Page 1 of 64 Diabetes
A Novel Model of Diabetic Complications:
Adipocyte Mitochondrial Dysfunction Triggers Massive β-cell Hyperplasia
Christine M. Kusminski1, Alexandra L. Ghaben1, Thomas S. Morley1, Ricardo J. Samms2, Andrew C. Adams2, Yu An1, Joshua A. Johnson1, Nolwenn Joffin1, Toshiharu Onodera1, Clair Crewe1, William L. Holland1, Ruth Gordillo1, and Philipp E. Scherer1,3*
1Touchstone Diabetes Center, Department of Internal Medicine, The University of Texas Southwestern
Medical Center, Dallas, TX 75390, USA
2Eli Lilly Research Laboratories, Division of Eli Lilly and Company, Indianapolis, IN 46285, USA
3Lead Contact
Running title: Induction of adipocyte iron loading in white adipose tissue triggers profound β-cell
hyperplasia
*Correspondence: [email protected]
Telephone: (214) 648-8715
Fax: (214) 648-8720
Diabetes Publish Ahead of Print, published online December 27, 2019 Diabetes Page 2 of 64
ABSTRACT
Obesity-associated type 2 diabetes mellitus (T2DM) entails insulin resistance and loss of -cell mass.
Adipose tissue mitochondrial dysfunction is emerging as a key component in the etiology of T2DM.
Identifying approaches to preserve mitochondrial function, adipose tissue integrity and -cell mass during obesity is a major challenge. Mitochondrial ferritin (FtMT) is a mitochondrial matrix protein that chelates iron. We sought to determine whether perturbation of adipocyte mitochondria influences energy metabolism during obesity. We utilized an adipocyte-specific doxycycline-inducible mouse model of FtMT overexpression (FtMT-Adip mice). During dietary challenge, FtMT-Adip mice are leaner, however exhibit glucose intolerance, low adiponectin levels, increased ROS damage, elevated GDF15 and FGF21 levels; indicating metabolically dysfunctional fat. Paradoxically, despite harboring highly dysfunctional fat, transgenic mice display massive -cell hyperplasia; reflecting a beneficial mitochondria-induced fat-to- pancreas inter-organ signaling axis. This identifies the unique and critical impact that adipocyte mitochondrial dysfunction has on increasing -cell mass during obesity-related insulin resistance.
Word count: 150
- 2 - Page 3 of 64 Diabetes
Obesity-related T2DM is characterized by insulin resistance and -cell dysfunction. Mitochondrial
dysfunction, specifically in white adipose tissue (WAT), is an unappreciated yet significant contributor to
the development of insulin resistance (1). Therefore, identifying mechanisms that maintain adequate
mitochondrial function during metabolic challenge, which are associated with the preservation of healthy
WAT expansion and insulin sensitivity, is a key challenge.
In our previous studies, we utilized the outer mitochondrial membrane protein mitoNEET as a tool
to manipulate mitochondrial iron homeostasis exclusively in adipose tissue. Induction of mitoNEET in
adipocytes compromises mitochondrial function and paradoxically, promotes metabolically healthy WAT
expansion. This aspect generated the heaviest mus musculus ever reported to date (2). As “proof-of-
concept”, we next asked: does induction of any adipose tissue mitochondrial protein involved in iron
homeostasis yield a “massively obese, yet metabolically healthy” mouse? To address this, we explored the
properties of another key mitochondrial protein, mitochondrial ferritin (FtMT).
Unlike mitoNEET, which resides in the outer mitochondrial membrane, FtMT is located in the
mitochondrial matrix. FtMT displays ferroxidase activity by chelating and storing surplus redox-active iron
within the mitochondrial matrix (3). FtMT also contributes to the regulation of oxidative stress (4). In vitro
studies highlight that by storing iron, FtMT prevents ROS generation through the Fenton reaction (3, 5).
Here, our aim was not to characterize the endogenous function of FtMT per se, rather, we take advantage of
its unique properties, which entail its’ ability to shuttle and sequester iron in the mitochondrial matrix, i.e.
we utilize FtMT as an “in vivo tool” to create an environment of adipocyte mitochondrial dysfunction. This
allows us to examine the local and system-wide mechanisms by which a dysregulation in adipocyte
mitochondrial function alters adipose tissue expansion, specifically during the progression of DIO and
insulin resistance. We hypothesize that (i) adipocyte-specific induction of FtMT impacts mitochondrial
function in a similar manner to mitoNEET, such that the adipocyte unleashes positive compensatory
- 3 - Diabetes Page 4 of 64 mechanisms that produce an “obese yet metabolically favorable” mouse. (ii) A FtMT-driven alteration in adipocyte mitochondrial function preserves whole-body insulin sensitivity during DIO.
- 4 - Page 5 of 64 Diabetes
MATERIALS AND METHODS
Mice
All animal experimental protocols were approved by the Institutional Animal Care and Use Committee of
University of Texas Southwestern Medical Center at Dallas. We generated a doxycycline (Dox)-inducible
mouse model of FtMT overexpression (TRE-FtMT mouse). Transgene-positive TRE-FtMT offspring were
genotyped using PCR with the primer set: 5’-GACAAGCACACGCTTGGAAG and 5’-
ATGAGGGTCCATGGTGATAC. Adiponectin-rtTA mice were generated, as previously described (6).
Adiponectin-rtTA offspring were genotyped using PCR with the primer set: 5’-
AGTCATTCCGCTGTGCTCTC and 5’-GCTCCTGTTCCTCCAATACG. All experiments were conducted
using littermate-controlled male mice. Mice were fed a standard chow-diet (#5058, LabDiet, St. Louis,
MO), a Dox-chow diet (600 mg/kg Dox; BioServ, Frenchtown, NJ) or a Dox-HFD (600 or 10 mg/kg Dox;
BioServ). All experiments were initiated at approximately 6-12 weeks of age.
Systemic Tests and Treatments
For OGTTs, mice were fasted for 3-h prior to the administration of glucose (2.5 g/kg body-weight by
gastric gavage). At the indicated time-points, venous blood samples were collected in heparin-coated
capillary tubes from the tail-vein. Glucose levels were measured using an oxidase-peroxidase assay
(Sigma-Aldrich). For TG clearance, mice were fasted (~14-16 h), then gavaged 20% Intra-lipid (15 ul/g
body-weight; Fresenius Kabi Clyton, L.P., Clayton, NC). Insulin and adiponectin levels were measured
using commercially available ELISA kits (Millipore Linco Research, St. Charles, MO). GDF15 was
measured using an ELISA kit (R&D Systems, MN, USA). Cytoplasmic and mitochondrial total iron levels
were measured using a commercially available kit (BioAssay Systems).
- 5 - Diabetes Page 6 of 64
Immunoblotting
Frozen tissues were processed, blotting and imaged as previously described (2). An anti-rabbit polyclonal antibody for FtMT was utilized (1:1000, Uscn Life Sciences). A monoclonal MitoProfile Total OXPHOS
Rodent Antibody Cocktail was utilized (1:1000; MitoSciences, Cambridge, MA). A monoclonal prohibitin antibody was also used (1:1000, Abcam, Cambridge, MA). Bound F2-isoprostane levels (ROS damage by lipid peroxidation) and hepatic TG content were measured as previously detailed (2).
Quantitative Real-Time qPCR and Illumina Microarray
Total RNA was isolated and cDNA was prepared from frozen tissues as previously described (2).
Supplementary Table 6 details the primer sequences that were utilized for quantitative RT-PCR. Results were calculated using the threshold cycle method (7), with -actin utilized for normalization. For Illumina microarray, total cDNA was synthesized from sWAT and spotted onto a mouse Illumina BeadArray platform
(Illumina, Inc.). Fold-changes and significance were calculated based on three independent replicates. For statistical analyses, for comparison between two independent groups, a Student’s t-test was utilized.
Significance was accepted at a P value of <0.05. All qPCR primer sequences are provided in Supplementary
Table 6.
Histology and Immunohistochemical (IHC) and Immunofluorescence (IF) Staining
The relevant fat-pads (sWAT, gWAT and BAT), liver and pancreas tissues were excised and fixed in 10%
PBS-buffered formalin for 24-h. Following paraffin embedding and sectioning (5 m), tissues were stained with H&E or a Masson’s Trichrome stain. For IHC, paraffin-embedded sections were stained using monoclonal anti-Mac2 antibodies (1:1000) (#CL8942AP, CEDARLANE Laboratories USA Inc.). For IF, paraffin-embedded sections were stained using monoclonal anti-perilipin antibodies (1:250; Fitzgerald), polyclonal anti-4-hydroxy-2-noneal (4-HNE) antibodies (1:200, Alpha Diagnostic International), a guinea
- 6 - Page 7 of 64 Diabetes
pig anti-swine insulin antibody (1:500; Dako, Carpinteria, CA), or a rabbit anti-glucagon antibody (1:250;
Zymed, Grand Island, NY).
Hyperinsulinemic-Euglycemic Clamps and Hyperglycemic Clamps
Hyperinsulinemic-euglycemic clamps and hyperglycemic clamps were performed, as previously described
(2, 8).
LPA, Phosphatidic Acid, Ceramides and Sphingolipid Measurements
LPA, phosphatidic acid, ceramides and sphingolipids were quantified by liquid chromatography-
electrospray ionisation-tandem mass spectrometry, using a Nexera UHPLC coupled to an LCMS-8050
(Shimadzu Scientific Instruments, Columbia, MD, USA), as previously described (9). Data were processed
using the LabSolutions V 5.82 and LabSolutions Insight V 2.0 program packages (Shimadzu Scientific
Instruments).
Statistical Analyses
All results are provided as means standard errors of the mean. All statistical analysis was performed using
GraphPad Prism (San Diego, CA). Differences between the two groups over time (as indicated in the
relevant figure legends) were determined by a two-way analysis of variance (ANOVA) for repeated
measures, followed by a Bonferroni post-test to compare replicate means in each time point. For comparison
between two independent groups, a Student’s t-test was utilized. The box-and-whisker analysis was
performed to exclude any potential outliers accordingly. Significance was accepted at a P value of <0.05.
All statistical information is provided in Supplementary Table 7.
- 7 - Diabetes Page 8 of 64
Data and Resource Availability. The datasets generated during and/or analyzed during the current study are available in the NCBI repository (GEO Accession Number: GSE125900) at https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE125900. The data sets generated and/or analyzed during the current study are available from the corresponding author upon reasonable request.
- 8 - Page 9 of 64 Diabetes
RESULTS
Inducible Overexpression of Mitochondrial Ferritin Specifically in Adipose Tissue
To trigger FtMT-induced mitochondrial dysfunction in WAT, we generated a mouse in which the
expression of FtMT is driven by a tetracycline-inducible promoter element (a tet-responsive element, or
TRE), i.e. a “TRE-FtMT mouse”. For this promoter element to be operational, the ‘Tet-on’ transcription
factor, rtTA is required. We provide this factor in a fat-specific manner through a mouse that harbors rtTA
under the control of the adiponectin promoter (6). Upon crossing TRE-FtMT mice with adiponectin-rtTA
mice (FtMT-Adip mice) and with the administration of doxycycline (Dox), we achieve induction of FtMT
specifically within adipose tissue (Fig. 1A). Our in vivo system of inducible FtMT is highly specific and
titratable. Following 1-week of Dox-chow (600 mg/kg Dox) feeding, FtMT mRNA (Fig. 1B) and protein
(Fig. 1C) are markedly increased in transgenic subcutaneous WAT (sWAT). Consistent with FtMT
localization to the mitochondrial matrix (10), FtMT protein levels are markedly enhanced in mitochondria
isolated from transgenic fat (Fig. 1D). Given its iron-sequestering properties (10), FtMT increases total iron
levels in adipose mitochondria, with no differences apparent in cytoplasmic total iron (Fig. 1E).
On Dox-chow, FtMT-Adip mice gain significantly less body-weight (data not shown) and display
a significant reduction in circulating and intracellular levels of adiponectin (Fig. 1F). As adiponectin is
tightly associated with enhanced insulin sensitivity (11, 12), this suggests a metabolically unfavorable
phenotype in FtMT-Adip mice. Indeed, transgenic adipose mitochondria have less dense cristae (Fig. 1G),
significantly lower oxygen-consumption rates (Fig. 1H) and exhibit reduced expression of ETC complexes
(Fig. 1I). Combined, this points to mitochondrial dysfunction in transgenic fat.
FtMT-Adip Mice are Resistant to DIO, however are Glucose-intolerant and have Reduced
Adiponectin with Local Oxidative Stress
FtMT-Adip mice exhibit a large reduction in body-weight (~20 g) during Dox high-fat diet (Dox-HFD)
feeding (Fig. 2A), which reflected by a significant decrease in circulating leptin levels (Fig. 2B) and - 9 - Diabetes Page 10 of 64 reduced fat-pad mass (Fig. 2C). Despite being leaner, transgenic mice display glucose intolerance, even after 1-week of Dox-HFD (Fig. 2D), which persists over several weeks (Fig. 2D and Supplementary Fig.
1A). FtMT-Adip mice also exhibit significantly higher levels of glucose and insulin during ad libitum feeding (Supplementary Table 1). Given that body-weights do not diverge between genotypes following 3- weeks of Dox-HFD (yet we observe glucose intolerance), we chose this 3-week time-point for subsequent experiments.
Hyperinsulinemic-euglycemic clamps show transgenic mice have enhanced basal glucose and insulin production and, require a significantly lower glucose infusion rate than wild-type (WT) littermates
(Fig. 2E) (reflecting impaired whole-body insulin sensitivity). Hepatic insulin sensitivity is worsened in transgenic mice (as shown by significantly higher hepatic glucose output) (Fig. 2E). Transgenic sWAT, gonadal WAT (gWAT) and liver display impaired insulin signaling (reduced insulin-stimulated phosphorylated-Akt levels) (Fig. 2F). Consistent with glucose intolerance, 2-deoxyglucose-uptake experiments reveal significantly reduced whole-body glucose disposal rates, with reduced glucose-uptake in transgenic sWAT, soleus- and gastrocnemius-muscle and heart (Fig. 2G).
Metabolic cage studies (performed prior to body-weights diverging, as no difference in body-fat was evident) (Supplementary Fig. 1B) showed that transgenic mice have increased lean body mass (Fig.
2H), however no marked differences in oxygen-consumption rates (Supplementary Fig. 1B) or food-intake
(data not shown). Interestingly, FtMT-Adip mice exhibit a moderate increase in total heat consumption
(Fig. 2H), suggesting their surplus calories are excreted and lost, possibly due a malabsorption defect. This is paralleled with moderate increases in certain sphingolipid and ceramide species (Supplementary Fig.
1C), suggesting some contribution of toxic lipid species to this phenotype. Transgenic mice have a significantly lower respiratory exchange ratio (Fig. 2H), indicating a preferential fuel utilization towards free fatty acids (FFAs) as a primary energy source. Consistent with this, transgenic mice have significantly improved triglyceride (TG) clearance rates (Fig. 2I). Lipoprotein lipase (LPL) is a rate-limiting enzyme that hydrolyzes TGs in circulating lipoproteins. Increased adipose LPL levels are typically associated with - 10 - Page 11 of 64 Diabetes
enhanced TG uptake (13). During fasting, induction of angiopoietin-3 (ANGPTL-3) and ANGPTL-4 inhibit
LPL activity in WAT (14). The significant downregulation of Angptl-3 and Angptl-4 expression in
transgenic sWAT (Fig. 2J) reaffirms their enhanced TG clearance rate. However, 3H-triolein tracer
experiments reveal no marked differences in tissue mass, lipid-uptake or lipid-oxidation in sWAT, gWAT
or liver (Supplementary Fig. 1D). This suggests that these tissues are not primarily responsible for
enhanced lipid-uptake in the transgenic mice at that given time-point.
Elevated adiponectin levels correlate with improved insulin sensitivity (11, 15). FtMT-Adip mice
have significantly lower circulating levels of adiponectin in the fed and fasted state (24-h), with minimal
levels expressed in WAT (Fig. 2K). Acute induction of FtMT in adipose during Dox-HFD feeding further
shows the significant gradual decline in circulating adiponectin levels (Fig. 2L). Fat-specific adiponectin
overexpressing mice are highly sensitive to β3-adrenergic receptor (AR) agonist treatment (16). Consistent
with this, transgenic mice are less sensitive to adrenergic stimuli (as evident by low FFA and glycerol
levels following β3-AR-agonist treatment) (Fig. 2M). FtMT-Adip mice also exhibit extremely low
circulating levels of glycerol (Supplementary Table 1). Glycerol clearance tests reveal that transgenic mice
clear exogenous glycerol from circulation at a significantly higher rate than WT littermates (Fig. 2N);
suggesting an additional preferential utilization of glycerol as an energy source.
Morphologically, transgenic mice have dysfunctional sWAT and gWAT, with enhanced
infiltration of adipose tissue macrophages (inflammation) and fibrosis (Fig. 2O and Supplementary Fig.
2A). While transgenic mice have reduced fat-pad mass (Fig. 2C), this is not due to adipose tissue apoptosis,
as perilipin immunofluorescence (IF) shows whole adipocyte staining in sWAT and BAT (Supplementary
Fig. 2B). Strikingly, FtMT-Adip mice have a massive 21-fold increase in ROS damage (lipid peroxidation
adducts) in sWAT (Fig. 2P), which is confirmed by 4-hydroxynonenal IF staining (lipid peroxide levels)
(Fig. 2Q). Combined, induction of FtMT in fat (as a unique tool to elicit mitochondrial dysfunction via
disruption of mitochondrial iron homeostasis), yields a profoundly metabolically unhealthy phenotype.
- 11 - Diabetes Page 12 of 64
FtMT Induction in Fat Exacerbates the Metabolically Unhealthy Phenotype of the ob/ob mouse,
Despite Lowering Body-Weight During DIO
Given transgenic mice are protected from DIO (Fig. 2A), we crossed FtMT-Adip mice into a leptin- deficient diabetic ob/ob background to provide a prolonged metabolic challenge. During Dox-chow, no differences in body-weight or glucose tolerance were apparent between FtMT-Adip-ob/ob mice and their non-transgenic ob/ob counterparts (Supplementary Fig. 3A and 3B). Furthermore, no systemic phenotype was evident during feeding or fasting (Supplementary Table 2). Histologically, FtMT-Adip-ob/ob mice still exhibit dysfunctional fat (Supplementary Fig. 3C) and more pronounced hepatic steatosis, with increased hepatic TG content (Supplementary Fig. 3D and 3E). Combined, this suggests a lack in systemic phenotype in transgenic-ob/ob under baseline conditions, however a worsened fat and liver phenotype.
We subsequently added an extra metabolically challenge using Dox-HFD feeding. Interestingly, with the added dietary lipid component, a systemic phenotype was now apparent in FtMT-Adip-ob/ob mice, as they gained less body-weight than their ob/ob littermates (Fig. 3A). Transgenic-ob/ob mice also exhibit profound glucose intolerance, with extremely hyperglycemic baseline glucose values of ~400 mg/dL (Fig. 3B) during feeding and fasting (Supplementary Table 3). This was concomitant with impaired insulin secretion (Fig. 3B) and lower circulating levels of adiponectin (Supplementary Table 3). Finally,
FtMT-Adip-ob/ob mice harbor highly dysfunctional, fibrotic and inflamed fat (Fig. 3C) with chronic hepatic steatosis (Fig. 3D). Taken together, fat-specific induction of FtMT worsens the already metabolically unhealthy phenotype of the ob/ob mouse; however, the added component of dietary lipid is required for this detrimental phenotype to fully unravel.
Enhancing the Antioxidant System Does Not Rescue the Detrimental Phenotype of Transgenic Mice
To examine whether high ROS damage in transgenic fat drives their detrimental systemic phenotype, we utilized in vivo antioxidant approach. We crossed FtMT-Adip mice with mice that overexpress catalase targeted to mitochondria, to achieve fat-specific induction of FtMT simultaneously with a constitutive - 12 - Page 13 of 64 Diabetes
overexpression of the antioxidant enzyme mitochondrial catalase (mCAT). Following Dox-HFD,
constitutive overexpression of mCAT failed to improve glucose tolerance in FtMT-Adip mice (data not
shown) or prevent the reduction in adiponectin levels (Fig. 4A). This suggests that mCAT, as an in vivo
approach to alleviate an ROS-driven impairment in glucose tolerance, is not sufficient to rescue the
detrimental metabolic phenotype of FtMT-Adip mice.
While chronic ROS generation contributes to insulin resistance, recent in vivo studies show that
mild ROS production paradoxically enhances insulin signaling and sensitivity (17). We next took
advantage of the titratable nature of our system by utilizing FtMT as a tool to acutely induce ROS in fat and
address whether mild ROS preserves insulin sensitivity during DIO. Given that mild ROS levels are
associated with enhanced insulin sensitivity (17), and here, transgenic mice have increased basal insulin
levels (Fig. 2E), we assessed insulin as an indirect indicator of ROS induction in fat. Figure 4B shows that
transgenic mice maintain normo-insulinemia for up to 12-h of Dox-HFD feeding, whereas WT mice
significantly elevate their insulin levels in response to the acute dietary challenge. Surprisingly, at the 12-h
time-point of Dox-HFD, FtMT-Adip mice displayed improved glucose tolerance and enhanced glucose-
stimulated insulin secretion (Fig. 4C). This suggests that mild ROS signaling may exert a beneficial role.
Interestingly, ROS damage (as measured by mitochondrial hydrogen peroxide levels (Fig. 4D) and lipid
peroxide adducts (Supplementary Fig. 4A)) is significantly reduced in transgenic sWAT following 12-h of
Dox-HFD, indicating that transgenic mice may unleash a highly protective antioxidant response to acute
dietary challenge. Consistent with this, antioxidant enzymes that detoxify ROS are significantly increased
in transgenic sWAT; namely, superoxide dismutases, glutathione peroxidases and glutathione-S-
transferases (Fig. 4E). Collectively, an efficient and protective antioxidant system is activated in transgenic
fat, but only in an acute setting of dietary challenge, which is overridden in a chronic setting.
- 13 - Diabetes Page 14 of 64
An Inter-Organ Crosstalk Signaling Axis Originating from Transgenic Fat Targets the Pancreas and
Heart to Elicit Massive β-cell Proliferation and Cardiac ROS Damage
The induction of FtMT in fat produces a major impact on the whole-body signaling communication axis, which signals from fat to the pancreas, liver and heart. With chronic Dox-HFD feeding, FtMT-Adip mice exhibit massive pancreatic β-cell hyperplasia (Fig. 5A) (more so than most genetic mouse models).
Hyperglycemic clamps show highly significant glucose-stimulated hypersecretion of insulin from transgenic β-cells (Fig. 5B). Transgenic livers are also severely affected. FtMT-Adip mice exhibit increased liver mass (Fig. 5C), elevated hepatic TG content (Fig. 5D) and larger hepatic lipid droplets (Fig. 5E); collectively suggesting hepatic steatosis. Paradoxically, despite hepatic steatosis, FtMT-Adip mice exhibit lower ROS damage in the liver (Fig. 5F), and conversely, higher ROS damage in the heart (Fig. 5G).
Cardiac tissue in fat-specific FtMT-Adip mice is highly susceptible to oxidative damage, even though
FtMT is induced exclusively in adipose, with no overexpression evident in the heart (Fig. 1B).
FtMT-Adip mice also exhibit significantly reduced brown adipose tissue (BAT) mass (Fig. 5H), which is fibrotic and contains enlarged lipid-laden disarrayed adipocytes (Fig. 5I). Transgenic BAT also has a marked reduction in classical BAT markers (Fig. 5J), suggesting a “whitened” depot. Indeed, 3H- triolein tracer experiments show significantly impaired lipid-uptake and lipid-oxidation in transgenic BAT
(Fig. 5K); indicating that BAT whitening elicits negative metabolic consequences upon lipid homeostasis.
FtMT-Adip Fat Harbors High Ceramide and Lysophosphatidic Acid Levels, with Large Increases in
GDF15 and FGF21
We performed transcriptional analyses to gain more mechanistic insight as to how FtMT causes such a profound metabolically unhealthy phenotype. Supplementary Table 4 shows the top significantly upregulated genes in transgenic sWAT. Real-time qPCR confirmation shows significant increases in growth differentiation factor 15 (Gdf15) (88-fold) in sWAT and BAT (Fig. 6A and Supplementary Fig. 5A),
Fgf21 (18-fold), Trib3 (15-fold), Atf3 (10-fold) and S1pl (3-fold) (Fig. 6A). GDF15 is a recently identified - 14 - Page 15 of 64 Diabetes
biomarker for insulin resistance and obesity (18-20). Administration of recombinant or transgenic
overexpression of GDF15 reduces DIO and enhances insulin sensitivity (21-23). Here, transgenic mice
exhibit significant increases in adipose Gdf15 mRNA (Fig. 6A) and circulating levels of GDF15 protein
(Fig. 6B). Consistent with rodent studies of GDF15 induction, FtMT-Adip mice also gain less body-weight
during DIO (Fig. 2A).
Fibroblast growth factor 21 (FGF21) is a hormone that enhances insulin sensitivity (24). While
FGF21 elicits positive metabolic effects, certain intracellular mitochondrial disturbances also increase the
protein, and as such, FGF21 also serves as a “stress-response hormone” (25). For instance, mitochondrial
diseases that inhibit oxidative phosphorylation display enhanced FGF21 levels (26). Despite having a
metabolically unfavorable phenotype, FtMT-Adip mice have significantly upregulated Fgf21 levels in fat
(Fig. 6A) and increased FGF21 protein in circulation (Fig. 6C). Given the degree of mitochondrial
dysfunction in transgenic fat (Fig. 1G-I), it is likely that FGF21 is a serological maker of a FtMT-induced
mitochondrial stress response.
The transcription factor Yin Yang 1 (YY1) suppresses certain proteins that activate thermogenic
and uncoupling transcriptional programs: namely Fgf21, Gdf15 and Angptl6 (27). WAT- and BAT-specific
YY1-null mice are protected from DIO and exhibit reduced fat-pad mass (27). Here, FtMT-Adip mice
harbor a significant downregulation in adipose Yy1 levels (Fig. 6D). Given transgenic mice have increased
GDF15 (Fig. 6B), FGF21 (Fig. 6C) and Angptl-6 in fat (Supplementary Fig. 5B), this coincides with the
downregulation in YY1. To examine this connection, we crossed FtMT-Adip mice with TRE-YY1 mice to
overexpress both FtMT and YY1 in fat. We hypothesized that the restoration of YY1 in transgenic mice
could normalize GDF15 and adiponectin levels to preserve insulin sensitivity. However, simultaneous
induction of YY1 and FtMT in fat did not prevent the drop in adiponectin, the increase in GDF15 (Fig. 6E),
or preserve glucose tolerance (data not shown). While Verdeguer and colleagues showed YY1 to suppress
Gdf15 levels in BAT (27), conversely, we demonstrate that fat-specific YY1 induction increases GDF15
(Fig. 6E). - 15 - Diabetes Page 16 of 64
We next hypothesized that the increase in GDF15 and FGF21 in transgenic mice (mitochondrial stress markers) triggers their metabolically unfavorable phenotype. We crossed FtMT-Adip mice with global constitutive GDF15 knockout mice (GDF15-KO mice), or fat-specific FGF21-KO mice (the latter confirmed to exhibit significantly reduced circulating levels of FGF21 (Supplementary Fig. 5C)). We used circulating adiponectin and GDF15 as positive and negative readouts, respectively (as indicators for overall metabolic health). Following DIO, the unhealthy phenotype of transgenic mice was not reversed by elimination of GDF15 or FGF21; as adiponectin levels were still reduced and GDF15 levels still increased in GDF15-KO mice (Fig. 6F) and FGF21-KO mice (Fig. 6G) (each crossed with FtMT-Adip mice). Of note, while constitutive expression of mCAT in FtMT-Adip mice did not prevent the decline in adiponectin
(Fig. 4B), mCAT also failed to counteract the rise in GDF15 (Fig. 6H). Combined, the detrimental phenotype of FtMT-Adip mice is independent of GDF15, FGF21 or mCAT.
Supplementary Table 5 shows the top downregulated genes in transgenic sWAT. qPCR confirmed significantly decreases in Grp120 (4-fold), Insig1 (4-fold), Rbp4 (12-fold), SucnR1 (8-fold), Lrg1 (10-fold),
Nnat (15-fold) and Fsd2 (7-fold) (Supplementary Fig. 5D). G-protein-coupled receptors play an important role in glucose and lipid homeostasis. GPR120 exerts anti-diabetic and anti-inflammatory actions that improve insulin sensitivity in obese (28) and diabetic rodents (29). Here, FtMT-Adip mice have significantly lower Gpr120 levels (Supplementary Fig. 5D). Given the known insulin-sensitization actions of GPR120, this is consistent with transgenic mice displaying severe insulin resistance (Fig. 2E).
Lysophosphatidic acid (LPA) is a bioactive signaling lipid. Transgenic mice have significantly increased levels of several LPA species exclusively in fat (Fig. 6I) (with no differences evident in liver or heart (Supplementary Fig. 5E), or in circulation (Supplementary Fig. 5F)). Phosphatidic acid (generated from LPA by the enzyme AGPAT2 (30)), is also significantly increased in transgenic fat (Fig. 6J).
Consistent with an unhealthy phenotype, several sphingolipid and ceramide species are elevated in transgenic fat (Fig. 6K). Specifically, lactosyl- and hexosyl-ceramide levels are massively increased, more so than ever reported to date (6-to-37-fold, respectively) (Fig. 6K). - 16 - Page 17 of 64 Diabetes
DISCUSSION
Here, we take advantage of the unique properties of FtMT as an “in vivo tool” to elicit adipocyte
mitochondrial dysfunction. This allows us to examine how a dysregulation in adipocyte mitochondrial
homeostasis influences WAT expansion during obesity. While we hypothesized that general adipocyte
mitochondrial dysfunction (caused by a fat-specific induction of FtMT), would elicit a positive “obese yet
metabolically favorable” phenotype, we in fact observed the opposite: a “lean yet metabolically unhealthy”
phenotype. The distinct phenotypic outcome is likely explained by the different mitochondrial perturbations
that FtMT and mitoNEET trigger in the adipocyte. This is based on their differential effect on
mitochondrial iron homeostasis. FtMT induction in the mitochondrial matrix increases mitochondrial iron,
while mitoNEET overexpression, in outer mitochondrial membrane reduces mitochondrial iron. It is rather
remarkable that such highly specific mitochondrial insults can trigger either a metabolically positive
(mitoNEET) or negative (FtMT) compensatory mechanism.
Despite our unexpected outcome, fat-specific induction of FtMT in its own right, generated a
unique and extreme phenotype. Adipocyte mitochondrial impairment generated dysfunctional fat, with
increases local and circulating levels of two established beneficial factors, GDF15 and FGF21. Albeit here,
they likely serve as mitochondrial stress markers. Our new model system also identifies how metabolically
unhealthy fat expansion has both negative and positive effects on target tissues, by signaling through a
whole-body inter-organ communication axis. Adipocyte mitochondrial dysfunction, while causing a local
negative milieu, paradoxically triggers massive pancreatic β-cell proliferation and protects the liver from
oxidative damage (the latter likely due to enhanced mitochondrial uncoupling). Conversely, this
dysfunctional fat promotes ROS damage in the heart. The FtMT-induced β-cell hyperplasia is extreme;
much more pronounced than typically seen in other mouse models of insulin resistance (31, 32). This raises
interesting questions as to how the pancreas responds in such a positive manner to compensate for severely
dysfunctional fat.
- 17 - Diabetes Page 18 of 64
Locally, FtMT-induced adipocyte mitochondrial impairment yields all the classical hallmarks of highly dysfunctional fat (33). Following DIO, transgenic fat becomes inflamed and fibrotic, exhibits reduced insulin sensitivity, mitochondrial dysfunction, enhanced ROS damage, high levels of LPA, and increased levels of toxic lipid species (ceramides, lactosyl-ceramides and hexosyl-ceramides); with the latter further promoting insulin resistance (34). LPA is a bioactive lipid and a key extracellular signaling molecule. Administration of LPA to obese glucose-intolerant mice diminishes insulin secretion to further promote hyperglycemia (35). LPA treatment generates ROS through NADPH oxidase 4 (36), PKC (37),
MAPK (38) and epidermal growth factor receptor-mediated mechanisms (39). And vice versa, ROS is a second messenger for LPA-mediated signaling (40). Here, transgenic mice exhibit large increases in several
LPA species exclusively in fat, suggesting that these signaling lipids contribute to their metabolically unfavorable phenotype.
GDF15 is a recently discovered biomarker for insulin resistance, obesity and CVD (20). In humans, increased circulating levels of GDF15 correlate with weight loss (41). In rodents, administration of recombinant GDF15 or transgenic overexpression reduces body-weight and fat-mass, to enhance insulin sensitivity (21, 22). While GDF15 is associated with a positive metabolic milieu, the protein is also secreted as a mitochondrial stress-responsive cytokine following mitochondrial dysfunction (42). Here, transcriptional analyses reveals GDF15 and the metabolic hormone FGF21, as two of the top most upregulated genes in transgenic fat. This also translates systemically, with increased levels of both in circulation. This also suggests that fat-derived FGF21 leads to an upregulation of circulating FGF21 levels; a notion unrecognized to date. FGF21 is also a factor that promotes weight loss and insulin sensitivity (24).
Similar to GDF15, intracellular disturbances enhance FGF21 levels. Here, mitochondria-induced fat dysfunction produces a metabolically unfavorable phenotype in mice, which exhibit increased levels of
FGF21 and GDF15, which act as serological makers of a mitochondrial stress response.
Adipose tissue health and insulin responsiveness are critical for the metabolic flexibility of other organs. Here, transgenic mice exhibit highly dysfunctional fat that triggers system-wide insulin resistance, - 18 - Page 19 of 64 Diabetes
which has detrimental effects on the heart and BAT. Paradoxically, beneficial effects are apparent for the
pancreas and liver; the latter in context of reduced oxidative damage, which could be a result of enhanced
mitochondrial uncoupling. The pancreas harbors one of the most striking phenotypes in the FtMT-Adip
mouse: massive β-cell hyperproliferation. This β-cell hyperplasia is much more pronounced than typically
observed for other mouse models of insulin resistance (31, 32). Accompanying this, transgenic mice exhibit
massive insulin secretion during a hyperglycemic clamp, suggesting a profound compensatory response
from the β-cell, rather than insufficient production of insulin or defective insulin secretion. Combined, this
points to a fat-to-pancreas signaling axis that initiates massive expansion of β-cell mass. One hypothesis of
how this may occur is through the adipokine adipsin, which signals from the adipocyte to the pancreas to
positively impact β-cell function (43). However, as transgenic fat displays a reduction in adipsin expression
(data not shown), it is unlikely that adipsin is the primary mediator here. Alternatively, the high degree of
ROS damage in transgenic fat, may modify lipid intermediates or proteins that are released in exosomal
vesicles. These vesicles (containing ROS-modified material) could potentially travel in circulation from the
fat to the pancreas.
T2DM is associated with reduced β-cell mass and function, resulting in inadequate insulin
production. Conversely, in diet-induced (32, 44) and genetic mouse models (45) of non-diabetic obesity,
particularly in the C57BL/6 ob/ob mouse, an expansion of β-cell mass (partly due to β-cell proliferation),
occurs prior to insulin resistance (44). Human autopsy studies show that non-diabetic obese individuals
have a 50% greater β-cell mass, when compared with lean individuals (46). As such, the ability to expand
functional β-cell mass in response to insulin resistance is crucial in the prevention of diabetes. Here, the
induction of mitochondrial dysfunction in fat produces a lean insulin-resistant mouse that exhibits massive
β-cell hyperplasia. Given that β-cell expansion typically occurs as a compensatory response to non-diabetic
obesity (47), this suggests the FtMT-Adip mouse is a unique model that promotes β-cell proliferation in a
lean setting.
- 19 - Diabetes Page 20 of 64
When excessively produced, ROS disrupts cellular signaling and inflicts damage to DNA, lipids and proteins. The heart is extremely susceptible to oxidative damage, either from intra-organ ROS or circulating ROS-inducing factors (48); as such, oxidative stress contributes to the development of CVD
(48). Here, fat-specific FtMT-Adip mice exhibit a ROS damage in the heart, despite FtMT only being induced exclusively in fat, with no overexpression in the heart. This suggests that an external source of
ROS (likely originating from dysfunctional fat), has detrimental effects on the heart, and is thus responsible for the oxidative stress inflicted on cardiac tissue.
In conclusion, Figure 7 highlights the proposed mechanism by which mitochondrial dysfunction in the adipocyte, in this particular case, alters local WAT function to elicit unique system-wide negative and positive effects on other organs. Specifically, FtMT induction in the adipocyte promotes local ROS damage, with increase in LPA and ceramide production. This activates a mitochondrial stress response from the adipocyte, which increases GDF15 and FGF21. Such local effects exert a profound impact globally, as fat-specific FtMT-Adip mice harbor a lean phenotype, yet are metabolically unhealthy. While the heart exhibits the negative effects of oxidative damage, the pancreas responds in a positive manner through massive β-cell proliferation.
- 20 - Page 21 of 64 Diabetes
Acknowledgments. We kindly thank J. Song and S. Connell for technical assistance, in addition to the rest
of the Scherer laboratory for helpful discussions. We would also like to thank R. Hammer and the UTSW
Transgenic Core Facility for the generation of mouse models, as well as the UTSW Metabolic Core
Facility. We also thank L. Jackson of the Iron and Heme Core Facility at the University of Utah for
additional confirmatory iron and heme measurements. G. Milne and S. Sanchez for F2-isoprostane
measurements. Floxed FGF21-KO mice were kindly provided by the D. Mangelsdorf and S. Kliewer lab.
mCAT mice were kindly provided by Dr. Peter Rabinovitch.
Funding. The authors were supported by US National Institutes of Health grants R01-DK55758, R01-
DK099110 and P01DK088761 (to P.E.S).
Author Contributions. C.M.K. conducted all experiments and wrote the manuscript, except the portions
indicated below. A.G. and T.S.M. performed and analyzed the triolein experiments. R.J.S. and A.C.A
performed the FGF21 measurements. Y.A. and J.J. assisted in the ROS measurements. N.J. and C.C.
assisted in mouse experiments. W.L.H. and J.J. performed the 2-DG and clamp experiments. R.G.
performed the ceramide and sphingolipid experiments. P.E.S. was involved in experimental design,
experiments, data analysis, and interpretation, in addition to writing of the manuscript. All authors approved
the final version of the manuscript. P.E.S. is the guarantors of this work and, as such, had full access to all
the data in the study and take responsibility for the integrity of the data and the accuracy of the data
analysis.
Conflict of Interest. R.J.S. and A.C.A are affiliated with Eli Lilly Research Laboratories. This does not
alter the authors’ adherence to Diabetes policies on sharing data and materials. There are no conflicts of
interest relevant to this article.
- 21 - Diabetes Page 22 of 64
References
1. Kusminski CM and Scherer PE, Mitochondrial dysfunction in white adipose tissue. Trends Endocrinol Metab 2012;23:435-43 2. Kusminski CM, Holland WL, Sun K, et al., MitoNEET-driven alterations in adipocyte mitochondrial activity reveal a crucial adaptive process that preserves insulin sensitivity in obesity. Nat Med 2012;18:1539-49 3. Corsi B, Cozzi A, Arosio P, et al., Human mitochondrial ferritin expressed in HeLa cells incorporates iron and affects cellular iron metabolism. J Biol Chem 2002;277:22430-7 4. Wu WS, Zhao YS, Shi ZH, et al., Mitochondrial ferritin attenuates beta-amyloid-induced neurotoxicity: reduction in oxidative damage through the Erk/P38 mitogen-activated protein kinase pathways. Antioxid Redox Signal 2013;18:158-69 5. Drysdale J, Arosio P, Invernizzi R, et al., Mitochondrial ferritin: a new player in iron metabolism. Blood Cells Mol Dis 2002;29:376-83 6. Kusminski CM, Gallardo-Montejano VI, Wang ZV, et al., E4orf1 induction in adipose tissue promotes insulin- independent signaling in the adipocyte. Mol Metab 2015;4:653-64 7. Livak KJ and Schmittgen TD, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25:402-8 8. Chen Z, Holland W, Shelton JM, et al., Mutation of mouse Samd4 causes leanness, myopathy, uncoupled mitochondrial respiration, and dysregulated mTORC1 signaling. Proc Natl Acad Sci U S A 2014;111:7367-72 9. Holland WL, Miller RA, Wang ZV, et al., Receptor-mediated activation of ceramidase activity initiates the pleiotropic actions of adiponectin. Nat Med 2011;17:55-63 10. Levi S and Arosio P, Mitochondrial ferritin. Int J Biochem Cell Biol 2004;36:1887-9 11. Kusminski CM and Scherer PE, The road from discovery to clinic: adiponectin as a biomarker of metabolic status. Clin Pharmacol Ther 2009;86:592-5 12. Ye R and Scherer PE, Adiponectin, driver or passenger on the road to insulin sensitivity? Mol Metab 2013;2:133- 41 13. Kersten S, Physiological regulation of lipoprotein lipase. Biochim Biophys Acta 2014;1841:919-33 14. Zhang R, The ANGPTL3-4-8 model, a molecular mechanism for triglyceride trafficking. Open Biol 2016;6:150272 15. Turer AT and Scherer PE, Adiponectin: mechanistic insights and clinical implications. Diabetologia 2012;55:2319- 26 16. Kim JY, van de Wall E, Laplante M, et al., Obesity-associated improvements in metabolic profile through expansion of adipose tissue. J Clin Invest 2007;117:2621-37 17. Loh K, Deng H, Fukushima A, et al., Reactive oxygen species enhance insulin sensitivity. Cell Metab 2009;10:260- 72 18. Brown DA, Breit SN, Buring J, et al., Concentration in plasma of macrophage inhibitory cytokine-1 and risk of cardiovascular events in women: a nested case-control study. Lancet 2002;359:2159-63 19. Kempf T, Bjorklund E, Olofsson S, et al., Growth-differentiation factor-15 improves risk stratification in ST-segment elevation myocardial infarction. Eur Heart J 2007;28:2858-65 20. Kempf T, Guba-Quint A, Torgerson J, et al., Growth differentiation factor 15 predicts future insulin resistance and impaired glucose control in obese nondiabetic individuals: results from the XENDOS trial. Eur J Endocrinol 2012;167:671-8 21. Johnen H, Lin S, Kuffner T, et al., Tumor-induced anorexia and weight loss are mediated by the TGF-beta superfamily cytokine MIC-1. Nat Med 2007;13:1333-40 22. Macia L, Tsai VW, Nguyen AD, et al., Macrophage inhibitory cytokine 1 (MIC-1/GDF15) decreases food intake, body weight and improves glucose tolerance in mice on normal & obesogenic diets. PLoS One 2012;7:e34868 23. Chrysovergis K, Wang X, Kosak J, et al., NAG-1/GDF-15 prevents obesity by increasing thermogenesis, lipolysis and oxidative metabolism. Int J Obes (Lond) 2014;38:1555-64 24. Owen BM, Mangelsdorf DJ, and Kliewer SA, Tissue-specific actions of the metabolic hormones FGF15/19 and FGF21. Trends Endocrinol Metab 2015;26:22-9 25. Gomez-Samano MA, Grajales-Gomez M, Zuarth-Vazquez JM, et al., Fibroblast growth factor 21 and its novel association with oxidative stress. Redox Biol 2017;11:335-341 26. Suomalainen A, Fibroblast growth factor 21: a novel biomarker for human muscle-manifesting mitochondrial disorders. Expert Opin Med Diagn 2013;7:313-7
- 22 - Page 23 of 64 Diabetes
27. Verdeguer F, Soustek MS, Hatting M, et al., Brown Adipose YY1 Deficiency Activates Expression of Secreted Proteins Linked to Energy Expenditure and Prevents Diet-Induced Obesity. Mol Cell Biol 2015;36:184-96 28. Oh DY, Walenta E, Akiyama TE, et al., A Gpr120-selective agonist improves insulin resistance and chronic inflammation in obese mice. Nat Med 2014;20:942-7 29. Satapati S, Qian Y, Wu MS, et al., GPR120 suppresses adipose tissue lipolysis and synergizes with GPR40 in antidiabetic efficacy. J Lipid Res 2017;58:1561-1578 30. Cortes VA, Curtis DE, Sukumaran S, et al., Molecular mechanisms of hepatic steatosis and insulin resistance in the AGPAT2-deficient mouse model of congenital generalized lipodystrophy. Cell Metab 2009;9:165-76 31. Ogino J, Sakurai K, Yoshiwara K, et al., Insulin resistance and increased pancreatic beta-cell proliferation in mice expressing a mutant insulin receptor (P1195L). J Endocrinol 2006;190:739-47 32. Mosser RE, Maulis MF, Moulle VS, et al., High-fat diet-induced beta-cell proliferation occurs prior to insulin resistance in C57Bl/6J male mice. Am J Physiol Endocrinol Metab 2015;308:E573-82 33. Sun K, Kusminski CM, and Scherer PE, Adipose tissue remodeling and obesity. J Clin Invest 2011;121:2094-101 34. Holland WL, Knotts TA, Chavez JA, et al., Lipid mediators of insulin resistance. Nutr Rev 2007;65:S39-46 35. Rancoule C, Attane C, Gres S, et al., Lysophosphatidic acid impairs glucose homeostasis and inhibits insulin secretion in high-fat diet obese mice. Diabetologia 2013;56:1394-402 36. Kang S, Han J, Song SY, et al., Lysophosphatidic acid increases the proliferation and migration of adiposederived stem cells via the generation of reactive oxygen species. Mol Med Rep 2015;12:5203-10 37. Lin CC, Lin CE, Lin YC, et al., Lysophosphatidic acid induces reactive oxygen species generation by activating protein kinase C in PC-3 human prostate cancer cells. Biochem Biophys Res Commun 2013;440:564-9 38. Chen Q, Olashaw N, and Wu J, Participation of reactive oxygen species in the lysophosphatidic acid-stimulated mitogen-activated protein kinase kinase activation pathway. J Biol Chem 1995;270:28499-502 39. Cunnick JM, Dorsey JF, Standley T, et al., Role of tyrosine kinase activity of epidermal growth factor receptor in the lysophosphatidic acid-stimulated mitogen-activated protein kinase pathway. J Biol Chem 1998;273:14468-75 40. Saunders JA, Rogers LC, Klomsiri C, et al., Reactive oxygen species mediate lysophosphatidic acid induced signaling in ovarian cancer cells. Free Radic Biol Med 2010;49:2058-67 41. Tsai VW, Macia L, Feinle-Bisset C, et al., Serum Levels of Human MIC-1/GDF15 Vary in a Diurnal Pattern, Do Not Display a Profile Suggestive of a Satiety Factor and Are Related to BMI. PLoS One 2015;10:e0133362 42. Fujita Y, Taniguchi Y, Shinkai S, et al., Secreted growth differentiation factor 15 as a potential biomarker for mitochondrial dysfunctions in aging and age-related disorders. Geriatr Gerontol Int 2016;16 Suppl 1:17-29 43. Lo JC, Ljubicic S, Leibiger B, et al., Adipsin is an adipokine that improves beta cell function in diabetes. Cell 2014;158:41-53 44. Hull RL, Kodama K, Utzschneider KM, et al., Dietary-fat-induced obesity in mice results in beta cell hyperplasia but not increased insulin release: evidence for specificity of impaired beta cell adaptation. Diabetologia 2005;48:1350- 8 45. Keller MP, Choi Y, Wang P, et al., A gene expression network model of type 2 diabetes links cell cycle regulation in islets with diabetes susceptibility. Genome Res 2008;18:706-16 46. Butler AE, Janson J, Bonner-Weir S, et al., Beta-cell deficit and increased beta-cell apoptosis in humans with type 2 diabetes. Diabetes 2003;52:102-10 47. Linnemann AK, Baan M, and Davis DB, Pancreatic beta-cell proliferation in obesity. Adv Nutr 2014;5:278-88 48. Taverne YJ, Bogers AJ, Duncker DJ, et al., Reactive oxygen species and the cardiovascular system. Oxid Med Cell Longev 2013;2013:862423
- 23 - Diabetes Page 24 of 64
FIGURE LEGENDS
Figure 1. Induction of mitochondrial ferritin (FtMT) in fat promotes mitochondrial dysfunction and reduces adiponectin.
(A) The breeding strategy to overexpress FtMT specifically in fat. Adipose tissue-specific adiponectin promoter (adiponectin)-rtTA mice were bred with TRE-FtMT mice. Following Dox administration, the resulting FtMT-Adip mice overexpress FtMT exclusively in fat. (B) A representative tissue distribution of
FtMT gene expression levels (relative to -actin) in sWAT, gWAT, mesenteric WAT (mWAT), BAT, liver, pancreas, heart, skeletal-muscle, kidney, brain and lung, from a male C57/BL6 FtMT-Adip mouse on standard chow-diet, or after 1-week of Dox-chow diet (600 mg/kg). (C) A representative Western blot of
FtMT (~22 kDa) and prohibitin (~30 kDa) in sWAT and liver from WT mice and FtMT-Adip mice fed
Dox-chow for 1-week. (D) A representative Western blot of FtMT in mitochondria isolated from sWAT of
WT and FtMT-Adip mice that were fed chow-diet containing either 50, 100, 200 or 600 mg/kg Dox. (E)
Cytoplasmic (left) and mitochondrial (right) iron levels in BAT from WT and FtMT-Adip mice that were fed chow-diet containing 600 mg/kg Dox. n = 3-4. (F) Circulating adiponectin levels in WT and FtMT-
Adip mice post Dox-chow. n = 4 (left). Representative Western blots of adiponectin (~30 kDa) and - tubulin (~55 kDa) in sWAT from Dox-chow fed WT and FtMT-Adip mice (right). The bar-graph shows the average adiponectin levels normalized to -tubulin. n = 4-5. (G) Representative EM images of WT sWAT
(left) and FtMT-Adip sWAT (right) from mice fed Dox-chow for 2-weeks. Scale bar = 1000 nm. (H)
Oxygen-consumption rates (OCRs) (p/moles/min) in mitochondria (5 μg) isolated from WT and FtMT-
Adip BAT, in response to sequential additions of DMEM (basal measurements with DMEM media containing FCCP, pyruvate, malate and the complex I inhibitor rotenone), succinate (complex II substrate), antimycin-A (complex III inhibitor), and ascorbate and TMPD (cytochrome c substrate). n = 4-5. (I)
Western blot showing complex I (subunit NDUFB8), complex II, complex III (core 2), complex IV
(subunit I) and ATP synthase α of the mitochondrial ETC in WT and FtMT-Adip BAT. Identical amounts
- 24 - Page 25 of 64 Diabetes
of total mitochondrial protein were loaded, as judged by the mitochondrial loading marker, prohibitin (~30
kDa). Data are shown as mean ± s.e.m. **P < 0.01; ***P < 0.001.
Figure 2. FtMT-Adip mice exhibit reduced diet-induced body-weight gain, glucose intolerance, low
adiponectin levels and ROS damage in adipose tissue.
(A) Body-weights (g) of WT versus FtMT-Adip mice during Dox-HFD feeding. n = 5. (B) Circulating
leptin levels in WT and FtMT-Adip mice following Dox-HFD feeding. n = 3-4. (C) Fat-pad (sWAT and
gWAT) tissue weights (mg) normalized to total body-weights (g) in WT and FtMT-Adip mice following
16-weeks Dox-HFD feeding. n = 5. (D) Glucose and insulin levels during an OGTT on male WT and
FtMT-Adip mice following 1-week of 10 mg/kg Dox-HFD (left) or 3-weeks of 600 mg/kg Dox-HFD
(right). n = 5. (E) Basal glucose (n = 9) and insulin production (n = 5), glucose infusion rates (n = 9) and
hepatic glucose output (n = 7-8) during hyperinsulinemic-euglycemic clamps performed on conscious
unrestrained 16-week-old male WT and FtMT-Adip mice. (F) Representative Western blots of p-Akt and
total-Akt expression (~60 kDa) in sWAT, gWAT and liver tissues from WT versus FtMT-Adip mice, prior
to and post insulin injection (0-, 5- and 15-min time-points) that were fed Dox-HFD for 3-weeks. Mice
were fasted overnight (~14-16 h) prior to insulin injection (1 U/kg body-weight insulin i.p). (G) Whole-
body 2-DG disposal rate (left), and glucose uptake in sWAT, soleus-muscle, gastrocnemius (gastro)-muscle
and the heart from WT and FtMT-Adip mice post 3-weeks of Dox-HFD feeding. n = 7-9 (n = 4-5 for
sWAT and gastro-muscle). (H) Metabolic cage analyses showing lean body mass (w%), RER and total heat
combustion (calories/g) of WT and FtMT-Adip mice post 3-weeks Dox-HFD feeding. n = 4-7. (I) TG
clearance test on WT and FtMT-Adip mice. Mice were gavaged 20% Intra-lipid following an overnight fast
(~14-16 h). n = 5. (J) Angptl-3 (left) and Angptl-4 (right) gene expression levels in WT and FtMT-Adip
sWAT. n = 3-4. (K) Circulating adiponectin levels (left) under fed and fasted (24 h) conditions in WT and
FtMT-Adip mice. n = 5. Representative Western blots of adiponectin and -tubulin (right) in sWAT from
- 25 - Diabetes Page 26 of 64
Dox-HFD-fed WT and FtMT mice, with the graph showing average adiponectin levels normalized to - tubulin. n = 4. (L) Circulating adiponectin levels during a Dox-HFD timecourse (every 3 d for up to 12 d). n = 9. (M) FFA (left) and glycerol levels (right) during a -3 adrenergic receptor agonist test on male WT and FtMT-Adip mice. n = 6-7. (N) Glycerol levels during a glycerol tolerance test (20% glycerol i.p. at a dose of 2 mg/kg following an overnight fast (14-16 h). n = 7. (O) Representative images of H&E staining
(top), Mac2 IHC staining (middle) and Trichrome staining (bottom) WT and FtMT-Adip sWAT following
Dox-HFD feeding. Scale bar = 32 μm. (P) ROS damage (bound F2-isoprostane (ng/g) levels reflecting lipid peroxide adducts) in WT and FtMT-Adip sWAT. n = 4-5. (Q) Representative images of 4-HNE (a marker of ROS damage; lipid peroxide levels) IF staining of WT and FtMT-Adip sWAT. Scale bars = 50 μm. Data are shown as mean ± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001.
Figure 3. Adipose tissue induction of FtMT further worsens the metabolically unhealthy phenotype of the ob/ob mouse, despite reduced body-weight during HFD feeding.
(A) Body-weights (g) of ob/ob versus FtMT-Adip-ob/ob mice during Dox-HFD. n = 3-6. (B) Glucose (left) and insulin (right) levels during an OGTT on male ob/ob and FtMT-Adip-ob/ob mice following 6 weeks of
Dox-HFD feeding. n = 3-5. (C) Representative images of H&E staining (top left), Trichrome staining (top right) and Mac2 IHC (bottom) of sWAT and gWAT from ob/ob and FtMT-Adip-ob/ob mice following 12- weeks Dox-HFD feeding. Scale bars = 50 μm and 32 μm. (D) Representative images of H&E staining of liver tissues from ob/ob and FtMT-Adip-ob/ob mice following 12-weeks Dox-HFD feeding. Scale bars =
50 μm. Data are shown as mean ± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001.
Figure 4. Acute Dox-HFD feeding initiates a compensatory antioxidant response in FtMT-Adip mice that prevents oxidative stress and a diet-induced spike in insulin levels.
- 26 - Page 27 of 64 Diabetes
(A) Circulating adiponectin levels in WT, FtMT-Adip and mCAT-FtMT mice during a 12 day timecourse
of Dox-HFD feeding. n = 6-7. (B) Circulating ad libitum insulin levels during acute Dox-HFD feeding (0-,
1-, 2-, 3-, 6-, 12- and 24-h) of WT and FtMT-Adip mice. n = 8. (C) Glucose (left) and insulin (right) levels
during an OGTT on WT and FtMT-Adip mice following 12-h Dox-HFD feeding. n = 6-7. (D) ROS damage
(mitochondrial hydrogen peroxide) (as measured by the peak area ratio of MitoP/MitoB) in sWAT, liver
and heart tissues from WT and FtMT-Adip mice post 12-h Dox-HFD feeding. n = 5-7. (E) Antioxidant
gene expression levels in WT and transgenic sWAT post 12-h Dox-HFD. n = 3-7. Data are shown as mean
± s.e.m. *P < 0.05; **P < 0.01; ***P < 0.001.
Figure 5. FtMT-Adip mice exhibit massive β-cell hyperplasia, ROS damage in the heart, hepatic steatosis
and BAT whitening.
(A) Insulin and glucagon IF staining of pancreata (left) and H&E staining of whole pancreas (center) from
WT and FtMT-Adip mice post 16-weeks Dox-HFD feeding. Scale bar = 129 μm. Right: Total pancreatic
islet area (mm2). (B) A hyperglycemic clamp: circulating insulin levels were measured at the indicated
times during glucose infusion in WT and FtMT-Adip mice post 3-weeks Dox-HFD. n = 3. (C) Liver
weights ((mg) normalized to total body-weights (g)), and liver TG content (D) in WT and FtMT-Adip
mice. n = 4-5. (E) Representative images of H&E staining of WT and FtMT-Adip livers. Scale bar =
32 μm. (F) ROS damage (as measured by the peak area ratio of MitoP/MitoB) in liver and (G) heart tissues
from WT and FtMT-Adip mice. n = 3-5. (H) Tissue-mass of BAT from WT and FtMT-Adip mice. n = 5-6.
(I) Representative images of H&E (top) and Trichrome staining (bottom) of BAT from WT and FtMT-
Adip mice following Dox-HFD feeding. Scale bar = 32 μm. (J) BAT-marker gene expression levels (Ucp1,
Cidea, Otop1, Dio2 and Cox7a1) in WT and FtMT-Adip BAT. n = 4-5. (K) 3H-triolein lipid-uptake and
lipid-oxidation in BAT from WT and FtMT-Adip mice. n = 4-6. Data are shown as mean ± s.e.m. *P <
0.05; **P < 0.01; ***P < 0.001.
- 27 - Diabetes Page 28 of 64
Figure 6. Dysfunctional transgenic fat harbors high toxic lipid species and LPA acid levels with enhanced production of GDF15 and FGF21.
(A) Real-time qPCR data of several of the top upregulated gene targets (as identified by Illumina microarray) (Gdf15, Fgf21, Trib3, Atf3 and S1pl) in sWAT from WT and FtMT-Adip mice following 3- weeks of Dox-HFD feeding. n = 4. (B) Circulating GDF15 levels following a 3-h fast (left) (n = 5) and
GDF15 levels during a Dox-HFD timecourse (every 3 days for up to 12 days) (right) in WT and FtMT-
Adip mice. n = 9. (C) Circulating FGF21 levels following a 3-h fast. n = 4-6. (D) YY1 expression levels in
WT and FtMT-Adip sWAT. n = 3-4. (E) Circulating adiponectin levels (left) and GDF15 levels (right) in
WT, FtMT-Adip and TRE-YY1 mice crossed with FtMT-Adip mice (YY1-FtMT), during a 12 d Dox-HFD timecourse. n = 6-8. (F) Circulating adiponectin levels (left) and GDF15 levels (right) in WT, FtMT-Adip and global GDF15-KO mice crossed with FtMT-Adip mice (GDF15-KO-FtMT). n = 6-8. (G) Circulating adiponectin (left), GDF15 (center) and FGF21 (right) levels in WT, FtMT-Adip and fat-specific FGF21-
KO mice crossed with FtMT-Adip mice (FGF21-KO-FtMT). n = 5-8. (H) Circulating GDF15 levels in
WT, FtMT-Adip and mCAT-FtMT mice during a 12 d timecourse of Dox-HFD feeding. n = 6-7. (I) LPA levels in WT and FtMT-Adip sWAT. n = 6. (J) Phosphatidic acid levels in WT and transgenic mice sWAT. n = 5-6. (K) Sphingolipid (sphingosine, sphingosine-1-phopshate, sphinganine, sphinganine-1-phosphate and deoxysphinganine), lactosyl-ceramide (lactosyl-16, 18, 20, 22, 24:1 and C24), dihydro-ceramide
(dihydro-16, 18, 20, 22, 24:1 and 24), hexosyl-ceramide (hexosyl-16, 18, 20, 22, 21:4 and C240) and ceramide (ceramide-14, 16, 18:1, 18, 20, 22, 24:1 and 24) levels in WT and FtMT-Adip mice following 3- weeks of Dox-HFD feeding. n = 3-5. Data are shown as mean ± s.e.m. *P < 0.05; **P < 0.01; ***P <
0.001.
Figure 7. The impact of mitochondrial dysfunction in the adipocyte during obesity.
The proposed mechanism of how FtMT-induced mitochondrial dysfunction specifically in the mature adipocyte impacts local adipose tissue function, which consequently inflicts unique system-wide negative - 28 - Page 29 of 64 Diabetes
and positive effects on other organs. Within the adipocyte, triggering mitochondrial impairment elicits
oxidative damage and LPA production, which unleashes a mitochondrial stress response to increase the
production of GDF15 and FGF21. In turn, this produces a lean, yet metabolically unfavorable phenotype.
The liver and heart harbor negative consequences that entail insulin resistance and ROS damage,
respectively. The pancreas however, acquires beneficial consequences; namely, massive β-cell hyper-
proliferation in response this unique FtMT-based perturbation of adipocyte mitochondria.
- 29 - Diabetes Page 30 of 64
Page 31 of 64 Diabetes Figure 1 Part 2
H I Oxygen consumption Electron transport in isolated mitochondria chain complexes
500 ATP synthase (~53 kDa) Complex III core 2 (~47 kDa) 400 Complex IV subunit I (~39 kDa)
300 Complex II (~30 kDa)
200 *** Complex I
OCR (p/mol/min) OCR (subunit NDUFB8) (~20 kDa) 100 *** *** Prohibitin (~30 kDa) 0 Basal Succ Ascorb WT FtMT- Adip WT FtMT-Adip Diabetes Page 32 of 64 Figure 2 Part 1
A Body weight: Dox-HFD Fat-pad weights 60 *** B Leptin C sWAT gWAT ****** 40
*** ) *** ) 16 50 *** ) 40 **** 30 ** 12 40 30
(ng/ml) ** 20 30 in 20 *** 8 *** Body-weight (g Body-weight Lept T (mg)/body weight (g weight (mg)/body T
10 (g weight (mg)/body T 20 10 4 WT sWA FtMT-Adip gWA 10 0 0 0 0 2 4 6 8 10 12 14 16 WT FtMT- WT FtMT- WT FtMT- Weeks on Dox-HFD Adip Adip Adip
D OGTT 1-week Dox-HFD OGTT 1-week Dox-HFD OGTT 3-wks Dox-HFD OGTT 3-wks Dox-HFD (glucose) (insulin) (glucose) (insulin) 500 500 8 12 * *** *** *** 400 400 *** 6 * *** 300 * 300 * 8 *** 4 200 200 Insulin (ng/ml) Insulin Insulin (ng/ml) Insulin 4 Glucose (mg/dl) Glucose
Glucose (mg/dl) Glucose 2 100 100 WT WT WT FtMT-Adip FtMT-Adip FtMT-Adip 0 0 0 0 0 15 30 60 120 0 15 30 60 120 0 15 30 60 120 0 15 30 60 120 Time (min) Time (min) Time (min) Time (min) F E Basal glucose Basal insulin Glucose Hepatic production production infusion rate glucose output sWAT p-Akt ) 2.0 ** ) 40 30 200 * ** sWAT Total-Akt ) ) 20 1.5 30 gWAT p-Akt 150 (mg/dl (mg/dl
10 gWAT Total-Akt 1.0 20 100 Liver p-Akt 0 *** Liver Total-Akt 0.5 10 50 -10 Insulin 0 5 15 0 5 15 (min): Basal insulin Basal
Basal glucose Basal WT FtMT- 0 0.0 0 -20 Adip WT FtMT- WT FtMT- (mg/kg/min rate infusion Glucose WT FtMT- WT FtMT- Hepatic glucose output (mg/kg/min output glucose Hepatic Adip Adip Adip Adip
G Whole-body glucose 2-DG uptake: 2-DG uptake: 2-DG uptake: 2-DG uptake: disposal rate sWAT Soleus-muscle Gastro-muscle Heart 0.6 30 6 50 30 40 * 0.4 20 4 20 30 * ** 20 0.2 10 2 10 ** sWAT 2-DG uptake 2-DG sWAT g) (umol/min/100 ** 10 Gastro-muscle 2-DG uptake 2-DG Gastro-muscle Soleus-muscle 2-DG uptake 2-DG Soleus-muscle g) (umol/min/100 0 0.0 0 0 0 Heart 2-DG uptake (umol/min/100 g) (umol/min/100 uptake 2-DG Heart Glucose disposal rate (umol/min/100 g) (umol/min/100 rate disposal Glucose WT FtMT- WT FtMT- WT FtMT- WT FtMT- WT FtMT- Adip Adip Adip Adip Adip (umol/min/100 g) (umol/min/100 Page 33 of 64 Diabetes Figure 2 Part 2 Lean body H RER RER Heat of combustion mass (w%) 0.80 70 * 0.78 0.78 200
0.76 0.76 60 ** 150
RER 0.74 0.74 RER 100 0.72 * Lean (w%) Lean 50 * ** 0.72 *** 50 0.70 ** * * 0.68 0 40 0.70 (cal/g) combustion heat Total WT FtMT- WT FtMT- WT FtMT- 9:30 7:36 7:52 8:34 9:16 14:42 11:30 14:06 10:28 13:04 15:40 12:28 17:40 Adip Adip Adip Time (hr:min) I TG clearance J WT Angptl-3 Angptl-4 160 *** FtMT-Adip 2000 6 ) dl g/ 120 A 1500 A * 4 80 1000 erides (m erides * yc igl Angptl-3 mRN Angptl-3 2 * Angptl-4 mRN Angptl-4 Tr 40 500 **
0 0 0 0 1 2 3 4 6 WT FtMT- WT FtMT- Time (min) Adip Adip
WT FtMT-Adip K Adiponectin Adiponectin L Adiponectin timecourse WT ~30 kDa 15 FtMT-Adip 10 -tubulin ~55 kDa *** *** *** WT 8 *** FtMT-Adip ) ml)
0.25 ml
10 g/ ug/ ** 6 0.20 *** 4 0.15 5 diponectin ( diponectin in expression in A Adiponectin (u Adiponectin ct 0.10 ** 2
0 0.05 0 dipone
A 0 3 6 9 12 Fed Fasted 0.00 Time (days on Dox-HFD) WT FtMT-Adip
M N Beta-3 test (FFAs) Beta-3 test (Glycerol) Glycerol-TT (Glycerol)
0.6 *** 0.4 to relative -tubulin 5 ****** *** *** *** *** *** ***
) 4 )
0.3 ) 0.4 3 0.2
As (mmol/L As 2 0.2 FF
Glycerol (mmol/l Glycerol 0.1 Glycerol (mmol/l Glycerol 1 * WT WT FtMT-Adip FtMT-Adip 0.0 0.0 0 0 15 30 60 120 0 15 30 60 120 0 15 30 60 120 Time (min) Time (min) Time (min) Diabetes Page 34 of 64
Figure 2 Part 3 P ROS damage in sWAT (lipid peroxide adducts)
O WT sWAT FtMT-Adip sWAT ) 10 ***
8 H&E staining 6
4
32 um 32 um 2
Bound F2-Isoprostanes (ng/g F2-Isoprostanes Bound 0 WT FtMT- Adip Inflammation (Mac2 IHC) Q ROS damage (4-HNE; lipid peroxide levels) IF staining 32 um 32 um WT sWAT FtMT-Adip sWAT
Fibrosis (Trichrome staining)
32 um 32 um 50 um 50 um Page 35 of 64 Diabetes
Diabetes Page 36 of 64 Figure 4
A Adiponectin levels B mCAT-FtMT cross Insulin levels 12 4 *** WT *** FtMT-Adip ** *** *** *** ) 3 8 * * 2
4 (ng/ml) Insulin 1 Adiponectin (ug/ml Adiponectin WT FtMT-Adip mCAT-FtMT 0 0 0 1 2 3 6 12 24 0 3 6 129 Time on Dox-HFD (days) Time on Dox-HFD (hours)
ROS damage C (Mitochondrial OGTT 12 h Dox-HFD OGTT 12 h Dox-HFD D hydrogen peroxide) (glucose) (insulin) (12 h Dox-HFD) 300 *** * 6 WT 8
*** o) FtMT-Adip 5 250 * 6 4
200 ** 4 3 Glucose (mg/dl) Glucose Insulin (ng/ml) Insulin 2 150 2 1 WT WT FtMT-Adip FtMT-Adip Rati (MitoP/B damage ROS 100 0 0 0 15 30 60 120 0 15 30 60 120 sWAT Liver Heart Time (min) Time (min)
E Superoxide Glutathione dismutases peroxidases Glutathione-S-transferases WT 35 ** 15 15 FtMT-Adip 30 * 25 10 10 ** 20 *** ** 15 * *** 5 5
Gene expression Gene *
10 expression Gene * expression Gene 5
0 0 0
Sod2 Sod3 S od1 G px 3 G px 7 G px 8 G st a4 (Mn) G st m1 G st p1 m Gs t1 m Gs t2 m Gs t3 G st k1 (Cu-Zn) C at alas e Page 37 of 64 Diabetes
Diabetes Page 38 of 64 Figure 6 Part 1
A Top upregulated genes in sWAT Gdf15 Fgf21 Trib3 Atf3 S1pl (88-fold) (18-fold) (15-fold) (10-fold) (3-fold) 250 ** 150 40 30 * ** *** 4 ** 200 A
30 A 100 20 3 150 20 2 100 Atf3 mRN Atf3
50 10 mRNA S1pl Fgf21 mRN Fgf21 GDF15 mRNA GDF15 Trib3 mRNA Trib3 10 1 50 0 0 0 0 0 WT FtMT WT FtMT WT FtMT WT FtMT WT FtMT -Adip -Adip -Adip -Adip -Adip
B Circulating GDF15 levels C Circulating D ** FGF21 Yy1 mRNA 150 *** * 400 *** ) 400 ) 120 3 ) * 300 300 90 2 * 200 60 200 Y Y1 m RNA
GDF15 (pg/ml GDF15 1 100 30 100
WT (pg/ml levels FGF21 GDF15 levels (pg/ml levels GDF15 FtMT-Adip 0 0 0 0 WT FtMT 0 3 6 9 12 WT FtMT WT FtMT -Adip Time (days on Dox-HFD) -Adip -Adip E Adiponectin levels GDF15 levels F Adiponectin levels GDF15 levels YY1-FtMT cross YY1-FtMT cross GDF15-KO-FtMT cross GDF15-KO-FtMT cross 12 WT *** *** *** ** FtMT-Adip *** 200 ** 80 *** ) *** *** 9 ** GDF15-KO-FtMT
) *** *** ) 160 ** ) 8 *** 60 120 6 *** *** 40 4 80 GDF15 (pg/ml GDF15 (pg/ml GDF15
Adiponectin (ug/ml Adiponectin 3 20 WT 40 (ug/ml Adiponectin FtMT-Adip YY1-FtMT 0 0 0 0 *** *** *** *** *** 0 3 6 129 0 3 6 129 0 3 6 129 0 3 6 129 Time on Dox-HFD (days) Time on Dox-HFD (days) Time on Dox-HFD (days) Time on Dox-HFD (days)
G Adiponectin levels GDF15 levels H GDF15 levels FGF21-KO-FtMT cross FGF21-KO-FtMT cross mCAT-FtMT cross 10 *** 160 200 *** *** *** ** ***
) 8 150
120 ) ) ** 6 * 80 100 4 GDF15 (pg/ml GDF15 GDF15 (pg/ml GDF15 40 50 Adiponectin (ug/ml Adiponectin 2 WT FtMT-Adip FGF21-KO-FtMT 0 0 0 0 3 6 129 0 3 6 129 0 3 6 129 Time on Dox-HFD (days) Time on Dox-HFD (days) Time on Dox-HFD (days) Page 39 of 64 Diabetes Figure 6 Part 2 I sWAT LPA J sWAT Phosphatidic acid
80 4000 WT *** *** FtMT-Adip 75 * 3000 *** 60 45 2000 *** *** ** 30 *** *** * 1000 *** LPA (vol/mg/protein) LPA 15 ** *** ***
0 (pg/mg/protein) acid Phosphatidic 0
3 2 1 6: 0 18: 1 1 8: 2 20: 4 3 4: 1 3 6: 1 3 6: 2 3 6: 4 3 8: 2 3 8: 4 3 8: 5 3 8: 6 4 0: 6
K Sphingolipids Lactosyl-ceramides Dihydro-ceramides 400
3000 250 * WT WT WT FtMT-Adip 2500 FtMT-Adip FtMT-Adip 300 200 2000 * 450 150 200 300 *** 100 *** 100 200 ** * 50 * 100
Sphingolipids (pg/mg tissue) (pg/mg Sphingolipids * Dihydrolipids (pg/mg tissue) Dihydrolipids 0 (pg/mg tissue) lipids Lactosyl 0 0
Sphingo Sphinga Lact-16 Lact-18Lact-20 Lact-22 Lact-C24 DeSphinga Lact-24:1 Sphingo-1P Sphinga-1P Dihydro-16Dihydro-18Dihydro-20Dihydro-22 Dihydro-24 Dihydro-24:1
Hexosyl-ceramides Ceramides 8000 18000 WT WT * 12000 FtMT-Adip 4000 FtMT-Adip * * 6000
4000 * 1200 * 600 2000 2000 * 1000 20 Ceramides (pg/mg tissue) Ceramides
Hexosyl levels (pg/mg tissue) levels Hexosyl 0 0
Hex-16 Hex-18 Hex-20 Hex-22 Hex-24 Cer-14 Cer-16 Cer-18 Cer-20 Cer-22 Cer-24 Hex-24:1 Cer-18:1 Cer-24:1 Diabetes Page 40 of 64 Figure 7 Page 41 of 64 Diabetes
SUPPLEMENTARY FIGURE LEGENDS
Supplementary Figure 1. Glucose tolerance, energy expenditure and lipid-uptake and oxidation
measurements in FtMT-Adip mice.
(A) Glucose and insulin levels during an OGTT on WT and FtMT-Adip mice following 2-weeks (left) or 6-
weeks (right) of Dox-HFD feeding. n = 5. (B) Metabolic cage analyses showing body-fat composition (w%)
(left) and oxygen-consumption rates (VO2) (ml/h/kg) in WT and FtMT-Adip mice post 3-weeks Dox-HFD
feeding. n = 5-7. (C) Sphingolipid (sphinganine, sphingosine, sphinganine-1-phosphate and sphingosine-1-
phopshate) and lactosyl-ceramide (lactosyl-16, 18, 20, 22, 24:1 and C24) levels in WT and FtMT-Adip mice
following 1-week of Dox-HFD feeding. n = 4-5. (D) Tissue-mass, 3H-triolein lipid-uptake, and lipid-oxidation
in sWAT, gWAT and liver tissues of WT and FtMT-Adip mice. n = 4-6. Data are shown as mean ± s.e.m. *P
< 0.05; **P < 0.01; ***P < 0.001.
Supplementary Figure 2. Representative images of fibrotic alterations and adipocyte cell viability following
FtMT induction in fat.
(A) Representative images of H&E staining (top) and Mac2 IHC staining (bottom) of gWAT from WT and
FtMT-Adip mice following 16-weeks of Dox-HFD feeding. Scale bar = 32 μm. (B) Representative images of
perilipin IF staining of sWAT and BAT from WT and FtMT-Adip mice post 16 weeks Dox-HFD feeding.
Scale bars = 153 μm, 32 μm and 100 μm.
Supplementary Figure 3. Fat-specific induction of FtMT in Dox-chow-diet fed ob/ob mice.
(A) Body-weights (g) of C57/BL6 ob/ob versus FtMT-Adip-ob/ob mice during Dox-chow (600 mg/kg)
feeding. n = 5. (B) Glucose (left) and insulin (right) levels during an OGTT on ob/ob and FtMT-Adip-ob/ob
mice following 6-weeks of Dox-chow feeding. n = 5. (C) Representative images of H&E staining (top left),
Trichrome staining (top right) and Mac2 IHC (bottom) of sWAT and gWAT from ob/ob and FtMT-Adip-ob/ob
mice following 12-weeks Dox-chow feeding. Scale bars = 50 μm and 32 μm. (D) Representative images of Diabetes Page 42 of 64
H&E stained livers and (E) hepatic TG content of ob/ob and FtMT-Adip-ob/ob mice following 12-weeks Dox- chow feeding. n = 3-4. Scale bars = 50 μm. Data are shown as mean ± s.e.m. *P < 0.05.
Supplementary Figure 4. ROS damage in tissues following acute 12 h Dox-HFD exposure.
(A) ROS damage (lipid peroxide adducts) (as measured by bound F2-isoprostane levels) in sWAT, liver and heart tissues from WT and FtMT-Adip mice post 12-h Dox-HFD feeding. n = 3-4.
Supplementary Figure 5. Gene expression and LPA analyses following FtMT induction in fat and circulating levels of FGF21.
(A) Gdf15 and (B) Angptl-6 expression levels in BAT from WT and FtMT-Adip mice following 3-weeks of
Dox-HFD (600 mg/kg) feeding. n = 4-5. (C) Circulating FGF21 levels in WT, FtMT-Adip and fat-specific
FGF21-KO mice crossed with FtMT-Adip mice (FGF21-KO-FtMT). n = 5-8. (D) Real-time qPCR data showing expression levels of the top downregulated genes (as identified by Illumina microarray (Gpr120,
Insig1, Rbp4, SucnR1, Lrg1, Nnat and Fsd2) in sWAT from WT and FtMT-Adip mice following 3-weeks of
Dox-HFD feeding. n = 4. (E) LPA levels in WT and FtMT-Adip liver and heart tissues. n = 6. (F) Circulating
LPA levels in WT and FtMT-Adip mice post 3 weeks Dox-HFD. n = 3. Data are shown as mean ± s.e.m. *P
< 0.05; **P < 0.01.
- 2 - Page 43 of 64 Diabetes
SUPPLEMENTARY TABLES AND LEGENDS
Supplementary Table 1. Fed and fasted (24 h) serum parameters in WT versus FtMT-Adip mice following
12 weeks Dox-HFD (600 mg/kg) feeding. n = 5. Data are shown as mean ± s.e.m. *p<0.05, **p<0.01,
***p<0.001.
Supplementary Table 2. Fed and fasted (5 h) serum parameters in ob/ob mice versus FtMT-Adip-ob/ob mice
following Dox-chow (600 mg/kg) feeding. n = 4-5. Data are shown as mean ± s.e.m. *p<0.05, **p<0.01,
***p<0.001.
- 3 - Diabetes Page 44 of 64
Supplementary Table 3. Fed and fasted (5 h) serum parameters in ob/ob mice versus FtMT-Adip-ob/ob mice following Dox-HFD (600 mg/kg) feeding. n = 3-6. Data are shown as mean ± s.e.m. *p<0.05, **p<0.01,
***p<0.001.
- 4 - Page 45 of 64 Diabetes
Supplementary Table 4. Top upregulated genes identified using Illumina microarray of WT versus FtMT-
Adip sWAT following 3 weeks of Dox-HFD feeding (600 mg/kg). n = 9. Data are shown as fold increase.
*p<0.05, **p<0.01, ***p<0.001.
- 5 - Diabetes Page 46 of 64
Supplementary Table 5. Top downregulated genes identified using Illumina microarray of WT versus FtMT-
Adip sWAT following 3 weeks of Dox-HFD feeding (600 mg/kg). n = 9. Data are shown fold decrease.
*p<0.05, **p<0.01, ***p<0.001.
- 6 - Page 47 of 64 Diabetes
Supplementary Table 6. Primer sequences that were utilized for real-time qPCR analyses.
- 7 - Diabetes Page 48 of 64
Supplementary Table 6 (cont).
- 8 - Page 49 of 64 Diabetes
- 9 - Diabetes Page 50 of 64
- 10 - Page 51 of 64 Diabetes
- 11 - Diabetes Page 52 of 64
- 12 - Page 53 of 64 Diabetes
- 13 - Diabetes Page 54 of 64
- 14 - Page 55 of 64 Diabetes
- 15 - Diabetes Page 56 of 64
- 16 - Page 57 of 64 Diabetes
SUPPLEMENTARY MATERIALS
Mice
mCAT mice (mitochondrial-targeted human catalase recombineered into a GAPDH BAC and inserted into
transgenic mice) were kindly provided by the P. Rabinovitch lab, and genotyped using the primer set: 5’-
CTGAGGATCCTGTTAAACAATGC and 5’-CTATCTGTTCAACCTCAGCAAAG. GDF15-KO sperm was
obtained from the MRC Harwell Institute (Oxfordshire, UK) and mice generated were genotyped using the
PCR primer set: (GDF15-KO-F) 5’- TGAAGCAGAATTGCCTTG AGT, (GDF15-KO-R1) 5’-
GAACTTCGGAATAGGAACTTGG and (GDF15-KO-R2) 5’- AGCATGGATCTCTCCAACCTT. Floxed-
FGF21-KO mice were kindly provided by the D. Mangelsdorf and S. Kliewer lab and were genotyped using
the primer set: 5’- AAGCATTCCTGGTACCACGG and 5’-
CAGCACTAAGGGAGGCAGAGGCAAGTGATT. We generated TRE-YY1 mice and the genotypes were
confirmed using the primer set: 5’-TACCGG AGACAGGCCCTATG and 5’-
GAAAACTTTGCCCCCTCCAT. All overexpression experiments were performed in a pure C57/BL6
background.
Transmission Electron Microscopy (TEM)
Fresh sWAT was fixed by perfusion with 4% paraformaldehyde and 1% glutaraldehyde in 0.1 M sodium
cacodylate buffer. Fixed tissues were then transferred to 2.5% glutaraldehyde in 0.1 M sodium cacodylate
buffer, post-fixed in buffered 1% osmium tetroxide, en bloc stained in 4% uranyl acetate in 50% ethanol,
dehydrated with a graded series of ethanol, then embedded in EMbed-812 resin. Thin sections were cut on a
Leica Ultracut UCT ultramicrotome and post-stained with 2% uranyl acetate and lead citrate. Images were
2 acquired on a FEI Tecnai G Spirit TEM equipped with a LaB6 source and operating at 120 kV.
- 17 - Diabetes Page 58 of 64
Isolation of Mitochondria and Oxygen-Consumption Experiments
To isolate mitochondria, BAT was homogenized using a motorized Dounce homogenizer in ice-cold MSHE buffer (70 mM sucrose, 210 mM mannitol, 5 mM HEPES, 1 mM EDTA) containing 0.5% FA-free BSA.
Homogenates then underwent low centrifugation (800 g for 10 min) to remove nuclei and cell debris, followed by high centrifugation (8,000 g for 10 min) to obtain the mitochondrial pellet, which was washed once in ice- cold MSHE buffer and re-suspended in a minimal amount of MSHE buffer prior to determination of protein concentrations. Oxygen consumption rates (OCRs) were determined using the XF24 Extracellular Flux
Analyzer (Seahorse Bioscience, MA), following the manufacturers’ protocols. For the electron-flow (EF) experiments, isolated BAT mitochondria were seeded at 10 μg of protein per well in XF24 V7 cell-culture microplates (Seahorse Bioscience), then pelleted by centrifugation (2,000 g for 20 min at 4°C) in 1X MAS buffer (70 mM sucrose, 220 mM mannitol, 10 mM KH2PO4, 5 mM MgCl2, 2 mM HEPES, 1 mM EGTA in
0.2% FA-free BSA; pH 7.2), supplemented with 10 mM pyruvate, 10 mM malate and 4 μM carbonyl cyanide
4-(trifluoromethoxy)phenylhydrazone (FCCP), with a final volume of 500 μl per well. The XF24 plate was then transferred to a temperature-controlled (37°C) Seahorse analyzer and subjected to a 10-min equilibration period and 2 assay cycles to measure the basal rate, comprising of a 30-sec mix, and a 3-min measure period each; and compounds were added by automatic pneumatic injection followed by a single assay cycle after each; comprising of a 30-sec mix and 3-min measure period. OCR measurements were obtained following sequential additions of rotenone (2 μM final concentration), succinate (10 mM), antimycin A (4 μM) and ascorbate (10 mM) (the latter containing 1 mM N,N,N',N'-tetramethyl-p-phenylenediamine [TMPD]). OCR measurements were recorded at set interval time-points. All compounds and materials above were obtained from Sigma-Aldrich.
- 18 - Page 59 of 64 Diabetes
3H-triolein Uptake and -oxidation
For assessment of tissue-specific triolein lipid-uptake and lipid-oxidation rates, protocols were adapted from
previously documented protocols (1, 2). In brief, 3H-triolein was tail-vein injected (2 Ci/mouse in 100 l of
5% Intra-lipid) into mice following a 16 h fast. Blood samples (20 l) were then collected at 1, 2, 5, 10 and
15 min post injection. Following 20 min post injection, mice were sacrificed, blood samples were obtained
and tissues were immediately excised, weighed and frozen at -80oC until further processing. Lipids were then
extracted using a chloroform-to-methanol based extraction protocols (3). The radioactivity content of tissues,
including blood samples, was then quantified, as previously documented (2).
Bomb Calorimetry
Feces were weighed before and after drying. The weight difference was considered as sample water content.
Samples were dried for 72 hr using a LABCONCO Centrivap concentrator equipped with a LABCONCO
Centrivap cold trap (-50 C) (Labconco Corporation, Kansas City, MO). Dried feces then were pulverized
using a multiplex bead tissue disruptor (TissueLyserII, Qiagen, Germantown, MD). Heat of combustion was
determined in a 6200 Isoperibol Calorimeter Equipped with a semi-micro oxygen combustion vessel. Benzoic
acid was utilized as standard (Parr Instrument Company, Moline IL).
SUPPLEMENTARY REFERENCES
1. Laplante M, Festuccia WT, Soucy G, et al., Tissue-specific postprandial clearance is the major determinant of PPARgamma-induced triglyceride lowering in the rat. Am J Physiol Regul Integr Comp Physiol 2009;296:R57-66 2. Hultin M, Carneheim C, Rosenqvist K, et al., Intravenous lipid emulsions: removal mechanisms as compared to chylomicrons. J Lipid Res 1995;36:2174-84 3. Bligh EG and Dyer WJ, A rapid method of total lipid extraction and purification. Can J Biochem Physiol 1959;37:911-7
- 19 - Diabetes Page 60 of 64 Supplement Figure 1 A OGTT 2-wks Dox-HFD OGTT 2-wks Dox-HFD OGTT 6-wks Dox-HFD OGTT 6-wks Dox-HFD (glucose) (insulin) (glucose) (insulin) 500 *** WT * *** 12 FtMT-Adip 400 ** 20 400 *** 16 9 300 g/dl) g/dl) 300 *** g/ml) g/ml) (m (m ** (n 12 (n 6 200 200 8 Insulin Insulin Insulin Insulin Glucose Glucose 3 Glucose 100 100 4 WT WT WT FtMT-Adip FtMT-Adip FtMT-Adip 0 0 0 0 0 15 30 60 120 0 15 30 60 120 0 15 30 60 120 0 15 30 60 120 Time (min) Time (min) Time (min) Time (min)
B Oxygen Oxygen-consumption (ml/h/kg) Body-fat (w%) consumption 5000 40 4000 4500
30 3000 4000
3500 20 2000 (ml/ hr/kg) (ml/ hr/kg) 2 Fat (w%) Fat 2 3000
1000 VO 10 VO 2500
0 0 2000
9:04 0:40 9:52 6:40 WT FtMT- WT FtMT- 14:16 5:52 16:16 21:28 7:52 13:04 23:28 15:04 20:16 Adip Adip Time (hr:min) C Sphingolipids Lactosyl-ceramides Tissue mass D 1200 sWAT gWAT Liver * WT FtMT-Adip 1500 50 50 * 40 800 1200 40 45 30 900 30 40
400 600 20 20 35
300 (mg)/ weight Tissue (g) weight body Tissue weight (mg)/ weight Tissue (g) weight body Tissue weight (mg)/ weight Tissue (g) weight body 10 10 30 Sphingolipids (pg/mg tissue) 0 0 Lactosyl-ceramides (pg/mg tissue) 0 0 25 WT FtMT- WT FtMT- WT FtMT- Sphinga Sphingo Lact-16 Lact-18Lact-20 Lact-22 Lact-24:1Lact-C24 Adip Adip Adip Sphinga-1PSphingo-1P
Lipid-uptake Lipid-oxidation
sWAT gWAT Liver sWAT gWAT Liver 0.8 4 1.2
0.3 3.0 0.3 0.7 1.0 3 n n 0.8 n 0.6 0.2 2.0 0.2 2 0.6 0.5 Lipid-uptake Lipid-uptake Lipid-uptake 0.4 0.1 1.0 0.1 Lipid-oxidatio Lipid-oxidatio
1 Lipid-oxidatio 0.4 0.2
0.3 0 0.0 0.0 0.0 0.0 WT FtMT- WT FtMT- WT FtMT- WT FtMT- WT FtMT- WT FtMT- Adip Adip Adip Adip Adip Adip Page 61 of 64 Diabetes
Diabetes Page 62 of 64
Page 63 of 64 Diabetes Supplement Figure 4
A ROS damage (Lipid peroxide adducts) (12 h Dox-HFD)
WT ) 6 FtMT-Adip
* 4
2 Bound F2-Isoprostanes (ng/g F2-Isoprostanes Bound 0 sWAT Liver Heart Diabetes Page 64 of 64 Supplement Figure 5
A Gdf15 mRNA C FGF21 levels in BAT B Angptl-6 mRNA (FGF21-KO-FtMT cross) 600 10 5 ** 8 4 400 6 3 ** 4 2 200 GDF15 mRNA GDF15 A ng pt l- 6 mRNA 2 1 (pg/ml) levels FGF21 ***
0 0 0 WT FtMT WT FtMT WT FtMT FGF21-KO -Adip -Adip -Adip -FtMT D Top downregulated genes in sWAT
Gpr120 Insig1 Rbp4 SucnR1 Lrg1 Nnat Fsd2 (4-fold) (4-fold) (12-fold) (8-fold) (10-fold) (15-fold) (7-fold) 10 8 60 25 80 40 60 8 20 6 60 30 40 A 6 40 15 4 40 20 4 10 Lrg1 mRNA Lrg1 Nnat mRNA Nnat
Rbp4 mRNA Rbp4 20 Insig1 mRNA Insig1 Fsd2 mRN Fsd2 Gpr120 mRNA Gpr120 2 * 20 20 10 SucnR1 mRNA SucnR1 * 2 * ** 5 ** ** * 0 0 0 0 0 0 0 WT FtMT WT FtMT WT FtMT WT FtMT WT FtMT WT FtMT WT FtMT -Adip -Adip -Adip -Adip -Adip -Adip -Adip
E Liver LPA Heart LPA F Circulating LPA 80 30 * 100 60 40 * 50 20 20 * 2.0 2.0 1.5 1.5 10 * 1.0 1.0 * LPA (vol/mg/protein) LPA LPA (vol/mg/protein) LPA
LPA (vol/mg/protein) LPA * 0.5 0.5 0 0 0
1 4: 0 1 6: 0 1 6: 1 1 8: 1 1 8: 2 2 0: 4 1 4: 0 1 6: 0 1 6: 1 1 8: 1 1 8: 2 2 0: 4 1 6: 0 1 8: 0 1 8: 1 1 8: 2 2 0: 4