Silencing of the Hypoxia-Inducible Cell Death Protein BNIP3 in Pancreatic Cancer

[CANCER RESEARCH 64, 5338–5346, August 1, 2004] Silencing of the Hypoxia-Inducible Cell Death Protein BNIP3 in Pancreatic Cancer

Jiro Okami,1 Diane M. Simeone,2 and Craig D. Logsdon1 Departments of 1Molecular and Integrative Physiology and 2Surgery, University of Michigan, Ann Arbor, Michigan

ABSTRACT pancreatic cancer cells exist within a hypoxic environment has come

from measurements of O2 tension that are significantly decreased in Hypoxic conditions exist within pancreatic adenocarcinoma, yet pan- pancreatic cancer when compared with adjacent normal pancreas (5). creatic cancer cells survive and replicate within this environment. To The ability of cancer cells to adapt to hypoxic environment is increas- understand the mechanisms involved in pancreatic cancer adaptation to hypoxia, we analyzed expression of a regulator of hypoxia-induced cell ingly recognized as an important mechanism promoting tumor growth death, Bcl-2/adenovirus E1B 19 kDa interacting protein 3 (BNIP3). We (6). In general, it is thought that tumor cells become resistant to found that BNIP3 was down-regulated in nine of nine pancreatic adeno- hypoxia during the progression of the disease by alterations in a carcinomas compared with normal pancreas despite the up-regulation of variety of cellular mechanisms (7, 8). other hypoxia-inducible genes, including glucose transporter-1 and insulin- In the current study, we analyzed the levels and role of a hypoxia- like growth factor-binding protein 3. Also, BNIP3 expression was undetect- inducible pro-apoptotic molecule, Bcl-2/adenovirus E1B 19 kDa able even after hypoxia treatment in six of seven pancreatic cancer cell interacting protein 3 (BNIP3), in pancreatic cancer. BNIP3 was orig- lines. The BNIP3 promoter, which was remarkably activated by hypoxia, inally isolated through its interaction with anti-apoptotic proteins such is located within a CpG island. The methylation status of CpG dinucle- as adenovirus E1B 19K and cellular Bcl-2 (9). BNIP3 belongs to the otides within the BNIP3 promoter was analyzed after bisulfite treatment Bcl-2 family and the Bcl-2 homology domain-3-only subfamily (10). by sequencing and methylation-specific PCR. Hypermethylation of the BNIP3 promoter was observed in all BNIP3-negative pancreatic cancer BNIP3 expression is increased under hypoxic conditions by the ac- cell lines and eight of 10 pancreatic adenocarcinoma samples. Treatment tions of the transcription factor, hypoxia-inducible factor 1 (HIF-1; of BNIP3-negative pancreatic cancer cell lines with a DNA methylation Refs. 11–13). Forced expression of BNIP3 has been shown to lead to .(inhibitor, 5-aza-2؅ deoxycytidine, restored hypoxia-induced BNIP3 ex- cell death in cardiac myocytes and other cultured cell lines (14, 15 pression. BNIP3 expression was also restored by introduction of a con- Thus, BNIP3 is considered to be a key regulator of hypoxia-induced struct consisting of a full-length BNIP3 cDNA regulated by a cloned cell death. BNIP3 promoter. Restoration of BNIP3 expression rendered the pancre- We observed that BNIP3 expression was decreased in pancreatic atic cancer cells notably more sensitive to hypoxia-induced cell death. In cancer compared with normal pancreas. This was not due to a general conclusion, down-regulation of BNIP3 by CpG methylation likely contrib- decrease in hypoxia gene induction in pancreatic cancer, because we utes to resistance to hypoxia-induced cell death in pancreatic cancer. observed increased levels of hypoxia-responsive genes including glucose transporter-1 (GLUT1) and insulin-like growth factor-binding INTRODUCTION protein 3 (IGFBP3). BNIP3 expression was also absent and could not Pancreatic adenocarcinoma is the fourth leading cause of cancer be induced by hypoxic treatment in several pancreatic cancer cell death in the United States, and the occurrence of this disease ranks lines. As an explanation for the low levels of BNIP3 expression, we 10th among all cancers (1). Currently, the only curative treatment for explored the possibility that the gene might be hypermethylated. We pancreatic cancer is surgical resection, but only ϳ10–20% of patients found that the BNIP3 promoter was located within a CpG island in are candidates for surgery at the time of diagnosis, and of this group, which numerous CpG dinucleotides were methylated in almost all only ϳ20% of patients who undergo a curative operation are alive pancreatic cancer cell lines and tumor samples but not in normal after 5 years (2). Pancreatic cancer tends to rapidly invade surround- pancreas. Moreover, pharmacological inhibition of methylation re- ing structures and undergo early metastatic spreading. In addition, stored expression and hypoxia induction of BNIP3 in pancreatic pancreatic cancer is highly resistant to chemotherapy and radiation cancer cell lines. We were also able to restore hypoxia-induced BNIP3 therapy, even though some new anticancer drugs and combinations of expression by transfection with a construct containing the BNIP3 drugs with radiotherapy have been recently introduced for treatment cDNA regulated by 754 bp of the BNIP3 promoter. Restoration of of this disease (3). Therefore, elucidation of the molecular basis of the hypoxia-inducible BNIP3 expression increased the sensitivity of pan- aggressive nature of pancreatic cancer and identification of novel creatic cancer cells to hypoxia-induced cell death. Taken together, targets for therapeutic intervention in this disease are urgently needed. these data suggest that down-regulation of the hypoxia-inducible gene Pancreatic cancer is pathologically characterized as nests of neo- BNIP3 by methylation is an important adaptive response, allowing plastic cells within an abundant fibrotic stroma. These tumors are pancreatic cancer cell growth in a hypoxic environment. observed as a lower density area on contrast-enhanced computed tomography scan, which suggests that they have a reduced blood MATERIALS AND METHODS oxygen supply compared with normal tissue (4). Direct evidence that Pancreatic Tissues and Cell Lines. Pancreatic tissue specimens analyzed Received 1/12/04; revised 4/5/04; accepted 5/11/04. in this study were collected from the University of Michigan Health System Grant support: The Lustgarten Foundation, Michigan Economic Development Grant with approval of the University of Michigan Institutional Review Board. After MEDC03-622, Sumitomo Life Social Welfare Service’s Foundation (J. Okami), Shinya pathological examination, tissue samples were embedded in OCT-freezing Foundation for Medical Research (J. Okami), and Japan-North America Medical Ex- medium (Miles Scientific, Naperville, IL) and cryotome sectioned (5 ␮m), and change Foundation (J. Okami). The costs of publication of this article were defrayed in part by the payment of page areas of relatively pure tumor or normal pancreas were microdissected and charges. This article must therefore be hereby marked advertisement in accordance with kept in TRIzol (Invitrogen, Carlsbad, CA) until RNA and DNA isolation. 18 U.S.C. Section 1734 solely to indicate this fact. Pancreatic cancer cell lines BxPC-3, Mia PaCa-2, HPAC, MPanc-96, Requests for reprints: Craig Logsdon, Department of Molecular and Integrative AsPC-1, PSN-1, and PANC-1 were obtained from the American Type Culture Physiology, Box 0622, 7710 Medical Sciences Building II, University of Michigan, Ann Arbor, MI 48109-0622. Phone: (734) 763-2539; Fax: (734) 936-8813; E-mail: Collection (Manassas, VA) or Japanese Cancer Research Resources Bank [email protected]. (Tokyo, Japan). These cells were cultured in high-glucose DMEM (Invitrogen) 5338

Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2004 American Association for Cancer Research. DOWN-REGULATION OF BNIP3 IN PANCREATIC CANCER with 10% FCS, 100 units/ml penicillin, and 100 ␮g/ml streptomycin in a NM004052) against a genomic DNA sequence of chromosome 10q26.3 (Gen- humidified incubator with an atmosphere of 5% CO2 and 95% air. Bank accession no. AL162274), a transcription start site of BNIP3 gene was Reverse Transcription-PCR. Total RNA extraction was performed from determined. A region from 385–21-bp upstream of the transcription start site, microdissected tissue samples or cultured cells using RNA easy kit (Qiagen, which contains a CpG-rich fragment, was amplified from one-twentieth of the Valencia, CA) according to the manufacturer’s protocol, and purified RNA modified DNA by PCR using HotStartTaq DNA polymerase (Qiagen). PCR was quantitated and assessed for purity by UV spectrophotometry. cDNA was primers used in this reaction were designed to amplify the coding strand generated from 1 ␮g of RNA with avian myeloblastosis virus reverse tran- of bisulfite-treated DNA as follows: GTGGTAGTTAGTGTTTAGAGAG scriptase (Promega, Madison, WI). The amplification of each specific RNA (sense) and ACTCACAAAAC AAAACRAAAC (antisense; where R ϭ Gor was performed in a 25-␮l reaction mixture containing 2 ␮l of cDNA template, A). The PCR conditions were as follows: one cycle of denaturing at 95°C for 1ϫ PCR master mix, and 0.5 pmol of primers. The PCR primers used for 15 min, followed by 35 cycles of 94°C for 30 s, 60°C for 50 s, and 72°C for detection of BNIP3 were: forward, 5Ј-GCCCACCTCGCTCGCAGACAC-3Ј; 1 min before a final extension at 72°C for 10 min. The PCR product was cloned and reverse, 5Ј-CAATCCGATGGCCAGCAAATGAGA-3Ј. The amplified into pGEM-T Easy Vector (Promega), and 10 clones for each sample were product was 585 bp, and the PCR conditions were as follows: one cycle of sequenced using T7 or SP6 primer at the Sequencing Core Facility of the denaturing at 95°C for 10 min, followed by 24 cycles of 94°C for 30 s, 60°C University of Michigan. Cytosines in CpG dinucleotides that remained uncon- for 50 s, and 72°C for 1 min before a final extension at 72°C for 10 min. The verted after bisulfite treatment were considered to be methylated. PCR products were loaded onto 2% agarose gels and visualized with ethidium Methylation-Specific PCR. Methylation-specific PCR was performed ac- bromide under UV light. As a control for cDNA synthesis, reverse transcrip- cording to the previously described principles (18). To detect the sequence tion-PCR was also performed using primers specific for ␤-actin gene (16). differences between methylated and unmethylated DNA as a result of bisulfite Quantitative (Q)-Reverse Transcription-PCR. Q-reverse transcription- treatment, each primer is designed to contain four or five CpG dinucleotides. PCR for BNIP3, GLUT1, IGFBP3, and ␤-actin was carried out using an Primer sequences for unmethylated reaction were 5Ј-TAGGATTTGTTTTGT- iCycler instrument (Bio-Rad, Hercules, CA) by adding 1ϫ SYBR Green I to GTATG-3Ј (sense) and 5Ј-ACCACATCACCCATTAACCACA-3Ј (anti- the same reaction mixture as standard reverse transcription-PCR described sense), and for methylated reaction were 5Ј-TAGGATTCGTTTCGCG- above. The PCR primers used for detection of IGFBP3 were: forward, 5Ј- TACG-3Ј (sense) and 5Ј-ACCGCGTCGCCCATTAACCGCG-3Ј (antisense; CGAAGCGGCCGACCACTG-3Ј; and reverse, 5Ј-GGATCCACGCCCTT- the bold nucleotides represent the putative methylation sites), and amplified GTTTCA-3Ј; and the primers for GLUT1 were as described previously (17). products were 94 bp for both reactions. The PCR conditions were as follows: The PCR conditions for BNIP3, GLUT1, IGFBP3, and ␤-actin were as one cycle of denaturing at 95°C for 15 min, followed by 35 cycles of 94°C for follows: one cycle of denaturing at 95°C for 10 min, followed by 40 cycles of 30 s, 64°C (for methylated reaction) or 58°C (for unmethylated reaction) for 94°C for 30 s, 60°C for 50 s, and 72°C for 1 min. Each reaction included a 50 s, and 72°C for 1 min before a final extension at 72°C for 10 min. .negative control and serial 10-fold dilutions from 10Ϫ1 to 10Ϫ5 of cDNA of 5-Aza-2؅ Deoxycytidine (5aza-dC) Treatment and Hypoxic Exposure positive control, and the experiment was done in triplicate. These serial-diluted The pancreatic cancer cell lines Mia Paca-2, HPAC, BxPC-3, and MPanc-96 positive controls were used for standards to confirm the linearity between the were seeded at a density of 1ϳ5 ϫ 105 cells/100-mm dish in culture medium amount of target cDNA in the sample and the intensity of fluorescent signal. and allowed to attach over a 24-h period. 5aza-dC (Sigma) was then added to For comparisons between samples, the mRNA expression of the target genes a final concentration of 1 ␮M, and the cells were allowed to grow for 6 days. was normalized to ␤-actin mRNA expression. Product specificity was con- The medium with or without 5aza-dC was changed every other day. At the end trolled by melting curve analysis and migration on a 2% agarose gel. of the treatment, the medium was removed; and the RNA, DNA, and protein Cell Protein Preparation, SDS-PAGE, and Western Blotting. Cells were extracted for reverse transcription-PCR, methylation analysis, and protein grown in 100-mm dishes were washed twice with cold PBS, harvested in 0.5 analysis. Hypoxic conditions were achieved with an anaerobic chamber (Sug- ml of lysis buffer [25 mM Tris-buffered saline (pH 7.4), 50 mM NaCl, 2% iyamagen, Tokyo, Japan) and AneroPack for Cell Gas generating system NP40, 0.5% sodium deoxycholate, 0.2% SDS, 1 mM phenylmethylsulfonyl (Mitsubishi Gas Chemical, Tokyo, Japan), which catalytically reduced oxygen fluoride, 10 ␮g/ml aprotinin, 10 ␮g/ml leupeptin, and 250 ␮g/ml sodium levels to less than 1% within 30 min (19). vanadate for BNIP3 detection or 7 M urea, 10% glycerol, 10 mM Tris-buffered Subcloning of BNIP3 Gene and Plasmids. Full-length cDNA for BNIP3 saline (pH 6.8), 1% SDS, 5 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl was amplified by PCR and subcloned into pcDNA 3.1 (ϩ) vector (Invitrogen). fluoride,10 ␮g/ml aprotinin, 10 ␮g/ml leupeptin, and 250 ␮g/ml sodium The primer sets were as follows: 5Ј-GGATCCCGCCATGTCGCAGAACG-3Ј vanadate for HIF-1␣ detection]. After removal of cell debris by centrifugation, and 5Ј-AGGAACGCAGCATTTACAGAACAA-3Ј. Plasmids were recovered, the protein concentrations in cell lysates were determined by the Bradford purified, and sequenced. assay. Lysates containing 30 ␮g of protein were added to loading buffer with Colony Formation Assay. Cells were plated subconfluently in culture 5% ␤-mercaptoethanol and heated for 10 min at 100°C. Samples were sepa- flasks for 24 h before transient transfection with either pcDNA3.1(ϩ)-BNIP3 rated by 10% SDS-PAGE and transferred to nitrocellulose membranes by or pcDNA3.1(ϩ)-empty vector using Lipofectin (Invitrogen) according to the semidry blotting. Membranes were incubated in blocking buffer (1ϫ Tris- manufacturer’s protocol. Transfected cells were trypsinized and plated on buffered saline, 0.1% Tween-20, and 5% nonfat dry milk) for1hatroom 10-cm dishes 24 h after transfection and cultured in the presence of G418 temperature and probed with anti-BNIP3 antibody (1000ϫ diluted; Sigma, St. (1000 ␮g/ml). After 10–14 days, colonies were fixed with methanol and Louis, MO), anti-HIF-1␣ antibody (250ϫ diluted; BD, Franklin Lakes, NJ), or stained with 0.1% crystal violet. anti-actin antibody (1000ϫ diluted; Sigma) overnight at 4°C, followed by Cell Death Detection Assay. Full-length BNIP3 cDNA was inserted into hybridization with a horseradish peroxidase-conjugated secondary antibody the pAdTrack-CMV vector, which contained dual independent cytomegalo- mouse IgG (1:3300) (Amersham Biosciences, Piscataway, NJ). Signals were virus promoters, one expressing BNIP3 and the other green fluorescence detected by chemiluminescence using the ECL detection system (Amersham protein (GFP). Ad-Track-BNIP3 vector or Ad-Track-empty vector was tran- Biosciences). siently transfected into pancreatic cancer cells. At the indicated times after Genomic DNA Isolation and Bisulfite Treatment of DNA. Genomic transfection, cells were washed with PBS twice, scraped, and lysed with PBS DNAs were isolated from microdissected tissue samples and cultured cells containing 0.2% Triton X-100. GFP intensity of cell lysates was measured by using Wizard Genomic DNA purification kit (Promega) based on the manu- a spectrophotometer (Perkin-Elmer, Wellesley, MA) with excitation at 488 nm facturer’s protocol. To differentiate methylated CpGs from unmethylated and emission at 510 nm. That the intensity of GFP of cell lysates linearly CpGs, 1 ␮g of genomic DNA was treated with sodium bisulfite at 50°C for correlated with the number of GFP-positive cells was confirmed by direct cell 20 h using a CpGenome DNA Modification kit (Serologicals Corp., Norcross, counting (data not shown). GA) according to the instructions of the manufacturer and finally resuspended Construction of Human BNIP3 Reporter Plasmid. Human BNIP3 5Ј- in 50 ␮lof10mM Tris (pH 8)-1 mM EDTA buffer. After this treatment, flanking sequence (GenBank accession no. AL162274) was amplified by PCR unmethylated cytosine is converted to uracil, whereas methylated cytosine using genomic DNA isolated from human normal pancreas as the template. remains cytosine. The PCR product was digested with BglII and NcoI and cloned into Amplification, Cloning, and Sequencing of Bisulfite-Treated DNA. By the pGL3-Basic vector (Promega). The primer sets were as follows: 5Ј- comparing the cDNA sequence of the BNIP3 gene (GenBank accession no. AGATCTCCCGGCGGGGCGGGCAAAGA-3Ј and 5Ј-CCATGGCGCCA- 5339

GAGG-GCAACTGCG-3Ј. Plasmids were recovered, purified, and se- tissues, 8 samples of normal pancreas, and 9 samples of pancreatic quenced. adenocarcinoma. In standard reverse transcription-PCR, obvious Luciferase Assays. Cells were seeded in a 6-well plate and grown to 90% bands appeared in all eight normal samples, whereas faint bands were confluence. For each well, human BNIP3 reporter construct was cotransfected ␤ visible in two of nine tumor samples. Q-reverse transcription-PCR with -gal reporter vector into HEK293 or Mia Paca-2 cells. Cells were Ͻ harvested, and reporter activity was measured using the Dual Luciferase Assay revealed a 56-fold (P 0.01) difference of BNIP3 expression be- (Promega) according to the manufacturer’s instructions. Transfection effi- tween normal and tumor tissues. BNIP3 mRNA expression was also ciency was normalized on the basis of ␤-galactosidase activity. undetectable by reverse transcription-PCR in five of six pancreatic Statistical Analysis. Data are presented as mean Ϯ SE. Statistically sig- cancer cell lines (Mia PaCa-2, HPAC, BxPC-3, MPanc-96, PANC-1, nificant differences were determined by unpaired t test and were defined as and AsPC-1) but was obvious in the PSN-1 cell line (Fig. 1C). Thus, Ͻ P 0.05. all pancreatic tumors and all but one cancer cell line displayed no or extremely low expression of BNIP3. RESULTS To explore the effects of hypoxia on BNIP3 expression in pancre- BNIP3 Expression in Pancreatic Tissues and Cells. The expres- atic cancer, the cell lines were cultured under conditions of hypoxia. Ͻ sion of BNIP3 mRNA was examined by reverse transcription-PCR Hypoxia treatment (O2 1%) was unable to induce BNIP3 mRNA in (Fig. 1A) and Q-reverse transcription-PCR (Fig. 1B) in 17 pancreatic the same six pancreatic cancer cell lines that showed no expression

Fig. 1. BNIP3 expression in pancreatic cancer tissue, cell lines, and normal pancreas. A, BNIP3 mRNA expression in normal pancreas and pancreatic cancer was examined by reverse transcription-PCR. Representative examples are shown. The fragment of human BNIP3 cDNA amplified is 585 bp. The ␤-actin gene was used as a control for RNA quality and loading. B, expression of BNIP3 mRNA was quantitated by Q-reverse transcription-PCR in the same samples as shown in A. The relative expression of BNIP3 and ␤-actin mRNA were determined and the BNIP3:␤-actin ratio was calculated for each sample. The mean value of nine tumor tissues was given a value of 1, and the mean value of the eight normal samples Ͻ ϭ ء Ϯ was then expressed relative to the tumor values. Values are mean SE. , P 0.01. C, BNIP3 mRNA levels under normoxic (CO2 5% and room air) conditions (N) and under Ͻ hypoxic (O2 1% for 24 h) conditions (H) in seven pancreatic cancer cell lines were examined by reverse transcription-PCR. D, BNIP3 protein levels under normoxic and hypoxic cell culture conditions in four pancreatic cancer cell lines were examined by Western blotting using a monoclonal anti-BNIP3 antibody. Actin is shown as a control for protein loading. 5340

Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2004 American Association for Cancer Research. DOWN-REGULATION OF BNIP3 IN PANCREATIC CANCER under normoxic conditions whether the cells were treated for 24 h (Fig. 1C) or even 48 h (data not shown). In contrast, the PSN-1 cell line, which expressed BNIP3 under normoxic conditions, displayed levels of BNIP3 mRNA that were 47-fold higher after hypoxia. BNIP3 protein expression was consistent with the mRNA expression data such that BNIP3 protein was not detected in Mia Paca-2, BxPC-3, or HPAC cells under either normoxic or hypoxic condition, whereas the PSN-1 cell showed BNIP3 protein expression after exposure to hypoxia (Fig. 1D). Induction of Hypoxia-Inducible Genes in Pancreatic Cancer. To determine whether the lack of BNIP3 induction in the majority of pancreatic cancer cell lines was due to a general inability to respond to hypoxia, we evaluated the effect of hypoxia on the transcription

Fig. 3. BNIP3 promoter activity in HEK 293 cells and Mia PaCa-2 cells. After transfection of the BNIP3 reporter plasmid, cells were incubated in normoxic (Ⅺ)or hypoxic (f) conditions for 24 h. The BNIP3 promoter activity is determined by luciferase assay. Transfection efficiency was normalized on the basis of ␤-galactosidase activity. The promoter activity in normoxic conditions was given a value of 1, and the data represent a mean of three experiments.

factor HIF-1␣ protein expression by Western blotting. HIF-1␣ is a major regulator of hypoxia-induced gene expression, and its targets include BNIP3. HIF-1␣ protein levels were significantly increased in pancreatic cancer cell lines after incubation under hypoxic conditions for 24 h (Fig. 2A). In addition, mRNA levels of two other genes that are known to be induced by hypoxia (20), GLUT1 and IGFBP3, were examined by Q-reverse transcription-PCR in 3 pancreatic cancer cell lines, 17 pancreatic tissues, 8 normal pancreas, and 9 pancreatic cancer. mRNA expressions of GLUT1 and IGFBP3 were obviously induced after hypoxic conditions in all three pancreatic cancer cell lines (Fig. 2B). They were also expressed at significantly higher levels in pancreatic cancer compared with normal pancreas: 8.6-fold (P Ͻ 0.05) and 7.9-fold (P Ͻ 0.01), respectively (Fig. 2C). CpG Methylation in the Promoter Region of the BNIP3 Gene in Pancreatic Cancer Cells and Tissues. To identify the promoter region of the BNIP3 gene, we cloned a 754-bp fragment of the BNIP3-flanking sequence into a reporter plasmid and examined hypoxia inducibility of this region using luciferase assay. We transiently transfected the BNIP3 reporter plasmid into HEK293 cells and Mia Paca-2 cells and exposed cells to hypoxic conditions or regular culture conditions for 24 h. The luciferase activity was markedly increased in hypoxic cells compared with the cells incubated in a normal culture condition in HEK293 cells and Mia Paca-2 cells: 12.3- and 8.8-fold in average, respectively (Fig. 3). This result demonstrated that this 754-bp BNIP3 5Ј-flanking sequence mediates transcriptional responses of BNIP3 to hypoxia. Reviewing the sequence of the gene, we found that the BNIP3 promoter is located within a 1700-bp CpG island, which spans from Fig. 2. Hypoxic induction of HIF-1␣ and hypoxia-inducible genes in pancreatic cancer. Ϫ ϩ A, HIF-1␣ protein expression under normoxic conditions (N) and under hypoxic condi- 1162 to 538 bp of the transcription start site and contains the first tions (H) in four pancreatic cancer cell lines were examined by Western blotting using a exon of BNIP3 gene. This promoter also contains a consensus monoclonal anti-HIF-1␣ antibody. Actin is shown as a control for protein loading. B, hypoxia-responsive element (HRE) motif (-CACGTG-) at Ϫ125 to expression of GLUT1 mRNA and IGFBP3 mRNA was quantitated by Q-reverse tran- ϭ Ⅺ Ϫ120 bp as previously reported (Fig. 4; Ref. 21). The BNIP3 pro- scription-PCR under normoxic (CO2 5% and room air; ) conditions and under Ͻ f hypoxic (O2 1% for 24 h; ) conditions in three different pancreatic cancer cell lines. moter has a G and C content of 78.5% with 116 CpG dinucleotides ␤ The relative expression levels of the target genes and -actin mRNA were determined, and existing in this region. Therefore, we hypothesized that the loss of the target gene:␤-actin mRNA ratio was calculated for each sample. The gene expression under normoxia was given a value of 1, and the data represent a mean of three different expression of BNIP3 in pancreatic cancer might be due to hyperm- PCR reactions. C, expression of GLUT1 mRNA and IGFBP3 mRNA were quantitated by ethylation of CpG dinucletotides in the promoter region. Q-reverse transcription-PCR in pancreatic cancer and normal pancreas. The mean value of eight normal tissues was given a value of 1, and all other values were then expressed To analyze the methylation status of the BNIP3 promoter, we P Ͻ 0.01). performed sequence analysis and methylation-specific PCR after ,ء ;P Ͻ 0.05 ,ءء) relative to this mean. Values shown are mean Ϯ SE 5341

Fig. 4. Schematic representation of BNIP3 gene. HRE (CACGTG), exon 1, and transla- tion start site (ATG) are indicated on the genomic BNIP3 sequence (GenBank accession no. AL162274). The gray box represents a CpG island spanning from Ϫ1162 to ϩ538 bp of the transcription start site. The line and double arrows below the CpG island represent regions analyzed by the promoter assay, bisulfite sequencing, and methylation-specific PCR, respectively.

bisulfite treatment of genomic DNA isolated from pancreatic cancer tissues and cell lines, we carried out methylation-specific PCR. cell lines and pancreatic tissues. Among the CpG sites in the promoter Among 10 cancer cell lines, BNIP3 gene methylation was detected in region, we focused on those located around the HRE because the HRE nine cell lines: Mia PaCa-2; BxPC-3; MPanc-96; SU86.86; AsPC-1; plays an important role for hypoxia induction of BNIP3 expression CAPAN; HPAF-II; HPAC; and PANC-1 (Fig. 5B). Importantly, the (Ref. 21; Fig. 4). First, we analyzed the methylation status of three methylation status of BNIP3 gene in these cell lines correlated with its representative samples by sequencing: normal pancreatic tissue; the loss of expression and its lack of induction by hypoxia. In all normal BNIP3-positive PSN-1 cell line; and the BNIP3-negative Mia PaCa-2 pancreatic tissues that we examined, the signal for unmethylated cell line (Fig. 5A). We found that most of 58 CpG dinucleotides in this BNIP3 was detected, and no signal for methylation was observed region were methylated in Mia PaCa-2 cell, whereas few of them were (results from representative samples are shown in Fig. 5C). In con- methylated in normal pancreas and the PSN-1 cell, respectively. To trast, the signal for methylated BNIP3 appeared in eight of 10 pan- investigate the methylation status in a larger series of pancreatic creatic cancer tissues. The unmethylated signals detected in cancer

Fig. 5. Methylation status of the BNIP3 promoter in pancreatic tissue and cell lines. A, bisulfite sequencing analysis of normal pancreas and two pancreatic cancer cell lines (PSN-1 and Mia PaCa-2). Each row shows a single clone of PCR product amplified from bisulfite-modified genomic DNA, which contains 58 CpG dinucleotides. Ⅺ and f, unmethylated and methylated CpG dinucleotides, respectively. Ten clones were examined for each sample. Small arrows indicate the CpG dinucleotide within HRE (-CACGTG-). B, methylation-specific PCR analysis of 10 pancreatic cancer cell lines. Bands (94 bp) in Lanes U and M are PCR products amplified with unmethylated and methylated gene- specific primers, respectively. C, methylation- specific PCR analysis of normal pancreas (N) and pancreatic cancer tissues (T). Results are representative from three or more experiments.

5342

Table 1 Summary of CpG methylation status of pancreatic tissues and flected in changes in BNIP3 protein expression (Fig. 7B). These cancer cell lines results indicated that expression of BNIP3 under normoxic conditions Methylation status of 20 microdissected tissue samples and 10 pancreatic cancer cell lines were evaluated by sequencing or methylation-specific PCR and after induction by hypoxia were related, at least in part, to the methylation status of the gene. Sample Methylated BNIP3 Reintroduction Causes Cell Death in Pancreatic Cancer Normal pancreas 0/10 Pancreatic adenocarcinoma 8/10 Cells. To evaluate the function of BNIP3 in pancreatic cancer, we Pancreatic cancer cell lines 9/10 transiently transfected a full-length cDNA for BNIP3 into PANC-1 and Mia PaCa-2 pancreatic cancer cell lines. Transfection with this construct, but not an empty vector, led to BNIP3 protein expression tissues were likely due to the presence of normal cells within the within 24 h after transfection (Fig. 8A). After transfection, we deter- tumors such as stroma cells or to heterogeneity of cancer cells. These mined the efficiency of colony formation under selection with G418. results were summarized in Table 1. Forced expression of BNIP3 reduced the number of colonies formed Restoration of BNIP3 Expression in Pancreatic Cancer Cells by in both cell lines (Fig. 8B). We were unable to make stable cell lines Inhibition of Gene Methylation. To further investigate whether or that constitutively express BNIP3. To test whether BNIP3 caused cell not the expression of BNIP3 mRNA is inactivated by methylation, we death, we transfected a plasmid bearing BNIP3 and GFP expressed treated four pancreatic cancer cells that displayed a constitutively from separate cytomegalovirus promoters or a control vector bearing methylated BNIP3 gene with the demethylating agent, 5aza-dC. We only GFP into PANC-1 cells and Mia PaCa-2 cells. The number of confirmed that treatment with 5aza-dC successfully blocked BNIP3 BNIP3-positive cells was evaluated by the intensity of GFP in cell gene methylation, because the signal for unmethylated BNIP3 alleles lysates. The GFP intensity of cell lysates decreased after transfection appeared in Mia PaCa-2 and HPAC cells after, but not before, meth- with BNIP3 in a time-dependent manner, such that 75% of BNIP3- ylation inhibition (Fig. 6). Next, we examined the level of BNIP3 positive PANC-1 cells and 46% of BNIP3-positive Mia PaCa-2 cells mRNA after 5aza-dC treatment under normoxic and hypoxic culture were killed within 24 h after transfection (Fig. 8C). These data were conditions in four pancreatic cancer cell lines with methylated BNIP3 confirmed by directly counting the GFP-positive cells using FACS gene, Mia PaCa-2, HPAC, BxPC-3, and MPanc-96 by reverse tran- analysis (data not shown). Thus, BNIP3 expression leads to pancreatic scription-PCR (Fig. 7A). No BNIP3 expression was detected in any of cancer cell death. the four cell lines before the 5aza-dC treatment in either normoxic Restoration of Hypoxia-Inducible BNIP3 Expression Makes control conditions or hypoxic conditions. After a 6-day treatment with Pancreatic Cancer Cells More Sensitive to Hypoxia. Following the 5aza-dC, faint bands were detected in normoxic conditions in Mia results that forced expression of BNIP3 causes pancreatic cancer cell PaCa-2, BxPC-3, and MPanc-96. When the cells were further exposed death, we wished to determine whether the restoration of hypoxia- to hypoxic conditions for 24 h after the 5aza-dC treatment, all four cell inducible BNIP3 expression makes pancreatic cancer cells more sen- lines displayed higher expressions of BNIP3. BNIP3 induction by sitive to hypoxia. To achieve the hypoxic induction of BNIP3 in hypoxia was 19-, 70-, 19-, and 40-fold, in Mia PaCa-2, HPAC, pancreatic cancer cells that possess methylated BNIP3 genes, we BxPC-3, and MPanc-96 cells, respectively, as indicated by Q-reverse made a vector (Pr-Fl-BNIP3 vector) containing a full-length BNIP3 transcription-PCR. These changes in BNIP3 mRNA were also re- cDNA regulated by the BNIP3 promoter. This construct was trans-

Fig. 6. Demethylation of BNIP3 in pancreatic cancer cell lines by 5aza-dC. Pancreatic cancer cells (Mia Paca-2 and HPAC) were incubated in culture medium containing 1 ␮M 5aza-dC for 6 days. Methylation status of these cells was then examined by methylation-specific PCR and compared with that of untreated cells. Bands (95 bp) in Lanes U and M are PCR products amplified with unmethylated and methylated gene-specific primers, respectively.

Fig. 7. Reactivation of BNIP3 expression by 5aza-dC treatment in pancreatic cancer cell lines. A, BNIP3 mRNA levels were examined by standard reverse transcription-PCR in cells treated with or without 5aza-dC for 6 days and cultured under ϭ normoxic (CO2 5% and room air; N) or hypoxic Ͻ ␤ (O2 1% for 24 h; H) conditions for 24 h. -Actin is used as a positive control for RNA quality and loading. B, BNIP3 protein levels under normoxic and hypoxic conditions were examined by Western blotting using a monoclonal anti-BNIP3 antibody, which recognizes BNIP3 at Mr 30,000. Actin is shown as a control for protein loading.

5343

Fig. 8. Functional analysis of BNIP3 in pancreatic cancer cells. A, BNIP3 protein expression was examined by Western blotting in the cells 24 h after transient transfection with BNIP3 (Lane BNIP3)or empty vector (Lane MOCK). Actin is shown as a control for protein loading. B, a colony formation assay was performed to evaluate the effect of BNIP3 on cell growth. The cells were transfected with BNIP3 cDNA or empty vector and selected with G418 for 10–14 days. Shown are representative results from three independent experiments. C, cell death detection assay in PANC-1 cells and Mia PaCa-2 cells. The cells were transfected with a vector expressing BNIP3 and GFP from separate promoters or the same vector expressing only GFP, and GFP intensities of cell lysates were measured at the indicated time point after transfection. Data are given as percentage of GFP intensity of BNIP3-transfected cells to that of empty vector-transfected cells. Values are mean Ϯ SE for three independent experiments.

fected into Mia PaCa-2 cells along with a GFP expression vector as a the hypoxic conditions that exist within these solid tumors. We have marker, and we then examined BNIP3 protein expression and cell demonstrated (a) that BNIP3 is down-regulated in pancreatic cancer; death after hypoxic exposure. As expected from our reporter assays, (b) that BNIP3 induction in hypoxic conditions is not detectable in whereas BNIP3 expression was undetectable in mock-transfected Mia nearly all pancreatic cancer cell lines; (c) that CpG dinucleotides near PaCa-2 cells in normoxic and hypoxic conditions, its expression was the transcription start site of the BNIP3 gene are methylated in clearly induced after hypoxic treatment (Fig. 9A). Furthermore, cell pancreatic adenocarcinomas and BNIP3-negative pancreatic cancer death analysis showed that GFP intensity of Pr-Fl-BNIP3-transfected cell lines; (d) that inhibition of DNA methylation restores BNIP3 Mia PaCa-2 cells decreased by 40% after hypoxia, whereas mock- expression under normoxic conditions and the ability of hypoxia to transfected cells displayed only a slight decrease of GFP intensity. induce expression of BNIP3 in pancreatic cancer cell lines; (e) that This result indicated that a greater number of Pr-Fl-BNIP3-transfected reintroduction of BNIP3 by transient transfection into pancreatic Mia PaCa-2 cells were killed by hypoxia than mock-transfected cells. cancer cells causes cell death; and (f) that restoration of hypoxia- Thus, restoration of hypoxia-inducible BNIP3 rendered Mia PaCa-2 inducible BNIP3 makes pancreatic cancer cells more sensitive to cells more susceptible to hypoxic injury. hypoxia. These observations provide important new insights into the functioning of pancreatic cancer cells. DISCUSSION We observed that BNIP3 mRNA expression is markedly down- In the current study, we have identified BNIP3 as a tumor suppres- regulated in pancreatic cancer tissue and cancer cell lines compared sor in pancreatic cancer, and our data suggest that silencing of BNIP3 with normal pancreas. The presence of BNIP3 mRNA in normal is a molecular mechanism by which pancreatic cancer cells adapt to pancreas supports the previous report that several normal human 5344

hypoxia. Furthermore, these same pathways are often activated in cancer, suggesting that tumors take advantage of these responses to survive in the hypoxic environment that generally exists within tumors (6, 8). However, in response to hypoxia, normal cells may also diminish their proliferative rate, undergo cell cycle arrest, or even undergo apoptosis (26, 27). These growth inhibitory events can also be justified as a physiological adaptation to hypoxia. For example, cell cycle arrest might be important for cells to escape from harmful effects caused by hypoxia-induced genetic instability (28). Further- more, hypoxia-induced cell death might help maintain tissue homeostasis by removing cells that are irreversibly damaged during oxygen deprivation. However, hypoxia-related growth inhibitory mechanisms are often missing in cancer cells (7), and our data suggest that this is the case for BNIP3 expression in pancreatic cancer. BNIP3 induction by hypoxia is mediated by the transcription factor HIF-1 (11, 12). HIF-1 is composed of two subunits, HIF-1␣ and HIF-1␤ (29). HIF-1␣ is the oxygen-regulated component that deter- mines HIF-1 activity (30). During hypoxia, accumulation of HIF-1␣ protein occurs because its constitutive proteolytic degradation through the ubiquitin proteosome pathway is inhibited (31, 32). Increased levels of HIF-1 activity lead to the transactivation of a number of genes whose protein products play key roles in angiogenesis, vascular reactivity and remodeling, glucose and energy metabolism, and cell proliferation and survival (20). Thus, not surprisingly, expression of HIF-1␣ has been linked to increased tumorigenesis and tumor invasiveness (33, 34). Importantly, HIF-1␣ has previously been demonstrated to be overexpressed in primary and metastatic human cancers Fig. 9. Restoration of hypoxia-inducible BNIP3 expression by transfection of the construct (Pr-Fl-BNIP3) containing a full length of BNIP3 cDNA following the BNIP3 including pancreatic cancer by immunohistochemistry (35). In the promoter. A, after transfection of Pr-Fl-BNIP3 plasmid (Lane Pr-FL-BNIP3) or empty current study, we demonstrated that HIF-1␣ protein expression was vector (Lane MOCK), Mia PaCa-2 cells were incubated in normoxic (N) or hypoxic conditions (H) for 24 h. BNIP3 protein levels were examined by Western blotting using significantly induced after hypoxic treatment in all pancreatic cancer a monoclonal anti-BNIP3 antibody, which recognizes BNIP3 at Mr 30,000. Actin is shown cell lines examined. Likewise, we observed increased expression of as a control for protein loading. B, after cotransfection of the Pr-Fl-BNIP3 vector or empty the HIF-1-regulated genes GLUT1 and IGFBP3 (36, 37). These data vector with GFP vector, cells were incubated in normoxic (Ⅺ) or hypoxic (f) conditions for 24 h. The number of viable transfected cells was evaluated by GFP intensity of the suggest that the hypoxia-HIF-1 pathway is intact and that the BNIP3 lysates. The GFP intensity in normoxic conditions was given a value of 100, and the data pathway is disrupted at some point after HIF-1 activation in pancreatic represent a mean of three experiments. cancer cells. Thus, when pancreatic cancer cells are exposed to hypoxia, they may exhibit increased invasiveness and promote neo- vascularization, anaerobic metabolism, and proliferation through HIF- tissues including pancreas, heart, and liver express BNIP3 mRNA (14, 1-mediated genes; whereas they may evade hypoxia-induced cell 22). In contrast to our observation of BNIP3 down-regulation in death at least in part by lacking BNIP3 induction. pancreatic cancer, in breast cancer tissues, BNIP3 is expressed at By allowing pancreatic cancer cells to survive during prolonged higher levels than normal breast tissue (12). This indicates that down- exposure to hypoxic stress, BNIP3 silencing may contribute to the regulation of BNIP3 expression is not a universal phenomenon that progression of pancreatic cancer. Tumor hypoxia is thought to be occurs during cancer development and progression but may be tissue associated with a malignant phenotype of tumors. Hypoxia increases specific. the mutation rate of tumor cells, promotes metastatic potential and Forced expression of BNIP3 killed 46 and 75% of transfected dedifferentiation, and decreases sensitivity to chemotherapy and ra- pancreatic cancer cells Mia PaCa-2 and PANC-1, respectively, within diation therapy (38–40). Moreover, it has been shown that the hy- 24 h. This was not unexpected, because BNIP3 is a pro-apoptotic poxic status of tumors correlates with increased recurrence and a member of the BCL-2 family that has been shown to lead to cell death shorter survival (41–43). Therefore, it is strongly suggested that in a wide range of cultured cells (14, 15, 23). BNIP3-mediated death BNIP3 silencing contributes to aggressive biological nature of pan- has been reported to occur by a pathway independent of caspase creatic cancer activation and cytochrome c release that is characterized by early In our effort to elucidate the mechanisms by which BNIP3 expres- plasma membrane and mitochondrial damage, before the appearance sion is down-regulated in pancreatic cancer tissues and cell lines, we of chromatin condensation or DNA fragmentation (24). We did not found that CpG dinucleotides in the CpG island of the BNIP3 pro- investigate the mechanisms of cell killing by BNIP3 in the current moter are densely methylated. Hypermethylation in CpG-rich regions study, but instead focused on the regulation of BNIP3 expression in is found in many tumors including pancreatic cancer, and this event is pancreatic cancer. associated with the inactivation of cancer-related genes such as p16, BNIP3 belongs to the category of genes induced during hypoxia E-cadherin, and hMLH1 (44, 45). In the current study, methylation of (11–13). Cells display a variety of physiological responses through the BNIP3 gene occurred in nine of 10 pancreatic cancer cell lines and hypoxia-inducible genes when exposed to low oxygen concentrations. eight of 10 human pancreatic cancer tissues. Although the number of The majority of hypoxia-inducible genes contribute to maintaining samples was relatively small, our findings suggest that BNIP3 meth- cellular viability under limited oxygen availability (25). For example, ylation is a frequent event in pancreatic cancer. Of note, PSN-1 cells, genes involved in angiogenesis, glucose up-take, and anaerobic met- which showed BNIP3 expression in normoxic culture conditions and abolic pathways, as well as several growth factors are induced by prominent induction by hypoxia, displayed almost totally unmethyl- 5345

Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2004 American Association for Cancer Research. DOWN-REGULATION OF BNIP3 IN PANCREATIC CANCER ated BNIP3 gene by sequencing, whereas all five BNIP3-negative 13. Guo K, Searfoss G, Krolikowski D, et al. Hypoxia induces the expression of the cells had methylated BNIP3 genes. That BNIP3 silencing was due to pro-apoptotic gene BNIP3. Cell Death Differ 2001;8:367–76. 14. Chen G, Ray R, Dubik D, et al. The E1B 19K/Bcl-2-binding protein Nip3 is a dimeric gene methylation was confirmed using a DNA methylation inhibitor. mitochondrial protein that activates apoptosis. J Exp Med 1997;186:1975–83. After DNA demethylation, BNIP3 expression was elevated under 15. Regula KM, Ens K, Kirshenbaum LA. Inducible expression of BNIP3 provokes mitochondrial defects and hypoxia-mediated cell death of ventricular myocytes. Circ normoxic cell culture conditions, and BNIP3 induction by hypoxia Res 2002;91:226–31. was also restored. These results indicate that methylation of the 16. Ji B, Bi Y, Simeone D, Mortensen RM, Logsdon CD. Human pancreatic acinar cells BNIP3 gene plays a key role in down-regulation of BNIP3. This is the lack functional responses to cholecystokinin and gastrin. Gastroenterology 2001;121: 1380–90. first report describing methylation of BNIP3 gene in cancer, although 17. Ito S, Fukusato T, Nemoto T, Sekihara H, Seyama Y, Kubota S. Coexpression of a recent microarray study suggested that BNIP3 expression is induced glucose transporter 1 and matrix metalloproteinase-2 in human cancers. J Natl Cancer after treatment of pancreatic cancer cells with a DNA methylation Inst (Bethesda) 2002;94:1080–91. 18. Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB. Methylation-specific inhibitor (46). PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci Based on the known pro-apoptotic role of BNIP3 in other cells and USA 1996;93:9821–6. 19. Kamiya T, Kwon AH, Kanemaki T, et al. A simplified model of hypoxic injury in our data that BNIP3 was silenced in pancreatic cancer cells, we primary cultured rat hepatocytes. In Vitro Cell Dev Biol Anim 1998;34:131–7. hypothesized that restoration of BNIP3 expression would increase the 20. Semenza GL. Hypoxia-inducible factor 1: oxygen homeostasis and disease patho- sensitivity of the cancer cells to apoptosis. We initially considered physiology. Trends Mol Med 2001;7:345–50. 21. Kothari S, Cizeau J, McMillan-Ward E, et al. BNIP3 plays a role in hypoxic cell death restoring hypoxia-inducible BNIP3 expression by using the demethy- in human epithelial cells that is inhibited by growth factors EGF and IGF. Oncogene lating agent. However, treatment with this agent is known to affect a 2003;22:4734–44. ␣ large number of methylated genes including those involved in cell 22. Yasuda M, Han JW, Dionne CA, Boyd JM, Chinnadurai G. BNIP3 : a human homolog of mitochondrial proapoptotic protein BNIP3. Cancer Res 1999;59:533–7. survival. Therefore, to more specifically restore BNIP3 expression, 23. Chen G, Cizeau J, Vande VC, et al. Nix and Nip3 form a subfamily of pro-apoptotic we generated a vector containing a full length of BNIP3 cDNA mitochondrial proteins. J Biol Chem 1999;274:7–10. 24. Vande VC, Cizeau J, Dubik D, et al. BNIP3 and genetic control of necrosis-like cell down-stream of the BNIP3 promoter and transfected this construct death through the mitochondrial permeability transition pore. Mol Cell Biol 2000; into Mia PaCa-2 cells. Wild-type Mia PaCa-2 cells have a methylated 20:5454–68. BNIP3 gene and do not express BNIP3 under normoxic or hypoxic 25. Sutherland RM. Tumor hypoxia and gene expression: implications for malignant progression and therapy. Acta Oncol 1998;37:567–74. conditions. Transfection with the BNIP3 promoter construct restored 26. Carmeliet P, Dor Y, Herbert JM, et al. Role of HIF-1␣ in hypoxia-mediated apoptosis, hypoxia-inducible BNIP3 expression, and after hypoxia, a greater cell proliferation and tumour angiogenesis. Nature 1998;394:485–90. number of cells were killed compared with mock-transfected cells. 27. Graeber TG, Peterson JF, Tsai M, Monica K, Fornace AJ Jr, Giaccia AJ. Hypoxia induces accumulation of p53 protein, but activation of a G1-phase checkpoint by These results indicate that the restoration of hypoxia-induced BNIP3 low-oxygen conditions is independent of p53 status Mol Cell Biol 1994;14:6264–77. expression renders pancreatic cancer cells more susceptible to 28. Reynolds TY, Rockwell S, Glazer PM. Genetic instability induced by the tumor microenvironment. Cancer Res 1996;56:5754–7. hypoxia-induced cell death. In another words, the loss of BNIP3 29. Wang GL, Semenza GL. Purification and characterization of hypoxia-inducible factor induction by hypoxia due to gene methylation allows pancreatic 1. J Biol Chem 1995;270:1230–7. cancer cells to avoid hypoxia-induced cell death. 30. Huang LE, Arany Z, Livingston DM, Bunn HF. Activation of hypoxia-inducible transcription factor depends primarily upon redox-sensitive stabilization of its ␣ In summary, the frequent inactivation of BNIP3 in pancreatic subunit. J Biol Chem 1996;271:32253–9. cancer and its role as an inducer of apoptosis support the role of this 31. Huang LE, Gu J, Schau M, Bunn HF. Regulation of hypoxia-inducible factor 1␣ is molecule as a tumor suppressor. The observation that BNIP3 expres- mediated by an O2-dependent degradation domain via the ubiquitin-proteasome pathway. Proc Natl Acad Sci USA 1998;95:7987–92. sion is silenced while other hypoxia-regulated genes are induced 32. Salceda S, Caro J. Hypoxia-inducible factor 1␣ (HIF-1␣) protein is rapidly degraded suggests that BNIP3 silencing contributes to the survival and progres- by the ubiquitin-proteasome system under normoxic conditions: its stabilization by hypoxia depends on redox-induced changes. J Biol Chem 1997;272:22642–7. sion of pancreatic cancer in a hypoxic environment. Taken together, 33. Krishnamachary B, Berg-Dixon S, Kelly B, et al. Regulation of colon carcinoma cell these observations suggest that BNIP3 reactivation might be a novel invasion by hypoxia-inducible factor 1. Cancer Res 2003;63:1138–43. target for treatment of this disease. 34. Chen J, Zhao S, Nakada K, et al. Dominant-negative hypoxia-inducible factor-1 ␣ reduces tumorigenicity of pancreatic cancer cells through the suppression of glucose metabolism. Am J Pathol 2003;162:1283–91. 35. Zhong H, De Marzo AM, Laughner E, et al. Overexpression of hypoxia-inducible REFERENCES factor 1␣ in common human cancers and their metastases. Cancer Res 1999;59: 5830–5. 1. Jemal A, Murray T, Samuels A, Ghafoor A, Ward E, Thun MJ. Cancer statistics, 36. Iyer NV, Kotch LE, Agani F, et al. Cellular and developmental control of O2 2003. CA Cancer J Clin 2003;53:5–26. homeostasis by hypoxia-inducible factor 1 ␣. Genes Dev 1998;12:149–62. 2. Yeo CJ, Cameron JL, Sohn TA, et al. Six hundred fifty consecutive pancreaticoduo- 37. Feldser D, Agani F, Iyer NV, Pak B, Ferreira G, Semenza GL. Reciprocal positive denectomies in the 1990s: pathology, complications, and outcomes. Ann Surg 1997; regulation of hypoxia-inducible factor 1␣ and insulin-like growth factor 2. Cancer 226:248–57. Res 1999;59:3915–8. 3. DiMagno EP, Reber HA, Tempero MA. AGA technical review on the epidemiology, 38. Young SD, Marshall RS, Hill RP. Hypoxia induces DNA overreplication and en- diagnosis, and treatment of pancreatic ductal adenocarcinoma: American Gastroen- hances metastatic potential of murine tumor cells. Proc Natl Acad Sci USA 1988; terological Association. Gastroenterology 1999;117:1464–84. 85:9533–7. 4. Megibow AJ. Pancreatic adenocarcinoma: designing the examination to evaluate the 39. Rofstad EK, Rasmussen H, Galappathi K, Mathiesen B, Nilsen K, Graff BA. Hypoxia clinical questions. Radiology 1992;183:297–303. promotes lymph node metastasis in human melanoma xenografts by up-regulating the 5. Koong AC, Mehta VK, Le QT, et al. Pancreatic tumors show high levels of hypoxia. urokinase-type plasminogen activator receptor. Cancer Res 2002;62:1847–53. Int J Radiat Oncol Biol Phys 2000;48:919–22. 40. Helczynska K, Kronblad A, Jogi A, et al. Hypoxia promotes a dedifferentiated 6. Harris AL. Hypoxia: a key regulatory factor in tumour growth. Nat Rev Cancer phenotype in ductal breast carcinoma in situ. Cancer Res 2003;63:1441–4. 2002;2:38–47. 41. Brizel DM, Scully SP, Harrelson JM, et al. Tumor oxygenation predicts for the 7. Graeber TG, Osmanian C, Jacks T, et al. Hypoxia-mediated selection of cells with likelihood of distant metastases in human soft tissue sarcoma. Cancer Res 1996;56: diminished apoptotic potential in solid tumours. Nature 1996;379:88–91. 941–3. 8. Hockel M, Vaupel P. Tumor hypoxia: definitions and current clinical, biologic, and 42. Hockel M, Schlenger K, Hockel S, Vaupel P. Hypoxic cervical cancers with low molecular aspects. J Natl Cancer Inst (Bethesda) 2001;93:266–76. apoptotic index are highly aggressive. Cancer Res 1999;59:4525–8. 9. Boyd JM, Malstrom S, Subramanian T, et al. Adenovirus E1B 19 kDa and Bcl-2 43. Yuan J, Narayanan L, Rockwell S, Glazer PM. Diminished DNA repair and elevated proteins interact with a common set of cellular proteins. Cell 1994;79:341–51. mutagenesis in mammalian cells exposed to hypoxia and low pH. Cancer Res 10. Yasuda M, Theodorakis P, Subramanian T, Chinnadurai G. Adenovirus E1B–19K/ 2000;60:4372–6. BCL-2 interacting protein BNIP3 contains a BH3 domain and a mitochondrial 44. Baylin SB, Herman JG. DNA hypermethylation in tumorigenesis: epigenetics joins targeting sequence. J Biol Chem 1998;273:12415–21. genetics. Trends Genet 2000;16:168–74. 11. Bruick RK. Expression of the gene encoding the proapoptotic Nip3 protein is induced 45. Ueki T, Toyota M, Sohn T, et al. Hypermethylation of multiple genes in pancreatic by hypoxia. Proc Natl Acad Sci USA 2000;97:9082–7. adenocarcinoma. Cancer Res 2000;60:1835–9. 12. Sowter HM, Ratcliffe PJ, Watson P, Greenberg AH, Harris AL. HIF-1-dependent 46. Sato N, Fukushima N, Maitra A, et al. Discovery of novel targets for aberrant regulation of hypoxic induction of the cell death factors BNIP3 and NIX in human methylation in pancreatic carcinoma using high-throughput microarrays. Cancer Res tumors. Cancer Res 2001;61:6669–73. 2003;63:3735–42. 5346

Jiro Okami, Diane M. Simeone and Craig D. Logsdon

Cancer Res 2004;64:5338-5346.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/64/15/5338

Cited articles This article cites 46 articles, 27 of which you can access for free at: http://cancerres.aacrjournals.org/content/64/15/5338.full#ref-list-1

Citing articles This article has been cited by 24 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/64/15/5338.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/64/15/5338. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.