Genes Genet. Syst. (2011) 86, p. 47–52 Molecular cloning, mRNA expression and imprinting status of PEG3, NAP1L5 and PPP1R9A genes in pig

Feng-Wei Zhang1, Chang-Yan Deng2, Hong-Juan He1, Ning Gu1, Zheng-Bin Han1, Yan Chen1 and Qiong Wu1* 1Department of Life Science and Engineering, Harbin Institute of Technology, Harbin 150001, China 2Key Laboratory of Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education, Huazhong Agricultural University, Wuhan 430070, China

(Received 22 November 2010, accepted 31 January 2011)

Imprinted genes are expressed monoallelically depending on their parental origin, and play important roles in the regulation of fetal growth, development, and postnatal behavior. Most genes known to be imprinted have been identified and studied in the human and the mouse. However, there are only a small number of reported imprinted genes in pigs. Therefore, identification and char- acterization of more imprinted genes in pigs is useful for comparative analysis of genomic imprinting across species. In this study, we cloned the porcine PEG3, NAP1L5 and PPP1R9A genes. The imprinting status of these genes was deter- mined using sequencing directly and single nucleotide polymorphisms (SNPs) identified in individuals from reciprocal cross of Meishan and Large White pigs. Imprinting analysis was carried out in 13 different tissues (skeletal muscle, fat, pituitary gland, heart, lung, liver, kidney, spleen, stomach, small intestine, uterus, ovary and testis) from twelve 2-month-old piglets. Imprinting analysis showed that PEG3 and NAP1L5 were exclusively expressed from the paternal allele whereas PPP1R9A was biallelically expressed in all tissues tested where the genes were expressed. The study is of interest to understand the conservation of genomic imprinting among mammals at the 3 loci.

Key words: genomic imprinting, NAP1L5, PEG3, pig, polymorphism, PPP1R9A

the present work was to investigate the imprinting status INTRODUCTION of porcine PEG3 (paternally expressed gene 3), NAP1L5 Imprinted genes are preferentially expressed from (nucleosome assembly protein 1-like 5) and PPP1R9A either the maternally inherited or the paternally inher- (protein phosphatase 1, regulatory subunit 9A) genes. ited alleles, and involved in a myriad of processes includ- The Nap1l5 and Ppp1r9a are located on a large ing fetal, placental, and neurological development (Lim imprinted gene cluster on mouse proximal chromosome 6 and Maher, 2010). At present, more than 61 imprinted (http://www.mousebook.org/imprinting/chr6.html). The genes have been identified in human and 102 in mouse, function of NAP1L5 is not known, but its protein shows but only 16 in sheep, 15 in cattle and 17 in pigs (http:// homology to nucleosome assembly proteins (NAPs) which igc.otago.ac.nz/home.html). In order to increase our unde- are involved in cell cycle regulation (Loyola and rstanding how different mammalian species are regulated Almouzni, 2004). The NAP1L5 is paternally expressed by imprinting, it is important to identify and characterize in many fetal tissues in human, mouse and cattle (Smith more imprinted genes in pigs. We have previously et al., 2003; Zaitoun and Khatib, 2006; Wood et al., described the maternally expressed gene DLX5 and pater- 2007). The PPP1R9A encodes neurabin I which is a reg- nally expressed genes PLAGL1, PEG10, NNAT and ulatory subunit of protein phosphatase I, and controls DIRAS3 in pigs (Cheng et al., 2007, 2008; Zhang et al., actin cytoskeleton reorganization (Oliver et al., 2002). It 2007). As part of an effort to study the conservation of is reported that PPP1R9A was preferentially maternally imprinted genes among mammalian species, the aim of expressed in embryonic muscle and placenta in human and mouse (Ono et al., 2003; Nakabayashi et al., 2004). Edited by Toshihiko Shiroishi The PEG3 encodes an unusual Krüppel-type zinc finger * Corresponding author. E-mail: [email protected] protein implicated in the cell growth, apoptosis, and 48 F.-W. ZHANG et al. maternal nurturing behavior (Li et al., 1999; Relaix et al., facturer’s instructions. The RNA samples were treated 2000). The gene is paternally expressed in human using Amplification Grade DNase I (TaKaRa, Tokyo, (19q13), mouse (7A2-B1), sheep and cattle (Kuroiwa et al., Japan) at room temperature for 60 min. First strand 1996; Murphy et al., 2001; Kim et al., 2004; Thurston et cDNA was synthesised from 2 μg total RNA in a 20 μL al., 2008). reaction volume containing 1 × M-MLV first-strand

In this study, we determined the imprinting status of buffer, 1 mM each dNTP, 5 μM oligo (dT)18 primer, 8 U the porcine PEG3, NAP1L5 and PPP1R9A genes by RNase inhibitor and 40 U M-MLV (Promega, Madison, sequencing directly at the genomic DNA (gDNA) and the WI, USA) at 42°C for 60 min. first-strand complementary DNA (cDNA) levels in het- erozygous pigs based on the SNP sites, and our results PCR amplification of gDNA and cDNA Primers used provided the direct evidence of imprinting or non- to amplify the PEG3, NAP1L5, and PPP1R9A (Table 1) imprinting of the 3 genes. genes were designed using sequence obtained by per- forming BLAST (http://www.ncbi.nlm.nih.gov/BLAST/) searches of the human PEG3 (NM_006210), NAP1L5 MATERIALS AND METHODS (NM_153757) and PPP1R9A (NM_017650) cDNA sequ- Experimental animals and gDNA isolation All ani- ences against porcine expressed sequence tag (EST) mals in this study were derived from the Experimental libraries in GenBank. PCR were performed in a 20-μL Pig Station of Huazhong Agricultural University. Recip- volume containing 50 ng of porcine cDNA or gDNA, 1 × rocal crosses were generated from natural mating of pure- PCR buffer, 0.2 μM of each primer, 150 μM of each dNTP, bred Meishan (Ms) with purebred Large White (LW) 1.5 mM MgCl2 and 1 U of Taq DNA polymerase (TaKaRa). pigs. Six 2-month-old piglets (4 females and 2 male) gen- The PCR conditions were as follows: 94°C for 4 min, 35 erated from the LW boars × Ms sows (LW × Ms) and 6 pigs cycles of 94°C for 45 s, annealing at optimal temperature, from the Ms boars × LW sows (Ms × LW) and their 4 dams 72°C for 1 min and a final extension at 72°C for 7 min. (2 Ms and 2 LW) were used for imprinting analysis of the Primers (forward: ACCACAGTCCATGCCATCAC and candidate imprinted genes. The gDNA was extracted reverse: TCCACCACCCTGTTGCTGTA), which amplify a from all experimental animals according to the standard fragment spanning intron 8 of the GAPDH gene, were phenol-chloroform method. applied to exclude the possibility of DNA contamination during all RT-PCR reactions. RNA isolation and cDNA synthesis Total RNA from 13 tissues including heart, liver, spleen, lung, kidney, Sequencing and SNP Detection The sizes of PCR stomach, small intestine, skeletal muscle, fat, uterus, and RT-PCR products obtained from the 13 tissues were ovary, testicle, and pituitary gland of the 12 F1 hybrid pig- estimated on a 1% agarose gel. The products were puri- lets and their dams were isolated with TRIzol reagent fied from the PCR solution using the Wizard prep PCR (Invitrogen, Carlsbad, CA, USA) according to the manu- purification system (Promega). Sequencing reactions of

Table 1. Primer sequences, SNP information and sequences similarity of the 6 porcine genes

Gene Size (bp) SNP and Sequence similarityc Primer sequencea (Acc no) DNA/cDNA Positionb P-H P-M PEG3 PE1F: GAAGTGGAAGCCAACGTC 695/695 603 bp, A/G 34.6% 2.0% (EF619475) *PE1R: CCAGTTCTCTGCGGTCTA PE2F: GCCAGGCACCAGAACAC 1455/1455 PE2R: CACAGAGCACGACCCAG NAP1L5 NA1F: GCCGAGATGGCAGAGGA 1158/1158 777 bp, G/A 78.8% 50.1% (EF619474) *NA1R: CTGTATGCCAGTCTGTTC PPP1R9A PP1F: AGCATTCTGGCTGGTCT 1097/1097 1217 bp, G/T 67.9% 0% (EF619476) PP1R: AGCAAAGCACCACACAT *PP2F: ATGTGTGGTGCTTTGCTA 866/866 PP2R: AATCATACCGAGCTGTTG a The F or R at the end of each primer indicates that it was a forward or reverse primer, respectively. * represents sequencing primers in imprinting analysis. b The SNP positions are according to the sequence with the accession number (Acc no). c P, H and M represent pigs, human and mouse, respectively. Imprinting analyses of the 3 porcine candidate genes 49

PCR and RT-PCR products were carried out using ABI lung, liver, kidney, spleen, stomach, small intestine, PRISM 3130 Genetic Analyzer (Applied Biosystems, CA, uterus, ovary and testis by semi-quantitative RT-PCR, USA) with the BigDye® Terminator v3.1 Cycle respectively. The results showed that NAP1L5 was Sequencing Kit (Applied Biosystems). Sequencing pri- expressed in all the 13 tissues, but no signals of expres- mers are listed in Table 1. Data were analyzed using sion were detected in skeletal muscle, fat and testis for version 5.0 of Sequencing Analysis (Applied Biosystems). PPP1R9A and in fat and small intestine for PEG3 (Fig. 1). The SNPs were identified by visually inspecting each base in sequencing traces. The site was considered as poly- Imprinting status of the PEG3, NAP1L5 and morphisms if double peaks appeared in the sequence PPP1R9A genes In this study, the sequencing- and chromatogram. polymorphism-based methods were used to analyze the imprinting status of the 3 porcine candidate genes. At first, the PCR products amplified from gDNA samples of RESULTS the 12 F1 piglets were sequenced directly to identify the Sequence analysis and SNP detection All the primer heterozygous individuals which would display two peaks pairs in Table 1 were used to amplify the transcript at SNP sites in a sequence chromatogram. Secondly, the regions of the porcine PEG3, NAP1L5 and PPP1R9A cDNA obtained from various tissues of the heterozygous genes at the gDNA and cDNA levels in independent Ms pigs and gDNA from the pigs’ dams were sequenced and LW pigs. A total of 2052 bp for PEG3, 1158 bp for directly to analyze the imprinting status of the candidate NAP1L5, and 1946 bp for PPP1R9A gDNA/cDNA sequ- genes. Monoallelically expressed genes would display ences (all the sequences were identical between gDNA only one peak, while biallelically expressed genes would and cDNA) were obtained and deposited in GenBank display two peaks corresponding to two alleles of the database (EF619475, EF619474 and EF619476). Com- SNP. The imprinting status of each candidate gene was paring the gDNA sequences between Ms and LW pigs determined by comparison to the maternal sequence. resulted in the identification of the A/G, G/A and G/T A (A/G) SNP was detected at PEG3 locus in each hybrid polymorphisms at position 603 bp, 777 bp and 1217 bp piglets generated and sequencing reactions of RT-PCR (according to the accession number) of the PEG3, NAP1L5 products were carried out using primer PE1R in all the and PPP1R9A genes, respectively (Table 1). All the 13 tissues except fat and small intestine where the gene SNPs were used for imprinting analysis of the 3 candidate was not expressed. The paternally inherited PEG3 allele genes. Sequencing analysis showed that sequence simi- was detected, in the absence of the maternal allele, in larity was higher between pigs and human than between sequence chromatograms obtained from all the tissues pigs and mouse for all 3 candidate genes (Table 1). detected. These results showed that the porcine PEG3 gene is exclusively paternally expressed (Fig. 2A). Expression of the PEG3, NAP1L5 and PPP1R9A A G/A SNP at NAP1L5 locus was identified between genes The primer pairs PE1F/PE1R, NA1F/NA1R and LM and Ms pigs, but only 3 LW × Ms hybrids were het- PP2F/PP2R were used to detect the expression of the por- erozygous at the SNP site. RT-PCR products of all the 3cine PEG , NAP1L5 and PPP1R9A genes in 13 tissues 13 tissues obtained from the 3 LW × Ms hybrids were including skeletal muscle, fat, pituitary gland, heart, directly sequenced with primer NA1R and preferential

Fig. 1. Expression patterns of the 3 porcine candidate genes in 13 tissues analyzed by RT-PCR. The samples were obtained from the cDNA pools of the 12 hybrid piglets. M represents DNA Marker DL2,000 (2,000, 1,000, 750, 500, 250 and 100 bp) (TaKaRa). 50 F.-W. ZHANG et al.

Fig. 2. Imprinting analysis of the PEG3, NAP1L5 and PPP1R9A genes by sequencing directly. The arrows point to SNP sites. Sequence chromatograms of gDNA obtained from l the hybrid piglets demonstrate the presence of the A/G, G/A and G/T SNP at the PEG3 (A), NAP1L5 (B), and PPP1R9A (C) locus, respectively. Sequence chromatograms of cDNA obtained from all the tissues tested (some of them not shown) where the genes were expressed indicate that PEG3 and NAP1L5 were exclusively paternally expressed, whereas PPP1R9A was biallelically expressed.

expression of the paternal allele was detected for all sam- (QTL) significantly affect growth, backfat thickness, car- ples in each animal. These results indicate that the por- cass composition and reproduction (de Koning et al., 2000; cine NAP1L5 gene is exclusively expressed from the Sato et al., 2006; Ding et al., 2009; Uemoto et al., 2009; paternal allele (Fig. 2B). Ruckert and Bennewitz, 2010). 2The IGF gene, which An informative SNP site, G/T, was found at PPP1R9A was identified as the first imprinted gene in pigs, has locus and all the 12 hybrid piglets were heterozygous at important effects on porcine growth, meat quality and the SNP sites. Sequences generated by directly sequenc- carcass composition, especially on fat deposition (Estellé ing RT-PCR products amplified from all the 13 tissues et al., 2005). Our previous study also showed that a except skeletal muscle, fat and testis where the gene was polymorphism of the paternally expressed DLX5 gene had not expressed contained both the maternal and paternal significant association with porcine fat deposition (Cheng alleles (Fig. 2C). These results demonstrate that et al., 2008). Therefore, it would be of interest to identi- PPP1R9A was biallelically expressed in all tissues tested. fication and characterization of more imprinted genes in pigs as sources of quantitative genetic variation (Khatib, 2004). Moreover, identifying additional imprinted genes DISCUSSION in pigs is useful for comparative analysis of genomic Genomic imprinting is a parent-of-origin-dependent imprinting across species due to a small number of epigenetic mechanism, and imprinted genes are preferen- reported imprinted genes in pigs. tially expressed from one parental allele. In mammals In this study, a polymorphism-based approach and in particular, imprinted genes have an important effect in reciprocal crosses model were used to analyze the imp- the regulation of fetal growth, development, function of rinting status of 3 porcine genes. Imprinting analysis the placenta, and postnatal behavior (Isles and Holland, showed that PEG3 and NAP1L5 were exclusively pater- 2005). In pigs, many imprinted quantitative trait locus nally expressed, whereas PPP1R9A was biallelically Imprinting analyses of the 3 porcine candidate genes 51 expressed. Recently, it was reported that the expression de Koning, D. J., Rattink, A. P., Harlizius, B., van Arendonk, J. of porcine PEG3 and NAP1L5 were increased in bipa- A., Brascamp, E. W., and Groenen, M. A. (2000) Genome- rental than parthenote samples in brain, liver, fibroblasts wide scan for body composition in pigs reveals important role of imprinting. Proc. Natl. Acad. Sci. USA 97, 7947– and placenta with microarray analysis. Concomitantly, 7950. the expression of PPP1R9A from biparental and par- Ding, N., Guo, Y., Knorr, C., Ma, J., Mao, H., Lan, L., Xiao, S., thenote samples were similar in the 4 same tissues by the Ai, H., Haley, C. S., Brenig, B., et al. (2009) Genome-wide semi-quantitative RT-PCR (Bischoff et al., 2009). These QTL mapping for three traits related to teat number in a × results indicated that PEG3 and NAP1L5 may be candi- White Duroc Erhualian pig resource population. BMC Genet. 10, 6. date paternally expressed but PPP1R9A biallelically Estellé, J., Mercadé, A., Noguera, J. L., Pérez-Enciso, M., Ovilo, expressed genes in pigs. However, our study provided C., Sánchez, A., and Folch, J. M. (2005) Effect of the porcine the direct evidence of monoallelic and/or biallelica expres- IGF2-intron3-G3072A substitution in an outbred Large sion of these genes. White population and in an Iberian x Landrace cross. J. The PEG3 and NAP1L5 were exclusively paternally Anim. Sci. 83, 2723–2728. Isles, A. R., and Holland, A. J. (2005) Imprinted genes and expressed in all tissues tested in pigs in our study. The mother offspring interactions. Early Human Development imprinting status of the genes was consistent with that in 81, 73–77. human and mouse. For PPP1R9A, it is showed that the Kim, J., Bergmann, A., Lucas, S., Stone, R., and Stubbs, L. gene to be preferentially maternally expressed in embry- (2004) Lineage-specific imprinting and evolution of the zinc- onic skeletal muscle but biallelic expression in other finger gene ZIM2. Genomics 84, 47–58. Khatib, H. (2004) Imprinting of Nesp55 gene in cattle. Mamm. embryonic tissues in human and mouse (Ono et al., 2003; Genome 15, 663–667. Nakabayashi et al., 2004). In contrast, the porcine Kuroiwa, Y., Kaneko-Ishino, T., Kagitani, F., Kohda, T., Li, L. PPP1R9A was not expressed in skeletal muscle and bial- L., Tada, M., Suzuki, R., Yokoyama, M., Shiroishi, T., lelically expressed in other tissues obtained from twelve Wakana, S., et al. (1996) Peg3 imprinted gene on proximal 2-month-old piglets. The differences of expression pat- chromosome 7 encodes for a zinc finger protein. Nat. Genet. 12, 186–190. tern in skeletal muscle among human, mouse and pigs Li, L., Keverne, E. B., Aparicio, S. A., Ishino, F., Barton, S. C., might occur due to differences in developmental stages. and Surani, M. A. (1999) Regulation of maternal behavior Furthermore, some imprinted genes may be imprinted in and offspring growth by paternally expressed Peg3. Science a limited type of ocular cells at a certain developmental 284, 330–333. stage. Therefore, the imprinting analysis of these genes Lim, D. H., and Maher, E. R. (2010) Genomic imprinting syn- dromes and cancer. Adv. Genet. 70, 145–175. in other developmental stages, especially in embryo, is Loyola, A., and Almouzni, G. (2004) Histone chaperones, a sup- potentially important. porting role in the limelight. Biochimica et Biophysica In summary, we have shown that PEG3 and NAP1L5 Acta 1677, 3–11. are paternally expressed, whereas PPP1R9A was biallel- Murphy, S. K., Wylie, A. A., and Jirtle, R. L. (2001) Imprinting ically expressed in pigs. The study may be useful for of PEG3, the human homologue of a mouse gene involved in nurturing behavior. Genomics 71, 110–117. elucidating the conservation of imprinting among mam- Nakabayashi, K., Makino, S., Minagawa, S., Smith, A. C., malian species and identifying causative factors of quan- Bamforth, J. S., Stanier, P., Preece, M., Parker-Katiraee, L., titative trait loci. Paton, T., Oshimura, M., et al. (2004) Genomic imprinting of PPP1R9A encoding neurabin I in skeletal muscle and extra- This study was supported by the Natural Scientific Research embryonic tissues. J. Med. Genet. 41, 601–608. Innovation Foundation in Harbin Institute of Technology (No. Oliver, C. J., Terry-Lorenzo, R. T., Elliott, E., Bloomer, W. A., Li, S., Brautigan, D. L., Colbran, R. J., and Shenolikar, S. GFQQ18400016), Heilongjiang Postdoctoral Sustentation (2002) Targeting protein phosphatase 1 (PP1) to the actin Foundation (No. AUGA41100158) and National Natural Science cytoskeleton: the neurabin I/PP1 complex regulates cell Foundation of China (No. 30971645). morphology. Mol. Cell. Biol. 22, 4690–4701. Ono, R., Shiura, H., Aburatani, H., Kohda, T., Kaneko-Ishino, T., REFERENCES and Ishino, F. (2003) Identification of a large novel imprinted gene cluster on mouse proximal chromosome 6. Bischoff, S. R., Tsai, S., Hardison, N., Motsinger-Reif, A. A., Genome Res. 13, 1696–1705. Freking, B. A., Nonneman, D., Rohrer, G., and Piedrahita, Relaix, F., Wei, X., Li, W., Pan, J., Lin, Y., Bowtell, D. D., J. A. (2009) Characterization of conserved and nonconserved Sassoon, D. A., and Wu, X. (2000) Pw1/Peg3 is a potential imprinted genes in swine. Biol. Reprod. 81, 906–920. cell death mediator and cooperates with Siah1a in p53- Cheng, H. C., Zhang, F. W., Deng, C. Y., Jiang, C. D., Xiong, Y. mediated apoptosis. Proc. Natl. Acad. Sci. USA 97, 2105– Z., Li, F. E., and Lei, M. G. (2007) NNAT and DIRAS3 genes 2110. are paternally expressed in pigs. Genet. Sel. Evol. 39, 599– Ruckert, C., and Bennewitz, J. (2010) Joint QTL analysis of 607. three connected F2-crosses in pigs. Genet. Sel. Evol. 42, Cheng, H. C., Zhang, F. W., Jiang, C. D., Li, F. E., Xiong, Y. Z., 40. and Deng, C. Y. (2008) Isolation and imprinting analysis of Sato, S., Atsuji, K., Saito, N., Okitsu, M., Sato, S., Komatsuda, the porcine DLX5 gene and its association with carcass A., Mitsuhashi, T., Nirasawa, K., Hayashi, T., Sugimoto, Y., traits. Anim. Genet. 39, 395–399. et al. (2006) Identification of quantitative trait loci affecting 52 F.-W. ZHANG et al.

corpora lutea and number of teats in a Meishan x Duroc F2 Wood, A. J., Roberts, R. G., Monk, D., Moore, G. E., Schulz, R., resource population. J. Anim. Sci. 84, 2895–2901. and Oakey, R. J. (2007) A screen for retrotransposed Smith, R. J, Dean, W., Konfortova, G., and Kelsey, G. (2003) imprinted genes reveals an association between X chromo- Identification of novel imprinted genes in a genome-wide some homology and maternal germ-line methylation. PloS screen for maternal methylation. Genome Res. 13, 558–569. Genet. 3, e20. Thurston, A., Taylor, J., Gardner, J., Sinclair, K. D., and Young, Zaitoun, I., and Khatib, H. (2006) Assessment of genomic L. E. (2008) Monoallelic expression of nine imprinted genes imprinting of SLC38A4, NNAT, NAP1L5, and H19 in cattle. in the sheep embryo occurs after the blastocyst stage. BMC Genet. 7, 49. Reproduction 135, 29–40. Zhang, F. W., Cheng, H. C., Jiang, C. D., Deng, C. Y., Xiong, Y. Uemoto, Y., Sato, S., Ohnishi, C., Terai, S., Komatsuda, A., and Z., Li, F. E., and Lei, M. G. (2007) Imprinted status of pleo- Kobayashi, E. (2009) The effects of single and epistatic QTL morphic adenoma gene-like I and paternal expression gene for fatty-acid composition in a Meishan × Duroc crossbred 10 genes in pigs. J. Anim. Sci. 85, 886–890. population. J. Anim. Sci. 87, 3470–3476.