Terminal Deoxynucleotidyltransferase- Mediated N-Nucleotide Addition in V(D)J Recombination1 Jamie A. E. Repasky, Elizabeth Corbett, Cristian Boboila, and David G. Schatz2 The addition of nontemplated (N) nucleotides to coding ends in V(D)J recombination is the result of the action of a unique DNA polymerase, TdT.
    [Show full text]
  • SARS-Cov-2 Spike Supported by Skewed TCR Repertoire in Patients with Hyperinflammation
    Superantigenic character of an insert unique to SARS-CoV-2 spike supported by skewed TCR repertoire in patients with hyperinflammation Mary Hongying Chenga, She Zhanga, Rebecca A. Porrittb,c, Magali Noval Rivasb,c, Lisa Pascholdd, Edith Willscherd, Mascha Binderd, Moshe Arditib,c,1,2, and Ivet Bahara,1,2 aDepartment of Computational and Systems Biology, School of Medicine, University of Pittsburgh, Pittsburgh, PA 15213; bDepartment of Pediatrics, Division of Pediatric Infectious Diseases and Immunology, Cedars-Sinai Medical Center, Los Angeles, CA 90048; cBiomedical Sciences, Infectious and Immunologic Diseases Research Center, Cedars-Sinai Medical Center, Los Angeles, CA 90048; and dDepartment of Internal Medicine IV, Oncology/ Hematology, Martin Luther University Halle-Wittenberg, 06120 Halle (Saale), Germany Contributed by Ivet Bahar, June 29, 2020 (sent for review May 26, 2020; reviewed by Talal A. Chatila, Ruth Nussinov, and Celia A. Schiffer) Multisystem Inflammatory Syndrome in Children (MIS-C) associ- shock syndrome (TSS) (8, 9) (Table 1), rather than Kawasaki ated with COVID-19 is a newly recognized condition in children with disease (KD), due to marked demographic, clinical, and labora- recent severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) tory differences (6). Indeed, a recent uncontrolled retrospective infection. These children and adult patients with severe hyperinflam- case study concluded that MIS-C is distinct from KD and KD mation present with a constellation of symptoms that strongly resem- shock syndrome (10). The similarities to TSS and the association ble toxic shock syndrome, an escalation of the cytotoxic adaptive of MIS-C with COVID-19 led us to hypothesize that SARS-CoV-2 immune response triggered upon the binding of pathogenic super- may possess superantigenic fragments that induce an inflamma- antigens to T cell receptors (TCRs) and/or major histocompatibility tory cascade and may also contribute to the hyperinflammation complex class II (MHCII) molecules.
    [Show full text]
  • Identification of a Unique TCR Repertoire, Consistent with a Superantigen Selection
    bioRxiv preprint doi: https://doi.org/10.1101/2020.11.09.372169; this version posted November 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Identification of a unique TCR repertoire, consistent with a superantigen selection process in Children with Multi-system Inflammatory Syndrome Rebecca A Porritt1,2,*, Lisa Paschold3,*, Magali Noval Rivas1,2,4, Mary Hongying Cheng5, Lael M Yonker6, Harsha Chandnani7, Merrick Lopez7, Donjete Simnica3, Christoph Schultheiß3, Chintda Santiskulvong8, Jennifer Van Eyk9, Alessio Fasano6, Ivet Bahar5,ǂ, Mascha Binder3,ǂ and Moshe Arditi1,2,4,9,ǂ,† 1 Departments of Pediatrics, Division of Infectious Diseases and Immunology, Infectious and Immunologic Diseases Research Center (IIDRC) and Department of Biomedical Sciences, Cedars-Sinai Medical Center, Los Angeles, CA, USA 2 Department of Biomedical Sciences, Cedars-Sinai Medical Center, Los Angeles, CA, USA 3 Department of Internal Medicine IV, Oncology/Hematology, Martin-Luther-University Halle- Wittenberg, 06120 Halle (Saale), Germany 4 Department of Pediatrics, David Geffen School of Medicine at UCLA, Los Angeles, CA, USA. 5 Department of Computational and Systems Biology, School of Medicine, University of Pittsburgh, Pittsburgh, PA 15213, USA 6 Mucosal Immunology and Biology Research Center and Department of Pediatrics, Boston, Massachusetts General Hospital, MA, USA 7 Department of Pediatrics, Loma Linda University Hospital, CA, USA 8 Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA, USA 9 Smidt Heart Institute, Cedars-Sinai Medical Center, Los Angeles, CA, USA * these authors contributed equally ǂ these authors contributed equally † corresponding author Conflicts of interest The authors have declared that no conflict of interest exists.
    [Show full text]
  • The Role of Short Homology Repeats and Tdt in Generation of the Invariant Y6 Antigen Receptor Repertoire in the Fetal Thymus
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Immunity, Vol. 3, 439-447, October, 1995, Copyright 0 1995 by Cell Press The Role of Short Homology Repeats and TdT in Generation of the Invariant y6 Antigen Receptor Repertoire in the Fetal Thymus Yi Zhang,’ Dragana Cado,’ David M. Asarnow,t In the epithelia of the skin and reproductive tract of mice Toshihisa Komori,* Frederick W. Alt,S there are unique populations of y6 T cells with very re- David H. Raulet,’ and James P. Allison’ stricted TCR repertoire (Asarnow et al., 1988, 1989; Ito- ‘Department of Molecular and Cellular Biology hara et al., 1990; Nandi and Allison, 1991). In the skin, and Cancer Research Laboratory essentially all the T cells express y chains encoded by University of California, Berkeley Vy3-Jyl segments, while those of the reproductive tract Berkeley, California 94720 are encoded by Vy4-Jyl segments. In both cases, the tBerlex, Incorporated junctions are characterized by minimal diversity, and the 15049 San Pablo Avenue absence of nongermline-encoded nucleotides. In these Richmond, California 94804 tissues there is a single and identical predominant 6 chain *Howard Hughes Medical Institute encoded by the VSl-DSP-JS2 segments. In all mouse Children’s Hospital strains examined to date, greater than 90% of the produc- Department of Genetics tively rearranged y and 6 genes in these tissues have the Harvard University Medical School same canonical junctions. These observations raise im- Boston, Massachusetts 02115 portant questions concerning the function and origin of these essentially monomorphic TCR.
    [Show full text]