ALBERT-LUDWIGS-UNIVERSITY OF FREIBURG LABORATORY FOR BIOINFORMATICS & MOLECULAR

TORC2 regulates endocytic trafficking via serum- and glucocorticoid-inducible kinase sgk-1 in the intestine of C. elegans

Inaugural-Dissertation zur Erlangung der Doktorwürde der Fakultät für Biologie der Albert-Ludwigs-Universität Freiburg im Breisgau

vorgelegt von Yijian Yan aus Xinjiang, China

Freiburg im Breisgau, Juli 2018

Dekan der Fakultät für Biologie: Prof. Dr. Bettina Warscheid

Promotionsvorsitzender: Prof. Dr. Andreas Hiltbrunner

1° Prüfe - Betreuer der Arbeit: Prof. Dr. Ralf Baumeister

2° Prüfer - Koreferent: Dr. Florian Steinberg

3° Prüfer: Prof. Dr. Winfried Römer

Tag der Verkündigung des Prüfungsergebnisses: 28.08.2018

TABLE OF CONTENTS

SUMMARY OF THE STUDY ...... 1 1 INTRODUCTION ...... 2 1.1 Serum- and glucocorticoid-inducible kinase ...... 2 1.2 SGK-1 crosslinks IIS, TRPA-1 and TORC2 in C. elegans ...... 6 1.3 Intracellular vesicular trafficking ...... 9 1.3.1 The early ...... 11 1.3.2 The early-late endosome transition ...... 13 1.3.3 ...... 17 1.4 C. elegans as a model to study endomembrane trafficking ...... 18 1.5 Aim of the study ...... 21 2 MATERIAL and METHODS ...... 23 2.1 Material ...... 23 2.2 Culture and maintain C. elegans ...... 23 2.3 Genetic cross and backcross ...... 24 2.4 RNA interference ...... 24 2.5 Generation of transgenic strains via microinjection ...... 25 2.6 Integration of strains with γ-irradiation ...... 25 2.7 Genotyping ...... 26 2.8 Molecular cloning ...... 27 2.9 Fractionation and immunodetection ...... 27 2.10 Quantitative real time polymerase chain reaction ...... 29 2.11 Brood size and body size assays ...... 30 2.12 LysoTracker staining ...... 30 2.13 Microscopy ...... 31 2.14 Image analysis ...... 31 2.15 Mammalian cell culture and transfection ...... 31 2.16 Bioinformatics ...... 32 2.17 Statistical analysis ...... 33 3 RESULTS ...... 34 3.1 Overexpressing SGK-1 leads to VLSs in the intestine of C. elegans ...... 34 3.2 Overexpressing SGK-1 blocks the basolateral recycling in the intestine ...... 40 3.3 VLSs in the sgk-1 transgene are enlarged ...... 47 3.4 Loss of sgk-1 suppresses the VLSs phenotype in rab-10 and rme-1 mutants ...... 52 3.5 Cell type specific functions of SGK-1 ...... 59

3.6 sgk-1(ok538) mutant has increased LROs ...... 63 3.7 Kinase activity and PX domain are required for the VLS formation ...... 68 3.8 Upstream regulators affecting endosomal function of SGK-1 ...... 78 4 DISCUSSION ...... 86 4.1 Dynamic regulating the expression of SGK-1 in C. elegans...... 86 4.2 Activation of SGK-1 ...... 90 4.3 The novel function of SGK-1 in endomembrane trafficking ...... 93 4.4 SGK-1 and the endosome maturation ...... 98 4.5 SGK-1 coordinates signaling transduction with endocytic trafficking ...... 103 4.6 Conclusion ...... 106 5 REFERENCES ...... 108 6 ACKNOWLEDGEMENTS ...... 119 7 APPENDIXES ...... 121 7.1 Abbreviation list ...... 121 7.2 Bacteria strains, mammalian cell lines and antibodies ...... 123 7.3 C. elegans strains used in the study...... 124 7.4 Oligonucleotides used in the study...... 129 7.5 used in the study ...... 130 7.6 Softwares used in the study ...... 132 7.7 Supplemental figure ...... 133

SUMMARY OF THE STUDY

Serum- and glucocorticoid-inducible protein kinase (SGK) in vertebrates play a role during development and in pathophysiology of several diseases by regulating the abundance and activity of several ion channels, glucose uptake, cell cycle progression, and death. In (C. elegans), the single sgk-1 gene product has been shown to mediate DAF-2/insulin-like signaling, TRPA-1 cold sensing channel and target of rapamycin complex 2 (TORC2) to regulate longevity, stress response, development, and lipid metabolism. In this study, I identified and characterized a novel function of C. elegans SGK-1 in endomembrane trafficking (EMT). Transgenic expression of sgk-1 results in the generation of like structures (VLSs) in the intestine which resemble the endosomal phenotype displayed in either rab-10 or rme-1 mutants. The endocytic transport of candidated membrane receptors are blocked in the VLSs which also harbor aberrant phospholipid content. The costaining analysis revealed that VLSs are enlarged endosomes, since they are predominantly labeled by GFP::RAB-5/LMP-1::GFP. Bioinformatic analysis predicted that SGK-1 contains a conserved Phox homology (PX) domain. Mutation either in the PX or the kinase domain of SGK-1 suppress the generation of VLSs in sgk-1 transgene. Additionally, deletion of sgk-1 suppresses the formation of VLSs in rab-10 or rme-1 mutants, further supporting a role of SGK-1 in endocytic trafficking. Besides, the sgk-1 mutant contains greatly increased numbers of - related organelles (LROs) which were suggested to be primarily derived from endosomes, indicating a disrupted function of the endosome in the sgk-1 mutant. Epistatic analysis for the upstream regulators of SGK-1 based on the VLSs phenotype in sgk-1 transgenic and rab-10 mutant animals indicate that the endosomal function of SGK-1 is mainly controlled by TORC2. In summary, C. elegans SGK-1 localizes to endosomes in the conserved TORC2 pathway to regulate the basolateral endocytic trafficking in the intestine.

SUMMARY OF THE STUDY | 1 1 INTRODUCTION

1.1 Serum- and glucocorticoid-inducible kinase

The serum- and glucocorticoid-inducible kinase 1 (SGK1) was originally identified as an immediate early gene transcriptionally stimulated by serum or glucocorticoids or both in Con8.hD6 rat mammary tumor cells [1, 2]. Subsequently, many other factors have been observed to stimulate the transcription of SGK (Table 1). Three closely related isoforms exist for mammalian SGK referred to as SGK1, SGK2, and SGK3, which share 80% amino acid (aa) sequence identity in their catalytic domain. Distinct translational isoforms of SGK have been disclosed differing in regulation of expression, subcellular localization and function [3-6]. The aa sequences of SGKs are conserved through evolution and homologous are found in many other eukaryotic organisms including rodents [1, 7], the amphibian Xenopus laevis (X. laevis) [8], the nematode C. elegans [9], and the yeast S. cerevisiae [10]. The C. elegans genome contains only one gene coding for sgk, referred to as sgk-1 [9]. Its catalytical domain shares around 55% aa sequence identity to human SGK proteins. SGKs display a domain organization placing them into the family AGC kinases although their domain organization varies slightly [11-13]. SGKs contain a central serine/threonine kinase domain, and a C-terminal AGC kinase domain characterized by a consensus hydrophobic sequence. A not well-defined N-terminal domain with one lipid-binding motif for SGK3 is missing in SGK1/2. The N-terminal parts of SGKs are shown to mediate protein-protein interactions [14, 15], translocation to endosomal membrane (SGK3) [16- 18], ubiquitin-proteasome mediated degradation [19], and supposedly can target the protein to mitochondria [20]. A PDK1 phosphorylation site at T256 localized in the kinase domain of SGK1 is critical for its kinase activity. PDK1 itself possesses a region termed the PDK1-interacting fragment (PIF) pocket in its catalytic domain that directly interacts with the phosphorylated hydrophobic motif Thr256 of SGK1 in response to agonists such as insulin and growth factors [12, 21-23]. The C-terminal part of the kinase domain

INTRODUCTION | 2 displays a conserved proline-tyrosine (PY) motif important for protein interaction through its binding to tryptophan-rich WW motifs. The C terminal domain of SGK contains two highly conserved motifs, the proline-rich PXXP motif, and the hydrophobic FXXFTF motif, which have been shown to act as cis-regulatory modules during the interaction of SGKs with other protein kinases [11]. The target consensus phosphorylation site Ser422 of SGK1 by mammalian TORC2 (mTORC2) is localized to the hydrophobic motif of the C terminal domain, and, together with the phosphorylation by PDK1, its phosphorylation is required to achieve full kinase activity [24]. Several E3 ubiquitin protein ligases involved in the fast ubiquitination of SGK have been proposed (Table 2), which include the neuronal precursor cells expressed developmentally downregulated factor 4-2 (Nedd4-2), the C-terminus Hsc70 interacting protein (CHIP) and RICTOR/Cullin-1 complex [25-27]. Nedd4-2 was shown to catalyze the ubiquitination of SGK1 by binding to its PY motif via WW repeat. However, a feedback regulation was suggested in which activated SGK regulated its own ubiquitination and degradation by phosphorylation and subsequent activation of Nedd4-2 [25]. Unlike Nedd4-2, CHIP is not a target of SGK1, but mediates both ubiquitination and proteasome mediated degradation of SGK1 at the endoplasmic reticulum (ER) [27]. Interestingly, RICTOR was shown to couple with Cullin-1 to form a complex with Rbx1 that mediates the degradation of SGK1 in mouse embryonic fibroblast (MEF) cells. RICTOR is the critical component of mTORC2 which promotes the activity of SGK1 via phosphorylation at Ser422. In rictor-/- mutants, the protein levels of SGK1 are elevated, while the activity of SGK-1 is not fully achieved [26]. The SGK consensus phosphorylation sequence has been defined as RXRXXS/T-Z by using in vitro peptide phosphorylation assays, where X stands for any amino acid, R for arginine, and Z indicates a hydrophobic amino acid [22, 28]. Although SGK kinases share the with Akt/PKB kinases, as both recognize similar consensus sequences and common substrates, they predominantly phosphorylate distinct sites in a common substrate for reasons that are not entirely understood yet [22, 29-31]. Two of these substrates identified are the glycogen synthase kinase 3 (GSK3) [30], involved in the

INTRODUCTION | 3 regulation of glucose metabolism, and the forkhead box O (FOXO) transcription factor [9, 29, 31]. Several other targets of SGKs involved in regulation of different physiological function were found in different species. Intriguingly, human SGK1 regulates epithelial Na+ channel (ENaC) indirectly by phosphorylating the ubiquitin ligase Nedd4–2, which otherwise ubiquitinates ENaC, thus preparing the channel protein for clearance from the cell membrane and subsequent degradation [32-34]. The interaction between SGK1 and Nedd4-2 renders its role in regulation of several other channels, such as renal and inner ear Cl-, CLC-Ka channels, and cardiac voltage-gated Na+ channel KCNE1/KCNQ1 [33]. CISK, synonymous for the human SGK3, strongly interacts and colocalizes with the E3 ubiquitin ligase AIP4, which is important for the ubiquitin‐dependent lysosomal degradation of CXCR4, proposing a mechanistic link between the phosphatidylinositide 3-kinase (PI3K) pathway and CXCR4 stability [35]. Furthermore, SGK proteins appear to control the abundance and activity of several carriers and pumps like SGLT1 glucose, SN1 glutamine, EAAT1/EAAT4 glutamate,

EAAT5/ASCT2 aa transporters and Na+-K+ ATPase in X. laevis oocytes [36-42], and GluR1 glutamate receptor in mouse hippocampal neurons to influence cell volume changes important for cardiovascular and neuromuscular function [43]. Additionally, in both the kidney collecting duct (proximal tubules) and gastrointestinal tract it has been shown that mammalian SGK proteins are directly involved in the regulation of integrated functions of insulin and mineralocorticoids which control salt appetite, glucose and fat metabolism [7, 44-47]. Moreover, several neurodegeneration disorders, including Parkinson’s disease and ischemic injury of the brain [48-50], have been linked with high levels of SGK. Increased SGK levels have also been observed in fibrous tissues of pancreas and liver [51, 52]. In addition, the downregulation of SGK has been linked with development of ovarian, prostate, and intestine tumors [53-55]. Roles of SGK proteins in regulating cell proliferation and apoptosis have been proposed as well [29, 56, 57].

Table 1: Stimuli induce expression of SGKs Stimuli or pathways cell or tissue types References

INTRODUCTION | 4 Glucocorticoids SGK1, mammary tumor cells, rodent and human [1, 2] epithelial cells Serum SGK1, mammary tumor cells [2] Aldosterone/mineralocorticoids SGK1, A6 cells, Xenopus [58] Gonadotropins Ovarian granulosa cells [59] Progestin Midsecretory endometrium [60] Medroxyprogesterone SGK1, Mice kidney cortex [61] 1, 2, 5-dyhydroxyvitaimin D3 Human head and neck squamous carcinoma cells [62] (SCC) Chelation of Ca2+ SGK1, human embryonic kidney (HEK) cells [63] Glucose SGK1, human umbilical vein endothelial cells [64] Sorbitol NMuMg mammary epithelial cells [56] Interleukin 6 Malignant human cholangiocarcinoma cell lines [65] KMCH-1 AND Mz-ChA-1 Thrombin SGK1, pulmonary artery smooth muscle cells [66] (PASMC) Endothelin A-10 smooth muscle cells [67] Fibroblast and platelet-derived NIH-3T3 cells [68] Growth factor Advanced glycation end SGK1, mouse CCD cells [69] products (AGE) Inflammatory cytokines Human peripheral blood granulocytes [70] Activation of peroxisome SGK1, human CCD cells [71] proliferator-activated receptor γ Cell shrinkage Human hepatoma cell line [72] Cell swelling SGK1, A6 cells [73] Metabolic acidosis Rat kidney [74] Salt loading of spontaneously Early nephropathy of 17-wk-old SHR/NDmcr-cp, rat [75] hypertensive mice model DNA damage/UV radiation NMuMg mammary epithelial cells [56] Heat shock NMuMg mammary epithelial cells [56] Oxidative stress SGK1, podocyte-associated molecules nephrin and [76, 77] podocin, HEK293T and rat fibroblast Cold temperature SGK-1, C. elegans [78] Ischemia 36 Sprague-Dawley rats [79] Chronic viral hepatitis SGK1, liver [52] Neuronal excitotoxicity Brain, glial cells [80] Neuronal challenge by exposure Rat, spinal cord tissue [81] to microgravity Fear conditioning SGK1, rats [82] Plus maze exposure High and low grooming rats (HG and LG) [83] Eletroconvulsive therapy Rat brain [84] Sleep deprivation Rat brain [84] Fluoxetine Rat brain [84] Rett syndrome Mice brain [85] Organ rejection Rat renal transplantation model [86] Dialysis Human blood, standard haemodialysis [87] Wound healing Mammalian fibroblasts [88] Diabetic nephropathy Mouse kidneys [89] glomerulonephritis Human distal nephron epithelial cells [90] Liver cirrhosis SGK1, liver [52] Fibrosing pancreatitis Pancreatic acinar cells [51]

INTRODUCTION | 5 Crohn’s disease Intestinal mucosal cells [91] Lung fibrosis Lung fibrosis [92] Cardiac fibrosis Mice [93] Transforming growth factor β Xenopus oocytes, intestinal mucosal cells, mouse [89, 91, 94] kidneys Protein kinase C intestinal mucosal cells, NIH-3T3 cells [68, 94] Protein kinase Raf NIH-3T3 cells [68] Mitogen-activated protein MCF10A cells [95] kinase (BMK1) Mitogen-activated protein In vitro kinase assay (E. coli), NIH-3T3 cells [68, 96] kinase (MKK1) Stress-activated protein kinase-2 NMuMg mammary epithelial cells, HepG2 human [97, 98] (SAPK2, p38 kinase) hepatoma cells Nuclear factor of activated T Rat renal medullary cells [99] cells (NFAT) 5 Phosphatidylinositol (PI)-3- Ovarian granulosa cells [59] kinase Cyclic AMP Ovarian granulosa cells, pancreatic cells [51, 59] Extracellular signal-regulated NIH-3T3 cells, mouse embryonic fibroblasts (MEFs) [68, 100] kinase (ERK1/2) p53 Mammary epithelial cells, rat fibroblasts, rat [101, 102] hepatoma cells Cytosolic Ca2+ Pancreatic cells [51] Nitric oxide U973 and mono Mac6 monocytes [103] EWS/NOR (NR4A3) fusion CFK2 fetal rat chondrogenic cells [104] protein

Table 2. Post translational modification of SGKs Regulators Type of modification References PDK1 Phosphorylation at Thr256 of human SGK1, activation [21, 22, 28, 105] mTORC2 Phosphorylation at Ser422 of human SGK1, activation [3, 24, 106] Protein kinase A (PKA) Phosphorylation at Thr369 of human SGK1, activation [107] P38α Phosphorylation at Ser78 of human SGK1, activation [65, 95] Nedd4-2 Ubiquitination [19, 25] CHIP Ubiquitination [27, 108] Cullin complex Ubiquitination [26]

1.2 SGK-1 crosslinks IIS, TRPA-1 and TORC2 in C. elegans

The C. elegans insulin/IGF-1 signaling (IIS) pathway, which is highly conserved in evolution, connects nutrient levels to metabolism, growth, development, longevity, and behavior. The main components include insulin-like peptides (ILPs) which are encoded by more than 40 in C. elegans genome [109]. DAF-2, the insulin/IGF receptor, activation results in recruitment and activation of the phosphoinositide 3-kinase AGE-1. In turn, the serine/threonine kinases PDK-1, SGK-1, AKT-1, and AKT-2 are activated,

INTRODUCTION | 6 resulting in phosphorylation of the DAF-16/FOXO transcription factor. Phosphorylation of DAF-16 regulates its interactions with the 14-3-3 proteins PAR-5 and FTT-2, which control DAF-16 subcellular localization. The DAF-18 lipid phosphatase and the serine/threonine phosphatase PPTR-1 counteracts AGE-1 and AKT-1 signaling, respectively. DAF-16 interacts with a number of transcriptional co-factors in the nucleus to preferentially regulate transcription of its targets. Potential targets of DAF-16 are antioxidant, antimicrobial, detoxification, metabolic genes, and molecular chaperones, which have revealed to impinge on development and metabolism affecting dauer formation, stress resistance, and aging in C. elegans [110, 111]. Epistasis analysis in C. elegans showed that PDK-1 is the activator of AKT-1, AKT-2 and SGK-1 [112]. Besides, it was shown that SGK-1 is activated by and strictly depends on PDK-1, and binds to AKT-1/2 to form a multimeric protein complex [9]. In mammalian cells, both SGK and Akt/PKB can phosphorylate FOXO3A, leading to its inhibition through cytoplasmic sequestration [29]. Accordingly, evidence has shown that the AKT- 1/AKT-2/SGK-1 complex transduces AGE-1 signals via PDK-1 to control the intracellular localization and activation of DAF-16 by phosphorylation [9]. In this respect, AKT-1/AKT-2/SGK-1 compete with a parallel branch within the DAF-2 pathway. It has been shown that knockdown of SGK-1 by RNAi induces nuclear translocation of DAF-16 and extends life span in a DAF-16-dependent manner [9]. However, recent studies have revealed that sgk-1 deletion mutants have a shorter life span than wild type animals [113- 115]. Furthermore, a sgk-1 gain-of-function mutation was shown to extend life span in a DAF-16-dependent manner when animals are incubated at 20°C, suggesting that SGK-1 promotes longevity [116]. Notably, in contrast to akt-1 deletion mutation, which increases the expression of DAF-16 target genes by promoting DAF-16 nuclear translocation [114, 117, 118], sgk-1 deletion and gain-of-function mutations in these experiments did not influence DAF-16 subcellular localization and had different effects on the expression of distinct DAF-16 target genes [116]. A delicate control of SGK-1 functions and activity in response to temperature (cold) and food quality has been proposed to be responsible for these apparent discrepancies [119]. Further studies will be necessary to resolve the

INTRODUCTION | 7 discrepancy between the effects of sgk-1 mutation and sgk-1 RNAi on life span [9, 116]. However, it is beyond dispute that SGK-1 is an important kinase in IIS that controls aspects of development, longevity, and stress response. The cold-sensitive TRP channel TRPA-1 was recently shown to promote longevity at low temperatures (15 and 20°C) in a DAF-16-dependent manner by activating a calcium- dependent kinase cascade involving the calcium-sensitive protein kinase C family member PKC-2 and SGK-1. Although life span extension induced by TRPA-1 activation required DAF-16, TRPA-1 activation did not promote DAF-16 nuclear localization, suggesting that TRPA-1 extends life span by activating nuclear DAF-16. Further analysis via a constitutively nuclear localized DAF-16AM::GFP showed that sgk-1 transgenes extended the lifespan of worms containing DAF-16AM::GFP to a greater extent. The result demonstrates that SGK-1 promotes DAF-16 nuclear activity therefore positioned SGK-1 a necessary component of the cold-sensitive TRP channel [78]. In addition, SGKs have been identified as the direct targets of the TOR, which is a conserved serine/threonine kinase that acts in distinct multiprotein complexes to control cell growth in response to nutrient availability and energy balance. In mammalian cells, insulin and IGF-1 activate mTORC1 through phosphorylation and inactivation of the TSC2 tumor suppressor by Akt [120]. By contrast, whether and how IIS couples to TOR signaling in C. elegans has not been entirely resolved. The long life span of let-363 RNAi treated animals is independent of daf-16 [121]. The rict-1/Rictor mutant showed increased body fat while delayed development, small body size, attenuated brood size and reduced life span, indicating that TORC2 plays a critical role in appropriately partitioning calories between long-term energy stores and vital organismal processes. The high-fat phenotype of rict-1 mutants is genetically dependent on akt-1, akt-2, and sgk-1. Moreover, the life span, growth, and reproductive phenotypes of rict-1 mutants are mediated predominantly by sgk-1, indicating that SGK-1 is the critical downstream kinase of TORC2 as a nutrient-sensitive complex to modulate the assessment of food quality and signal to fat metabolism, growth, feeding behavior, reproduction, and life span [113, 122].

INTRODUCTION | 8 1.3 Intracellular vesicular trafficking

Every cell must eat, communicate with the world around it, and quickly respond to changes in its environment. To help accomplish these tasks, an elaborate internal membrane system endocytic pathway is used to regulate cell surface proteins, such as receptors, ion channels, and transporters. Cells also use the endocytic pathway to capture important nutrients, such as vitamins, cholesterol, iron and macromolecules that are taken up and then transported to endosomes and lysosomes, from where they can be distributed into the cytosol for use in various biosynthetic processes. The endocytic pathway has been strongly connected to signaling, cell dynamics, growth, regulation, and defense. Endocytic processes are linked to almost all aspects of cell life and disease. The endocytic pathway, in its simplest form, consists of three elements: a recycling circuit for plasma membrane components and their ligands, a degradative system for digestion of macromolecules, and a unidirectional feeder pathway involving the trans-Golgi network (TGN) and cytosol for transport of fluids and selected membrane components from the recycling circuit to the degradative system (Figure 1A). Its components, including early endosomes (EEs), late endosomes (LEs), recycling endosomes (REs), and lysosomes, provide a dynamic and adaptable continuum [123]. They are scattered and undergo continuous maturation, transformation, and fusion. Specific protein and lipid components are only partially useful as molecular markers because the majority is either transiently associated with the organelles or follow the organelles through several steps of transformation. The heterogeneity, and lack of synchrony in the endocytic system prevents universally accepted concepts and models for endosome maturation and functions.

INTRODUCTION | 9

INTRODUCTION | 10 Figure 1: (A) The intracellular vesicular trafficking system. The endocytic vesicles deliver their contents and their membrane to EEs in the peripheral cytoplasm. Cargos are sorted at the EEs and either recycled to the plasma membrane (directly or via REs in the peripheral cytoplasm region) or sequestered in the vacuolar parts of EEs. The intraluminal vesicles (ILVs) start to form at the EEs. The LEs are formed inheriting the vacuolar domains of the EEs which harbor selected subsets of endocytosed cargos. There is extensive communication between early/late endosomes and TGN. For example, newly synthesized lysosomal hydrolases and membrane components from the secretory pathway can be retrogradely transported from TGN to LEs and finally reach the lysosome. The maturation process of LEs involves Rab switch, phosphatidylinositol (PI) conversion, homotypic fusion reactions, growth in size, and acquisition of more ILVs. The fusion of LEs with lysosomes generate a transient hybrid organelle, the endolysosome, in which active degradation takes place. Adapted from [124]. (B) Rab5 is activated to its GTP‐bound and membrane‐associated form by the GEF Rabex‐5 on EE membranes. The Rab5 effector Rabaptin‐5 binds to Rabex‐5 and promotes the activation of Rab5, thus forming a positive feedback loop in which more Rab5 molecules are activated and recruited. To initiate the Rab switch, Mon1/SAND‐1 complexed Ccz1 binds to

Rab5, phosphatidylinositol-3-phosphate (PI(3)P), and Rabex‐5, causing disassociation of Rabex‐5 from the membrane. This in turn terminates the feedback loop, resulting in Rab5 inactivation and disassociation. The Mon1/SAND‐1–Ccz1 complex promotes (directly or indirectly) the recruitment and activation of Rab7. Members of the homotypic fusion and protein sorting (HOPS) complex (Vps11, Vps16, Vps18, Vps33, Vps39, and Vps41) are able to bind both Rab7 and the Mon1/SAND‐1–Ccz1 complex. The HOPS complex mediates membrane tethering, required for fusion with other LEs and lysosomes. Adapted from [125]. (C) PI(3)P is synthesized by the kinase VPS34, which forms a core complex together with p150 and Beclin‐1. Dephosphorylation of PI(3)P is catalyzed by members of the myotubularin family. The kinase responsible for conversion of PI(3)P to phosphatidylinositol-3,5-biphosphate (PI(3,5)P2) is PIKfyve. It forms an active complex with its activator ArPIKfyve and the phosphatase Sac3. This complex is required for both the kinase and the phosphatase activities Adapted from [125]. (D) ESCRT complexes are recruited sequentially to the endosome and recognize ubiquitinated transmembrane proteins, passing cargo from one complex to the next to facilitate sorting to ILVs. Deubiquitination of cargoes by the ubiquitin hydrolase Doa4 and disassembly of ESCRTs by the ATPase Vps4 precede invagination. Adapted from [126].

1.3.1 The early endosome EEs are the initial compartments that receive incoming cargos and fluid [127], and are recognized as the main sorting station in the endocytic pathway. How EEs arise is not entirely understood, but the membrane and internal volume are mainly derived from primary endocytic vesicles that fuse with each other. EEs receive endocytic cargos not

INTRODUCTION | 11 only through the clathrin‐dependent or -independent processes, but several other pathways including caveolar‐, GEEC‐, and ARF6‐dependent pathways [128]. Typically, formation of an EE takes about 10 min by fusing with incoming vesicles, during which time some of the content is rapidly recycled, while the rest cargo is either retained or sorted to other destinations [129]. EEs are weakly acidic (pH 5.9–6.8) [130], and contain a relatively low Ca2+ concentration [131]. Most of them are rather small and patrol the peripheral cytoplasm close to the plasma membrane through saltatory movements along [132]. Individual EEs have a complex structure with tubular and vacuolar domains corresponding to the large membrane surface area and much of the volume. Proteins associated with the limiting membrane of EE from the cytosolic surface defines many of its subdomains that differ in composition and function [133], including domains enriched in Rab5, Rab4, Rab11, Arf1/COPI, retromer, and caveolae [134-136]. Rab5 is a key component together with its effector VPS34/p150, a PI(3)K complex that generates the phosphatidylinositol-3-phosphate (PI(3)P) and thus helps to manifest the identity of EE [133, 137, 138]. Rab5 follows the endocytic membrane from the beginning through various stages of EE maturation, and is later the main regulator of the conversion to LE. Subdomains located in the tubular extensions are responsible for molecular sorting and generate vesicle carriers targeted to distinct organelles, including the plasma membrane, the REs, and the TGN [139]. EEs communicate with the TGN through bidirectional vesicle exchange, which is, on one hand, responsible for the delivery of lysosomal , on the other hand removes endosomal components during maturation. This process occurs at the level of EEs, maturing LEs, and possibly for some time after the fusion of LEs with lysosomes. The sorting and vesicle formation for transport to the TGN depends on factors such as Rab7, Rab9, and the retromer complex [139, 140]. Besides, the formation of intraluminal vesicles (ILVs) begins already in EEs. For this the cytosolic surface of the EE subdomain enriched in clathrin and components of the endosomal sorting complex required for transport (ESCRT) machinery is responsible for sorting of ubiquitinated membrane proteins into ILVs [141, 142]. The lumen of the vacuolar EE often contains several ILVs [143].

INTRODUCTION | 12 1.3.2 The early-late endosome transition LEs are derived from the vacuolar domains of EEs. Mature LEs are typically round or oval and have a diameter of 250–1,000 nm [144]. The limiting membrane contains lysosomal membrane proteins such as LAMP1 and the lumen contains a complement of acid hydrolases and numerous ILVs (often up to ≤ 30) with a diameter of about 50–100 nm. The pH ranges between 4.9–6.0 [130]. The formation of a new LE involves a few hallmarks including the Rab GTPase switch, PI conversion, Arf1/COPI association, ILVs biogenesis, acidification, and LE motility. LEs form in the peripheral cytoplasm and continue to undergo a multitude of changes to close down recycling and other functions of EEs and to eventually allowing fusion of LEs with the degradative compartment. Meanwhile, they move to the perinuclear area of the cell where they fuse with each other to form larger bodies and to undergo transient fusions and eventually full fusions with lysosomes and pre‐existing hybrid organelles between endosomes and lysosomes some 10-40 min later [145]. The Rab switch Endosome maturation involves a conversion from Rab5 to Rab7 (Figure 1B) [134, 146, 147]. Initially, Rabex‐5, a GEF for Rab5, is recruited to EEs where it activates Rab5 [148, 149]. In addition to its GEF activity, Rabex‐5 also possesses ubiquitin E3 ligase activity and can bind to ubiquitinated proteins, which is indeed required for its association with EE membranes [150]. The GEF activity of Rabex‐5 is promoted by Rabaptin‐5, a Rab5 effector with which it forms a complex [148]. This complex is required to establish a feedback loop, whereby Rab5‐GTP promotes further Rab5 binding [151]. This causes a rapid recruitment of numerous Rab5 effectors including the VPS34/p150 complex that produces PI(3)P [137, 152], which in turn promotes the binding of a spectrum of proteins with specific PI‐binding domains. Two factors, SAND-1 and CCZ-1, firstly identified as proteins required for vacuole fusion in yeast, and in transport of yolk proteins from EEs to LEs in C. elegans [153, 154], are recruited from the cytosol to endosomal membranes to regulate the Rab conversion in endosomes and phagosomes [147, 155]. The SAND-1 complexed with CCZ-1 to perform multiple roles as bind to Rab5‐GTP to displace Rabex-

INTRODUCTION | 13 5, thereby disrupting the positive feedback loop of Rab5. In the meantime, it binds to PI(3)P and interacts with components of the HOPS complex to promote Rab7 binding by (a) potentially displacing the GDI from Rab7 and (b) activating the VPS39 subunit of the HOPS complex that has been proposed to act as a GEF for Rab7 [156]. As a result, the complex turns off Rab5 while turning on Rab7. The timing of SAND‐1 association with EEs via PI(3)P is critical for the initiation of Rab conversion [147, 157]. This suggests that the concentration of PI(3)P on endosomes may be a determinant defining the timing of the Rab conversion. To inactive Rab5 on endosomes, a Rab5 GAP protein TBC‐2 was shown to be required both during endosome and phagosome maturation in C. elegans [158-160]. It is recruited to endosomes only when Rab7 is already present, thereby allowing coordination of Rab5 inactivation with Rab7 activation [161]. Once established as a domain in the hybrid endosome, Rab7‐GTP recruits its own effectors to proceed the maturation of LEs. These include factors such as RILP, a protein that connects LEs to dynein motors; components of the retromer complex that support vesicle traffic to the TGN; components of the HOPS complex serving as a tether for LE fusion [162]. The phosphatidylinositol (PI) conversion Like the Rab GTPase switch, the PI conversion plays an indisputable role in endosome maturation (Figure 1C). The two important PIs are PI(3)P and PI(3,5)P2 that contribute to the identity of EE and LE membranes, and they are synthesized locally in organelle membranes by the action of specific kinases and phosphatases allowing tight control of compartmentalization [163]. PI(3)P is mostly found on the cytosolic leaflet of EE membranes, generated mainly by a class III PI(3)K, VPS34 [164], which is recruited by Rab5‐GTP through direct interaction with its partner, p150 [137, 165]. VPS34 forms a core complex with p150 and Beclin‐1 that associates with a protein called UVRAG [166, 167], an activator of the HOPS complex. Dephosphorylation of PI(3)P is executed by the myotubularin family of 3‐phosphatases [168]. PI(3,5)P2 is generated by a phosphatidylinositol-3‐phosphate 5‐kinase, PIKfyve, originally characterized in yeast [169]. PIKfyve was later found to play an essential role in the endolysosomal system of C. elegans, D. melanogaster, and mammalian cells [170-173]. Membrane localization of

INTRODUCTION | 14 PIKfyve/Fab1p is mediated by its PI(3)P binding FYVE domain, which links the production of PI(3,5)P2 to existing membranes enriched in PI(3)P. PIKfyve activity is regulated by its activator ArPIKfyve/Vac14p and the PI(3,5)P2 phosphatase Sac3 [174], with which it forms a stable complex critical for both lipid kinase and phosphatase activities [175, 176]. PIKfyve is also able to contribute to the production of PI(5)P [177]. The formation of ILVs The biogenesis of ILVs is critical for the selective sorting of membrane‐associated cargo for degradation in lysosomes. The main players in ILV biogenesis are the ESCRT complexes (ESCRT‐0, ‐I, II, ‐III) and a number of accessory proteins such as the AAA‐type ATPase VPS4 and Alix [178, 179]. The role of the ESCRT machinery is to sort out a cohort of pre‐tagged membrane proteins within the limiting membrane to generate inward‐ budding vesicles (Figure 1D). Sorting is based on the presence of ubiquitin‐tags in the cytosolic domains of membrane proteins recognized by ESCRT-0 machinery, which consists of Vps27/Hrs and STAM1/2, through their various ubiquitin‐binding domains. The ability of the Hrs FYVE domain to bind PI(3)P provides both membrane recruitment and endosomal specificity for the ESCRT-0 complex [180]. ESCRT-0 is the key to the initiation of the multivesicular bodies (MVBs) pathway, not only by binding to ubiquitinated cargo and PI(3)P, but also because it recruits the ESCRT-I complex [33, 136, 181, 182], which is a soluble hetero-tetramer consisting of Vps23/TSG101, Vps28, Vps37 and Mvb12 or ubiquitin-associated protein 1 (UBAP1). UBAP1-containing ESCRT-I appears to be more specific for MVB sorting. Vps28 binds to the GLUE domain of the ESCRT-II protein Vps36/Eap45 and thereby interacts with the ESCRT-II complex. ESCRT-II is a hetero-tetrameric protein complex which consists of Vps36/Eap45, Vps22/Eap22, and two Vps25/Eap20 molecules [183, 184]. The GLUE domain functions as a hub that connects to Vps28 of ESCRT-I and can bind simultaneously to PI(3)P and ubiquitin. In addition to cargo sorting, ESCRT-I together with ESCRT-II is capable of budding membranes into the lumen of giant unilamellar vesicles [185, 186]. The rigid architecture and size of ESCRT-I and ESCRT-II may help to stabilize the bud neck of a growing vesicle. The ESCRT-III complex consists of four core subunits, Vps20/CHMP6,

INTRODUCTION | 15 Snf7/CHMP4, Vps24/CHMP3 and Vps2/CHMP2 and only transiently assembles on endosomes [187]. In vivo and in vitro data suggest a dual role for the ESCRT-III complex during MVB sorting: cargo sequestration within the site of MVB vesicle formation and membrane budding/scission [188-190]. The Vps4 complex consists of the type I AAA- ATPase Vps4 and its co-factor Vta1. Once recruited to the ESCRT-III complex, Vps4 assembles into a dodecamer. It invests the energy from ATP hydrolysis into mechanical power to disassemble the membrane-bound ESCRT-III filament and thereby recycles its individual subunits back to the cytoplasm. After completion of ESCRT-III disassembly, the Vps4 complex also dissociates into its inactive protomers. As such, the Vps4 complex terminates each round of MVB cargo sorting and vesicle formation [191, 192]. It has been proposed that both of the lipids BMP/LBPA and ceramide are able to spontaneously induce formation of ILVs in liposomes independent of ESCRT [193, 194]. However, some components of the BMP/LBPA and ceramide dependent formation of ILVs act redundantly or upstream of the ESCRT machinery [195]. Acidification of endosome-derived organelles The lumens of endocytic organelles and lysosomes are acidic, and the acidification and its regulation constitute an important part of endosome maturation. The low pH not only provides a better environment for hydrolytic reactions, but is also essential for the sorting and routing of cargos, for the inactivation of internalized pathogens, etc. The V‐ATPases are large, complex proton pumps that are responsible for acidification. They consist of a membrane‐associated V0 complex that serves as a transmembrane pore for protons, and a soluble cytosolic V1 complex that binds and hydrolyzes the ATP [196, 197]. The regulation of luminal pH involves adjustment of the V‐ATPase concentration in the membrane, selection of V‐ATPase isoforms, as well as the association and dissociation of the V0 and V1 complexes [198-200]. Since V‐ATPases generate a positive internal membrane potential, acidification is also affected by a variety of independent factors such as Na+/K+ ATPase, and channels for the influx of counter ions such as Cl− or efflux of cations such as Ca2+, Na+, and K+ [197, 201, 202]. It has also been suggested that the

INTRODUCTION | 16 location of V‐ATPase is sensitive to the concentration of cholesterol, since it partitions into detergent resistant membrane domains [197].

1.3.3 Lysosomes Lysosomes, function as the terminal degradative compartment of the endocytic pathway, are also obligate to digest the intracellular material that is segregated during the process of autophagy. Luminal pH is kept at 4.6–5.0 to maintain the acid hydrolases. The lack of mannose-6-phosphate receptors (MPRs) allows distinction from LEs [203]. Several theories have been proposed for mechanisms of transfer of endocytosed material from endosomes to lysosomes, including maturation, vesicular transport, kiss-and-run, direct fusion and fusion–fission events [204-206]. Recently, experiments have shown that kiss-and-run and direct fusion events both contribute to the mixing of the contents of endosomes and lysosomes in living cells [207]. In kiss-and-run events, transient contact of the organelles occurs, followed by exchange of content and then dissociation of the organelles. Current models of lysosome function suggest that the endolysosomes formed as a result of such interactions are the main site of action of the acid hydrolases, with terminal lysosomes being more akin to quiescent storage organelles for these enzymes. Reformation of lysosomes from these hybrid organelles requires retrieval and/or recycling of some membrane proteins by vesicular traffic [207, 208]. Additional functions of lysosome were reported in different cell types. Lysosomes are capable of undergoing fusion with the plasma membrane, a process implicated in plasma membrane repair and defense against some parasites. Some specialized cell types contain lysosome-related organelles (LROs) or secretory lysosomes that contain specialized proteins destined for secretion in addition to acid hydrolases [209]. The cytosolic surface of the lysosome membrane is now recognized as a major site of action of signaling complex mTORC1 that integrates signals arising from nutrients, energy and growth factors [210]. In worms, lipid breakdown in lysosomes has been linked to the promotion of longevity [211].

INTRODUCTION | 17 1.4 C. elegans as a model to study endomembrane trafficking

The free-living soil nematode C. elegans has a number of features make it a perfect model for analyzing complex intracellular and organismal processes and was introduced as a model organism by Sydney Brenner [212]. Experimental evidence proved that the pathways and molecular machineries which regulate numerous aspects of development and physiology are highly conserved between worms and mammals [213]. Thus, C. elegans is a valid model for probing key questions in cell biology and is now indispensable for analyzing various cellular processes such as membrane trafficking. In C. elegans, endomembrane trafficking (EMT) has been studied most extensively in oocytes, early embryos, coelomocytes, and polarized epithelial cells of the intestine [214, 215]. Oocytes The C. elegans oogenesis occurs during the adult stage and entails a tremendous increase in cytoplasmic volume and ultimately produces a maternally provisioned cell that can support early embryogenesis [216]. During the maturation of oocytes and transition from oocytes to embryos, nutrients are provided by other tissues like the intestine. Transport of GFP tagged nutrient components can be followed in vivo, make intestine/germline transport an appropriate model for the investigation of secretion and endocytosis. C. elegans yolk protein expressed specifically in the adult hermaphrodite intestine, and later is transported to the oocytes [217]. In wild type animals, one of the yolk proteins, YP170 (typically fused to GFP in order to follow its transport), is synthesized in the intestine and secreted into the pseudocoelom (body cavity) so that worms show minimal accumulation of YP170::GFP in intestinal cells, display two or three brightly fluorescing oocytes, bright embryos in the uterus, and a dim body cavity. Worms defective in YP170::GFP endocytosis by oocytes display dim or dark oocytes and embryos, while the body cavity of such animals is filled with bright fluorescent YP170::GFP; worms defective in secretion of YP170::GFP by the intestine display an enhanced fluorescence signal from the intestine, and dim or dark body cavity and oocytes/embryos. This phenotype may result from defects in one of the many steps of the transport and its control, such as endocytosis, recycling, or cell surface delivery of the yolk receptor RME-2 in oocytes [218, 219]. Besides,

INTRODUCTION | 18 analyzing the localization of yolk receptor RME-2 in the oocytes helps to differentiate between these possibilities [218, 219]. Therefore, YP170::GFP and RME-2::GFP transgenic worms can be used to study the integrity of the secretory and endocytic pathways [220]. Genome-wide RNAi screens have identified many proteins required for yolk secretion, including COPII proteins SAR-1, SEC-13 and SEC-23, SNARE proteins SNAP-29, SYN-5 and SNAP-25 [218, 221, 222]. Coelomocytes The adult C. elegans hermaphrodite has six coelomocytes: large, ovoid, mesodermal cells situated as three pairs (right, left and dorsal) in the body cavity adjacent to the somatic musculature. The coelomocyte cells appear to be stationary, with fixed anatomical positions and function as scavenger type cells capable of removing numerous macromolecules from the body cavity by endocytosis [223]. Coelomocytes offer the advantage of containing highly active large endosomes, which are easily spotted already at the light-microscope level. The availability of endosomal markers, in combination with the tracing of endocytosed cargos, makes these cells an excellent system to study endocytosis events by live cell imaging in a whole living organism [147, 224]. Based on its phagocytic function, screens which identified mutants with coelomocytes that could not endocytose secretory green fluorescent protein (ssGFP) were performed [223]. In this case the reporter molecule was simple GFP with an N-terminal signal sequence, from the SEL-1 protein, expressed specifically from body wall muscle cells. The coelomocyte uptake defective (CUP) screen identified 14 genes important for endocytic trafficking, including three genes that overlapped with the receptor mediated endocytosis (RME) screen (rme-1, rme-6, and rme-8) [223, 225, 226]. Several studies also investigated the cellular mechanisms of endosomal maturation in coelomocytes. Poteryaev et al. identified the first important regulator, SAND-1, in the Rab conversion process [147]. A similar process involving SAND-1 and its binding partner CCZ-1 occurs during phagosome maturation was also investigated [155]. Moreover, a genetic screen for HOPS subunit VPS-18 suppressor has identified two novel factors of the endosome-lysosome

INTRODUCTION | 19 pathway, SORF-1 and SORF-2, which are essential for maintenance of proper PI(3)P levels in early-to-late endosome conversion [224, 227]. Intestine Beyond the work described above, most research on endocytic recycling mechanisms has focused on the C. elegans intestine [214]. The intestine is an interesting object for the study of membrane traffic, because it is a polarized epithelial tube, and thus maintains two distinct plasma membrane domains: apical and basolateral (WormAtlas). Apical junctions separate the two domains and are thought to prevent lateral diffusion of protein and lipid components between the apical and basolateral membranes [215]. The C. elegans intestine is a relatively simple epithelial tube made up of 20 epithelial cells arranged mostly in pairs to form nine rings. The apical membranes of the intestinal cells form the intestinal lumen, which is characterized by a microvillar brush border covered with a specialized extracellular matrix called the glycocalyx. The brush border is supported from underneath by a subapical terminal web composed of actin and intermediate filaments. The basolateral membrane contacts the body cavity. Nutrients and other molecules absorbed or produced by the intestine must be exchanged via the basolateral membrane to reach the other cells of the organism. These 20 differentiated enterocyte cells are thought to be maintained for the life of the animal and are not replaced. Several transmembrane cargo proteins have been established to monitor the basolateral traffic in the intestine. These include the human proteins human IL-2 receptor α-chain (hTAC) which enters cells using clathrin-independent endocytosis (CIE), and human transferrin receptor (hTfR) which enters cells using clathrin-dependent endocytosis (CDE) [228-230]. hTAC and hTfR are known to recycle using basolateral REs. They accumulate in such endosomes in rme-1 mutant animals [228, 231]. The endogenous C. elegans protein MIG-14 has also been used as a model cargo for CDE from the basolateral membrane of the intestine [232-234]. MIG-14 appears to bind to Wnt ligands in the Golgi and chaperone them to the cell surface for release, then it recycles to the TGN using a retromer- dependent mechanism and enters the degradative pathway in case of recycling failures [231, 232, 235]. In addition, TGN-38 and Furin were also introduced to investigate EMT.

INTRODUCTION | 20 It was shown that TGN-38 was transported from the EE to the TGN via RE, whereas Furin recycling involved transit from the EE to the LE, then to the TGN [236, 237]. Additionally, server markers for specific phospholipids were generated. The subcellular distribution of PI(4,5)P2 in the C. elegans intestinal cells can be visualized with PH(PLCδ)::GFP, which contains the PI(4,5)P2-specific binding PH domain of the rat phospholipase Cδ. The subcellular localization of PI(3)P and PI(3,4,5)P3 can be monitored by biosensors GFP::2xFYVE (2 times FYVE domain from mouse HRS) and PH(Akt)::GFP (pleckstrin homology domain of Akt) [230]. In addition, various marker proteins including Rab GTPases tagged with fluorescent proteins were developed and extensively use in the investigation of EMT in the intestine of C. elegans. Recent years have marked an explosion in membrane trafficking data from C. elegans studies and many of them have identified novel mechanisms that conserved also in mammals. To integrate basic cell biological information with analysis of higher order development and physiology will shed the light on understanding how trafficking regulates, and is regulated by, the development and functions of differing cell types and tissues.

1.5 Aim of the study

This study aims to explore and specify the function of C. elegans serum- and glucocorticoid-inducible kinase-1 (SGK-1). In higher organisms SGK proteins have been suggested to be involved during manifold cellular processes including cellular stress response, cell proliferation, cell differentiation, and cell death [29, 49, 56, 57]. However, the molecular and cytological mechanisms underlying the function of SGK are only partly understood. Since in C. elegans only one gene coding for SGK, the functional analysis of sgk-1 in this model organism may provide a better insight into the role of SGK in various developmental and physiological processes. In one attempt to address its function during C. elegans development, several aspects of physiology of the sgk-1 deletion and overexpression mutants were analyzed by assessing brood size, body size, lipid metabolism and endomembrane trafficking. A further goal of the study was to explore the detailed mechanism of sgk-1 to regulate the endocytic

INTRODUCTION | 21 trafficking in the intestine of C. elegans. To reveal the regulation of sgk-1 activity, genetic interactions with IIS, TORC2 and TRPA-1 in C. elegans were analyzed. And the genetic position of sgk-1 within a conserved pathway controlling intracellular trafficking was addressed. In essence, this study aimed at developing a model which links the high expression level of SGK-1 with endocytic trafficking that many physiological diseases associated. And the discovery may shed the light on elucidating the elevated SGK levels in cancer development.

INTRODUCTION | 22 2 MATERIAL and METHODS

2.1 Material

C. elegans strains, oligonucleotides, plasmids, bacteria strains, mammalian cell lines and softwares used in the study are listed in the APPENDIXES. If not stated otherwise, chemicals and reagents for standard laboratory use were of highest purity and purchased from Carl Roth, Merck, Sigma-Aldrich, VWR, Thermo Fisher Scientific, Qiagen, Roche Diagnostics and highQu. Antibodies were obtained from Abcam, Clontech and Sigma. Resins were purchased from GE Healthcare BioScience. LysoTracker was purchased from Thermo Fisher Scientific.

2.2 Culture and maintain C. elegans

All strains were maintained at 15°C or 20°C on nematode growth medium (NGM) agar plates (3 g/l NaCl; 17 g/l agar; 2.5 g/l bacto-peptone; 5 μg/ml cholesterol; 1 mM CaCl2;

1 mM MgSO4; 5 mM KH2PO4 (pH 6.0); 20 μg/l nystatine) seeded with (E. coli) OP50 unless otherwise indicated [212]. OP50 bacteria were overnight cultured in double yeast tryptone (DYT) medium (16 g/l bacto-trypton; 10 g/l yeast extract; 5 g/l NaCl) at 37°C, 180 rpm. NGM agar plates were seeded with grown OP50 and dried overnight at room temperature (RT). For decontamination of C. elegans strains, animals were treated with alkaline hypochlorite (0.5 N NaOH; 1% NaClO) and synchronized L1 larvae were spotted onto NGM plates seeded with OP50 and inspected visually before starting a new experiment. For synchronizing L1 larval, egg-prep was performed. Gravid adult hermaphrodites were collected with M9 buffer (3 g/l KH2PO4; 6 g/l Na2HPO4; 5 g/l NaCl (pH 6.0); 1 mM

MgSO4) in 15 ml falcon tubes. After 3 washing steps (centrifugation at 1000 rpm) worms were resuspended in 4 ml deionized water to which 4 ml of 2x bleaching solution (10 ml stock solution: 0.5 ml 5 N NaOH, 0.2 ml NaClO (12%), 9.3 ml deionized water) were added. Worms were shaken vigorously on a vortex mixer for 10-15 min until most of

MATERIAL and METHODS | 23 worms were dissolved. Eggs were washed in M9 buffer 4 to 6 times, resuspended and transferred to fresh 15 ml falcon tubes. Then tubes were kept on a rotation mixer at 20°C. The next day synchronized hatched L1 larvae were placed onto NGM seeded with OP50. To get synchronized day one adults, L4 larval at well-fed condition were picked and transferred to fresh OP50 plates and allowed to grow for 24 h.

2.3 Genetic cross and backcross

For genetic crosses C. elegans L4 hermaphrodites were mated with males at a ratio of 1:4 on small NGM (Ø 3.5 cm) seeded with OP50 at 15°C or 20°C. Worms were transferred to a fresh plate 24 h after mating and males were removed 3 days later. Progeny laid within the first 24 h were discarded due to high percentage of self-progeny versus cross progeny. Mating was considered as successful when occurrence of male progenies is close to 50%. From the plate with the highest occurrence of males, 4 L4 larvae (F1 animals) were singled on fresh plates and were allowed to grow to adulthood and produce the F2 generation. After egg-laying commenced, F2 animals were tested with genotyping PCR if the crossing entailed gene mutations. Or the progeny were examined under the fluorescent microscope to determine the marker segregation if the crossing entailed fluorescent marker strains. Homozygosity of expected mutant was confirmed in subsequent generations by phenotype analysis and/or PCR.

Genetic backcrosses were performed with laboratory Bristol N2 wild type strain with the method described above.

2.4 RNA interference

To prepare RNAi plates, the RNAi clones were inoculated from ORFeome/Ahringer library, single colonies of respective genes from LB plates contains ampicillin antibiotics were picked and confirmed by sequencing. The overnight culture (37°C, 180 rpm) of validated RNAi bacteria in LB medium supplemented with 12.5 μg/ml tetracycline and 25 μg/ml carbenicillin were prepared, and the next day the overnight culture was diluted with a ratio of 1:100 in LB medium supplemented with 25 μg/ml carbenicillin for another

MATERIAL and METHODS | 24 2 h at 37°C, 180 rpm, then 1 mM IPTG was added to the bacteria medium and continue culturing for 4 h. Bacteria were then seeded on small NGM plates (Ø 3.5 cm) containing 1.0 mM IPTG and 50 μg/ml carbenicillin and dry overnight at RT. To knockdown a gene, L4 worms were transferred to RNAi plates and the next generation were analyzed.

2.5 Generation of transgenic strains via microinjection

Transgenic animals were constructed by germline transformation using the gonad microinjection method as previously described [238]. The respective construct was injected into animals along with about 20 ng/μl pRF4 as a coinjection marker (if not mentioned otherwise). The coinjection plasmid pRF4 contains rol-6(su1006) allele, leading to a knockout of a collagen type IV, causing the phenotype of rolling worms [238]. The allele is semi-dominant, thus animals of the F1 generation expressing the coinjection marker would roll already and can be singled out on a plate and monitored until the next generation (F2). Individuals transferring the marker to the F2 generation were considered to contain a stable extrachromosomal transgene.

2.6 Integration of strains with γ-irradiation

To integrate extra chromosomal arrays into the genome, γ-irradiation from a Cesium source was used (ZKF, Uniklinik Freiburg). γ-irradiation leads to double-strand DNA break and integration of extrachromosomal copies into the via the subsequent DNA repair process [239]. Typically, 20 late L4/young adult animals from a low penetrance array were transferred per 10 cm NGM plate seeded with OP50, and 10 plates were used each strain, irradiated with 30 Gray. The worms were recovered and incubated at 20°C to produce progenies. After 10-14 days, wash off the worms from the plates with M9 and recover on a new set of 10 plates (Ø 10 cm). Then 20 animals with corresponding phenotype from each plate were singled onto a small NGM plate (Ø 3.5 cm) seeded with OP50 with a total number of 200. The progeny of those 200 animal were analyzed for 100% transmission expression of the transgene. Stable lines that originated

MATERIAL and METHODS | 25 from separate big plate were considered to represent independent integration events and were assigned a unique Is number (standing for integrated strain).

2.7 Genotyping

Single worm PCR (SW-PCR) was used for genotyping C. elegans alleles during genetic cross or outcross procedures. Single worms were transferred into a PCR tube containing

5 μl worm lysis buffer (10 mM Tris, pH 8.2, 50 mM KCl, 2.5 mM MgCl2, 0.45% NP-40, 0.45% Tween 20, 0.01% gelatin, 0.5 mg/ml proteinase K) on ice, follow by incubation at 65°C for 1 h. For inactivation of the proteinase K samples were incubated at 95°C for 5 min. Mutants harbor deletion alleles were detected with the combination of three specific primers, two flank the deletion and the third binds within the area that has been deleted. And point mutations were validated with tetra-arm PCR as was described [240]. Primers (lyophilized) were ordered from Sigma-Aldrich and dissolved in deionized water. Primers were stored as 100 μM aqueous stocks (-20°C) and diluted to 10 μM for using. DNA polymerase was purchased from Genaxxon (TaqS polymerase); dNTPs were purchased from MBI Fermentas and stored as dNTP mix (2 mM aqueous stock). PCR reactions were performed according to the given table and analyzed with standard DNA gel electrophoreses. PCR System Volume (μl) DNA template 1.0-2.0 (from worm lyses) 10xBuffer with MgCl2 2.5 dNTPs 2.5 Primer mixture 2 Taq polymerase 0.125 ddH2o add up to 25 PCR program 94°C 5 min 94°C 30 s 50-70°C 30 s 35x 72°C 1 kb/min 72°C 7 min 4°C infinite

MATERIAL and METHODS | 26 2.8 Molecular cloning

Standard molecular cloning techniques were implemented following manufacturer’s protocols [241]. The DNA fragment of interest was amplified by PCR using oligonucleotides with specific restriction digestion sites. Genomic DNA, cDNA or fosmid DNA were used to amplify the corresponding fragments of interest. The ALLinTM HiFi DNA polymerase was used for DNA amplifications (highQu). For digestions (MBI Fermentas Inc), typically, 1 μg of DNA was digested per reaction. In case of self-ligation, the 5’ ends of the digested vectors were dephosphorylated with alkaline phosphatases (AP) according to the supplier’s instruction (Roche). The digestion and dephosphorylation reactions were terminated by incubating at 65˚C for 15 min. The desired products were obtained after separation by gel electrophoreses, following excision of the expected band with a scalpel and purification with a Gel Extraction Kit (Qiagen) according to manufacturer’s instruction. Ligation of the desired digestion products was performed by using the Rapid DNA Ligation Kit (Thermo Fischer Scientific) according to manufacturer's instruction. For an optimal ligation the molar ratio between vector and insert is 1:5 with a total amount of 200-300 ng DNA. 5 units of T4 ligase were used in a reaction volume of 20 μl. The mixture was incubated at RT for 15 min, and an aliquot of the ligation reaction was directly used for bacterial transformation. Aliquots of chemically competent cells TOP10 or DH5a (Invitrogen) were used, according to the standard calcium chloride transformation method [241]. To identify positive clones, either single colony PCR or restriction digestion of previously isolated plasmids using Plasmid Mini Prep Kit (Qiagen) was performed. Positive clones were sequenced by GATC Biotech AG (Konstanz). To introduce point mutation into a plasmid backbone, Gibson Cloning or Quick Change XL Site Directed Mutagenesis Kit were used according to the supplier’s instructions (NEB and Agilent).

2.9 Fractionation and immunodetection

To prepare the large amount of fraction for C. elegans, 5 NGM plates (Ø 10 cm) with well- fed worms at different developmental stages were collected and washed 3-5 times with

MATERIAL and METHODS | 27 M9 buffer to remove E. coli cells. Then worms were pelleted at 2000 rpm (Sorvall Evolution RC) for 2 min at 4°C, frozen in liquid nitrogen, and may store at -80°C. To prepare native protein extracts, worm pellets were resuspended in lysis buffer (50 mM Tris-HCl, pH 8.0; 150 mM NaCl; 1% (v/v) NP-40, add protease and phosphatase inhibitor freshly), cracked by Silent Crusher S homogenizer (Labotal Scientific Equipment). The soluble fraction was separated by centrifugation at 13,000 rpm (Sorvall Evolution RC) for 15 min at 4°C. The supernatant was transferred to Eppendorf tubes, frozen in liquid nitrogen and may store at -80°C. To prepare C. elegans sample for Western blot, typically 30 synchronized worms of each strain were transferred to an Eppendorf tube with 20 μl Laemmli buffer, then the protein samples were denatured by incubation for 5 min at 95°C. Proteins were separated by sodium dodecyl sulphate polyacrylamid-gel electrophoresis (SDS-PAGE) following the standard protocols [241]. Protein samples were denatured by incubation for 5 min at 95°C in 2x Laemmli buffer and separated by SDS-PAGE with a constant currency of 20 mA for 1 h and either visualized by Coomassie brilliant blue staining or Western blot. For Western blot, proteins samples were transferred from the gel onto a membrane made of polyvinylidene difluoride (PVDF) (Millipore), previously activated with methanol (Sigma-Aldrich), and the transfer was performed in transfer blotting buffer A and K (ROTH, Germany) with a constant current of 0.2 A at RT for 1 h (varies according the size of protein interested), using semi-dry blotting approach according to manufacturer´s instruction (Bio-Rad). After blocking with 5% nonfat milk (ROTH) in TBST (20 mM Tris-HCl, 150 mM NaCl, 0.1% Tween-20, pH 7.5) at RT for 1 h, the membrane was incubated with the primary antibody which was diluted with 5% BSA in TBST depending on the sensitivity of the antibody at 4°C overnight. Followed by washing 3 times with TBST and incubated with the secondary antibody diluted in blocking buffer at RT for 1 h. After washing the membrane 3 times with TBST, image was developed with either SuperSignal West Femto Maximun Sensitivity Substrate or Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific) and detected with ImageQuant LAS 4000 min (GE Healthcare Life Sciences).

MATERIAL and METHODS | 28 2.10 Quantitative real time polymerase chain reaction

Quantitative real-time PCR (qRT-PCR) was used to quantify the relative transcription level of sgk-1 gene in wild type worms upon different culturing conditions. To prepare the total RNA, synchronized animals were grown on large NGM plates (Ø 10 cm) seeded with OP50. Day one adults were collected and washed with M9 5 times (2000 rpm, 1 min) in 15 ml falcon tubes, and then transferred to Eppendorf tubes and spin down (8000 rpm, 1 min). The supernatant was discarded and 800 μl RLT buffer from RNeasy Mini Kit (Qiagen) with 1% β-mercaptoethanol (2-ME) was added to resuspend the pellet. Worms were cracked by Silent Crusher S homogenizer (Labotal Scientific Equipment) and centrifuged for 3 min at 13,000 rpm. The supernatant was transferred to a new Eppendorf tube, supplemented with the same volume of 70% ethanol and total RNA was exacted according to the manufacturer's instruction (Qiagen). RNA concentration was measured at 260 nm in a 1:100 dilution and stored at -80°C or immediately transcribed into cDNA. cDNA was synthesized from 1 μg of total RNA of the respective strains and was carried out using Transcriptor High Fidelity cDNA Synthesis Kit according to the manufacturer’s protocol (Roche). qRT-PCRs were conducted with the Absolute QPCR SYBR Green Mix (Thermo Fisher Scientific). Primer pairs were designed with the Universal Probe Library Assay Design Center (www.roche-applied-science.com). A diluted primer premix was prepared (1.5 μM) from the 100 μM primer stocks. qRT-PCR of each sample was conducted in triplicates with the Rotor-GeneTM3000 Real Time Thermal Cycler (Corbett Research) as is shown following. Samples were normalized to the housekeeping gene act- 4. The evaluation was performed according to the comparative ct method [242]. All the tests were repeated 3 times and standard curves, which indicate the qPCR efficiency, for both sgk-1 and act-4 were made in each round of the test. The relative mRNA level of sgk- 1 was calculated using Microsoft Excel and the comparative 2−ΔΔCT quantification method [243]. PCR System Volume (μl) SYBR mix 10 Primer mix 0.08 cDNA 2

MATERIAL and METHODS | 29 ddH2o 7.92 Program 95°C 7 min 95°C 15 s 55°C 15 s 45x 72°C 20 s 4°C infinite

2.11 Brood size and body size assays

To determine the brood size, each of 5 L4 hermaphrodites (P0) were placed onto 6 NGM plates (Ø 3.5 cm) seeded with OP50 and incubated at 20°C. Worms were transferred every day onto new plates until no eggs were laid. The progeny of each 5 animals were counted one to three days after removal of the P0 generation [244]. For measuring the body size, 30 L4 larvae were transferred and kept on NGM plates (Ø 3.5 cm) seeded with OP50 and then cultured at 20°C for 24 h. The DIC images of day one adults were taken under compound microscope with 10x magnification objective. The body size was measured with ImageJ (1.51s) based on the free hand selection of interested area.

2.12 LysoTracker staining

LysoTracker staining was conducted as described previously [113]. Briefly, LysoTracker (Red DND-99 or Green DND-26, 1 mM, Thermo Fisher Scientific) was diluted in M9 to make the fresh stock with a concentration of 40 μM and protected from light. For each strain, 200 μl LysoTracker stock were added onto each of 3 NGM plates (Ø 3.5 cm) seeded with OP50 to a final concentration of 2 μM. After dried out at RT for 2 h (protected from light), L4 larvae were then transferred to LysoTracker plates and incubated at 20°C for 24 h. The staining phenotypes were investigated at the day one adult stage. Amount of acidified organelles were represented by the intensity of red or green fluorescence in the intestine of worms. Worms without staining were used as the control to measure the proper exposure time.

MATERIAL and METHODS | 30 2.13 Microscopy

For compound microscopy, levamisole (0.25 mM) dissolved in M9 was used to immobilize animals which were then analyzed with Axio Imager Z1 compound microscope (Carl Zeiss) using the appropriate objectives and filters. Micrographs were recorded with an AxioCam MRm3 CCD camera. For confocal microscopy, images were acquired with a Nikon A1 CLEM confocal microscope and NIS-Elements AR 4.0 64-bit software using a 60x oil objective unless otherwise stated. Within each group of reporter strains the laser power and PMT values were kept constantly, always avoiding clipped pixels. For all strains, z-stack images were acquired with the suggested interval according to the setup of the confocal system.

2.14 Image analysis

ImageJ (1.51s) was used to quantify the fluorescence intensity of C. elegans reporter strains. The mean fluorescence intensity of each worm was measured with the subtraction of background fluorescence. To determine the body size of worms, the contour of each animal was drawn with freehand selection tool in the DIC channel. For confocal images, deconvolution analysis of the z-stack images was done by Huygens Essential 14.10 (Scientific Volume Imaging) based on a manually measured point spread function (PSF). Then the images were analyzed with ImageJ (1.51s) according to purpose of the experiment as is indicated [245].

2.15 Mammalian cell culture and transfection

All mammalian cell lines were cultivated according to the protocols of the American Type Culture Collection (ATCC) under sterile conditions in flow work-benches. However, cells were normally split more sparsely than recommended by ATCC in the ratio 1:10. All treatments on cultured cells were performed under sterile conditions. HEK293T and JIMT-1 cells were cultured in DMEM (4.5 g glucose/l) supplemented with 10% fetal bovine serum (FBS) and 1.5% (v/v) L-glutamine, and were incubated at 37°C in a humidified atmosphere containing 7.5% CO2.

MATERIAL and METHODS | 31 For cryopreservation of cell lines, cells were grown to a confluency of approximately 80%, trypsinised and centrifuged at 600 rpm for 3 min at RT. The supernatant was carefully removed and the pellet of one 10 cm dish was resuspended in 2 ml of pre-cooled (on ice) cryopreservation buffer (90% full medium and 10% DMSO). 2x 1 ml cell solution was pipetted in two cryovials and immediately put on ice. For storage, cells were put in a cryopreservation box filled with pre-cooled isopropanol or in a polystyrene box and put at -80°C immediately after the cryopreservation procedure. Ultimately, cells were transferred to a liquid nitrogen tank. For thawing, cells were shortly warmed in water bath at 37°C, the outside of cryovials was carefully cleaned with 70% ethanol and 1 ml of cryopreserved cells was resuspended in 9 ml of pre-warmed (37°C) medium. The cell solution was centrifuged at 600 rpm for 3 min at RT. The supernatant was carefully removed and cells were resuspended in 10 ml of pre-warmed medium. 2 and 8 ml cell solution were distributed into two 10 cm dishes and filled up to 10 ml per dish with full medium respectively. Transfection of HEK293T cells with plasmid DNA was performed using ietPEI reagent (Polyplus, France). jetPEI is a cationic polymer that forms complexes with negatively charged DNA which are subsequently taken up by the cell via endocytosis. Transfection was performed according to the manufacturer’s instruction and cells were lysed 72 h post-transfection.

2.16 Bioinformatics

The database of the C. elegans model organism Wormbase (http://www.wormbase.org) was used to search for C. elegans genes. The protein domain architecture was explored by using Simple Modular Architecture Research Tool (SMART) (http://smart.emblheidelberg.de) or InterPro (https://www.ebi.ac.uk/interpro/). National Center for Biotechnological Information (NCBI) was used to BLAST analysis of protein or DNA sequences, genome surveys and pattern searches (http://ncbi.org). Sequence alignments were conducted with Clustal Omega (http://www.ebi.ac.uk/Tools/services/web/toolform.ebi?tool=clustalo) and were

MATERIAL and METHODS | 32 graphically displayed as dotblots, using the EMBOSS dotmatcher program (http://emboss.sourceforge.net/). The UniProt database (http://www.uniprot.org/) was used to retrieve information concerning human proteins. To design primer for qRT- PCR the software from http://www.roche-appliedscience.com/pcr/application web page was used. For DNA cloning design and analysis, Unipro UGENE v1.29.0 was used [246].

2.17 Statistical analysis

To investigate if the difference between means of two groups of samples were significant paired/unpaired two-tailed t-test or one sample t-test (for normalized data) was performed using GraphPad Prism 7 (GraphPad Prism Software Inc). One-way ANOVA with Tukey post-hoc test was used for comparisons between three or more groups, when the distributions were normal (according to the D’Agostino & Pearson normality test). In case of non-parametric distributions, Kruskall-Wallis ANOVA with Dunn’s post-hoc test was used instead. In all bar column graphs, the error bars depict the mean of standard error (SEM) while in all bar scatter graphs the error bars depict the mean of standard deviation (SD). For all statistical tests the 0.05 level of confidence was accepted as a significant difference.

MATERIAL and METHODS | 33 3 RESULTS

3.1 Overexpressing SGK-1 leads to VLSs in the intestine of C. elegans

To monitor sgk-1 expression and SGK-1 localization, GFP-tagged transgenes were generated. For this purpose, several transgenic lines of sgk-1 including both transcriptional and translation fusion reporters were produced. For the transcriptional reporter, a 4.0 kb upstream the start codon of sgk-1 was cloned into pEGFP-C1 to generate pBY3666 (Fig. 3.1A). For the translational fusion the full genomic coding sequence of sgk- 1 was sequentially inserted into pBY3666 in frame of GFP to get a N terminal tagged GFP::SGK-1 fusion reporter (pBY3707, Fig. 3.1A). In addition, a GFP::sgk-1(cDNA) fusion construct driven by endogenous was also generated (pBY3667, Fig. 3.1A). The sgk-1 constructs were microinjected into wild type N2 and sgk-1(ok538) deletion mutant animals along with a coinjection marker harboring the semi-dominant rol-6(su1006) mutation [238]. At least three independent extrachromosomal transgenic lines per construct were generated (see chapter: 7.3 Strains). Transgenic expression of SGK-1 translation fusions resulted in the formation of vacuole- like structures (VLSs). VLSs were observed in the intestine of worms that express transgenic SGK-1 (both N and C terminal GFP-tagged SGK-1), but not in the wild type

N2 and sgk-1(ok538) animals (Fig. 3.1B and C, arrows). To validate that the VLSs were indeed induced by overexpression of SGK-1 rather than GFP, transgenic animals expressing the transcriptional reporter, Psgk-1::GFP, were generated. The respective transgene expresses GFP, but not sgk-1, under the control of the sgk-1 promoter. Transgenic animals were inspected at day one adult stage and no VLSs appeared in the intestine (Fig. 3.1C and D). The results suggest a SGK-1 dependent phenotype in the intestine of C. elegans, but could in principle also result from an aberrant behavior of the GFP-tagged SGK-1 gene product. To eliminate a contribution of the GFP-tag to the phenotype, SGK-1 without any tags was expressed from an equivalent promoter construct. Transgenic strains were generated harboring the genomic coding sequence of

RESULTS | 34 sgk-1 driven by the endogenous promoter (pBY3847: Psgk-1::sgk-1, Fig. 3.1A, see chapter: 7.5 Plasmids) and maintained as extrachromosomal arrays (BR7454-7456, see chapter: 7.3 Strains). Generation of VLSs in the intestine was strongly penetrant (Fig. 3.1B and D). This suggests that the VLSs observed in the intestine of worms were induced by excess expression of SGK-1. The diameter of the VLSs varies greatly. I observed VLSs with diameters between several hundred nanometers (which I termed "small") while they can be as big as 20 m (Fig. 3.1C). Almost all VLSs in the intestine are spherical structures, shaped like bubbles. However, in rare situations, some VLSs showed irregular shapes. Interestingly, I observed a strong staining for GFP-tagged SGK-1 at the borders of the VLSs resulting in a ring-like appearance (Fig. 3.1C). However, in most cases staining was not uniform, but seems to show preferred punctual localization (Fig. 3.1C, arrow heads). This raft-like local preference of SGK-1 might possibly represent a specialized function of SGK-1 at these VLSs. To obtain more uniform expression and penetrance, the BR2773 (Psgk-1::sgk-1::GFP, see chapter: 7.3 Strains) transgene was integrated into the genome of adequate worm strains using γ-irradiation. We obtained two independently integrated lines for sgk-

1::GFP which were then backcrossed to wild type N2 worms 10 times each to get rid of possible background mutations caused by the insertion events. The two lines (RB6575, BR6580, see chapter: 7.3 Strains) were further analyzed for the VLSs. Compare to the wild type worms, in each of the two lines available more than 80% animals showed VLSs in the intestine (Fig. 3.1D). These can been seen at all developmental larval stages following hatching. The penetrance and number of VLSs were quantified during development, which the day one adult animals displayed both the highest penetrance and number of VLSs (Fig. 3.1E, F and G). Since overexpression of SGK-1 leads to VLSs formation in the intestine, one possibility was that increased protein level of SGK-1 may also elevate the kinase activity in the transgenic worms. Increased kinase activity was also suggested for the only available sgk- 1 gain-of-function strain, sgk-1(ft15), although this has never been proven, nor did sgk- 1(ft15) behave like a true gain-of-function allele in all assays tested [113]. However, I did

RESULTS | 35 not find any VLSs in the intestine of day one adult animals harboring this allele (Fig. 3.1B). Surprisingly, the penetrance of VLS generation was temperature-sensitive, with decreased penetrance at 20°C compared to 15°C (Fig. 3.2A). To test whether VLS penetrance correlates with expression levels, SGK-1::GFP expression levels at the various growth temperatures, 15°C, 20°C, and 25°C, were determined. The average fluorescence intensity at 20°C and 25°C was normalized to that of 15°C. A decreased mean intensity of fluorescence was observed at the higher temperatures (Fig. 3.2B). Notably, the penetrance of VLSs at 15°C and 20°C correlated to the mean fluorescence intensity of sgk- 1::GFP. The increased fluorescence intensity of sgk-1::GFP at 15°C could be induced by intrinsic regulation of SGK-1 or the artificial effect of the GFP tagged recombinant protein in the transgenic worms. To distinguish these possibilities, I performed qRT-PCR for the wild type N2 worms to measure the relative mRNA levels of sgk-1 at these conditions, using act-4 as the reference mRNA. mRNA level of sgk-1 in worms cultured at 20°C was about 60% of that cultured at 15°C. Worms grown at 25°C showed only 45% expression compared to 15°C (Fig. 3.2C). This suggests that sgk-1 expression is inversely controlled by temperature, a novel finding that has not been reported before. In contrast, Western blot analysis of endogenous SGK-1 in the N2 worms showed that the relative SGK-1 protein level decreased significantly with the increasing of temperature (from 15 to 25°C, Fig. 3.2D and E). From these results I conclude that overexpression of sgk-1 induces intestinal defects designated as VLSs, of which the penetrance inversely correlated with the culturing temperature. And the protein level of transgenic sgk-1::GFP behaves similar to the endogenous sgk-1 in the wild type worms when responses to temperature change.

RESULTS | 36

Figure 3.1: Overexpression SGK-1 results in VLSs in the intestine of worms. (A) Scheme for the constructs of sgk-1. (B) DIC images for the intestines of wild type N2, sgk-1(ok538), sgk-1(ft15) (sgk-1 gain-of-function

RESULTS | 37 mutant) and Psgk-1::sgk-1(BR7454, see chapter: 7.3 Strains) worms. Arrows represent VSLs. (C) Images for transcriptional and translational transgenes of sgk-1 acquired by compound microscope in both DIC and GFP channels. Arrows indicate VSLs. Psgk-1::GFP, BR5519; sgk-1::GFP, BR6575; GFP::sgk-1, BR6662, see chapter: 7.3 Strains. (D) Penetrance of VLSs at day one adult stage for the respective strains. More than 30 L4 worms were picked and transferred to a fresh NGM plate seeded with OP50 and were cultured for 24 h. Thereafter, the worms were inspected and penetrance of VLSs was counted under a compound microscope with a 20x magnification objective in the DIC channel. Worms had been cultured at 15°C. (E) DIC images for VLSs at all the stages of the integrated transgene sgk-1::GFP. (F) Penetrance of VLSs in sgk- 1::GFP animals for all the stages. sgk-1::GFP integrated strain were cultured at 15°C unless otherwise indicated. (G) Number of VLSs at different developmental stages in individual sgk-1::GFP animals. Scale bar, 50 µm.

RESULTS | 38

Figure 3.2: Expression level of SGK-1 negatively correlates to the incubation temperature. (A) Penetrance of the VLSs in day one adult worms of sgk-1::GFP that were raised at different temperatures. (B) Relative fluorescence intensity in day one adult worms of sgk-1::GFP which were raised at different temperatures.

(C) qRT-PCR for measuring the mRNA levels of sgk-1 in N2 worms that were raised at different temperatures. act-4 was used as the reference mRNA to quantitate the relative sgk-1 mRNA levels. (D-E)

Protein levels of endogenous SGK-1 in the N2 worms that were raised at different temperatures, measured from Western blot. Actin was used as the reference protein to quantify the relative protein level of SGK-1.

RESULTS | 39 3.2 Overexpressing SGK-1 blocks the basolateral recycling in the intestine

VLS formation had been reported before [159, 228]. Previous experiments had suggested that VLS formation may be the consequence of erroneous endocytic transport. To monitor eventual endocytic trafficking defects induced by the sgk-1 transgenes, several transmembrane cargo markers for monitoring basolateral endocytosis and recycling in the C. elegans intestine were applied. Among them, hTAC (-chain of the human IL-2 receptor) is internalized through CIE and recycles back to plasma membrane via RAB- 10/RME-1 dependent recycling endosome [229, 230] (Fig. 3.3). In contrast, hTfR (human transferrin receptor) is a marker for CDE and constitutive recycling, but uses the same route for recycling as hTAC [230] (Fig. 3.3). The C. elegans protein MIG-14/Wntless has also been used as a model cargo for CDE from the basolateral membrane of the intestine. However, MIG-14 recycles to the TGN by using a retromer-dependent mechanism that differs from the recycling of hTfR/hTAC, and enters the degradative pathway in case of a recycling failure [231, 235] (Fig. 3.3). Of note, a new cargo marker TGN-38 had recently been described in C. elegans and it retrogrades to TGN via the RE, independent of retromer [247] (Fig. 3.3). I analyzed the subcellular localization of GFP tagged cargo proteins and Scarlet-tagged SGK-1 (pBY3991, see chapter: 7.5 Plasmids) that coexpressed specifically in the intestinal epithelia of transgenic animals. The GFP fused cargo markers were genome-inserted via bombardment to result in low copy number of transgenes, and had been provided generously by the Grant lab (Rutgers University, USA). Their expression did not obviously have a destructive or dominant influence on the default endocytic pathway. On the contrary, the extrachromosomal expression of SGK-1 with high copy number was generated with the purpose to achieve strong VSLs phenotype in the intestine. Intensive VLSs in the intestine were found in the respective animals, and SGK-1 strongly stained the borders of VSLs, yet with an irregular distribution pattern (Fig. 3.4A). Besides, SGK- 1 localized to large intracellular puncta and was enriched at the basolateral and apical plasma membrane (Fig. 3.4A). Intestinally expressed hTAC::GFP labels small cytoplasmic puncta and both basolateral and apical plasma membrane. Interestingly, I detected a

RESULTS | 40 strong costaining by hTAC::GFP and Scarlet::SGK-1 on the borders of VLSs while they were not exactly colocalized to the same subdomains of the membrane of VLSs since the average Pearson correlation coefficient is only about 0.34 (Fig. 3.4B). Next I counted the number of VLSs costained by hTAC::GFP and Scarlet::SGK-1. They showed an almost complete overlap (97% of 275 VLSs) (Fig. 3.4C). TGN-38::GFP and MIG-14::GFP were prone to form large puncta in the cytosol of intestinal cells while hTfR::GFP formed small puncta in the cytosol. hTfR::GFP was strongly enriched at the plasma membrane, similar to hTAC, whereas TGN-38::GFP and MIG-14::GFP localized less well to the plasma membrane (Fig. 3.4A). In total, localization of these markers correlated well with that reported in the published literature. The quantification of the VLSs costained by cargo markers and Scarlet::SGK-1 showed that in almost all the VSLs costaining between hTfR or hTAC, respectively, with SGK-1 was observed. In contrast, MIG-14 and TGN-38 costained efficiently with SGK-1 with the percentage of 80% and 60%, respectively (Fig. 3.4C). All of the cargo markers, after endocytosis, are transported along the endocytic pathway with slightly different routes. But all of them pass through the EE/LE and then back to the plasma membrane via different routines. The cooccurrence of SGK-1 with the cargo markers suggests that VLSs in the intestine caused by overexpression of sgk-1 are probably enlarged EEs/LEs. Furthermore, the retention of marker proteins at the VLSs suggests that the transport of cargos to default destinations was blocked in the VLSs, indicating that overexpression of sgk-1 jeopardized the function of the early or late endosomes, therefore impairing basolateral recycling. To monitor the endocytic trafficking of cargos other than the described membrane receptors and to test cell-autonomy of SGK-1 function, I harnessed the well-established cargo ssGFP that is synthesized in body wall muscle cells and secreted into the body cavity [228]. Since the ssGFP is not recognized as a relevant protein in C. elegans, the ssGFP secreted to the body cavity is subsequently endocytosed by either coelomocytes or intestinal cells [228]. In wild type N2 animals, it was detected in the intestine, muscles, body cavity and the coelomocytes (Fig. 3.4D). The ssGFP was introduced into both sgk- 1(ok538) deletion mutant and sgk-1 transgenic strain (BR7454: Psgk-1::sgk-1, see chapter:

RESULTS | 41 7.3 Strains), and the localization of ssGFP was investigated. In both sgk-1 mutant and Psgk-1::sgk-1 the signal of ssGFP was observed in the same tissues as in wild type animals, which suggests that its expression, secretion, and endocytosis was not affected by either deletion or overexpression of sgk-1 (Fig. 3.4D). In addition, I found that neither deletion nor the overexpression of sgk-1 altered ssGFP subcellular localization pattern. Of note, the ssGFP was not found in the lumens of VLSs (Fig. 3.4D, arrow heads). The coelomocytes of sgk-1 mutant or transgene contained multiple GFP positive endosomes that were stained similarly to the wild type worms (Fig. 3.4E). However, the average intensity of GFP in the coelomocytes of sgk-1 mutant was lower than that of wild type animals, whereas it was in comparable amounts in both wild type and Psgk-1::sgk-1 transgenic animals. The data indicates that transgenic sgk-1 does not affect endocytosis of the ssGFP into coelomocytes, but possibly the sgk-1 deletion mutant indirectly influences ssGFP expression, an effect that I cannot interpret at this moment without additional experiments (Fig. 3.4F). Notably, the sgk-1(ok538) mutant has defects in several aspects such as development, longevity, lipid metabolism and reproduction which might all influence levels. Since the mean intensity of total ssGFP in sgk-1(ok538) mutant backgrounds was lower than that of wild type worms (see chapter: 7.7 Supplemental figure B), I suggest that reduced intensity of ssGFP in coelomocytes of sgk- 1(ok538) might be not caused by impaired endocytosis of coelomocytes. So far, I focused my analysis on the intestine, which represents a well-characterized model of polarized cells with a basolateral and an apical (luminal) surface. To explore whether sgk-1 also functions in non-polarized cells, next, I measured the maximal diameter of endosomes in coelomocytes of respective strains, since it had been shown that mutants of genes involved in maturation of endosomes have enlarged endosomes in coelomocytes [224]. Unexpectedly, the maximal diameter was slightly smaller than that of wild type animals in both sgk-1 mutant and Psgk-1::sgk-1 (Fig. 3.4G), although sgk-1 has not been shown to be expressed in these cells. I also tested the distribution of vit-2::GFP, encoding a C. elegans yolk protein tagged with GFP, into both sgk-1 mutant and Psgk- 1::sgk-1 transgenic backgrounds to investigate the possible role of SGK-1 in non-polarized

RESULTS | 42 oocytes and embryos. In wild type animals, vit-2 was expressed in the intestine, secreted into the body cavity, and then taken up by either oocytes or embryos as a nutrient for development (Fig. 3.4H). Localization of VIT-2::GFP in both sgk-1 mutant and transgene was not altered, suggesting that neither yolk protein secretion from intestine nor uptake to oocytes or embryos was affected by altering sgk-1 expression levels. This suggests that SGK-1 does not seem to have functions in tissues in which it is not expressed or localized. Taken together, the data above suggested that the endocytic distribution of plasma membrane receptors was affected by overexpression of SGK-1, and the receptor cargos displayed erroneously enriched localization at the VLSs membranes and costained with SGK-1. Analyzing the transport routes of four cargos suggests that the VLSs are probably aberrant early/late endosomes to which SGK-1 localizes. Assays with two other non- membrane bound cargos, synthetic ssGFP and VIT-2, demonstrated that neither the secretion of intestine nor uptake of cargos in coelomocytes, oocytes and embryos were dramatically affected by different sgk-1 levels. Of note, I did not detect expression of sgk- 1 in coelomocytes, oocytes and early embryos, which argues that sgk-1 should have no (cell-autonomous) function in these non-polarized cells. Thus, these findings suggest that sgk-1 regulates basolateral endocytic trafficking cell-autonomously, but independent of a respective endocytosis pathway.

RESULTS | 43 Figure 3.3: Intracellular vesicular trafficking. Routes of model cargos are indicated. The endocytic pathway involves invaginations of the plasma membrane which form clathrin-coated and other endocytic vesicles. These vesicles deliver their contents and their membranes to RAB5-positive EEs in the peripheral cytoplasm. The EEs/LEs accumulate cargos and support recycling to the plasma membrane (directly or via recycling endosomes in the perinuclear region) or retrograde transport towards the TGN. hTfR marks clathrin-dependent uptake and rme-1-dependent recycling while hTAC marks CIE and rme-1-dependent recycling. TGN-38, trans-Golgi network protein 38, traffics from the EE to RE and then towards the TGN. MIG-14 is imported by CDE from the basolateral plasma membrane of the intestine and recycled to the TGN using a retromer-dependent mechanism. Upon recycling failures, it enters the degradative pathway [125, 228, 230, 235].

RESULTS | 44

Figure 3.4: SGK-1 functions in the intestine to regulate basolateral trafficking in C. elegans. (A) Confocal

RESULTS | 45 images for costaining analysis of cargos and SGK-1. Scarlet::sgk-1 transgene (BR8173, see chapter: 7.3 Strains) was crossed with hTAC, hTfR, TGN-38 and MIG-14 marker strains. The resulting strains were investigated at day one adult stage by confocal microscopy. Z-stack multiple channel images were acquired for each strain and the deconvolution of images was done using a manually measured point spread function (PSF), followed by analysis with ImageJ. (B) Pearson correlation coefficient between hTAC/ hTfR and SGK-1 was analyzed with IMARIS (Bitplane, Zurich). (C) Penetrance of costaining of cargos and Scarlet::SGK-1 at the membranes of VLSs. The number of VLSs counted was indicated in the bar column. (D) Images for the localization pattern of ssGFP in both sgk-1(ok538) deletion mutant and sgk-1 transgenic strain (BR7454, see chapter: 7.3 Strains) versus wild type animals. Arrow head, VLS. (E)

The expression pattern of ssGFP in coelomocytes of wild type N2, sgk- 1(ok538) deletion mutant and sgk- 1 transgene (BR7454, see chapter: 7.3 Strains). Note that sgk-1 is not known to be expressed in the coelomocytes. (F) The average intensity of GFP in the coelomocytes of wild type N 2, sgk-1(ok538) deletion mutant and sgk-1 transgene (BR7454, see chapter: 7.3 Strains). (G) The distribution of maximal diameters of endosomes in the coelomocytes of wild type N2, sgk-1(ok538) deletion mutant and sgk-1 transgene (BR7454, see chapter: 7.3 Strains). Synchronized day one adults of the respective strains were mounted on 2% agarose pad and images of coelomocytes were acquired using a compound microscope at 100x magnification. The maximal diameters of endosomes were measured with ImageJ. (H) The localization pattern of VIT-2::GFP in wild type N2, sgk-1(ok538) deletion mutant and sgk-1 transgene (BR7454, see chapter: 7.3 Strains). Scale bar, 5 µm unless otherwise indicated.

RESULTS | 46 3.3 VLSs in the sgk-1 transgene are enlarged endosomes

Since the endosomes are a dynamic membrane system, perturbations of endocytic transport can result in aberrant formation of many membrane enclosed structures. One possibility to learn about the biophysical nature of VLSs is to analyze the occurrence and colocalization with membrane markers specific for individual steps of endocytic trafficking. My previous experiments have shown that all VLSs formed are labelled by SGK-1. Therefore, a costaining analysis with Scarlet::sgk-1 and several well-established endosomal markers was performed. It has been shown that RAB-5, the early endosome marker, in wild type labels punctuated endosomal structures [160]. I found that 22% of VSLs was costained by GFP::RAB-5 and Scarlet::SGK-1 (Fig. 3.5A arrow heads and B). In contrast, only 7% of VLSs were costained by GFP::RAB-7 and Scarlet::SGK-1. The other markers GFP::RAB-10, GFP::RAB-11, GFP::RME-1 that label EEs, apical REs, and basolateral REs, respectively, costained with Scarlet::SGK-1 with a penetrance lower than 6%. This suggests that the VLSs generated in transgenic sgk-1 animals may show some characteristics of early endosomal origin. In comparison, tbc-2 mutant animals in another study, that also result in the generation of VLSs, show almost complete overlap with a GFP::RAB-7 marker, indicating that in this mutant the VLSs display characteristics of late endosomal membranes [159]. Surprisingly, the late-endosomal and lysosomal marker LMP-1::GFP, showed 85% costaining of VSLs with Scarlet::SGK-1 (Fig. 3.5A and B). Given RAB-5 is typical EE marker and LMP-1, the lysosomal-associated membrane protein 1, particularly labels LEs and lysosomes in both mammals and C. elegans, the observation strongly suggests that most of the VLSs derived from either LEs or lysosomes while some of them maintained EE identity. The observation with endocytic cargos described above (RESULTS 3.2) suggested that VLSs may be enlarged and malfunctioned EEs/LEs. Taken together, these data are in consistent with origin of VSLs being LEs whereas the possible lysosomal identity of VLSs remains open to discuss. Next, the costaining assay for VLSs by Scarlet::SGK-1 and another lysosomal marker CUP-5 was performed. CUP-5 is the C. elegans functional ortholog of human Mucolopin-1 which consists of the transient

RESULTS | 47 receptor potential cation channel and localized to nascent and mature lysosomes to regulate the biogenesis of lysosome and concentration of Ca2+ [248]. The result showed that SGK-1-positive VLSs did not stain with CUP-5 at all (Fig. 3.5A and B), suggesting that VLSs do not seem to have the lysosomal identity. A subsequent LysoTracker staining supported this result, since the VLSs in sgk-1 transgene did not stain with this dye that is a marker for acidic organelles, most notably lysosomes (Fig. 3.5C). The data indicates that VLSs were not acidified suggesting that they do not seem to represent lysosomal organelles or organelles derived from the lysosomes. PIs are a minor class of comparably short‐lived membrane phospholipids that are crucial for endocytic traffic, and are frequently used to define the identity of endomembrane. To further characterize the features of the VLSs generated upon transgenic SGK-1 expression, costaining assay of VLSs by Scarlet::SGK-1 and individual phospholipid markers were performed. PI(3,4,5)P3 is a critical phospholipid on the plasma membrane to mediate signal transduction. Upon endocytosis, PI(3,4,5)P3 is dephosphorylated to generate other PIs like PI(3)P, PI(3,4)P2 or PI(4,5)P2 and eventually PI. The PI(3,4)P2 that is generated by Class II PI3Kα (in C. elegans: PIKI-1) or by dephosphorylation of PI(3,4,5)P3 through 5- PPase/INPP5K/INPP5J (potential C. elegans candidates: INPP-1, CIL-1) at the plasma membrane, is required for clathrin-coated pits (CCPs) maturation during endocytosis. It also contributes to the generation of PI(3)P indirectly at EEs while the endosomal pool of PI(3,4)P2 is poorly understood [249]. I found that PH(Akt)::GFP, a PI(3,4,5)P3/PI(3,4)P2 marker, labeled the apical versus basolateral plasma membrane but rarely cytoplasmic puncta (Fig. 3.5D). Scarlet::SGK-1 colocalized strongly with PH(Akt)::GFP at the plasma membrane. And about 80% of VLSs were costained by Scarlet::SGK-1 and PH(Akt)::GFP, suggesting that majority of VLSs enriched with either PI(3,4,5)P3 or PI(3,4)P2. I also noticed that PH(PLCδ)::GFP, the PI(4,5)P2 indicator, displayed a similar subcellular localization as PH(Akt)::GFP and also strongly enriched on the VLSs (Fig. 3.5D and E). This suggests that VLSs, in addition to PI(3,4,5)P3/PI(3,4)P2, also may contain PI(4,5)P2. PI(4,5)P2 is concentrated along both the exocytic pathway and the plasma membrane. At

RESULTS | 48 the plasma membrane, PI(4,5)P2 is required for signaling transduction and endocytosis. Recently it was proposed that many intracellular organelles may be enriched with PI(4,5)P2, particularly the REs [230, 250]. Therefore, the enrichment of PI(4,5)P2 on VLSs could be a consequence of retarded formation of REs, however with functional synthesis of PI(4,5)P2 for recycling purpose at the EEs membrane. Nevertheless, it is also possible that the PI(4,5)P2 was inherited from the plasma membrane via endocytosis duo to disrupted dephosphorylation of PI(4,5)P2 in VLSs. Next, the possible PI(3)P content of VSLs was analyzed with a biosensor GFP::2xFYVE generated from mouse HRS protein. GFP::2xFYVE dispersed in the cytosol with barely visible plasma membrane localization and a low costaining penetrance of VLSs with Scarlet::SGK-1 (about 10%, Fig. 3.5D and E), suggesting that most of the VLSs do not contain PI(3)P. Collectively, VLSs in sgk-1 transgene acted as the malfunctioned endosomes that showed early/late endosome identity. Besides, most of the VLSs contained abundant PI(3,4,5)P3/ PI(3,4) P2 and PI(4,5)P2 however with low enrichment of PI(3)P.

RESULTS | 49

Figure 3.5: SGK-1 may function on early/late endosome. (A) Images for costaining analysis between endocytic markers and Scarlet::SGK-1 (BR8173, see chapter: 7.3 Strains). Worms coexpressing Scarlet::sgk-1 and GFP tagged endocytic markers were monitored at day one adult stage by confocal microscopy. Z-stack multiple channel images were acquired for each strain and the deconvolution of

RESULTS | 50 images was done by using a manually measured PSF. Followed by analyzing with ImageJ. (B) Penetrance of costaining for endocytic markers and Scarlet::SGK-1 on the membrane of VLSs. The number of VLSs counted was indicated in the bar column. (C) LysoTracker Red staining for byEx1223[Psgk-1::GFP::sgk-1] (BR6662, see chapter: 7.3 Strains), images were acquired with compound microscope. LysoTracker dye was not observed in the lumens of VLSs. (D) Representative images for costaining analysis of phospholipid markers and Scarlet::SGK-1 as was described in (A). (D) Penetrance of costaining for phospholipid markers and Scarlet::SGK-1 on the membrane of VLSs. The number of VLSs counted was indicated in the bar column. Scale bar, 5 µm.

RESULTS | 51 3.4 Loss of sgk-1 suppresses the VLSs phenotype in rab-10 and rme-1

mutants

RAB-10 is a key regulator in the intestinal basolateral recycling in which SGK-1 may function, and rab-10 mutant shows large VLSs in the intestine that accumulated with fluid-phase endocytic marker ssGFP and CIE cargo hTAC::GFP [228, 230]. In addition, RAB-10 negatively regulates ARF-6 activity through the Arf-GAP protein CNT-1 to link cell signaling with cytoskeletal rearrangements and membrane trafficking [230]. The regulatory loop from RAB-10 to ARF-6 is required to regulate PI(4,5)P2 levels at the REs. The EPS15 homology (EH) domain-containing protein RME-1, on the other hand, controls cargo exit from REs to the plasma membrane. Depletion of rme-1 also induces VLSs accumulated with several basolateral cargo proteins including hTAC and hTfR, and these VLSs are filled with basolaterally applied fluid-phase endocytosis markers [225, 230]. The basolateral recycling defects of rme-1 mutants, but not of rab-10 mutants, are be suppressed in loss-of-function mutants of the PTB domain protein NUM-1/Numb. Current models indicate that NUM-1 is localized to the basolateral surfaces of most polarized epithelial cells, is a negative regulator of endocytic recycling, although the detailed mechanism of its action is not known [251]. VLSs found here in SGK-1 transgenic animals resemble aberrant endocytic structures that had been reported before for transgenic animals overexpressing NUM-1, and in loss-of- function mutants of rab-10(q373), rme-1(b1045), tbc-2(tm2241), and ppk-3(n2668) [159, 171, 225, 228]. This suggests that sgk-1 may have functions at similar steps in endocytic trafficking and could in principle function in a shared regulatory pathway, but should oppose activity of e.g. rab-10. In such a case, sgk-1 loss of function mutants should suppress endocytic defects of rab-10. rab-10(q373) mutant slightly increased the number of VLSs in the intestine of the byIs207[sgk-1::GFP] worms (Fig. 3.6A and B). This would be consistent with opposing activities of RAB-10 and SGK-1, but could indicate both a function in the same or in two (independent) parallel pathways. The number of VLSs in rme-1(b1045);byIs207[sgk-1::GFP]

RESULTS | 52 was slightly reduced in comparison with rme-1(b1045), but this reduction was not significant (Fig. 3.6B). VLSs in rab-10(q373) were large and irregularly shaped, while VLSs in byIs207[sgk-1::GFP] were round, regular ring like structures exclusively stained by SGK-1::GFP (Fig. 3.1C). I observed that VLSs in rab-10(q373);byIs207[sgk-1::GFP] were mostly round and resembled those of byIs207[sgk-1::GFP], while some of the VLSs that lacked SGK-1::GFP were irregularly shaped, and resemble those seen in rab-10(q373) single mutants (Fig. 3.6A, green arrow head). The VLSs in rme-1(b1045);byIs207[sgk-1::GFP] mutants mostly resembled the shape of VLSs seen in rme-1(b1045), which have been reported to have RE characteristics, and lack SGK-1::GFP staining (Fig. 3.6A, green arrow head) [225]. I next assayed the VLS numbers and phenotype in rab-10(q373), rab-10(dx2), rme-1(b1045), and svIs23[num-1(+)] (BR6934, see chapter: 7.3 Strains) in genetic backgrounds with reduced sgk-1 activity. Attenuation of sgk-1 either by mutant ok538 or RNAi knockdown in all four strains almost completely suppressed the formation of VLSs (Fig. 3.6C, D and E). sgk-1(ok538) mutant however showed stronger levels of suppression than the RNAi knockdown, which could be consistent with a partial reduction of sgk-1 activity by RNAi. Taken together, these results support a role of sgk-1 in endocytic trafficking downstream of RAB-10 and RME-1, and would be consistent with sgk-1 functioning either up or downstream of num-1. Second, since RAB-10 is localized to the EE and rab-10 loss of function results in an early endosomal blockade [228], suppression by sgk-1(ok538) may support an endosomal role of SGK-1 in overcoming this blockade. A remarkable variability in the penetrance of VLS formation was observed in svIs23[num- 1(+)] that seems to depend on environmental cues. For VLSs inspection, animals had been typically mounted on agarose pads with 0.5 mM levamisole that functions as an anesthetic. In svIs23[num-1(+)] animals, VSLs disappeared quickly within 5 minutes, most notably after feeding with HT115 instead of OP50. As a consequence, this generated a variability in VLSs numbers of the svIs23[num-1(+)] strain that resulted in increased standard deviations (Fig. 3.6D and E). Nevertheless, sgk-1(ok538) suppression of VLSs formation in svIs23[num-1(+)] was very efficient.

RESULTS | 53 Double mutants generated for these epistasis analyses were generally smaller, sicker than the single mutants and showed strongly retarded development when compared to respective single mutants (Fig. 3.6C). In detail, sgk-1(ok538), which is a deletion mutation, was considered as null mutant since part of its S/T kinase domain was removed. The sgk- 1 mutant phenotype results in animals that are smaller than wild type, have slower development, reduced brood size, and increased gut granules [9, 113, 122]. Mutants of rab-10 were also sick and showed significantly reduced body size (Fig. 3.11G). Several phenotypic aspects were enhanced in the double mutants, indicating that not all aspects of the single mutants' phenotype was suppressed by sgk-1(ok538). I conclude that RAB- 10, RME-1, and NUM-1 may have functions that are not controlled by SGK-1, and vice versa. In addition to rab-10, rme-1, and num-1 that function in the recycling branch of endocytic trafficking, mutants of genes such as tbc-2 and ppk-3, act in the degradative branch of endocytic trafficking, also generate VLSs in the intestine. tbc-2(tm2241) that mutates an ortholog of the human TBC1D2 (Tre-2/Bub2/CDC16 domain family), produces enlarged LMP-1/RAB-7-positive LEs that resemble those formed upon expression of constitutively active (GTPase defective) RAB-5(Q78L). The tbc-2 phenotype has been interpreted to occur because permanently GTP-bound RAB-5 hyper-activates RAB-7 through the RAB- 5 to RAB-7 cascade involving the membrane-associated proteins SAND-1/MON1A/B and CCZ-1/C7orf28A/B [159] (Fig. 3.7A). I found VLSs in tbc-2(tm2241) to be unstable in numbers and appearance during the course of development and between individual animals. The VLSs were first seen in L3 stage in tbc-2(tm2241) mutant, they persisted until young adult stage. Moreover, VLS numbers varied dramatically between individual tbc- 2(tm2241) animals. However, sgk-1(ok538) did not suppress the VLSs in tbc-2(tm2241) mutant, implying that sgk-1 may not affect the TBC-2 mediated Rab switch. The tbc- 2(tm2241);sgk-1(ok538) double mutant displayed the similar appearance of VLSs in the intestine (Fig. 3.7B, DIC images). It has previously been reported that VLSs in tbc- 2(tm2241) single mutants contain aggregates of unknown identity, which were suggested to at least in part be non-degraded proteins residing inside the VLSs [159](Fig. 3.7B, DIC

RESULTS | 54 images). Obviously, sgk-1(ok538) was unable to prevent aggregate formation. Since sgk- 1(ok538) also did not alter the membrane localization of GFP::RAB-7 on VLSs seen in tbc- 2(tm2241), it does not seem to function epistatically to tbc-2. In conclusion, SGK-1 may not be involved in the TBC-2 controlled Rab conversion during endosome maturation. PPK-3 encodes a phosphatidylinositol phosphatase that is the ortholog of yeast and mammalian PIKfyve/Fab1p. PIKfyve had been suggested as a downstream target of SGK1 phosphorylation to control the Na+, Cl-, creatine transporter SLC6A8 [252]. In C. elegans, PPK-3 is required for the proper maturation of lysosomes and the production of PI(3,5)P2 from PI(3)P [171]. ppk-3(n2668) mutants display VLSs in both intestine and coelomocytes that are marked by the lysosomal marker LMP-1::GFP [171]. In sgk- 1(ok538);ppk-3(n2668) double mutant, the induction of large VLSs seen in the coelomocytes of ppk-3 mutant was unaffected (Fig. 3.7C), suggesting that SGK-1 does not functionally interfere with VLSs generation in the coelomocytes of this ppk-3(n2668) mutant. This was not overly surprising, given that sgk-1 does not seem to be expressed in coelomocytes. The double mutant sgk-1(ok538);ppk-3(n2668) displayed VLSs in the intestine as was shown in the DIC image (Fig. 3.7D). In addition, large puncta labeled by LMP-1::GFP were found in the intestine of sgk-1(ok538);ppk-3(n2668) (Fig. 3.7D). The subsequent confocal microscopy for both ppk-3(n2668);Is[lmp-1::GFP] and sgk- 1(ok538);ppk-3(n2668);Is[lmp-1::GFP] revealed that the enrichment of LMP-1::GFP at the borders of VSLs disappeared in the intestine (white arrows) but not the coelomocytes (green arrowheads) of the sgk-1(ok538);ppk-3(n2668) double mutant (Fig. 3.7D). The boosted large puncta labeled by LMP-1::GFP in the intestine of sgk-1(ok538);ppk-3(n2668) double mutant were mostly round shaped superficially resembling lysosome-related organelles (LROs) (Fig. 3.7D, yellow arrows). Collectively, the results propose that sgk-1 affected the membrane localization of LMP-1::GFP on the VLSs generated in ppk-3(n2668), but not the generation of intestinal VLSs per se, and the functional relationship between both may be more complex than previously anticipated.

RESULTS | 55

Figure 3.6: Loss of sgk-1 suppresses the VLS phenotype in rab-10(q373), rme-1(b1045) or svIs23[Pnum-1::num- 1]. (A) Representative images in DIC and GFP channels of rab-10(q373);byIs207[sgk-1::GFP] and rme- 1(b1045);byIs207[sgk-1::GFP]. Animals that show both round (white arrows) and irregularly shaped (green arrow heads) VLSs in the intestine. (B) The average number of VLSs per animal in rab-10(q373);byIs207[sgk-

RESULTS | 56 1::GFP] and rme-1(b1045);byIs207[sgk-1::GFP] strains, compared to rab-10(q373), rme-1(q373), and byIs207[sgk-1::GFP]. (C) VLSs in rab-10(q373), rme-1(b1045) and svIs23[Pnum-1::num-1] mutants were reduced to background in the corresponding double mutants with sgk-1(ok538). (D) The average number of VLSs in each worm of rab-10(q373), rme-1(b1045) and svIs23[Pnum-1::num-1] fed with L4440 or sgk-1RNAi bacteria. For this analysis, day one adults were mounted on 2% agarose pads and counted, using a compound microscope at 20x. (E) The average number of VLSs in the respective strains. Scale bar, 50 µm.

RESULTS | 57

Figure 3.7: Loss of sgk-1 does not affect VLSs in tbc-2(tm2241) mutant while alters the phenotype of ppk- 3(n2668). (A) Model for the RAB switch involving RAB-5 and RAB-7. SAND-1 complexes with CCZ-1 to bind HOPS and recruit RAB-7 onto the membrane of endosome. TBC-2 was proposed as a GAP of RAB-5 GTPase to inactivate GTP tagged RAB-5 on endosome membrane [159]. (B) tbc-2(tm2241);pwIs170[GFP::rab- 7] and tbc-2(tm2241);sgk-1(ok538);pwIs170[GFP::rab-7] animals display large VLSs in the intestine. The VLSs in both tbc-2(tm2241) and tbc-2(tm2241);sgk-1(ok538) mutant backgrounds are stained by GFP::RAB-7. (C) DIC images for the coelomocytes of respective strains indicated. (D) Images in DIC and GFP channels of ppk-3(n2668);pwIs50[lmp-1::GFP] and ppk-3(n2668);sgk-1(ok538);pwIs50[lmp-1::GFP] that show large VLSs in the intestine. In the confocal images, the VLSs in the intestine of ppk-3(n2668) are stained by LMP-1::GFP while they are less stained by LMP-1::GFP in the intestine of ppk-3(n2668);sk-1(ok538) (white arrows). The staining of VLSs by LMP-1::GFP in the coelomocytes of ppk-3(n2668);sgk-1(ok538) was not altered (green arrow heads). More large LMP-1::GFP-positive structures (yellow arrows) are found in the intestine of ppk- 3(n2668);sgk-1(ok538). Asterisks, VLSs in intestine. Scale bar, 50 µm unless otherwise indicated.

RESULTS | 58 3.5 Cell type specific functions of SGK-1

Given that results obtained with sgk-1 so far point towards an exclusively cell- autonomous function, SGK-1 activity may affect both intestinal and neuronal tissues ([9] and Fig. 3.1C). To distinguish between neuronal and intestinal functions of SGK-1, sgk-1 cDNA was expressed selectively in neurons and intestine, respectively, using the tissue- specific promoters Prab-3 (neurons) and Pvha-6 (intestine) (Fig. 3.8A). This resulted in plasmids pBY3942 and pBY3915 (see chapter: 7.5 Plasmids). Plasmids were injected into sgk-1(ok538) or sgk-1(ok538);rab-10(q373) and resulted in three transgenic lines with extrachromosomal arrays for each combination (BR7909-7920, see chapter: 7.3 Strains). Then, cell type specific rescuing activity of individual sgk-1 transgene was tested in neurons and intestine. The vha-6 promoter resulted in strong intestinal expression of sgk- 1, but showed variable penetrance in distinct intestinal cells. Neither intestinal nor the neuronal SGK-1 induced VLSs in the transgenic lines of sgk-1(ok538) mutant background (Fig. 3.8B). VLS suppression in sgk-1(ok538);rab-10(q373) was rescued with the Pvha-6::mChery::sgk-1 transgenes to levels similar to that of rab-10(q373) mutant (Fig. 3.8B and C). Expression of Prab-3::mCherry::sgk-1 was strong in neurons. Although neuronal sgk-1, unlike intestinal sgk-1, was not sufficient to restore VLSs in the intestine of the rab-10(q373) worms, intestinal VLSs numbers were nevertheless significantly increased using in the background of theses transgenes (Fig. 3.8B and C). The data suggests that either the rab- 3 promoter used in this experiment shows some undocumented intestinal activity, or neuronal sgk-1 may in a so far unknown way affect intestinal endomembrane transport non-cellautonomously. Cell-autonomous/non-autonomous rescuing activity was also attempted for other phenotypic aspects of sgk-1. These were: Sma (small body size), reduced brood size, and increased numbers of gut granules. sgk-1(ok538) animals are about 60% smaller than wild type worms (Fig. 3.8D and E). Pvha-6::mCherry::sgk-1 expression rescued body size to about 93% of wild type animals. In contrast, expression of transgenic sgk-1 in neurons did not alter body size (Fig. 3.8D and E), indicating that sgk-1 impact on body size acts in the

RESULTS | 59 intestine and is cell-autonomous. The reduced brood size of sgk-1 animals (on average 200 instead of 280 eggs per animal) was also rescued by intestinal, but not neuronal sgk- 1 (Fig. 3.8F). sgk-1(ok538) mutant also displayed increased gut granules in the intestine which can be visualized by BODIPY, LysoTracker, or Nile Red staining [113, 253]. Intestine-only expression of SGK-1 was sufficient to reverse LysoTracker staining from sgk-1(ok538) to wild type levels (Fig. 3.8G). LysoTracker staining in strains expressing neuronal sgk-1 was in between wild type and sgk-1(ok538), but statistically different from sgk-1(ok538) alone (Fig. 3.8G). Therefore, intestinal sgk-1 expression is sufficient to restore body size, brood size, and the gut granules phenotype of sgk-1 mutants, suggesting that all three aspects are mostly controlled by the intestinal sgk-1, but neuronal sgk-1 activity may somehow contribute to endomembrane trafficking and gut granule formation in the intestine in ways that are currently not understood. Since sgk-1 has been shown to act upstream of DAF-16 in IIS, and DAF-16 regulates transcription of several insulin-like molecules that impact on intestinal IIS, endocrine functions downstream of SGK-1 may contribute to these non-cellautonomous effects. Taken together, blocking sgk-1 activity suppressed the generation of VLSs in rab-10(q373), rme-1(b1045), and svIs23[num-1(+)], and at least in the rab-10(q373) mutant this function requires intestinal sgk-1. Intestinal SGK-1 also played a prominent role in the most obvious phenotypic aspects of the sgk-1(ok538) mutant such as Sma, reduced brood size and increased gut granules.

RESULTS | 60

Figure 3.8: Intestinal SGK-1 plays a prominent role in regulating endocytic trafficking as well as other functions. (A) Diagram for plasmid constructs of tissue specific expression of sgk-1. The pBY numbers of the respective plasmids and corresponding strains can be found in chapter: 7.3 Strains and 7.5 Plasmids. (B) Images in DIC and RFP channels of intestinal and neuronal transgenic strains of sgk-1. Both intestinal and neuronal expression of SGK-1 in sgk-1(ok538) do not induce VLSs in the intestine. Intestinal expression

RESULTS | 61 of SGK-1 in rab-10(q373);sgk-1(ok538) results in VLSs occurrence as is indicated the by the arrows. Strong expression of mCherry::sgk-1, which was not evenly distributed, was observed in intestinal transgenic lines. VLSs were not observed in the intestine of worms expressing neuronal SGK-1. Intensive expression of mCherry::sgk-1 in the head, tail, dorsal and ventral neurons was observed. (C) Number of VLSs in tissue specific transgenic strains. (D) DIC images for day one adults of wild type, sgk-1(ok538), intestinal and neuronal transgenic strains. Synchronized animals were mounted onto 2% agarose pad and images were taken under a compound microscope with a 5x objective. (E) Relative body size of the indicated strains. At least 90 worms from three independent tests were measured. (F) Rescuing efficacy of brood size for the tissue specific transgenic lines. (G) Rescuing efficacy of LysoTracker staining for the tissue specific transgenic lines. sgk-1(ok538) mutant has increased gut granules which can be stained with LysoTracker. Scale bar, 50 µm.

RESULTS | 62 3.6 sgk-1(ok538) mutant has increased LROs sgk-1 was proposed to have increased lipid storage that can be stained by Nile Red [122]. However, a later study showed that Nile Red colocalized with the fluorescent dye LysoTracker green and does not stain the major C. elegans fat stores[253]. Nevertheless, the observation implies that sgk-1 may have increased LysoTracker staining which has not been shown before. LysoTracker staining labels membrane-surrounded organelles with acidic contents including LEs, lysosomes, autophagosomes and LROs. LROs with acidic content are found in large numbers within the intestine of C. elegans and it has been proposed to have specialized functions [254, 255]. Of note, the biogenesis of LROs was reported to derive from the EEs/LEs [256]. For example, the biogenesis of lysosome- related organelles complex 1 (BLOC-1) was shown to localize to the EEs and promote the trafficking of specific proteins from EEs to LROs via a mechanism that is widely conserved and also exists in C. elegans [254, 257]. In addition, several other proteins and complexes, including GLO (gut granule loss) proteins, adaptor protein complex 1/3 (AP- 1 and AP-3), and HOPS complex are found to localize to endosomes and are critical for the generation of LROs in the intestine of C. elegans [258-260]. Since the experiments described above suggest that overexpression of SGK-1 blocks cargo recycling at the endosomes, one of the interpretation for the formation of VLSs could be that the endosome uses escape pathways to balance an occurring block of membrane flow. Increased numbers of acidic organelles derived from EEs could represent one such escape pathway. I conducted LysoTracker staining for sgk-1(ok538) mutant, and deletion of sgk- 1 resulted in two fold elevated LysoTracker staining compared to wild type worms (Fig. 3.9A and B). Maximal intensity projection (MIP) of the confocal images of representative animals showed that the number of these stained organelles was increased (Fig. 3.9A). LysoTracker generally stains acidic organelles including LEs, lysosomes, autophagosomes and LROs. To identify the functional identity of these organelles in sgk- 1(ok538), I used transgenic markers GFP::rab-7 (that labels LEs), lmp-1::GFP (LEs and lysosomes), and glo-1::GFP (LROs), and compared in wild type and sgk-1(ok538) mutant backgrounds. None of these marker was upregulated in sgk-1(ok538) (Fig. 3.9C, D, E and

RESULTS | 63 F). In addition, the mRNA level of lgg-1, which functions at the autophagosomes, was not altered in sgk-1(ok538) mutant (unpublished data from our lab). The data suggests that the overall volume of acidic organelles was not increased. Since markers used here are Rab GTPases and membrane-associated proteins, it is possible that the membrane association of these markers is promoted, but not the general protein level. However, I observed more birefringent gut granules in sgk-1(ok538) when compared to wild type animals (Fig. 3.9G). Gut granules are mainly represented by LROs [258, 260], suggesting that LROs are probably elevated in sgk-1(ok538) (Fig. 3.9G, arrows). Therefore, suppressing biogenesis of LROs may affect the increased LysoTracker staining in the sgk- 1(ok538) mutant. To validate the hypothesis, I performed epistasis experiments between sgk-1 and glo-1 which, together with its nucleotide exchange factor GLO-4, functions epistatically to AP- 3 in the biogenesis of gut granules. Each glo-1 mutant tested eliminates the gut granules in embryo or adult stage entirely [260]. I confirmed that glo-1(zu391) did not show LysoTracker Red in the intestinal cells compared to wild type animals. sgk-1(ok538) displayed strongly LysoTracker Red in the intestine, suggesting that intracellular LysoTrcker labeled organelles are enhanced. Additional depletion of glo-1 in the sgk- 1(ok538) mutant abrogated the LysoTacker staining (Fig. 3.9H and I), indicating that the increased LysoTracker staining in sgk-1(ok538) was generated by elevation of LRO levels. In conclusion, sgk-1 may act earlier than glo-1 in regulating LRO generation. I next investigated the subcellular localization of GLO-1::GFP in wild type and sgk- 1(ok538) mutant backgrounds even though the average fluorescence intensity of GLO- 1::GFP was not altered in sgk-1(ok538) (Fig. 3.9F). Two different subcellular structures, small puncta and large vesicular structures (about 1 µm in diameter) (Fig. 3.9J, white arrows and green arrow heads) that labeled by GLO-1::GFP were found in both wild type and sgk-1(ok538) mutant backgrounds. The number of small GLO-1::GFP positive puncta in sgk-1(ok538) was similar to that of wild type background. However, the proportion of large vesicular LROs was higher in the sgk-1(ok538) mutant (Fig. 3.9K and L). Thus, the observed increase in LysoTracker in sgk-1(ok538) intestines did not correlate to overall

RESULTS | 64 intensity of GLO-1::GFP, but to the increase in large vesicular LROs. The unchanged average intensity of GLO-1::GFP may be evoked by the different staining mechanisms. The Rab GTPase GLO-1, as membrane associated protein of LROs, cannot penetrate into the lumen of the LROs. On contrast, LysoTracker responses to the low pH value and permeates to the lumens of LROs therefore elevates the amount of LysoTracker dye in the LROs. These data validated the increased LysoTracker staining in sgk-1(ok538) mutant, and indicated that the elevation was contributed by increased number of large LROs in a GLO-1 dependent manner. In agree with the mammalian paralog of GLO-1 which was found to function on endosome to regulate the formation of LROs, the results suggest that SGK-1 localizes to endosome and may act upstream of glo-1 to regulate the biogenesis of LROs in C. elegans.

RESULTS | 65

Figure 3.9: sgk-1(ok538) mutants display increased LRO numbers. (A) Wild type and sgk-1(ok538) mutant were stained with LysoTracker Red DND-99. The maximal intensity projection (MIP) images of wild type and sgk-1(ok538) mutant were generated from confocal microscopy images. (B) Quantification of the relative fluorescence intensity of LysoTracker staining for wild type and sgk-1(ok538) mutant. (C) GFP::RAB-7 in

RESULTS | 66 wild type and sgk-1(ok538) at the L4 stage are comparable. The average fluorescence intensities from three independent tests were normalized to wild type worms. (D) Images of GFP::RAB-7, LMP-1::GFP and GLO- 1::GFP in wild type and sgk-1(ok538) mutant backgrounds. (E) LMP-1::GFP in wild type and sgk-1(ok538) at the day one adult stages are not significantly altered. (F) GLO-1::GFP in wild type and sgk-1(ok538) at the day one adult stage are similar. (G) DIC images of wild type N2 and sgk-1(ok538) mutant. The large birefringent gut granules are indicated by arrows. Scale bar, 10 µm. (H) Wild type, sgk-1(ok538), glo-1(zu391), and glo-1(zu391) sgk-1(ok538) are stained with LysoTracker Red DND-99. (I) Quantification of LysoTracker staining for wild type, sgk-1(ok538), glo-1(zu391) and glo-1(zu391) sgk-1(ok538) mutants. For each data set, three independent tests were normalized to wild type worms. (J) MIP for confocal images of GLO-1::GFP in the wild type and sgk-1(ok538) mutant backgrounds. Two different organelle structures in the intestine are apparent, and shown by with white arrows (puncta structures) and green arrow heads (large vesicular structures). Scale bar, 10 µm. (K) The average number of large vesicular structures per selected area (20x20 µm) in wild type and sgk-1(ok538) mutant were counted. At least three randomly selected areas (green box in (J)) were counted for each worm. More than 10 animals of each strain were counted. Error bar, mean ± SD. (L) The average number of small GLO-1::GFP-positive puncta per selected area (20x20 µm) in wild type and sgk-1(ok538) mutant were counted as is described in (K). Scale bar, 50 µm unless otherwise indicated.

RESULTS | 67 3.7 Kinase activity and PX domain are required for the VLS formation

Sequence and proposed functional domains of SGK-1 have been used to group it in the family of AGC serine/threonine kinase, together with AKT-1/AKT-2, RSKS-1/S6K [13, 122]. With the proposed function of SGK-1 in endocytic trafficking, it would be interesting to know whether the kinase activity of SGK-1 is required to exert its endosomal function. In addition to the kinase domain, SGK-1 has a predicted PX domain which may enable its binding to PI(3)P (predicted by Interpro and [261]). I then asked whether the pseudo PX domain contributes to the endosomal function of SGK-1. With the notion, an alignment for the PX domain of SGK-1/hSGK3 proteins was plotted (Fig. 3.10A). Of note, the PX domain of SGK3 (residues 1–162, PXSGK3) interacts with PI(3)P, and the mutations of conserved Arg50 or Arg90 to Ala abolish binding of PXSGK3 to PI(3)P in protein lipid overlay assays [17]. Within the predicted PX domain, C. elegans SGK-1 shares similarities from aa residues 29 to 114, indicating that, if they constitute a PI(3)P binding domain, this may be considerably shorter than in hSGK3 (85 versus 162 aa). The Arg50 of SGK3 was not conserved in SGK-1 (Fig. 3.10A, red box) while the Arg90 of SGK3 corresponds to the SGK-1 Arg83, was conserved and located within a highly conserved stretch of residues (Fig. 3.10A, black box). Multiple alignments with human and Xenopus SGK1 indicate that several residues important for mediating kinase activity were conserved in C. elegans SGK-1 (Fig. 3.10B). The predicted PX domain is located at the N-terminus of SGK-1 isoform b (according to the annotation of WormBase, version: WS263) from aa 29 to 111, and Arg83 which has been postulated to be critical for the PI(3)P binding localizes to this domain. The ATP binding site K164 and proton acceptor site D259 localize to the kinase domain that extends from aa 135 to 392. The presumed PDK-1 phosphorylation site T293 is located in the activation loop. In mammals, full activity of SGK1 requires both the phosphorylation of residues at the C-terminal hydrophobic motif by mTORC2 and a subsequent phosphorylation at the activation loop by PDK1. According to in vitro kinase assays, mTORC2 phosphorylation has a minor effect for the kinase activity of SGK1, while it is the prerequisite for the phosphorylation by PDK1 which activates SGK1 substantially [24].

RESULTS | 68 The C terminal domain extends from aa 393 to 457, but is not strongly conserved between mammals and C. elegans, impeding the prediction of corresponding sites in CeSGK-1 (Fig. 3.10B). A recent suggestion predicts that the S434 and T454 are the respective TORC2 phosphorylation sites in C. elegans since the respective mutants mimicking constitutively active SGK-1(S434E, T454E) suppressed the defect of loss of sinh-1 in chemotaxis response [262]. To explore the importance of endosomal membrane attachment via a putative PX domain to the endosomal function of SGK-1, a point mutation R83A that should abrogate the membrane binding capacities was generated (pBY3966, see chapter: 7.5 Plasmids). Duo to the previous determined correlation of expression level and the generation of VLSs in sgk-1 transgenes (Fig. 3.2A and B), the injecting concentration of pBY3966 in sgk-1(ok538) mutant background was increased to gain equal or higher expression of SGK-1 comparing to wild type construct (pBY3707, see chapter: 7.5 Plasmids). Five out of the six lines of GFP::sgk-1(R83A) did have equal or higher expression level of SGK-1 comparing to the wild type transgenes (Fig. 3.11C, BR7994-7996 and BR8060-8062, see chapter: 7.3 Strains). The R83A point mutation dramatically changed the localization pattern of GFP::SGK-1. Large puncta and VLSs seen with wild type GFP::SGK-1 were not visible in the intestinal cells of SGK-1(R83A) transgenic strains. In addition, apical plasma membrane localization was strongly enhanced at the expense of basolateral staining (Fig. 3.11B). Despite the high expression levels, VLS formation obtained by GFP::sgk-1(R83A) was reduced significantly. The sgk-1(R83A) transgenic worms with equal or lower expression of SGK-1 (lines 1-3) to wild type SGK-1 did not generate VLSs, whereas only 10% of the animals (compared to more than 90% of wild type GFP:: sgk-1 transgenic worms) of the remaining lines 4-6, which have higher levels of SGK-1 than wild type, showed VLSs in the intestine (Fig. 3.11D). This result indicates that the R83A mutation reduces or eliminates at least part of the SGK-1 activity to induce VLS formation. This also suggests that endosomal membrane binding may be a prerequisite of SGK-1 mediated VLS induction. Does R83A also affect other activities of SGK-1 resulting in different phenotypic aspects? To answer this question, I tested whether GFP::sgk-1(R83A)

RESULTS | 69 was able to rescue the Sma phenotype of sgk-1(ok538). All sgk-1(R83A) lines rescued the Sma phenotype of sgk-1(ok538) (Fig. 3.11E), suggesting that this SGK-1 variant retained at least some functionality and probably modulation of body size does not require endosomal membrane attachment of SGK-1. Since rescue of Sma phenotype did not work with sgk-1 variants that have mutations in the proposed phosphorylation sites, this result also indicates that SGK-1(R83A) probably does not negatively affect SGK-1 kinase activity. To further investigate the importance of the PX domain for SGK-1 functions, I tested the capacity of this variant to rescue certain phenotypic aspects of sgk-1(ok538). For this purpose, I attempted to generate a CRISPR/Cas9 sgk-1(R83A) mutant in rab-10(q373) background, unfortunately ended up in failure. Four independent GFP::sgk-1(R83A) transgenic strains, two with low and two with high expression levels of sgk-1, were then generated in rab-10(q373);sgk-1(ok538) mutant background (BR8259, BR8260, BR8325 and BR8330, see chapter: 7.3 Strains). All four fully rescued Sma phenotype to levels similar as that of rab-10(q373) (Fig. 3.11G). These results strongly indicate that R83A does not affect functions of SGK-1 required for the SGK-1 mediated control of body size, and, in particular, this function does not require endosomal membrane binding of the protein. The rab-10(q373) mutant on its own was small, and the fact that SGK-1(R83A) did not rescue the Sma phenotype of rab-10(q373) suggests that sgk-1 and rab-10 may independently control body size. Importantly, the number of VLSs decreased significantly in the transgenic backgrounds with low, but not high, sgk-1 expression (Fig. 3.11H). Both strains with high sgk-1 transgenic expression levels show high numbers of VLSs. This may indicate that that sgk-1(R83A) mutant may have retained some endosomal membrane binding capacities, and high numbers of this transgene therefore display some SGK-1 functions that do not suppress the VLSs phenotype of rab-10(q373), albeit without additional experiments this interpretation should be treated with caution. To test whether kinase activity is required for endosomal activities of SGK-1, I injected GFP::sgk-1(K164R) that supposedly inactivate the ATP binding site of the kinase domain as was shown for Yeast Ypk1 [263] at high concentrations and received three transgenic lines (Fig. 3.11A and BR8336-8338, see chapter: 7.3 Strains). As predicted, the three lines

RESULTS | 70 of GFP::sgk-1(K164R) had equal or higher level of SGK-1 compared to the wild type GFP::SGK-1 (Fig. 3.12E). GFP::sgk-1(K164R) did not rescue the Sma phenotype of sgk- 1(ok538). It may imply that the replacement of lysine with arginine at residue 164 is sufficient to inactivate SGK-1. This also suggests that kinase activity of SGK-1 is a requirement for the maintenance of wild type body size (Fig. 3.12A). Enhanced LysoTracker staining of sgk-1(ok538) mutant was also not rescued by this mutant, implying that GFP::sgk-1(K164R) could not revert other sgk-1(ok538) defects and may be considered non-functional or at least a kinase-dead mutant (Fig. 3.12B and C). I observed that GFP::sgk-1(K164R) was less enriched on both basolateral and apical plasma membrane, compared to GFP::sgk-1(wild type), whereas large accumulations of SGK- 1(K164R) were enhanced compared to the GFP::sgk-1(wild type) lines (Fig. 3.12D). Importantly, VLSs were not observed in the intestine of the GFP::sgk-1(K164R) transgenic worms (Fig. 3.12D and F), suggesting that SGK-1 kinase activity is prerequisite for disturbing endosomal homeostasis. In summary, the data suggests that the PX domain and, thus, endosomal membrane binding, is required for SGK-1 to maintain endosomal functions. In addition, SGK-1 activity at the endosomal membrane also requires its kinase activity. The observed rescue of Sma phenotype of sgk-1(ok538) by already low-level expression of SGK-1(R83A) indicates that weak or no endosomal membrane attachment is required for this activity, or that already very low levels of functional SGK-1 are sufficient to rescue this phenotypic aspect.

RESULTS | 71

RESULTS | 72 Figure 3.10: Alignments of PX domains (A) and full amino acid sequence (B) of SGK-1. (A) Multiple sequence alignment of PX domains of CeSGK-1/hSGK3 and other PX harboring proteins was analyzed using the CLUSTAI Omega program. Note that the SGK-1 PX domain has 85 aa over the PX domain length. The human SGK3 and C. elegans SGK-1 are highlighted with red and black asterisks. In human SGK3, R50 and R90 were shown to be critical for the binding affinity to PI(3)P (red and black boxes, conserved residues are highlighted in blue). The R50 residue of huSGK3 localizes to a highly conserved region among various PX domains of PI(3)P binding proteins (red box), and this entire amino acid stretch is missing in C. elegans SGK-1. More C-terminal, within the region highlighted by the black box, the R90 of huSGK3 is conserved as C. elegans SGK-1 R83 (RRAG of SGK3 versus RRVW of SGK-1). (B) Alignment of SGK-1, human and Xenopus SGK1 aa sequences. Conserved aa residues relevant for this study are highlighted. The postulated PDK-1 phosphorylation site T293: green; putative TORCR2 phosphorylation sites S434 and T454: purple; ATP binding site K164: yellow; proton accept site D259: red. The '*' indicates positions with a single, fully conserved residue; ':' indicates conservation between groups of strongly similar properties, scoring > 0.5 in the Gonnet PAM 250 matrix; ‘.’ indicates conservation between groups of weakly similar properties, scoring ≤ 0.5 in the Gonnet PAM 250 matrix.

RESULTS | 73

Figure 3.11: The PX domain is required for the endosomal function of SGK-1. (A) Scheme for domain architecture and phosphorylation sites of SGK-1, showing the predicted PX domain, the conserved kinase domain and the C terminal hydrophobic motif. Conserved aa residues are indicated. (B) Representative confocal images of animals with transgenic expression of GFP::sgk-1 and GFP::sgk-

RESULTS | 74 1(R83A) (pBY3707 and pBY3966, see chapter: 7.5 Plasmids). The Arg83 was mutated into Ala to impair the pseudo PX domain of SGK-1, according to a suggestion made in mammalian SGK3 [17]. Scale bar, 10 µm. (C) Expression levels of GFP::SGK-1(R83A) or GFP::SGK-1 in the transgenic worms. The mean intensities from three independent tests was normalized to mean intensity of GFP::sgk-1 transgenic line 1. (D) Percentage of GFP::sgk-1(R83A) or GFP::sgk-1 transgenic animals displaying VLSs. (E) Body size phenotype of GFP::sgk-1(R83A) and GFP:: sgk-1(wild type) transgenic animals. (F) Representative images of rab-10(q373) and rab-10(q373);sgk-1(ok538) strains with/without transgenes. Four transgenic lines are represented, two of them (upper row) with low penetrance of GFP::sgk-1(R83A) (line1 and 2 in (C)), and two of them with high penetrance of GFP::sgk-1(R83A) (line 4 and 5 in (C)) (BR8259, BR8260, BR8325 and BR8330, see chapter: 7.3 Strains). (G) Rescue of rab-10(q373);sgk-1(ok538) Sma phenotype by GFP::sgk-1(R83A). (E) Number of VLSs in strains indicated. At least 60 worms from three independent tests were counted. Error bars, mean ± SD. Scale bar, 50 µm.

RESULTS | 75

Figure 3.12: Kinase activity is critical to the endosomal function of SGK-1. (A) Sma phenotype of wild type, sgk-1(ok538), and indicated transgenic strains. (B) LysoTracker staining of two transgenic lines

RESULTS | 76 with GFP::sgk-1(K164R). Wild type and sgk-1(ok538) animals were used as controls. Scale bar, 50 µm. (C) The mean intensity of LysoTracker staining of indicated strains. More than 60 worms of each strain from three independent preparations were analyzed and the relative intensity of the LysoTracker staining was calculated by normalizing to the level of wild type animals. (D) Confocal images of transgenic strains expressing GFP::sgk-1 and GFP::sgk-1(K164R) (BR8336-8338, see chapter: 7.3 Strains). Scale bar, 10 µm. (E) Expression levels of GFP::SGK-1(K164R) or GFP::SGK-1(wild type) in the respective strains. The mean intensities from three independent preparations for each genotype were normalized to mean intensity of the GFP::sgk-1(wild type) transgenic line 1. (F) Percentage of worms showing VLSs of the indicated strains.

RESULTS | 77 3.8 Upstream regulators affecting endosomal function of SGK-1

In C. elegans, SGK-1 was reported to integrate several signaling pathways involved in regulating metabolism, development, longevity, and stress response (Fig. 3.14A). Previous work of this lab had suggested that SGK-1 is a component of IIS and is activated by PDK-1 kinase in parallel to AKT-1 and AKT-2, and can multimerize with both proteins [9]. The proposed PDK-1 phosphorylation site in SGK-1 is conserved in evolution (Fig. 3.10B, T293). To investigate the contribution of PDK-1 phosphorylation of SGK-1, a genomic mutation of threonine 293 to alanine was generated by CRISPR/Cas9 (BR7343: sgk-1(by192[T293A], see chapter: 7.3 Strains). The hypothesis is that SGK-1 produced in this strain would not be phosphorylated any more by PDK-1. In the absence of adequate antibodies against CeSGK-1 and the low levels of endogenous SGK-1 protein produced by C. elegans, no biochemical attempt was made to test this assumption. However, in all experiments performed with this mutant, this sgk-1 mutant was non-functional and behaved like the sgk-1(ok538) deletion allele. Most notably, it suppressed VLSs formation of rab-10(q373) mutant to a similar extent as sgk-1(ok538) (Fig. 3.13A and B). I therefore suggest that T293A probably has eliminated the PDK-1 phosphorylation site that, in other organisms, is critical for SGK-1 activity. Previous experiments have suggested that mutations of IIS components upstream of SGK-1 may affect protein levels of SGK-1. Deletion of pdk-1 resulted in a loss of intestinal SGK-1::GFP [9]. Consistent with the data reported there, I found that depletion of pdk-1 reduced the GFP intensity of byIs[sgk-1::GFP] almost to background (Fig. 3.13C and D). Surprisingly, SGK-1::GFP levels were restored to levels slightly higher than wild type in pdk-1(sa680);daf-16(mu86) mutant background. Besides, expression levels of sgk-1::GFP were elevated in daf-16(mu86) alone as well (Fig. 3.13C and D). This result is consistent with daf-16 negatively regulating sgk-1. In pdk-1(sa680), DAF-16 is considered to be constitutively active, and, according to such a model, would inhibit sgk-1. Such an inhibition would be lost in any mutant combination involving the daf-16(mu86) loss-of- function allele. DAf-16 has been suggested to control a large number, possibly hundreds, of downstream genes, most of which have so far not been functionally characterized.

RESULTS | 78 According to a second, more indirect model, DAF-16 could also negatively interfere with the expression of transgenes like sgk-1::GFP, although this has not been observed so far. To exclude this possibility, I attempted to measure endogenous sgk-1 expression, instead of relying on transgenic reporter gene fusions. Using a new SGK-1 antibody raised in our lab (see chapter: 7.2 Bacteria strains, mammalian cell lines and antibodies) protein levels of SGK-1 in samples prepared from synchronized wild type N2, sgk-1(ok538), pdk-1(sa680), and pdk-1(sa680);daf-16(mu86) animals were determined. The pdk-1(sa680) mutant had reduced protein level while the pdk-1(sa680);daf-16(mu86) mutant showed the same amount of SGK-1 as wild type animals (Fig. 3.13E and F). The protein level of SGK-1 in pdk-1(sa680) was about 50% of the wild type worms and, thus, surprisingly high, given the low level of SGK-1::GFP seen in the transgenic strain (Fig. 3.13C and D).This experiment eliminates the hypothesis of an influence of DAF-16 on transgene expression and suggests that sgk-1 expression is negatively controlled by DAF-16. Evidence had been provided that mammalian SGK1 may be a downstream target of mTORC2 that is able to phosphorylates SGK1 at S422 localized in the C terminal hydrophobic tail [24]. The consequences of this phosphorylation and the order dependency of PDK1 and mTORC2 phosphorylation have been subject to debate. A direct phosphorylation of C. elegans SGK-1 by TORC2 has not been shown previously. Genetic analysis indicated that sgk-1 mutant phenocopies many aspects of the rict-1(ft7) phenotype, including increased body fat, delayed development, Sma and attenuated brood size. Moreover, the putative gain-of-function mutant sgk-1(ft15) rescued delayed development, Sma and increased fat storage of rict-1(mg360), indicating that sgk-1 may function downstream of TORC2 [122]. To test these assumptions, I measured endogenous SGK-1 level in rict-1(ft7) background and sgk-1(by192[T293A]). The protein level of SGK- 1 did not show significant differences in both sgk-1(by192) and rict-1(ft7) (Fig. 3.13E and G), indicating that loss of both upstream gene activities does not affect SGK-1 protein levels. Therefore, any loss of SGK-1 function in these mutants is probably not the result of altered expression levels, but may indicate loss of the respective phosphorylation. These data also suggest that phosphorylation at either the PDK-1 or the TORC2 site seems

RESULTS | 79 to be essential for SGK-1 activity. As a consequence, SGK-1 may be only functional if both IIS and TORC2 are active. It had been suggested recently that SGK-1 acts downstream of the cold-sensitive TRPA-1 channel and calcium-sensitive PKC-2 in a signaling pathway that responds to reduction of environmental temperature [78]. Although pkc-2 was proposed to act upstream of sgk- 1, no attempts had been made to detect whether SGK-1 is a substrate of PKC-2 kinase. As is shown in Fig. 3.13E and H, in the pkc-2(ok328) mutant SGK-1 levels were significantly increased, compared to wild type. Therefore, unlike rict-1 or pdk-1, pkc-2 suppresses sgk- 1 expression and/or steady state protein levels. The experiments so far have shown that sgk-1 may integrate three signaling pathways, IIS, TORC2, and PKC-2 and that exaggerated expression of SGK-1 is sufficient to result in substantial perturbation of endomembrane dynamics. In principle, any of the three pathways could contribute to the VLSs phenotype, and to distinguish between individual roles, I measured VLSs generation by transgenic sgk-1::GFP in mutants of each pathway. For this purpose, I quantitated levels of SGK-1::GFP and the resulting VLSs phenotype in daf-16(mu86), pdk-1(sa680);daf-16(mu86), pkc-2(ok328), and rict-1(mg360)/(ft7) mutant backgrounds. The hypothesis is to generate conditions at which the expression levels of the transgene are not altered, since the reduction of SGK-1 levels were shown to reduce or eliminate VLSs phenotype (Fig. 3.2A and B). Therefore, an upstream mutant that suppresses VLSs generation without affecting SGK-1 expression levels is a candidate for a gene controlling SGK-1 activity. Since the VSLs in sgk-1 transgenes depend on expression level of SGK-1::GFP and loss of pdk-1 significantly reduced the expression of sgk-1::GFP, the role of pdk-1 in the formation of VLSs was investigated in the pdk- 1(sa680);daf-16(mu86) background that, as I showed, generated SGK-1::GFP protein levels similar to the wild type background. In pdk-1(sa680);daf-16(mu86) background, the number of VLSs was reduced, whereas the daf-16;byIs207[sgk-1::GFP] showed no alteration (Fig. 3.14B). This suggests that among two genetic backgrounds that maintain SGK-1::GFP protein levels, only one of them (pdk-1(sa680)) reduced VLS formation. This may be taken as a strong argument that PDK-1 phosphorylation is prerequisite of VLSs

RESULTS | 80 generation by sgk-1. In pkc-2(ok328) mutant background, the average number of VLSs was also reduced. However, considerable amount of VLSs (about 14 on average) can still be detected in both pdk-1(sa680);daf-16(mu86) and pkc-2(ok328) mutant backgrounds (Fig. 3.14B). Since in pkc-2(ok328), endogenous SGK-1 levels were increased compared to wild type, even reduced activity of SGK-1, caused by speculative loss of PKC-2 phosphorylation, could still result in a gain-of-function phenotype due to the increased protein levels. Therefore, any contribution of SGK-1 (phosphorylation) by the TRPA- 1/PKC-2 axis cannot be proposed without further experiments. The most substantial reduction of VLSs to almost background was observed in both the weak loss-of-function allele rict-1(mg360) and the proposed null allele rict-1(ft7) (Fig. 3.14B). This suggests that TORC2 activation of SGK-1 has more impact on endosomal (dys-)function of SGK-1 than the activity of IIS and PKC-2. As an integrator of at least three pathways, SGK-1 may act downstream of RAB-10 to modulated endomembrane dynamics. Previous experiments have shown that sgk-1(ok538) deletion mutant, which will affect all three pathways, can suppress the VLSs phenotype of rab-10(q373). This offered me a unique opportunity of another readout to investigate individual inputs into SGK-1 activation. Therefore, I crossed pdk-1(sa680), daf-16(mu86), pdk-1(sa680);daf-16(mu86), rict-1(mg360)/(ft7) and pkc-2(ok328) mutants into the rab- 10(q373) background and analyzed modulation of VLSs formation. Neither pdk- 1(sa680);daf-16(mu86) nor daf-16(mu86) affected VLS numbers of rab-10(q373). pdk-1(sa680) reduced VLS numbers of rab-10(q373) significantly however not fully suppressed (Fig. 3.14C and D). Since in Western blot experiments I showed that pdk-1(sa680) reduced SGK- 1 protein levels, whereas pdk-1(sa680);daf-16(mu86) restored SGK-1 to wild type levels, it is tempting to speculate that the slight rab-10 suppression by pdk-1 may be the consequence of less SGK-1 protein, and not of reduced SGK-1 activity. Deletion of pkc-2 had no effect on VSL numbers in rab-10(q373) (Fig. 3.14C and D), along with the assay described (Fig. 3.14B), suggesting that PKC-2 may affect the endosomal function of SGK- 1 probably via regulating the kinase activity of SGK-1. Both rict-1(mg360) and rict-1(ft7) suppressed the VSLs of rab-10(q373) completely. They

RESULTS | 81 also enhanced the Sma phenotype of rab-10(q373) (Fig. 3.14C and D). I conclude that rict- 1/TORC2 may be considered as the predominant regulator of SGK-1 activity in endocytic trafficking. Introduction of the gain-of-function allele sgk-1(ft15) to some extent restored VLSs suppression seen in rict-1;rab-10(q373) mutants (Fig. 3.14E), further supporting the position of sgk-1 downstream of rict-1 with respect to endosomal functions. Number of VLSs in both of the two rict-1 alleles were restored by ft15, even though the restoration of the VLSs was more profound in the weak rict-1(mg360) allele compared to the presumed rict-1(ft7) null allele (Fig. 3.14E). The fact that only partial suppression was observed with this, but not other phenotypes, should be interpreted with caution, but may indicate that ft15 results in a gain of only selected functions of SGK-1. In summary, SGK-1 integrates TORC2 activity for the regulation of endocytic trafficking.

RESULTS | 82 Figure 3.13: Signaling pathways that regulate protein level of SGK-1. (A) rab-10(q373);sgk- 1(by192[T293A]) does not show VLSs in the intestine compared to rab-10(q373). (B) Number of VLSs at day one adult stage of rab-10(q373) and rab-10(q373);sgk-1(by192[T293A]). (C) Images of sgk-1::GFP in the various mutants background. SGK-1::GFP was detected in both neurons and intestine of the wild type

RESULTS | 83 N2, daf-16(mu86) and pdk-1(sa680);daf-16(mu86) backgrounds. (D) The mean fluorescence intensity of SGK-1::GFP in the indicated mutant backgrounds. More than 90 animals of each strain from three independent tests were analyzed. (E) Western blot for the endogenous SGK-1. To measure the endogenous protein level of SGK-1, 30 day one adults of the wild type N2, sgk-1(ok538), pdk-1(sa680) and pdk-1(sa680);daf-16(mu86) were transferred to the Eppendorf tubes and the Western blot samples were prepared as is described in Material and Methods 2.9. With the exception of the sgk-1(ok538) mutant, for each strain three independent protein samples were prepared and loaded on the gel. Antibody used see chapter: 7.2. Worms for the pdk-1 group were raised at 20°C until L4 stage and then switched to 25°C for another 24 h. Worms for rict-1 and pkc-2 groups were raised at 20°C. (F) The protein level of SGK-1 in the pdk-1 group. Images of the Western blot from three independent assays were analyzed with ImageJ. The pixel value represents the intensity of SGK-1 protein was firstly normalized to the intensity of actin. Then all the yielded value of each strain was normalized to the wild type worms. (G) The protein level of SGK-1 in the rict-1 group. (H) The protein level of SGK-1 in the pkc-2 group. Scale bar, 50 µm.

RESULTS | 84 Figure 3.14: TORC2 provides the predominant input into SGK-1 function in endocytic trafficking. (A) Signaling pathways known to regulate the function of SGK-1 in C. elegans. (B) Number of VLSs in day one adult animals of byIs207[sgk-1::GFP] in the indicated genetic backgrounds. VLSs were counted using a compound microscope with a 20x magnification objective in the DIC channel. Animals were raised at 15°C. (C) Representative images of intestinal VLSs in distinct genetic backgrounds. rab-10(q373) show large VLSs in the intestine. Mutations pdk-1(sa680), daf-16(mu86), pdk-1(sa680);daf-16(mu86), pkc-2(ok328), rict-1(mg360), rict-1(ft7) and sgk-1(ft15) were crossed into rab-10(q373) background to investigate modulation of VLSs in double or triple mutants. (D) Number of VLSs at day one adult stage of various mutants. (E) Number of VLSs at day one adult stage of rict-1 related mutants. Scale bar, 50 µm.

RESULTS | 85 4 DISCUSSION

4.1 Dynamic regulating the expression of SGK-1 in C. elegans

During the characterization of the endosomal phenotype of sgk-1 transgene, unexpected results I have presented highlight a new mechanism for regulating the expression of SGK- 1 (RESULTS 3.1). I found that C. elegans senses temperature to change the expression of a transgenic construct sgk-1::GFP. The fluorescence intensity of SGK-1::GFP is inversely correlated to temperature, with lower temperature resulting in stronger expression levels. These results, obtained with transgenic marker strains, were verified with qRT-PCR and Western blot that detect the endogenous transcription and protein level in wild type. SGK was originally identified in rat mammary tumor cells upon stimulation of serum or glucocorticoids [1, 2]. Both transcriptional and translational responses to a variety of stimuli have been reported before for SGK proteins in different species (Table 1). However, temperature dependent regulation of SGKs was rarely reported. It has been shown that the protein level of SGK in NMuMg nontumorigenic mouse mammary epithelial cells was sharply increased at time intervals of 0.5 and 1 h after heat shock at 42°C. It was also reported that the induction of SGK upon heat shock was p38/MAPK dependent and suggested that p38/MAPK somehow ultimately targets the promoter of sgk to elevate its expression [56]. Notably, the induction of SGK upon heat shock is dynamic and showed an induction peak at 0.5 h post heat shock, and went back to the basal level within 2 h [56]. The upregulation of SGK upon heat shock seems contradictory to my results. However, since the aa sequence of SGK-1 shares only about 55% similarity to the mammalian SGKs, therefore, some of the functions that regulated by different mechanisms may be not conserved. C. elegans SGK-1 was shown to function in a pathway with TRPA-1, which is a cold-sensing TRP channel, to mediate regulation of lifespan [78]. The trpa-1 mutant is short lived at 15 and 20°C (cold temperature) while lifespan at 25°C is unaffected. Transgenic expression of trpa-1 extends the lifespan of C. elegans at cold temperature and it is sgk-1 dependent. Meanwhile, overexpression of sgk-1 extends

DISCUSSION | 86 lifespan at 20°C whereas the lifespan of a sgk-1 transgene at 25°C has not been reported. Consistently, the sgk-1 mutant is short lived and has no temperature dependence [78]. Therefore, sgk-1 is critical for the TRPA-1 mediated signaling pathway to promote longevity at low temperatures. However, how the protein level and activity of SGK-1 react to temperature cue remains unclear. The decreased protein level of SGK-1, either in the transgene or wild type N2 worms along with the raising temperature correlates with the sgk-1 dependent promotion of longevity at low temperatures. It is reasonable to hypothesize that elevated protein level probably results in enhanced activity of SGK-1 to extend the lifespan at low temperature, and may relate to the long-lived phenotype of wild type worms at low temperature [264]. In addition, the correlation between the transgenic and endogenous expression of SGK-1 indicates that SGK-1::GFP could be used as the indicator of endogenous SGK-1 in the future studies. Of note, there are drawbacks that should always be considered in assays with integrated expression arrays. The integration of each array is a unique and highly mutagenic event, which creates linked mutations in close proximity to the insertion site that may not be removed by simple backcrossing. Furthermore, the integration has been inserted in the genome might not only affect the expression levels of the integrated array, but also leads to synthetic genetic background due to the disruption of the sequence environment at the integration site. To circumvent such problems, it is stand art in the field to at least analyze two independent integration lines per construct that need to show consistent results. Unfortunately, the expression level test based on the sgk-1::GFP was only done with one array, the future work shall include at least another array. Moreover, in order to show that no background insertion mutation influences the results, evidence from extrachromosomal arrays (which typically are expressed less consistently than from the integrated lines) are also required in a parallel test. However, the data obtained from the sgk-1::GFP transgene correlated well to the results of endogenous SGK detected by qRT-PCR and Western blot, suggesting that at least the single sgk-1::GFP transgene used in this work is qualified for its representative role of endogenous SGK-1. There are elegant ways to avoid transgene insertion-related effects in light of advantage brought by the

DISCUSSION | 87 transposon or CRISPR/CAS9 mediated single copy insertion techniques in C. elegans. However, a single-copy transgene insertion probably would result in weaker expression than the expression from an integrated multi-copy array. In the study shown here, integration of such multi-copy arrays generated a gain-of-function phenotype and allowed the study of sgk-1 roles in endosome dynamics, whereas site in sgk-1 whose mutation could result in a functionally similar gain-of-function to be used in CRISPR/Cas9 mutagenesis is currently not known. Taken together, I have disclosed that the expression of SGK-1 changes with the alteration of culturing condition of C. elegans, and the response is most likely mediated at transcriptional levels, since mRNA level altered accordingly to the protein level. It will be interesting to further investigate the detailed mechanisms how sgk-1 transcription is mechanistically controlled by cold temperature. Overall, these observations indicate that sgk-1 responds to temperature cues to adjust its expression actively. Other than the temperature dependent regulation of SGK-1 expression, I confirmed not only that the IIS pathway mediates the SGK-1 kinase activity, but also controls the protein level of SGK-1 (see RESULTS 3.8 and [9]). A previous study has shown that in pdk-1 or daf-2 mutant background, sgk-1::GFP expression was dramatically downregulated in the intestine, and to a lesser extent in neurons [9]. Subsequent work in our lab suggested that the transcription of sgk-1 in the daf-2 mutant background is suppressed and can be regained by additional deletion of daf-16 (Venera Gashaj, PhD Dissertation). My results here on the basis of the integrated stain validated the observation that expression of SGK- 1::GFP is downregulated in the pdk-1 background and the reduction can be restored by additional knockout of daf-16, suggesting the negative role of DAF-16 in regulating the expression of SGK-1. Western blot results detecting endogenous SGK-1 levels supported a model that, in addition to the suppressive (or in other studies activating) role of SGK-1 on DAF-16, the expression level SGK-1 is negatively regulated by DAF-16 maybe in a feedback loop. Such a feedback loop would suppress expression of SGK-1, once insulin signaling is blocked by alterations of, e.g. physiological or environmental conditions. Given that the mRNA level of sgk-1 was restored in the daf-2;daf-16 mutant when

DISCUSSION | 88 compared to daf-2, it is feasible that daf-16 suppresses the transcription of sgk-1 directly. A recent publication had included sgk-1 as a negative target of daf-16 in a microarray database. However, the automated collection of data had suggested that sgk-1 may not be directly controlled by DAF-16 (that has only been shown to act as a transcriptional activator), but instead may be the direct target of the antagonistically acting transcription factor PQM-1 [111]. However, the expression of sgk-1::GFP was not changed in pqm-1 mutant background (see chapter: 7.7 Supplemental figure A). In mammalian cell culture, where SGK1 expression is increased in the Rictor-1 knockout MEF cells. Rictor-1 was suggested to associate with Cullin-1 to form a functional E3 ubiquitin ligase to promote the SGK1 ubiquitination. Loss of Rictor/Cullin-1-mediated ubiquitination leads to increased SGK1, while the ubiquitination is abolished when Rictor is phosphorylated by AGC kinases (Akt, SGK1 and S6K1) [26]. Whereas my data suggests that TORC2 did not affect SGK-1 protein levels in C. elegans, since the alteration obtained in rict-1 mutant proved to be insignificant (RESULTS 3.8). However, our unpublished data (see chapter: 7.7 Supplemental figure B) suggests that SGK-1 levels are increased in the rict-1 mutant background. Given the small sampling (four independent tests and one was significant outlier) for statistical analysis and inferior SGK-1 poly-antibody in my assay, it would be preferable to repeat the assay with a superior SGK-1 antibody to reveal whether there is phylogenetically conserved regulatory mechanism of SGK-1 by TORC2 between mammals and C. elegans.

DISCUSSION | 89 4.2 Activation of SGK-1

Many details of activation of mammalian SGKs are understood fairly well, but little mechanistic details are known. As one of the AGC kinases, SGK1 was proposed to have the similar activation mechanism. Since the upstream regulator of hSGK1, PDK1, is localized at PI(3,4,5)P3 in the plasma membrane, SGK1 and SGK2 are probably activated in the cytosol. It was suggested that the C terminal hydrophobic motif of SGK1/2 is phosphorylated by mTORC2 which triggers its interaction with PDK1 via the PIF-motif and is then phosphorylated by PDK1 to achieve the full activity [21, 24]. Besides, PDK1 seems to dominate the activation of SGK1 since phosphorylation of SGK1 with mTORC2 in the absence of PDK1 did not stimulate SGK1 activity significantly [24]. Unlike SGK1/2, SGK3 contains a conserved PX domain which preferentially binds to PI(3)P [17]. Inhibiting SGK3 binding to the endosomes by applying a VPS34 inhibitor (thus blocking PI(3)P generation) induces a rapid 50-60% decrease in SGK3 activity accompanied by a proportional decrease in the T-loop and hydrophobic motif phosphorylation, whereas attenuating PX almost completely suppresses activity of SGK3 [17]. The same study proposed three pools of SGK proteins at the plasma membrane, the endosomal membrane, and possibly in the cytosol, for activation of SGK3 by PDK1 and mTORC2. The C. elegans SGK-1 was firstly shown to interact with PDK-1 and form a complex with AKT-1/2 [9]. Later, sgk-1 was shown to share many phenotypic aspects with of rict-1 and placed sgk-1 the direct downstream target of TORC2 [113, 122]. Consistent with the mammalian SGKs, activation of SGK-1 was suggested to require both the upstream regulator PDK-1 and TORC2. However, the detailed mechanism for activation of C. elegans SGK-1 remains unclear. I suggested that SGK-1 harbors a (partial) PX domain that might possibly allow a SGK3 like mechanism for activation. Mutating a conserved R83 residue within this putative domain altered SGK-1 localization, and possibly (as revealed by in situ imaging) also its binding to endosomal membranes. Whereas impairing the binding of SGK-1 to the endosomes did not significantly affect the kinase activity that is contradictory to the discovery of SGK3. It may suggest a distinct regulatory mechanism that, unlike SGK3, the activation of SGK-1 is PI(3)P binding independent. It is possible

DISCUSSION | 90 that SGK-1 is activated in the cytosol and recruited to the endosomal membranes. Interestingly, my observation suggested that PDK-1 slightly affects the activity of SGK-1 while TORC2 controls the activity of SGK-1 referring to the endosomal function of SGK- 1. Both PDK-1 and TORC2 phosphorylations are required to activate SGK-1. However, sgk-1 phenocopies several of the phenotypic aspects of rict-1 but not pdk-1. For functions related to lipid metabolism, sgk-1 does not seem to be the single output of TORC2, and there it probably functions redundantly with akt-1 [113]. It is likely that TORC2 shows a dominantly effect on the activity of SGK-1 in C. elegans, which is opposite to the activation mechanism of mammalian SGKs. A previous study has suggested that purified SGK- 1::GFP in the pdk-1 mutant background was unable to phosphorylate its target DAF-16 in vitro [9]. But a distinct study on SGK-1 suggested that immunopurified SGK-1::GFP from pdk-1 mutant phosphorylated the PXXP domain of CED-5, suggesting that activation of SGK-1 does not strictly depend on PDK-1 phosphorylation (Venera Gashaj, PhD Dissertation). One justified explanation is that executing certain functions of SGK-1 requires different activating mechanisms of which the prominent role of PDK-1 or TORC2 to SGK-1 activity changes simultaneously. I would like to mention that the pdk- 1(sa680) is not a null mutant, it is possible partial kinase activity is remained. It is impossible to predict whether the residual PDK-1 in pdk-1(sa680) mutant is enough to activate SGK-1 unless direct phosphorylation target of SGK-1 in respect to the endosomal function is identified. It would be worthy to use a null mutant of pdk-1 to conduct the assay in the future work. Again, in vitro phosphorylation assay with known substrates of SGK-1 is desirable. PDK1 phosphorylates mammalian SGK1 at T256 while the mTORC2 phosphorylation site is S422, and both of the sites are highly conserved in SGK2 and SGK3. We positioned the PDK-1 phosphorylation site at the T293 of SGK-1 and generated a CRISPR/Cas9 mutant which replaced the threonine with alanine to block the putative phosphorylation site of PDK-1. This mutant behaved similar to the putative null mutant sgk-1(ok538) even for the suppression of VLSs in the rab-10 mutant (RESULTS 3.8), implying the lost kinase activity of SGK-1 by removing PDK-1 phosphorylation is absolutely critical for SGK-1

DISCUSSION | 91 function. Besides, transgenic expression of sgk-1(T293A) was unable to rescue the Sma phenotype of sgk-1(ok538) further supporting this conclusion (see chapter: 7.7 Supplemental figure D and E). However, the genetic analysis above (RESULTS 3.8) indicated that PDK-1 was not necessarily required for the activity of SGK-1 regarding to the endosomal function. One explanation is that T293A abolished a phosphorylation site that can be used by several upstream kinases, and PDK-1 is only one of them. Although the PDK-1 phosphorylation site is highly conserved, none of the previous studies done in C. elegans has actually shown that T293 is indeed phosphorylated by PDK-1. Given T293 sits in the highly conserved kinase domain, the T293A mutation may impair the default conformation and inactivate SGK-1, e.g. resulting in protein or domain misfolding. The TORC2 phosphorylation site of SGK-1 remains unclear whereas several sites were suggested [113, 262]. Although SGK-1 is phylogenetically conserved to the mammalian SGKs, the similarity is not high as is above mentioned. Especially, the C terminal hydrophobic motif only shares a similarity of approximately 25% that did not allow me to precisely position the phosphorylation sites by TORC2 via simple alignment with SGKs. Transgenic expression of constitutively active sgk-1(T453K) was able to partially suppress the increased fat mass of rict-1 while could not rescue the Sma phenotype [113]. A recent study showed that constitutively active sgk-1(S434E, T454E) also partially rescued the sinh-1 defect of chemotaxis [262]. However, in my assay, transgenic expression of postulated inactive SGK-1(S434A, T454A) (BR8342-8344, see chapter: 7.3 Strains) rescued the Sma phenotype of sgk-1(ok538) and induced VLSs in the intestine, indicating against S434, T454 being the correct TORC2 phosphorylation sites, or TORC2 phosphorylation being not important for SGK-1 functions to rescue these phenotypic aspects (see chapter: 7.7 Supplemental figure D, E and F). It would be advantageous to conduct mass spectrometry experiments in the future to identify the exact phosphorylation sites of SGK-1. In addition, the development of phospho-specific antibodies for SGK-1 would be useful for subsequent biochemistry or genetic assay of SGK-1.

DISCUSSION | 92 4.3 The novel function of SGK-1 in endomembrane trafficking

As closely related members of the AGC kinase family, SGK1, 2 and 3 share overlapping substrate specificity with Akt as well as similar functions [18, 113]. However, unlike Akt, SGK1 and 2 are predominantly cytoplasmically localized, whereas SGK3 has a PI(3)P lipid-binding PX domain and localized to the endosomal membrane. It has been proposed that SGK3, localized to EE, attenuates ubiquitin-dependent degradation of CXCR4 by blocking the function of E3 ubiquitin ligase AIP4 in HeLa cells [35]. Recent work suggested that SGK3 may substitute for Akt after application of PI3K/Akt inhibitor, to promote activation of mTORC1 in the tumor cell lines [18]. Moreover, another localization of SGK3 was suggested, according to which SGK3 colocalized with NHE3 to the recycling endosomes and enabling acute regulation of NHE3 via the PI3K-PDK1 pathway [265]. To date, all the studies highlighted the function of SGKs mediating signaling transduction in the context of IIS or mTORC2, none of them showed the direct contribution of SGK proteins to the endocytic machinery. The observation that SGK3 localizes to the EE prompted me to consider if C. elegans SGK-1 could have a similar function, and to the greater extent, possible role in regulating intracellular traffic machinery. I predicted that SGK-1 contains a, at least partially conserved, PX domain at its N terminus. I detected a VSLs phenotype after multi-copy expression of sgk-1 that resembles several aspects of a phenotype of rab-10 or rme-1, implying that hyperactive SGK-1 is able to impair the endocytic machinery of C. elegans. Rather than being unspecific, this may suggest that SGK-1 itself plays a role in endocytic trafficking, although such a defect was not obvious from inspecting sgk-1 loss-of-function alleles. To identify the origin and identity of the VSLs generated upon SGK-1 hyperactivity, I performed costaining with several membrane marker proteins. SGK-1 in the intestine of C. elegans costained VLSs with the early endosome marker RAB-5 and the late endosome/lysosome marker LMP-1, but not the lysosome marker CUP-5 (RESULTS 3.3). An additional, weakly penetrant correlation of Scarlet::SGK-1 labelled VSLs with the late endosome marker GFP::RAB-7 was also observed. Even though both RAB-7 and LMP-1 can label LEs, they emphasize different maturation steps of LEs given the endosomes

DISCUSSION | 93 they marked were not fully overlapped [159, 171]. Furthermore, during the lysosome biogenesis, LMP-1/LAMP1 acts as a cargo protein initially which is transported from the TGN to endosomes. With the maturation of endosome, LMP-1 is transferred from EEs/LEs to the newly generated lysosomes [228]. In consistent with observation from cargo proteins (Fig. 3.4, RESULTS 3.2), it is possible that the transport of LMP-1::GFP was blocked therefore sequestered in the VLSs in the sgk-1 transgene. Thus, the LMP-1::GFP may mark EEs/LEs rather than lysosomes in this case. These results suggest that VSLs probably originated from EEs/LEs. One possibility would be that SGK-1 blocks endosome maturation, and subsequently escape routes for the blocked proteins and membranes result in the generation of VSLs. The fact that the LE/lysosome marker LMP- 1, but not the lysosome marker CUP-5 costained VLSs with SGK-1 is remarkable, since it implies that a maturation step of the LE/lysosome to lysosome is blocked upon SGK-1 overexpression. CUP-5 is the ortholog of Mucolipin-1 that plays a role in autophagy, membrane trafficking and metal homeostasis. It has been proposed to play a major role in Ca2+ release from the LE or lysosome, a function that has also being proposed for hSGK1. Lysosomal degrading defects, as those seen in cup-5 mutants, result in the appearance of large similar to that seen upon sgk-1 overexpression [223]. According to unpublished observations, cup-5 is strongly inactivated by PI(4,5)P2 (as it accumulates in a rab-10 mutant) and activated by PI(3,5)P2. ppk-3 also tested in my study is required for the production of PI(3,5)P2. According to one possible model, SGK-1 overexpression could block PPK-3/PIKfyve function, thus reducing PI(3,5)P2 levels on the expense of PI(4,5)P2. This would inactivate CUP-5 and could result in VLSs. Other interpretations also need to be discussed. A role of C. elegans SGK-1 in intracellular trafficking was also suggested recently from another study [266]. It was shown that GFP-tagged MIG-14/Wntless, the sorting receptor of Wnt, failed to localize to the basolateral membrane of intestinal cells, instead, it was missorted to lysosomes in the sgk-1(ok538) deletion mutant. This defect can be partially restored by reducing glucosylceramide biosynthesis [266]. In contrast to this observation, I did not observe a dramatic change of the localization of MIG-14::GFP to either

DISCUSSION | 94 basolateral or apical membranes in sgk-1(ok538). Consistent with this observation, the localization of other cargo markers were not perturbed in general, as no obvious morphological defects were detected for the endosomes of the sgk-1(ok538) mutant. Of note, the endocytic recycling pathway is highly dynamic and tightly coupled with the secretory pathway, so it is possible that reduced or increased plasma membrane localization of the cargos/receptors can be compensated immediately by the secretory pathway. Importantly, I found that deletion of sgk-1 dramatically increased the LROs (in C. elegans also called gut granules) in the cell, suggesting an obviously altered degradative branch of endomembrane trafficking. LRO generation involves adaptor complex 3 (AP- 3) mediated lysosomal transports. The C. elegans gut granules are intestinal cell specific LROs, containing conspicuous autofluorescent and birefringent material, which act as specialized lysosomes in synthesis, storage, and secretion and they often coexist with conventional lysosomes. Several proteins such as GLO-1, GLO-3, PGP-2, AP-3 complex, BOLC-1 and HOPS complex, which function at EEs/LEs are conserved in mammals, were identified in C. elegans to regulated the biogenesis of LROs [255, 258]. Thus, my data indicates that the balance between cargo recycling and degradation in the sgk-1 mutant background is perturbed, and probably the sorting function of the endosome is impaired. Interestingly, Ypk1, the homolog of SGK-1 in Yeast, was reported to function in endocytosis, also, where it controls the biogenesis of sphingolipid and glucosylceramide [263, 267, 268]. The internalization of α-factor, the ligand of Ste2 that is a G protein- coupled signaling receptor, was severely impaired in the ypk1/SGK-1 knockout or the kinase dead mutants. The further characterization showed that the fluid-phase maker Lucifer yellow was blocked as well in the ypk1 mutant. Based on these finding, a model was proposed that Ypk1 regulates the endocytosis via affecting the sphingolipid level in a Pkd1 (the homolog of mammalian PDK1) dependent manner [263]. Other studies showed that Ypk1 was recruited to the plasma membrane by scaffold protein Slm1/2. And then phosphorylated by TORC2. While Ypk1 balances the sphingolipid content and aminophospholipid of the plasma membrane by regulating Fpk1, a known flippase activator [269, 270]. Intriguingly, I observed the strong plasma membrane localization of

DISCUSSION | 95 SGK-1 at both basolateral and apical membrane, implying that SGK-1 may function similar to Ypk1 at the plasma membrane even though the mechanism for recruiting SGK- 1 to plasma membrane probably differs, since the homologs of scaffold proteins Slm1/2 are missing in C. elegans. Severe defects of endocytosis were not detected in sgk-1(ok538) mutant as the distribution of ssGFP and YP170::GFP was not changed when compared to the wild type worms. It is important to keep in mind that both ssGFP and YP170::GFP are typically used to investigate the endocytosis of coelomocytes and oocytes in which SGK- 1 (at least from studies involving transgenic reporters) does not seem to be expressed, arguing that SGK-1 probably does not function in these tissues. Accordingly, I generated transgenes that express mCherry::sgk-1 in coelomocytes by the tissue specific promoter Punc-122. While mCherry::SGK-1 was detected inside of endosomes rather than the endosomal membranes (BR7750-7752, see chapter: 7.3 Strains; 7.7 Supplemental figure G), indicating that ectopic expression of SGK-1 in coelomocytes may produce inactive SGK- 1 protein and was sorted into the lumens of endosomes as waste protein for degradation. This result further indicates that SGK-1 does not function in coelomocytes. Notably, this ssGFP, which is secreted from the body wall muscle cells, is also internalized by intestinal cells from the basolateral membrane. However, it is hard to track GFP signal due to the instability of GFP in the acidic environment which is the default condition of endosomal lumen. In addition, the intestinal cells show strong autofluorescence which impedes the accurate detection of GFP. The receptor mediated endocytosis was also investigated with other markers in the intestine, and no significant difference for the membrane localization of hTAC, hTfR and MIG-14 in the intestine was observed (data not shown), suggesting that SGK-1 does not regulate the endocytosis step of intracellular trafficking. It has been reported that Xenopus SGK1 phosphorylates Nedd4-2, an E3 ubiquitin ligase that labels the ENaC sodium channel, and reduces the interaction between Nedd4-2 and ENaC, thus leading to elevated ENaC cell surface expression [34]. A subsequent study showed that the phosphorylation of Nedd4-2 by SGK1 is triggering SGK1 ubiquitination by Nedd4-2 and proteasomal turnover [25]. The negative regulation of Nedd4-2 and SGK1 proposes a fine-tuned feedback inhibition to adjust the concentration of ENaC on the plasma

DISCUSSION | 96 membrane. Since another E3 ubiquitin ligase, AIP4, is phosphorylated by SGK3, it might be interesting to test whether SGK-1, the single homolog of mammalian SGKs in C. elegans, may regulate the internalization of certain receptors via controlling E3 ubiquitin ligases. Combined with the plasma membrane and endosomal localization of SGK-1, it is desirable in future work to identify the direct targets that may be regulated by SGK-1, and to a greater extent, dissect the plasma membrane and the endosomal function of SGK- 1 in membrane trafficking. The discovery in the present study demonstrated that SGK-1 functions at the endosome and coordinate the dynamics of intracellular vesicular trafficking. In addition, I further validated the functional conservation between C. elegans SGK-1 and mammalian SGKs, which will be helpful to the investigation of redundant functions of mammalian SGKs.

DISCUSSION | 97 4.4 SGK-1 and the endosome maturation

PI(3)P is a major determinant of EE membrane identity, and participates in nearly all aspects of endosomal function, particularly protein sorting at the endosomes. It has been reported that in rab-10 or rme-1 mutants, hTAC::GFP was blocked and accumulated at the membranes of VLSs more than hTfR::GFP, suggesting that RAB-10 and RME-1 function in the basolateral recycling of clathrin-independent cargos [228]. In strains hyperactive for sgk-1, both hTAC::GFP and hTfR::GFP strongly accumulated on the membrane of VLSs, implying that the basolateral transport of these two cargos was impaired. Furthermore, both of the other tested cargos MIG-14 and TGN-38 that use different transport pathways and are shuttled to the TGN, were also blocked by hyperactive SGK- 1. This suggests that hyperactive SGK-1 probably blocks steps in endocytic pathways common to all transport routes of those proteins. It also suggests that transport problems are not confined to particular early endocytic steps, like clathrin-mediated transport, since both CIE and CME transported cargos were blocked in the mutant. SGK-1 also localizes to the membrane of VLSs that show EE/LE identity (see RESULTS 3.3). Given the recycling of the cargos are mediated basically by the SNXs, proteins that primarily localize to EE/LE, SGK-1 may interfere with the function of sorting nexins, including those responsible for selecting proteins to recycling endosome and TGN. The common feature of the SNXs in orchestrating cargo sorting in the early/late endosome is that they are PI(3)P-binding proteins (contain a PX domain, like SGK3) even though some of them (such as SNX-3) do not have the BAR domain involved in mediating membrane curvature. An attractive hypothesis would be that overload of SGK-1 that I have shown to have a partial PX domain that may be functional, competes with SNXs localization and/or activity and jeopardizes protein sorting at endosome. This could be tested by systematically inactivating snx genes in the worm in search for a similar phenotype. At first glance, snx loss-of-function mutants should display similar VLSs as transgenic sgk- 1, and these should stain with the same markers. As a consequence, VLS formation might be the result of accumulated cargos or membranes following protein sorting defects at the endosome. It is surprising that sgk-1 transgenic animals, although displaying highly

DISCUSSION | 98 penetrant VLSs, do not have more severe defects in development, stress resistance, reproduction, and lifespan. sgk-1(ok538) mutant had increased amount of LROs, implicating the excess transport of cargo from endosomes to LROs. This result suggests that sgk-1 might control the activity of regulators in generation of LROs. It had been proposed earlier that CISK (synonymous for hSGK3) prevents degradation of the chemokine receptor CXCR4 by inhibiting its sorting into ILVs. In contrast, CISK/SGK3 did not interfere with ligand-induced degradation of epidermal growth factor receptors [35]. CXCR4 sorting involves interactions of SGK3 with the ubiquitin ligase AIP that promotes the early sorting phase in endosome, and thus the transition of EE to LE. It is interesting to note that the protease USP8, antagonizing AIP4 function, is an ESCRT associated protein that sorts proteins marked for degradation at the membranes of early/late endosomes. The initiation of this process is the recognition of ubiquitinated proteins by the ESCRT-0 complex that consists of two protein HGRS-1 and STAM-1. HGRS-1 harbors FYVE domain which also binds to the separate PI(3)P pools on the vacuolar part of the limited endosome membrane. Since the maturation of endosome is fast and dynamic, the sorting of proteins for recycling and degradation is delicately tuned by SNXs and the ESCRT complex. If overexpression of SGK-1 would indeed suppress the function of SNXs, as hypothesized above, deletion of sgk-1 might release such suppression, forcing the sorting towards a degrading route. Therefore, loss-of-function mutants of candidate ESCRT proteins or a systematic RNAi screen should be able to suppress the increased LROs of sgk-1. Upon close inspection of the VLSs found in sgk-1 transgenic animals, about 15% of the VLSs contained one or two smaller ring-like substructure in their lumen, that are always connected to one site at the inner surface of their membrane (Fig. 3.4A, hTAC and hTfR). Such VLS substructures correlate with the known ILVs that are formed via inward vesiculation of the endosomal membrane and are typically degraded upon endosomal fusion with the lysosomes. Consequently, blocking the fusion of endosomes with lysosomes should also prevent the turnover of ILVs. ILVs are also the first step in the generation of extracellular vesicles (exosomes) and their budding from the endosomal membrane is controlled, among

DISCUSSION | 99 others, by the ESCRT complex or LBPA. However, the mechanism for LBPA mediated formation of ILVs remains unclear. Given the rings inside of the VLSs were strongly stained by Scarlet::SGK-1 and along with the postulated PI(3)P binding affinity of SGK-1, it is possible that hyperactive SGK-1 interferes with the generation of ILVs. The attachment of small rings with VLSs at small membrane patches may indicate that the detachment of the ILVs from the endosomal membrane is perturbed, although further experiments will be required to confirm this assumption. In yeast, the SGK homolog Ypk1 is a critical regulator for synthesizing sphingolipid and ceramide [267, 268]. Both serve as substrates for LBPA and are involved in the biogenesis of ILVs. It is possible that the C. elegans SGK-1 may performs the same role and somehow interferes with the function of LBPA. It will be interesting to investigate both mutants and transgenic markers of the ESCRT complex in sgk-1 mutant and transgene backgrounds to elucidate the possible role of SGK-1 in the MVBs maturation. VLSs showed a high level of costaining of SGK-1 with PH(Akt)::GFP (marker for PI(3,4,5)P3) or PH (PLCδ)::GFP (marker for PI(4,5)P2) (see RESULTS 3.3), which suggests that the majority of VLSs contain abundant PI(3,4,5)P3 and PI(4,5)P2. Both PI(3,4,5)P3 and PI(4,5)P2 are enriched at the plasma membrane to mediate signal transduction in response to stimuli. Moreover, accumulating evidence suggests that PI(4,5)P2 has crucial roles in intracellular compartments, particularly in the RE, while PI(3,4,5)P3 has not been implicated in endocytic trafficking so far. It is well-established that the lipid messengers including PI(3,4,5)P3 and PI(4,5)P2 will be soon dephosphorylated after termination of signaling via endocytosis [271]. The pools of PI(4,5)P2 on REs are synthesized during the maturation of RE [250]. Since PI(3,4,5)P3 does not accumulate into large intracellular pools, it is likely that overexpression of SGK-1 suppresses the dephosphorylation of PI(3,4,5)P3 on endocytic vesicles and this suppressing effect may also apply to PI(4,5)P2. Recent discovery showed that another PIP2, plasma membrane PI(3,4)P2, is required for membrane constriction during endocytosis, but also plays important roles in signaling events occurring at the membrane [249]. The endosomal pool of PI(3,4)P2 synthesized by class II PI3Kβ negatively regulates mTORC1 activity [272]. Of note, the PH domain of Akt

DISCUSSION | 100 has binding affinities to both PI(3,4,5)P3 and PI(3,4)P2. Therefore, in my experiments, the PH(Akt)::GFP reporter used may mark a hybrid pool of PI(3,4,5)P3 and PI(3,4)P2 at the membranes of VLSs. Given that PI(3,4)P2 was suggested as the mediator from PI(4,5)P2 to PI(3)P during the maturation of EE [249], I would like to propose a role of SGK-1 in blocking the dephosphorylation of PIPs on endosomal membranes. Therefore, future work should focus on phosphatases modulating the sgk-1 transgene phenotype. PI(3)P which can be marked by GFP::2xFYVE, rarely costained with Scarlet::SGK-1 (Fig. 3.5C and D). The observation is surprising, since SGK-1, as I predict here, contains a PX domain and may, thus, be able to bind to PI(3)P. However, the generation of VLSs themselves may alter the PI(3)P content at endosomal membranes since the VLSs are malfunctioned endosomes in which the metabolism of PI(3)P may be altered. Nevertheless, the retained PI(3,4,5)P3 and PI(4,5)P2 on the membranes of VLSs (aberrant endosomes) implicates a prolonged or translocated signaling hub in the sgk-1 transgenes. Notably, PTEN which encoding the PI(3,4,5)P3-3-phosphatase was recently found to localize to EE to attenuate the PI3K mediated signaling pathway, suggesting that a pool of both PI(3,4,5)P3 and PI(4,5)P2, and thus in principle also the signal transduction machinery adhering to these phospholipids, might be found at intracellular vesicles [273]. Therefore, it could be that SGK-1, via modulating endomembrane dynamics, also affects signal transduction occurring at the respective rafts. The metabolism of PI(3)P at EE is mediated by myotubularins and the PIKfyve kinase which is responsible for synthesizing PI(3,5)P2. In order to mediate phosphorylation, PIKfyve has to bind to the PI(3)P via its FYVE domain. The C. elegans homolog of PIKfyve is PPK-3 that has been implicated in the regulation of lysosome maturation. The ppk-3 loss of function mutant produces VLSs in both coelomocytes and intestinal cells [171]. Those VLSs are RAB-7-positive LEs or endolysosomes that remain the degradative capability, while they have retarded generation of PI(3,5)P2 therefore are unable to maturate into lysosomes [171]. Interestingly, the mammalian PKB and SGK1 may phosphorylate and activate PIKfyve directly [252, 274], considering it is worth testing a similar function of CeSGK-1 in activating PPK-3. Since ppk-3(n2668) is a weak loss of

DISCUSSION | 101 function mutant (ppk-3 null allele is lethal), deletion of sgk-1 in ppk-3 mutant could in principle enhances the VLSs phenotype of ppk-3. However, sgk-1(ok538) did not affect the formation of VLSs in ppk-3, suggesting that the relationship of sgk-1 and ppk-3 is more complex than anticipated, or the two do not functionally interact at all. In agreement with this, a phosphorylation site of PKB does not seem to be conserved in PPK-3. Despite the lack of obvious genetic interactions in VLS formation, the localization of LMP-1::GFP was changed in the ppk-3;sgk-1 double mutant and accumulated in large puncta in the intestine, whereas in ppk-3 and sgk-1 single mutants it localized to the membranes (Fig. 3.7). Therefore, the double mutant displayed a synthetic phenotype not seen in either single mutant. One of the hallmarks of endosome maturation is the switch from RAB5 to RAB7. Probably controlled by the PI(3)P level on the early endosomal membrane, the GTP tagged RAB-5 gets replaced by the RAB-7 through the activities of the HOPS complex, SAND-1/CCZ- 1, and TBC-2 [146, 147, 224]. During this switch, TBC-2 acts as a GAP for RAB-5 and is recruited by RAB-10 or VPS-34 at the late step of Rab switch. Depletion of tbc-2 shifted the balance towards activated RAB-5, thus RAB-7 that resulted in enlarged LEs [159, 160, 275]. Superficially, VLSs formed in hyperactive sgk-1 background resemble those generated in tbc-2 mutant. However, upon careful inspection VLSs generated in both mutant background differ as no refractile material was found in the VLSs of sgk-1 transgenes (Fig 3.1 and 3.7). Moreover, deletion of sgk-1 did not change the VLSs and the localization of GFP::RAB-7 on VLSs in tbc-2 mutant, indicating that SGK-1 and TBC-2 may not function in the same pathway.

DISCUSSION | 102 4.5 SGK-1 coordinates signaling transduction with endocytic

trafficking

Endocytosis has long been recognized as a mean to terminate signaling via the degradation of activated receptor complexes after their internalization from the cell surface [276]. Recent reports, however, suggest that several receptors might be active only after endosomal internalization. Proper temporal and spatial control of the receptor internalization in the endosome is therefore essential for accurate signal propagation [277]. Early work on EGFR and insulin signaling revealed receptor recruitment of adaptor proteins (SHC, GRB2 and mSOS) in endosomes [278]. Subsequently, a number of quantitative techniques have confirmed these initial observations. Live-cell imaging revealed sustained localization of the fluorescence-tagged signaling adaptor Grb2 to endosomes [279]. Recently, it was shown that cytoplasmic PTEN is distributed along microtubules, tethered to PI(3)P of vesicles via the non-catalytic C2 domain, suggesting the concept of PI3K signal activation on the vast plasma membrane that is contrasted by PTEN-mediated signal termination on the small, discrete surfaces of internalized vesicles [273]. This model suggests an endosomal localization of the PI3K pathway, in addition to PI3K acting at the cytoplasmic membrane. Endosomes regulate the localization of signaling complexes either by acting as vesicular carriers to transport signaling proteins to subcellular locations or by providing an anchor point for scaffolding the signaling components. For example, -mediated retrograde transport of signaling complexes in endocytic vesicles facilitate NGF bound to its receptor TrkA. And NGF–TrkA internalization and retrograde transport were shown to be necessary for neuronal survival, probably because TrkA kinase activity can be maintained in endosomes as they travel along the axon [280]. Active transport enables the generation of different signaling outputs depending on its location. In the EGF/MAPK pathway, the MP1–p14 scaffold complex anchored to the late endosomal membrane by the p18 protein and then recruits MEK1 to LEs, thereby promoting the phosphorylation of ERK1 and ERK2 kinases. The MP1/p14/p18 scaffold complex is also

DISCUSSION | 103 known as the LAMTOR1-3 complex which recruits the mTORC1 complex via Rag GTPase proteins to lysosomes on stimulation with amino acids [281]. This ‘Ragulator’ complex enables activation of mTOR by its lysosomal activator, the Rheb GTPase in human cells [282]. Another example for the role of endosomal scaffolds is SARA, an endosome specific scaffold that can enhance TGF-β signaling by carrying the TGF-β receptor and its phosphorylation targets, SMAD2 and SMAD3, into close proximity, as was shown in cultured hamster cells [283]. Of note, SGKs has been suggested to regulate several signaling pathways. First of all, both mammalian SGK1 and C. elegans SGK-1 were shown to mediate PI3K pathway and phosphorylate transcription factor FOXO3a/DAF-16 [9, 22, 29]. Besides, SGKs act as the direct downstream target to mediate the TORC2 pathway in both mammals and C. elegans [18, 24, 113, 122]. Furthermore, other signaling pathways such as MAPK, CXCR4, SKN-1 and ERG were also shown to be regulated by SGKs directly or indirectly [31, 35, 284, 285]. In this work I provide evidence that the C. elegans SGK-1, may have an additional function consistent with its mammalian homolog SGK3, and can localize to endosomal membranes to regulate endocytic trafficking. Endosomal localization probably adds a spatio-temporal variability to SGK-1 regulatory functions. Its sister AGC kinase, Akt/AKT-1, for example, gets activated at the plasma membrane, however has to transduce phosphorylation signals to cytosolic and nuclear DAF-16. How this is accomplished, is not known. SGK-1, on the other hand, acts downstream of PDK-1 and can localize to endosomes, so that upon certain environmental signals, SGK-1complex may sense PI3K signaling and moves along with endosomes, then finally interacts with and phosphorylates downstream targets at the endosomal membrane. DAF-16/FOXO could be such a target, although no reports so far have suggested an endosomal localization of DAF-16. The antagonist of PI3K, PTEN, should in principle occupy similar sites as PI3K, so it would be interesting to test whether C. elegans DAF-18, the homolog of mammalian PTEN, also localizes to the EEs. One of the crucial question I would like to answer is that at which intracellular localized SGK-1 is phospho-activated by TORC2. Since several subcellular localizations of TORC2 were reported including plasma

DISCUSSION | 104 membrane, mitochondria, ER, lysosome and nucleus [286], it is necessary to investigate in future work the subcellular localization of TORC2 along with SGK-1 in C. elegans. The endosomal localization of mammalian SGK3 is required for kinase activity that subsequently activates mTORC1 in cancer cells after prolonged treatment by PI3K or Akt inhibitors [18]. However, the current data showed that endosomal localization of SGK-1 was not required for the kinase activity, which suggests a different mechanism for C. elegans SGK-1 to transmit the TORC2 signal. Additionally, TORC2-SGK-1 regulates the fat metabolism in C. elegans, in light of the endosomal localization of SGK-1, it would be exciting to identify both the stimuli that activate TORC2 signals and the downstream targets of endosomal SGK-1 to regulate aspects of fat metabolism.

DISCUSSION | 105 4.6 Conclusion

In the present work, I discovered VLSs formation in the intestine of C. elegans that was induced by high levels of expression of wild type sgk-1. The VLSs were observed in all the developmental stages of worm, and adult animals displayed both highest penetrance and largest numbers of VLSs. SGK-1 itself decorate VLSs. I demonstrated that sgk-1 has to be expressed in the intestine in order to generate intestinal VLSs, strongly arguing for a cell-autonomous role of the kinase The further investigation with endocytic model cargos showed that overexpression of SGK-1 blocks the basolateral transport of membrane receptors and leads to accumulated cargos at the membrane of VLSs. However, the secretion of ssGFP from body wall muscle and VIT-2 from intestine were not affected by sgk-1 transgene, and endocytosis of ssGFP by coelomocytes and VIT-2 by oocytes were not significantly altered in sgk-1 mutant and transgene. Since I could not find evidence for sgk-1 expressing in coelomocytes and oocytes, the data strongly argue that overexpression of SGK-1 affect basolateral endocytic recycling in the intestine of C. elegans, and not endocytosis into other tissues. VLSs generated in hyperactive sgk-1 background are probably aberrant endosomes. SGK-1 preferentially costained with the late-endosomal/lysosomal marker LMP-1 and to a lesser extent with the early endosomal marker RAB-5 at the VLS membranes. These VLSs enriched by PI(3,4,5)P3/PI(3,4)P2 and PI(4,5)P2, implicating sgk-1 activity might retard the dephosphorylation of PI(3,4,5)P3/PI(3,4)P2 and PI(4,5)P2 during the endosome maturation. Reduced, instead of increased, activity of sgk-1 also affected VLS generation, and strongly suppressed VLSs of rab-10 and rme-1 loss-of-function, as well as transgenic num-1 gain- of-function mutants. Since RAB-10 and RME-1 have been proposed to coordinate basolateral endocytic recycling, this suppressing phenotype emphasizes that SGK-1 might regulated basolateral trafficking, or might antagonize defective basolateral endocytic trafficking. In addition, sgk-1 displays significantly increased LysoTracker staining which indicates that loss of sgk-1 function increases generation of acidified organelles. This increased LysoTracker staining originates from an increase in LROs generation, displayed by the increased numbers and larger size of GLO-1::GFP marked

DISCUSSION | 106 organelles that were found in the intestine of sgk-1. Since LROs are presumably derived from endosomes, the data indicates that SGK-1 may act as a coordinator of cargo sorting at endosomes, and its loss drops the balance of trafficking towards LROs generation. Bioinformatic analysis predicted that SGK-1 harbors a conserved PX domain, which preferentially bind to endosomal PI(3)P. Introducing the R83 mutation that presumably abrogated PI(3)P binding prevented VLS formation, suggesting that loss of endosomal membrane binding makes endocytic SGK-1 non-functional. This was corroborated by the suppression of rab-10 VLSs seen with this variant that behaved like the sgk-1 loss-of- function allele. Although loss of endosomal membrane binding was not shown directly in a biophysical assay, the in situ localization of SGK-1 and the functional data suggest that the PX domain of SGK-1 is required for endosomal (dys-)functions of SGK-1. In addition, SGK-1 also requires its kinase activity that is preferentially activated by the TORC2 pathway that functions upstream. Minor roles of upstream kinases PDK-1 and PKC-2 are probably also required at this regulatory level. These results provide new insights into our understanding of the multiple role of SGKs levels, e.g. those associated with resistance to PI3K inhibitors in cancer treatment, and are an exciting example how a kinase couples different upstream signaling pathways in response to stress and nutrition.

DISCUSSION | 107 5 REFERENCES

1. Webster, M.K., L. Goya, and G.L. Firestone, Immediate-early transcriptional regulation and rapid mRNA turnover of a putative serine/threonine protein kinase. J Biol Chem, 1993. 268(16): p. 11482-5. 2. Webster, M.K., et al., Characterization of sgk, a novel member of the serine/threonine protein kinase gene family which is transcriptionally induced by glucocorticoids and serum. Mol Cell Biol, 1993. 13: p. 2031- 2040. 3. Kobayashi, T., et al., Characterization of the structure and regulation of two novel isoforms of serum- and glucocorticoid-induced protein kinase. Biochem J, 1999. 344 Pt 1: p. 189-97. 4. Arteaga, M.F., et al., Multiple translational isoforms give functional specificity to serum- and glucocorticoid- induced kinase 1. Mol Biol Cell, 2007. 18(6): p. 2072-80. 5. Raikwar, N.S., P.M. Snyder, and C.P. Thomas, An evolutionarily conserved N-terminal Sgk1 variant with enhanced stability and improved function. Am J Physiol Renal Physiol, 2008. 295(5): p. F1440-8. 6. Liu, D., X. Yang, and Z. Songyang, Identification of CISK, a new member of the SGK kinase family that promotes IL-3-dependent survival. Curr Biol, 2000. 10(19): p. 1233-6. 7. Wulff, P., et al., Impaired renal Na+ retention in the sgk1-knockout mouse. J Clin Invest, 2002. 110(9): p. 1263-8. 8. Pearce, D., et al., Role of SGK in mineralocorticoid-regulated sodium transport. Kidney Int, 2000. 57(4): p. 1283-9. 9. Hertweck, M., C. Gobel, and R. Baumeister, C. elegans SGK-1 is the critical component in the Akt/PKB kinase complex to control stress response and life span. Dev Cell, 2004. 6: p. 577-588. 10. Casamayor, A., et al., Functional counterparts of mammalian protein kinases PDK1 and SGK in budding yeast. Curr Biol, 1999. 9(4): p. 186-97. 11. Kannan, N., et al., The hallmark of AGC kinase functional divergence is its C-terminal tail, a cis-acting regulatory module. Proc Natl Acad Sci U S A, 2007. 104(4): p. 1272-7. 12. Lang, F., et al., (Patho)physiological significance of the serum- and glucocorticoid-inducible kinase isoforms. Physiol Rev, 2006. 86(4): p. 1151-78. 13. Pearce, L.R., D. Komander, and D.R. Alessi, The nuts and bolts of AGC protein kinases. Nat Rev Mol Cell Biol, 2010. 11(1): p. 9-22. 14. Engelsberg, A., F. Kobelt, and D. Kuhl, The N-terminus of the serum- and glucocorticoid-inducible kinase Sgk1 specifies mitochondrial localization and rapid turnover. Biochem J, 2006. 399(1): p. 69-76. 15. Cordas, E., A. Naray-Fejes-Toth, and G. Fejes-Toth, Subcellular location of serum- and glucocorticoid- induced kinase-1 in renal and mammary epithelial cells. Am J Physiol Cell Physiol, 2007. 292: p. C1971-81. 16. Tessier, M. and J.R. Woodgett, Role of the Phox homology domain and phosphorylation in activation of serum and glucocorticoid-regulated kinase-3. J Biol Chem, 2006. 281(33): p. 23978-89. 17. Bago, R., et al., Characterization of VPS34-IN1, a selective inhibitor of Vps34, reveals that the phosphatidylinositol 3-phosphate-binding SGK3 protein kinase is a downstream target of class III phosphoinositide 3-kinase. Biochem J, 2014. 463(3): p. 413-27. 18. Bago, R., et al., The hVps34-SGK3 pathway alleviates sustained PI3K/Akt inhibition by stimulating mTORC1 and tumour growth. EMBO J, 2016. 35(17): p. 1902-22. 19. Brickley, D.R., et al., Ubiquitin modification of serum and glucocorticoid-induced protein kinase-1 (SGK-1). J Biol Chem, 2002. 277(45): p. 43064-70. 20. O'Keeffe, B.A., et al., The serum- and glucocorticoid-induced protein kinase-1 (Sgk-1) mitochondria connection: Identification of the IF-1 inhibitor of the F(1)F(0)-ATPase as a mitochondria-specific binding target and the stress-induced mitochondrial localization of endogenous S. Biochimie, 2013. 21. Biondi, R.M., et al., The PIF-binding pocket in PDK1 is essential for activation of S6K and SGK, but not PKB. EMBO J, 2001. 20(16): p. 4380-90. 22. Park, J., et al., Serum and glucocorticoid-inducible kinase (SGK) is a target of the PI 3-kinase-stimulated signaling pathway. EMBO J, 1999. 18(11): p. 3024-33. 23. Collins, B.J., et al., In vivo role of the PIF-binding docking site of PDK1 defined by knock-in mutation. EMBO J, 2003. 22(16): p. 4202-11. 24. Garcia-Martinez, J.M. and D.R. Alessi, mTOR complex 2 (mTORC2) controls hydrophobic motif phosphorylation and activation of serum- and glucocorticoid-induced protein kinase 1 (SGK1). Biochem J, 2008. 416: p. 375-385.

REFERENCES | 108 25. Zhou, R. and P.M. Snyder, Nedd4-2 phosphorylation induces serum and glucocorticoid-regulated kinase (SGK) ubiquitination and degradation. J Biol Chem, 2005. 280(6): p. 4518-23. 26. Gao, D., et al., Rictor forms a complex with Cullin-1 to promote SGK1 ubiquitination and destruction. Mol Cell, 2010. 39(5): p. 797-808. 27. Belova, L., et al., Ubiquitin-proteasome degradation of serum- and glucocorticoid-regulated kinase-1 (SGK- 1) is mediated by the chaperone-dependent E3 ligase CHIP. Biochem J, 2006. 400: p. 235-244. 28. Kobayashi, T. and P. Cohen, Activation of serum- and glucocorticoid-regulated protein kinase by agonists that activate phosphatidylinositide 3-kinase is mediated by 3-phosphoinositide-dependent protein kinase-1 (PDK1) and PDK2. Biochem J, 1999. 339 ( Pt 2): p. 319-28. 29. Brunet, A., et al., Protein kinase SGK mediates survival signals by phosphorylating the forkhead transcription factor FKHRL1 (FOXO3a). Mol Cell Biol, 2001. 21: p. 952-965. 30. Sakoda, H., et al., Differing roles of Akt and serum- and glucocorticoid-regulated kinase in glucose metabolism, DNA synthesis, and oncogenic activity. J Biol Chem, 2003. 278(28): p. 25802-7. 31. Tullet, J.M., et al., Direct inhibition of the longevity-promoting factor SKN-1 by insulin-like signaling in C. elegans. Cell, 2008. 132: p. 1025-1038. 32. Asher, C., I. Sinha, and H. Garty, Characterization of the interactions between Nedd4-2, ENaC, and sgk-1 using surface plasmon resonance. Biochim Biophys Acta, 2003. 1612: p. 59-64. 33. Staub, O., et al., Regulation of stability and function of the epithelial Na+ channel (ENaC) by ubiquitination. EMBO J, 1997. 16(21): p. 6325-36. 34. Debonneville, C., et al., Phosphorylation of Nedd4-2 by Sgk1 regulates epithelial Na+ channel cell surface expression. EMBO J, 2001. 20(24): p. 7052-9. 35. Slagsvold, T., et al., CISK attenuates degradation of the chemokine receptor CXCR4 via the ubiquitin ligase AIP4. EMBO J, 2006. 25(16): p. 3738-49. 36. Henke, G., et al., Activation of Na+/K+-ATPase by the serum and glucocorticoid-dependent kinase isoforms. Kidney Blood Press Res, 2002. 25(6): p. 370-4. 37. Boehmer, C., et al., Regulation of the glutamate transporter EAAT1 by the ubiquitin ligase Nedd4-2 and the serum and glucocorticoid-inducible kinase isoforms SGK1/3 and protein kinase B. J Neurochem, 2003. 86(5): p. 1181-8. 38. Boehmer, C., et al., Properties and regulation of glutamine transporter SN1 by protein kinases SGK and PKB. Biochem Biophys Res Commun, 2003. 306(1): p. 156-62. 39. Bohmer, C., et al., Stimulation of the EAAT4 glutamate transporter by SGK protein kinase isoforms and PKB. Biochem Biophys Res Commun, 2004. 324(4): p. 1242-8. 40. Boehmer, C., et al., Regulation of the excitatory amino acid transporter EAAT5 by the serum and glucocorticoid dependent kinases SGK1 and SGK3. Biochem Biophys Res Commun, 2005. 329(2): p. 738- 42. 41. Dieter, M., et al., Regulation of glucose transporter SGLT1 by ubiquitin ligase Nedd4-2 and kinases SGK1, SGK3, and PKB. Obes Res, 2004. 12(5): p. 862-70. 42. Palmada, M., et al., The serine/threonine kinases SGK1, 3 and PKB stimulate the amino acid transporter ASCT2. Biochem Biophys Res Commun, 2005. 331(1): p. 272-7. 43. Strutz-Seebohm, N., et al., Regulation of GluR1 abundance in murine hippocampal neurones by serum- and glucocorticoid-inducible kinase 3. J Physiol, 2005. 565(Pt 2): p. 381-90. 44. Wang, J., et al., SGK integrates insulin and mineralocorticoid regulation of epithelial sodium transport. Am J Physiol Renal Physiol, 2001. 280(2): p. F303-13. 45. Sandu, C., et al., Decreased intestinal glucose transport in the sgk3-knockout mouse. Pflugers Arch, 2005. 451(3): p. 437-44. 46. Boini, K.M., et al., Serum- and glucocorticoid-inducible kinase 1 mediates salt sensitivity of glucose tolerance. Diabetes, 2006. 55(7): p. 2059-66. 47. Grahammer, F., et al., Intestinal function of gene-targeted mice lacking serum- and glucocorticoid-inducible kinase 1. Am J Physiol Gastrointest Liver Physiol, 2006. 290(6): p. G1114-23. 48. Schoenebeck, B., et al., Sgk1, a cell survival response in neurodegenerative diseases. Mol Cell Neurosci, 2005. 30(2): p. 249-64. 49. Stichel, C.C., et al., sgk1, a member of an RNA cluster associated with cell death in a model of Parkinson's disease. Eur J Neurosci, 2005. 21(2): p. 301-16. 50. Nishida, Y., et al., Alteration of serum/glucocorticoid regulated kinase-1 (sgk-1) gene expression in rat hippocampus after transient global ischemia. Brain Res Mol Brain Res, 2004. 123(1-2): p. 121-5. 51. Klingel, K., et al., Expression of cell volume-regulated kinase h-sgk in pancreatic tissue. Am J Physiol

REFERENCES | 109 Gastrointest Liver Physiol, 2000. 279(5): p. G998-G1002. 52. Fillon, S., et al., Expression of the serine/threonine kinase hSGK1 in chronic viral hepatitis. Cell Physiol Biochem, 2002. 12(1): p. 47-54. 53. Chu, S., et al., FSH-regulated gene expression profiles in ovarian tumours and normal ovaries. Mol Hum Reprod, 2002. 8(5): p. 426-33. 54. Rauhala, H.E., et al., Dual-specificity phosphatase 1 and serum/glucocorticoid-regulated kinase are downregulated in prostate cancer. Int J Cancer, 2005. 117(5): p. 738-45. 55. Wang, K., et al., SGK1-dependent intestinal tumor growth in APC-deficient mice. Cell Physiol Biochem, 2010. 25(2-3): p. 271-8. 56. Leong, M.L., et al., Expression of the serum- and glucocorticoid-inducible protein kinase, Sgk, is a cell survival response to multiple types of environmental stress stimuli in mammary epithelial cells. J Biol Chem, 2003. 278(8): p. 5871-82. 57. Zhang, L., et al., Antiapoptotic effect of serum and glucocorticoid-inducible protein kinase is mediated by novel mechanism activating IκB kinase. Cancer Res, 2005. 65(2): p. 457-64. 58. Chen, S.Y., et al., Epithelial sodium channel regulated by aldosterone-induced protein sgk. Proc Natl Acad Sci U S A, 1999. 96(5): p. 2514-9. 59. Gonzalez-Robayna, I.J., et al., Follicle-Stimulating hormone (FSH) stimulates phosphorylation and activation of protein kinase B (PKB/Akt) and serum and glucocorticoid-lnduced kinase (Sgk): evidence for A kinase-independent signaling by FSH in granulosa cells. Mol Endocrinol, 2000. 14(8): p. 1283-300. 60. Feroze-Zaidi, F., et al., Role and regulation of the serum- and glucocorticoid-regulated kinase 1 in fertile and infertile human endometrium. Endocrinology, 2007. 148(10): p. 5020-9. 61. Thomas, C.P., K.Z. Liu, and H.S. Vats, Medroxyprogesterone acetate binds the glucocorticoid receptor to stimulate α-ENaC and sgk1 expression in renal collecting duct epithelia. Am J Physiol Renal Physiol, 2006. 290(2): p. F306-12. 62. Akutsu, N., et al., Regulation of gene Expression by 1α,25-dihydroxyvitamin D3 and Its analog EB1089 under growth-inhibitory conditions in squamous carcinoma Cells. Mol Endocrinol, 2001. 15(7): p. 1127-39. + 63. Pfau, A., et al., Ca2 but not H2O2 modulates GRE-element activation by the human mineralocorticoid receptor in HEK cells. Mol Cell Endocrinol, 2007. 264(1-2): p. 35-43. 64. Khan, Z.A., et al., Glucose-induced serum- and glucocorticoid-regulated kinase activation in oncofetal fibronectin expression. Biochem Biophys Res Commun, 2005. 329(1): p. 275-80. 65. Meng, F., et al., IL-6 activates serum and glucocorticoid kinase via p38α mitogen-activated protein kinase pathway. Am J Physiol Cell Physiol, 2005. 289(4): p. C971-81. 66. BelAiba, R.S., et al., The serum- and glucocorticoid-inducible kinase sgk-1 is involved in pulmonary vascular remodeling: role in redox-sensitive regulation of tissue factor by thrombin. Circ Res, 2006. 98(6): p. 828-36. 67. Wolf, S.C., et al., Stimulation of serum- and glucocorticoid-regulated kinase-1 gene expression by endothelin-1. Biochem Pharmacol, 2006. 71(8): p. 1175-83. 68. Mizuno, H. and E. Nishida, The ERK MAP kinase pathway mediates induction of SGK (serum- and glucocorticoid-inducible kinase) by growth factors. Genes Cells, 2001. 6(3): p. 261-8. 69. Chang, C.T., et al., Enhancement of epithelial sodium channel expression in renal cortical collecting ducts cells by advanced glycation end products. Nephrol Dial Transplant, 2007. 22(3): p. 722-31. 70. Cowling, R.T. and H.C. Birnboim, Expression of serum- and glucocorticoid-regulated kinase (sgk) mRNA is up-regulated by GM-CSF and other proinflammatory mediators in human granulocytes. J Leukoc Biol, 2000. 67(2): p. 240-8. 71. Hong, G., et al., PPARgamma activation enhances cell surface ENaCα via up-regulation of SGK1 in human collecting duct cells. FASEB J, 2003. 17(13): p. 1966-8. 72. Waldegger, S., et al., Cloning and characterization of a putative human serine/threonine protein kinase transcriptionally modified during anisotonic and isotonic alterations of cell volume. Proc Natl Acad Sci U S A, 1997. 94(9): p. 4440-5. 73. Rozansky, D.J., et al., Hypotonic induction of SGK1 and Na+ transport in A6 cells. Am J Physiol Renal Physiol, 2002. 283(1): p. F105-13. 74. Faroqui, S., S. Sheriff, and H. Amlal, Metabolic acidosis has dual effects on sodium handling by rat kidney. Am J Physiol Renal Physiol, 2006. 291(2): p. F322-31. 75. Nagase, M., et al., Enhanced aldosterone signaling in the early nephropathy of rats with metabolic syndrome: possible contribution of fat-derived factors. J Am Soc Nephrol, 2006. 17(12): p. 3438-46. 76. Shibata, S., et al., Podocyte as the target for aldosterone: roles of oxidative stress and Sgk1. Hypertension, 2007. 49(2): p. 355-64.

REFERENCES | 110 77. Kim, M.J., et al., Negative regulation of SEK1 signaling by serum- and glucocorticoid-inducible protein kinase 1. EMBO J, 2007. 26(13): p. 3075-85. 78. Xiao, R., et al., A Genetic Program Promotes C. elegans Longevity at Cold Temperatures via a Thermosensitive TRP Channel. Cell, 2013. 152: p. 806-817. 79. Feng, Y., et al., Enhanced expression of serum and glucocorticoid-inducible kinase-1 in kidneys of L-NAME- treated rats. Kidney Blood Press Res, 2006. 29(2): p. 94-9. 80. Godt, D.E. and T. Roitsch, Regulation and tissue-specific distribution of mRNAs for three extracellular invertase isoenzymes of tomato suggests an important function in establishing and maintaining sink metabolism. Plant Physiol, 1997. 115(1): p. 273-82. 81. David, S., et al., Expression of serum- and glucocorticoid-inducible kinase is regulated in an experience- dependent manner and can cause dendrite growth. J Neurosci, 2005. 25(30): p. 7048-53. 82. Lee, C.T., Y.L. Ma, and E.H. Lee, Serum- and glucocorticoid-inducible kinase1 enhances contextual fear memory formation through down-regulation of the expression of Hes5. J Neurochem, 2007. 100(6): p. 1531- 42. 83. Koya, E., et al., Molecular reactivity of mesocorticolimbic brain areas of high and low grooming rats after elevated plus maze exposure. Brain Res Mol Brain Res, 2005. 137(1-2): p. 184-92. 84. Conti, B., et al., Region-specific transcriptional changes following the three antidepressant treatments electro convulsive therapy, sleep deprivation and fluoxetine. Mol Psychiatry, 2007. 12(2): p. 167-89. 85. Nuber, U.A., et al., Up-regulation of glucocorticoid-regulated genes in a mouse model of Rett syndrome. Hum Mol Genet, 2005. 14(15): p. 2247-56. 86. Velic, A., et al., Acute rejection after rat renal transplantation leads to downregulation of NA+ and water channels in the collecting duct. Am J Transplant, 2005. 5(6): p. 1276-85. 87. Friedrich, B., et al., Influence of standard haemodialysis treatment on transcription of human serum- and glucocorticoid-inducible kinase SGK1 and taurine transporter TAUT in blood leukocytes. Nephrol Dial Transplant, 2005. 20(4): p. 768-74. 88. Iyer, V.R., et al., The transcriptional program in the response of human fibroblasts to serum. Science, 1999. 283(5398): p. 83-7. 89. Kumar, J.M., et al., Sgk, a putative serine/threonine kinase, is differentially expressed in the kidney of diabetic mice and humans. J Am Soc Nephrol, 1999. 10(12): p. 2488-94. 90. Friedrich, B., et al., Up-regulation of the human serum and glucocorticoid-dependent kinase 1 in glomerulonephritis. Kidney Blood Press Res, 2002. 25(5): p. 303-7. 91. Waldegger, S., et al., h-sgk serine-threonine protein kinase gene as transcriptional target of transforming growth factor beta in human intestine. Gastroenterology, 1999. 116(5): p. 1081-8. 92. Waerntges, S., et al., Excessive transcription of the human serum and glucocorticoid dependent kinase hSGK1 in lung fibrosis. Cell Physiol Biochem, 2002. 12(2-3): p. 135-42. 93. Vallon, V., et al., SGK1-dependent cardiac CTGF formation and fibrosis following DOCA treatment. J Mol Med (Berl), 2006. 84(5): p. 396-404. 94. Lang, F., et al., Deranged transcriptional regulation of cell-volume-sensitive kinase hSGK in diabetic nephropathy. Proc Natl Acad Sci U S A, 2000. 97(14): p. 8157-62. 95. Hayashi, M., et al., BMK1 mediates growth factor-induced cell proliferation through direct cellular activation of serum and glucocorticoid-inducible kinase. J Biol Chem, 2001. 276(12): p. 8631-4. 96. Davies, S.P., et al., Specificity and mechanism of action of some commonly used protein kinase inhibitors. Biochem J, 2000. 351(Pt 1): p. 95-105. 97. Bell, L.M., et al., Hyperosmotic stress stimulates promoter activity and regulates cellular utilization of the serum- and glucocorticoid-inducible protein kinase (Sgk) by a p38 MAPK-dependent pathway. J Biol Chem, 2000. 275(33): p. 25262-72. 98. Waldegger, S., et al., h-sgk serine-threonine protein kinase as transcriptional target of p38/MAP kinase pathway in HepG2 human hepatoma cells. Cell Physiol Biochem, 2000. 10(4): p. 203-8. 99. Chen, S., et al., Tonicity-dependent induction of Sgk1 expression has a potential role in dehydration-induced natriuresis in rodents. J Clin Invest, 2009. 119: p. 1647-1658. 100. You, H., et al., p53-dependent inhibition of FKHRL1 in response to DNA damage through protein kinase SGK1. Proc Natl Acad Sci U S A, 2004. 101(39): p. 14057-62. 101. Maiyar, A.C., et al., p53 stimulates promoter activity of the sgk. serum/glucocorticoid-inducible serine/threonine protein kinase gene in rodent mammary epithelial cells. J Biol Chem, 1996. 271(21): p. 12414-22. 102. Maiyar, A.C., et al., Repression of glucocorticoid receptor transactivation and DNA binding of a

REFERENCES | 111 glucocorticoid response element within the serum/glucocorticoid-inducible protein kinase (sgk) gene promoter by the p53 tumor suppressor protein. Mol Endocrinol, 1997. 11(3): p. 312-29. 103. Turpaev, K., et al., Analysis of differentially expressed genes in nitric oxide-exposed human monocytic cells. Free Radic Biol Med, 2005. 38(10): p. 1392-400. 104. Poulin, H., et al., Serum- and glucocorticoid-regulated kinase 1 (SGK1) induction by the EWS/NOR1(NR4A3) fusion protein. Biochem Biophys Res Commun, 2006. 346(1): p. 306-13. 105. Chun, J., et al., The Na(+)/H(+) exchanger regulatory factor 2 mediates phosphorylation of serum- and glucocorticoid-induced protein kinase 1 by 3-phosphoinositide-dependent protein kinase 1. Biochem Biophys Res Commun, 2002. 298(2): p. 207-15. 106. Lu, M., et al., mTOR complex-2 activates ENaC by phosphorylating SGK1. J Am Soc Nephrol, 2010. 21(5): p. 811-8. 107. Perrotti, N., et al., Activation of serum- and glucocorticoid-induced protein kinase (Sgk) by cyclic AMP and insulin. J Biol Chem, 2001. 276(12): p. 9406-12. 108. Wang, Y., et al., Coordinated regulation of serum- and glucocorticoid-inducible kinase 3 by a C-terminal hydrophobic motif and Hsp90-Cdc37 chaperone complex. J Biol Chem, 2014. 289(8): p. 4815-26. 109. Hua, Q.X., et al., A divergent INS protein in Caenorhabditis elegans structurally resembles human insulin and activates the human insulin receptor. Genes Dev, 2003. 17(7): p. 826-31. 110. Murphy, C.T. and P.J. Hu, Insulin/insulin-like growth factor signaling in C. elegans. WormBook, 2013: p. 1- 43. 111. Tepper, R.G., et al., PQM-1 Complements DAF-16 as a Key Transcriptional Regulator of DAF-2-Mediated Development and Longevity. Cell, 2013. 154: p. 676-690. 112. Paradis, S., et al., A PDK1 homolog is necessary and sufficient to transduce AGE-1 PI3 kinase signals that regulate diapause in Caenorhabditis elegans. Genes Dev, 1999. 13(11): p. 1438-52. 113. Soukas, A.A., et al., Rictor/TORC2 regulates fat metabolism, feeding, growth, and life span in Caenorhabditis elegans. Genes Dev, 2009. 23: p. 496-511. 114. Alam, H., et al., EAK-7 controls development and life span by regulating nuclear DAF-16/FoxO activity. Cell Metab, 2010. 12(1): p. 30-41. 115. Kwon, E.S., et al., A new DAF-16 isoform regulates longevity. Nature, 2010. 466(7305): p. 498-502. 116. Chen, A.T., et al., Effects of Caenorhabditis elegans sgk-1 mutations on lifespan, stress resistance, and DAF- 16/FoxO regulation. Aging Cell, 2013. 12(5): p. 932-40. 117. Zhang, Y., et al., Caenorhabditis elegans EAK-3 inhibits dauer arrest via nonautonomous regulation of nuclear DAF-16/FoxO activity. Dev Biol, 2008. 315(2): p. 290-302. 118. Dumas, K.J., et al., Functional divergence of dafachronic acid pathways in the control of C. elegans development and lifespan. Dev Biol, 2010. 340(2): p. 605-12. 119. Mizunuma, M., et al., mTORC2-SGK-1 acts in two environmentally responsive pathways with opposing effects on longevity. Aging Cell, 2014. 13(5): p. 869-78. 120. Avruch, J., et al., Insulin and amino-acid regulation of mTOR signaling and kinase activity through the Rheb GTPase. Oncogene, 2006. 25(48): p. 6361-72. 121. Vellai, T., et al., Genetics: influence of TOR kinase on lifespan in C. elegans. Nature, 2003. 426(6967): p. 620. 122. Jones, K.T., et al., Rictor/TORC2 regulates Caenorhabditis elegans fat storage, body size, and development through sgk-1. PLoS Biol, 2009. 7: p. e60. 123. Von Bartheld, C.S. and A.L. Altick, Multivesicular bodies in neurons: distribution, protein content, and trafficking functions. Prog Neurobiol, 2011. 93(3): p. 313-40. 124. Lamb, C.A., T. Yoshimori, and S.A. Tooze, The autophagosome: origins unknown, biogenesis complex. Nat Rev Mol Cell Biol, 2013. 14(12): p. 759-74. 125. Huotari, J. and A. Helenius, Endosome maturation. EMBO J, 2011. 30(17): p. 3481-500. 126. Nickerson, D.P., M.R. Russell, and G. Odorizzi, A concentric circle model of multivesicular body cargo sorting. EMBO Rep, 2007. 8(7): p. 644-50. 127. Grant, B.D. and J.G. Donaldson, Pathways and mechanisms of endocytic recycling. Nat Rev Mol Cell Biol, 2009. 10(9): p. 597-608. 128. Mayor, S. and R.E. Pagano, Pathways of clathrin-independent endocytosis. Nat Rev Mol Cell Biol, 2007. 8(8): p. 603-12. 129. Maxfield, F.R. and T.E. McGraw, Endocytic recycling. Nat Rev Mol Cell Biol, 2004. 5(2): p. 121-32. 130. Maxfield, F.R. and D.J. Yamashiro, Endosome acidification and the pathways of receptor-mediated endocytosis. Adv Exp Med Biol, 1987. 225: p. 189-98.

REFERENCES | 112 131. Gerasimenko, J.V., et al., Calcium uptake via endocytosis with rapid release from acidifying endosomes. Curr Biol, 1998. 8(24): p. 1335-8. 132. Jongsma, M.L., et al., An ER-Associated Pathway Defines Endosomal Architecture for Controlled Cargo Transport. Cell, 2016. 166(1): p. 152-66. 133. Zerial, M. and H. McBride, Rab proteins as membrane organizers. Nat Rev Mol Cell Biol, 2001. 2(2): p. 107- 17. 134. Vonderheit, A. and A. Helenius, Rab7 associates with early endosomes to mediate sorting and transport of Semliki forest virus to late endosomes. PLoS Biol, 2005. 3(7): p. e233. 135. Rojas, R., et al., Regulation of retromer recruitment to endosomes by sequential action of Rab5 and Rab7. J Cell Biol, 2008. 183(3): p. 513-26. 136. Hayer, A., et al., Caveolin-1 is ubiquitinated and targeted to intralumenal vesicles in endolysosomes for degradation. J Cell Biol, 2010. 191(3): p. 615-29. 137. Christoforidis, S., et al., Phosphatidylinositol-3-OH kinases are Rab5 effectors. Nat Cell Biol, 1999. 1(4): p. 249-52. 138. Behnia, R. and S. Munro, Organelle identity and the signposts for membrane traffic. Nature, 2005. 438(7068): p. 597-604. 139. Bonifacino, J.S. and J.H. Hurley, Retromer. Curr Opin Cell Biol, 2008. 20(4): p. 427-36. 140. Pfeffer, S.R., Multiple routes of protein transport from endosomes to the trans Golgi network. FEBS Lett, 2009. 583(23): p. 3811-6. 141. Raiborg, C. and H. Stenmark, The ESCRT machinery in endosomal sorting of ubiquitylated membrane proteins. Nature, 2009. 458(7237): p. 445-52. 142. Sachse, M., et al., Bilayered clathrin coats on endosomal vacuoles are involved in protein sorting toward lysosomes. Mol Biol Cell, 2002. 13(4): p. 1313-28. 143. van Meel, E. and J. Klumperman, Imaging and imagination: understanding the endo-lysosomal system. Histochem Cell Biol, 2008. 129(3): p. 253-66. 144. Falguieres, T., et al., In vitro budding of intralumenal vesicles into late endosomes is regulated by Alix and Tsg101. Mol Biol Cell, 2008. 19(11): p. 4942-55. 145. Luzio, J.P., P.R. Pryor, and N.A. Bright, Lysosomes: fusion and function. Nat Rev Mol Cell Biol, 2007. 8(8): p. 622-32. 146. Rink, J., et al., Rab conversion as a mechanism of progression from early to late endosomes. Cell, 2005. 122(5): p. 735-49. 147. Poteryaev, D., et al., Identification of the switch in early-to-late endosome transition. Cell, 2010. 141(3): p. 497-508. 148. Horiuchi, H., et al., A novel Rab5 GDP/GTP exchange factor complexed to Rabaptin-5 links nucleotide exchange to effector recruitment and function. Cell, 1997. 90(6): p. 1149-59. 149. Barr, F. and D.G. Lambright, Rab GEFs and GAPs. Curr Opin Cell Biol, 2010. 22(4): p. 461-70. 150. Mattera, R. and J.S. Bonifacino, Ubiquitin binding and conjugation regulate the recruitment of Rabex-5 to early endosomes. EMBO J, 2008. 27(19): p. 2484-94. 151. Lippe, R., et al., Functional synergy between Rab5 effector Rabaptin-5 and exchange factor Rabex-5 when physically associated in a complex. Mol Biol Cell, 2001. 12(7): p. 2219-28. 152. Jovic, M., et al., The early endosome: a busy sorting station for proteins at the crossroads. Histol Histopathol, 2010. 25(1): p. 99-112. 153. Wang, C.W., et al., Yeast homotypic vacuole fusion requires the Ccz1-Mon1 complex during the tethering/docking stage. J Cell Biol, 2003. 163(5): p. 973-85. 154. Poteryaev, D., et al., Caenorhabditis elegans SAND-1 is essential for RAB-7 function in endosomal traffic. EMBO J, 2007. 26(2): p. 301-12. 155. Kinchen, J.M. and K.S. Ravichandran, Identification of two evolutionarily conserved genes regulating processing of engulfed apoptotic cells. Nature, 2010. 464(7289): p. 778-82. 156. Wurmser, A.E., T.K. Sato, and S.D. Emr, New component of the vacuolar class C-Vps complex couples nucleotide exchange on the Ypt7 GTPase to SNARE-dependent docking and fusion. J Cell Biol, 2000. 151(3): p. 551-62. 157. Vieira, O.V., et al., Modulation of Rab5 and Rab7 recruitment to phagosomes by phosphatidylinositol 3- kinase. Mol Cell Biol, 2003. 23(7): p. 2501-14. 158. Li, W., et al., C. elegans Rab GTPase activating protein TBC-2 promotes cell corpse degradation by regulating the small GTPase RAB-5. Development, 2009. 136(14): p. 2445-55. 159. Chotard, L., et al., TBC-2 regulates RAB-5/RAB-7-mediated endosomal trafficking in Caenorhabditis

REFERENCES | 113 elegans. Mol Biol Cell, 2010. 21(13): p. 2285-96. 160. Liu, O. and B.D. Grant, Basolateral Endocytic Recycling Requires RAB-10 and AMPH-1 Mediated Recruitment of RAB-5 GAP TBC-2 to Endosomes. PLoS Genet, 2015. 11(9): p. e1005514. 161. Frasa, M.A., et al., Armus is a Rac1 effector that inactivates Rab7 and regulates E-cadherin degradation. Curr Biol, 2010. 20(3): p. 198-208. 162. Zhang, M., et al., Rab7: roles in membrane trafficking and disease. Biosci Rep, 2009. 29(3): p. 193-209. 163. Vicinanza, M., et al., Function and dysfunction of the PI system in membrane trafficking. EMBO J, 2008. 27(19): p. 2457-70. 164. Sahu, R., et al., Microautophagy of cytosolic proteins by late endosomes. Dev Cell, 2011. 20(1): p. 131-9. 165. Murray, J.T., et al., Role of Rab5 in the recruitment of hVps34/p150 to the early endosome. Traffic, 2002. 3(6): p. 416-27. 166. Funderburk, S.F., Q.J. Wang, and Z. Yue, The Beclin 1-VPS34 complex-at the crossroads of autophagy and beyond. Trends Cell Biol, 2010. 20(6): p. 355-62. 167. Itakura, E., et al., Beclin 1 forms two distinct phosphatidylinositol 3-kinase complexes with mammalian Atg14 and UVRAG. Mol Biol Cell, 2008. 19(12): p. 5360-72. 168. Robinson, F.L. and J.E. Dixon, Myotubularin phosphatases: policing 3-phosphoinositides. Trends Cell Biol, 2006. 16(8): p. 403-12. 169. Odorizzi, G., M. Babst, and S.D. Emr, Fab1p PtdIns(3)P 5-kinase function essential for protein sorting in the multivesicular body. Cell, 1998. 95(6): p. 847-58. 170. Ikonomov, O.C., D. Sbrissa, and A. Shisheva, Mammalian cell morphology and endocytic membrane homeostasis require enzymatically active phosphoinositide 5-kinase PIKfyve. J Biol Chem, 2001. 276(28): p. 26141-7. 171. Nicot, A.S., et al., The phosphoinositide kinase PIKfyve/Fab1p regulates terminal lysosome maturation in Caenorhabditis elegans. Mol Biol Cell, 2006. 17(7): p. 3062-74. 172. Rusten, T.E., et al., Fab1 phosphatidylinositol 3-phosphate 5-kinase controls trafficking but not silencing of endocytosed receptors. Mol Biol Cell, 2006. 17(9): p. 3989-4001. 173. Jefferies, H.B., et al., A selective PIKfyve inhibitor blocks PtdIns(3,5)P(2) production and disrupts endomembrane transport and retroviral budding. EMBO Rep, 2008. 9(2): p. 164-70. 174. Shisheva, A., PIKfyve: Partners, significance, debates and paradoxes. Cell Biol Int, 2008. 32(6): p. 591-604. 175. Sbrissa, D., et al., ArPIKfyve homomeric and heteromeric interactions scaffold PIKfyve and Sac3 in a complex to promote PIKfyve activity and functionality. J Mol Biol, 2008. 384(4): p. 766-79. 176. Ikonomov, O.C., et al., PIKfyve-ArPIKfyve-Sac3 core complex: contact sites and their consequence for Sac3 phosphatase activity and endocytic membrane homeostasis. J Biol Chem, 2009. 284(51): p. 35794-806. 177. Sbrissa, D., et al., Phosphatidylinositol 5-phosphate biosynthesis is linked to PIKfyve and is involved in osmotic response pathway in mammalian cells. J Biol Chem, 2002. 277(49): p. 47276-84. 178. Hurley, J.H., The ESCRT complexes. Crit Rev Biochem Mol Biol, 2010. 45(6): p. 463-87. 179. Hurley, J.H. and P.I. Hanson, Membrane budding and scission by the ESCRT machinery: it's all in the neck. Nat Rev Mol Cell Biol, 2010. 11(8): p. 556-66. 180. Raiborg, C., et al., FYVE and coiled-coil domains determine the specific localisation of Hrs to early endosomes. J Cell Sci, 2001. 114(Pt 12): p. 2255-63. 181. Vaccari, T. and D. Bilder, The Drosophila tumor suppressor vps25 prevents nonautonomous overproliferation by regulating notch trafficking. Dev Cell, 2005. 9(5): p. 687-98. 182. Lobert, V.H., et al., Ubiquitination of α5β1 integrin controls fibroblast migration through lysosomal degradation of fibronectin-integrin complexes. Dev Cell, 2010. 19(1): p. 148-59. 183. Babst, M., et al., Endosome-associated complex, ESCRT-II, recruits transport machinery for protein sorting at the multivesicular body. Dev Cell, 2002. 3(2): p. 283-9. 184. Langelier, C., et al., Human ESCRT-II complex and its role in human immunodeficiency virus type 1 release. J Virol, 2006. 80(19): p. 9465-80. 185. Gill, D.J., et al., Structural insight into the ESCRT-I/-II link and its role in MVB trafficking. EMBO J, 2007. 26(2): p. 600-12. 186. Teo, H., et al., ESCRT-I core and ESCRT-II GLUE domain structures reveal role for GLUE in linking to ESCRT-I and membranes. Cell, 2006. 125(1): p. 99-111. 187. Babst, M., et al., Escrt-III: an endosome-associated heterooligomeric protein complex required for mvb sorting. Dev Cell, 2002. 3(2): p. 271-82. 188. Odorizzi, G., et al., Bro1 is an endosome-associated protein that functions in the MVB pathway in . J Cell Sci, 2003. 116(Pt 10): p. 1893-903.

REFERENCES | 114 189. Jouvenet, N., et al., Dynamics of ESCRT protein recruitment during retroviral assembly. Nat Cell Biol, 2011. 13(4): p. 394-401. 190. Wollert, T., et al., Membrane scission by the ESCRT-III complex. Nature, 2009. 458(7235): p. 172-7. 191. Scott, A., et al., Structural and mechanistic studies of VPS4 proteins. EMBO J, 2005. 24(20): p. 3658-69. 192. Yu, Z., et al., Cryo-EM structure of dodecameric Vps4p and its 2:1 complex with Vta1p. J Mol Biol, 2008. 377(2): p. 364-77. 193. Matsuo, H., et al., Role of LBPA and Alix in multivesicular liposome formation and endosome organization. Science, 2004. 303(5657): p. 531-4. 194. Trajkovic, K., et al., Ceramide triggers budding of exosome vesicles into multivesicular endosomes. Science, 2008. 319(5867): p. 1244-7. 195. Puertollano, R. and J.S. Bonifacino, Interactions of GGA3 with the ubiquitin sorting machinery. Nat Cell Biol, 2004. 6(3): p. 244-51. 196. Forgac, M., Vacuolar ATPases: rotary proton pumps in physiology and pathophysiology. Nat Rev Mol Cell Biol, 2007. 8(11): p. 917-29. 197. Marshansky, V. and M. Futai, The V-type H+-ATPase in vesicular trafficking: targeting, regulation and function. Curr Opin Cell Biol, 2008. 20(4): p. 415-26. 198. Trombetta, E.S., et al., Activation of lysosomal function during dendritic cell maturation. Science, 2003. 299(5611): p. 1400-3. 199. Kane, P.M., The where, when, and how of organelle acidification by the yeast vacuolar H+-ATPase. Microbiol Mol Biol Rev, 2006. 70(1): p. 177-91. 200. Lafourcade, C., et al., Regulation of the V-ATPase along the endocytic pathway occurs through reversible subunit association and membrane localization. PLoS One, 2008. 3(7): p. e2758. 201. Huynh, K.K. and S. Grinstein, Regulation of vacuolar pH and its modulation by some microbial species. Microbiol Mol Biol Rev, 2007. 71(3): p. 452-62. 202. Jentsch, T.J., CLC chloride channels and transporters: from genes to protein structure, pathology and physiology. Crit Rev Biochem Mol Biol, 2008. 43(1): p. 3-36. 203. Mellman, I., R. Fuchs, and A. Helenius, Acidification of the endocytic and exocytic pathways. Annu Rev Biochem, 1986. 55: p. 663-700. 204. Storrie, B. and M. Desjardins, The biogenesis of lysosomes: is it a kiss and run, continuous fusion and fission process? Bioessays, 1996. 18(11): p. 895-903. 205. Luzio, J.P., et al., Lysosome-endosome fusion and lysosome biogenesis. J Cell Sci, 2000. 113 ( Pt 9): p. 1515- 24. 206. Mullins, C. and J.S. Bonifacino, The molecular machinery for lysosome biogenesis. Bioessays, 2001. 23(4): p. 333-43. 207. Bright, N.A., M.J. Gratian, and J.P. Luzio, Endocytic delivery to lysosomes mediated by concurrent fusion and kissing events in living cells. Curr Biol, 2005. 15(4): p. 360-5. 208. Pryor, P.R., et al., The role of intraorganellar Ca2+ in late endosome-lysosome heterotypic fusion and in the reformation of lysosomes from hybrid organelles. J Cell Biol, 2000. 149(5): p. 1053-62. 209. Xu, H. and D. Ren, Lysosomal physiology. Annu Rev Physiol, 2015. 77: p. 57-80. 210. Settembre, C., et al., Signals from the lysosome: a control centre for cellular clearance and energy metabolism. Nat Rev Mol Cell Biol, 2013. 14(5): p. 283-96. 211. Han, S. and A. Brunet, Cell biology. Lysosomal lipid lengthens life span. Science, 2015. 347(6217): p. 32-3. 212. Brenner, S., The genetics of Caenorhabditis elegans. Genetics, 1974. 77(1): p. 71-94. 213. Markaki, M. and N. Tavernarakis, Modeling human diseases in Caenorhabditis elegans. Biotechnol J, 2010. 5(12): p. 1261-76. 214. Sato, K., et al., C. elegans as a model for membrane traffic. WormBook, 2014: p. 1-47. 215. Ang, S.F. and H. Folsch, The role of secretory and endocytic pathways in the maintenance of cell polarity. Essays Biochem, 2012. 53: p. 29-39. 216. Pazdernik, N. and T. Schedl, Introduction to germ cell development in Caenorhabditis elegans. Adv Exp Med Biol, 2013. 757: p. 1-16. 217. Kimble, J. and W.J. Sharrock, Tissue-specific synthesis of yolk proteins in Caenorhabditis elegans. Dev Biol, 1983. 96(1): p. 189-96. 218. Grant, B. and D. Hirsh, Receptor-mediated endocytosis in the Caenorhabditis elegans oocyte. Mol Biol Cell, 1999. 10(12): p. 4311-26. 219. Balklava, Z., et al., Genome-wide analysis identifies a general requirement for polarity proteins in endocytic traffic. Nat Cell Biol, 2007. 9(9): p. 1066-73.

REFERENCES | 115 220. Sappington, T.W. and A.S. Raikhel, Molecular characteristics of insect vitellogenins and vitellogenin receptors. Insect Biochem Mol Biol, 1998. 28(5-6): p. 277-300. 221. Kang, J., et al., Essential roles of snap-29 in C. elegans. Dev Biol, 2011. 355(1): p. 77-88. 222. Sato, M., et al., Caenorhabditis elegans SNAP-29 is required for organellar integrity of the endomembrane system and general exocytosis in intestinal epithelial cells. Mol Biol Cell, 2011. 22(14): p. 2579-87. 223. Fares, H. and I. Greenwald, Genetic analysis of endocytosis in Caenorhabditis elegans: coelomocyte uptake defective mutants. Genetics, 2001. 159(1): p. 133-45. 224. Liu, K., et al., Negative regulation of phosphatidylinositol 3-phosphate levels in early-to-late endosome conversion. J Cell Biol, 2016. 212(2): p. 181-98. 225. Grant, B., et al., Evidence that RME-1, a conserved C. elegans EH-domain protein, functions in endocytic recycling. Nat Cell Biol, 2001. 3(6): p. 573-9. 226. Sato, M., et al., Caenorhabditis elegans RME-6 is a novel regulator of RAB-5 at the clathrin-coated pit. Nat Cell Biol, 2005. 7(6): p. 559-69. 227. Xiao, H., et al., Lysosome biogenesis mediated by vps-18 affects apoptotic cell degradation in Caenorhabditis elegans. Mol Biol Cell, 2009. 20(1): p. 21-32. 228. Chen, C.C., et al., RAB-10 is required for endocytic recycling in the Caenorhabditis elegans intestine. Mol Biol Cell, 2006. 17(3): p. 1286-97. 229. Shi, A., et al., EHBP-1 functions with RAB-10 during endocytic recycling in Caenorhabditis elegans. Mol Biol Cell, 2010. 21(16): p. 2930-43. 230. Shi, A., et al., RAB-10-GTPase-mediated regulation of endosomal phosphatidylinositol-4,5-bisphosphate. Proc Natl Acad Sci U S A, 2012. 109(35): p. E2306-15. 231. Pant, S., et al., AMPH-1/Amphiphysin/Bin1 functions with RME-1/Ehd1 in endocytic recycling. Nat Cell Biol, 2009. 11(12): p. 1399-410. 232. Shi, A., et al., Regulation of endosomal clathrin and retromer-mediated endosome to Golgi retrograde transport by the J-domain protein RME-8. EMBO J, 2009. 28(21): p. 3290-302. 233. Ruck, A., et al., The Atg6/Vps30/Beclin 1 ortholog BEC-1 mediates endocytic retrograde transport in addition to autophagy in C. elegans. Autophagy, 2011. 7(4): p. 386-400. 234. Gu, M., et al., AP2 hemicomplexes contribute independently to synaptic vesicle endocytosis. Elife, 2013. 2: p. e00190. 235. Yang, P.T., et al., Wnt signaling requires retromer-dependent recycling of MIG-14/Wntless in Wnt-producing cells. Dev Cell, 2008. 14(1): p. 140-7. 236. Mallet, W.G. and F.R. Maxfield, Chimeric forms of furin and TGN38 are transported with the plasma membrane in the trans-Golgi network via distinct endosomal pathways. J Cell Biol, 1999. 146(2): p. 345-59. 237. Lee, S., et al., Impaired retrograde membrane traffic through endosomes in a mutant CHO cell defective in phosphatidylserine synthesis. Genes Cells, 2012. 17(8): p. 728-36. 238. Mello, C.C., et al., Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J, 1991. 10(12): p. 3959-70. 239. Mello, C. and A. Fire, DNA transformation. Methods Cell Biol, 1995. 48: p. 451-82. 240. Ye, S., et al., An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res, 2001. 29: p. E88-8. 241. Sambrook, J.a.G., M, Molecular Cloning: a laboratory manual. 4th edition. Cold Spring Harbor Laboratory Press, New York, 2012. 242. Schmittgen, T.D. and K.J. Livak, Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc, 2008. 3(6): p. 1101-8. 243. Livak, K.J. and T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 2001. 25(4): p. 402-8. 244. Wong, A., P. Boutis, and S. Hekimi, Mutations in the clk-1 gene of Caenorhabditis elegans affect developmental and behavioral timing. Genetics, 1995. 139(3): p. 1247-59. 245. Schindelin, J., et al., Fiji: an open-source platform for biological-image analysis. Nat Methods, 2012. 9(7): p. 676-82. 246. Okonechnikov, K., et al., Unipro UGENE: a unified bioinformatics toolkit. Bioinformatics, 2012. 28(8): p. 1166-7. 247. Bai, Z. and B.D. Grant, A TOCA/CDC-42/PAR/WAVE functional module required for retrograde endocytic recycling. Proc Natl Acad Sci U S A, 2015. 112(12): p. E1443-52. 248. Treusch, S., et al., Caenorhabditis elegans functional orthologue of human protein h-mucolipin-1 is required for lysosome biogenesis. Proc Natl Acad Sci U S A, 2004. 101(13): p. 4483-8.

REFERENCES | 116 249. Posor, Y., et al., Spatiotemporal control of endocytosis by phosphatidylinositol-3,4-bisphosphate. Nature, 2013. 499(7457): p. 233-7. 250. Tan, X., et al., Emerging roles of PtdIns(4,5)P2-beyond the plasma membrane. J Cell Sci, 2015. 128(22): p. 4047-56. 251. Nilsson, L., et al., Caenorhabditis elegans num-1 negatively regulates endocytic recycling. Genetics, 2008. 179(1): p. 375-87. 252. Strutz-Seebohm, N., et al., PIKfyve in the SGK1 mediated regulation of the creatine transporter SLC6A8. Cell Physiol Biochem, 2007. 20(6): p. 729-34. 253. O'Rourke, E.J., et al., C. elegans major fats are stored in vesicles distinct from lysosome-related organelles. Cell Metab, 2009. 10(5): p. 430-5. 254. Hermann, G.J., et al., C. elegans BLOC-1 functions in trafficking to lysosome-related gut granules. PLoS One, 2012. 7(8): p. e43043. 255. Marks, M.S., H.F. Heijnen, and G. Raposo, Lysosome-related organelles: unusual compartments become mainstream. Curr Opin Cell Biol, 2013. 25(4): p. 495-505. 256. Huizing, M., et al., Disorders of lysosome-related organelle biogenesis: clinical and molecular genetics. Annu Rev Genomics Hum Genet, 2008. 9: p. 359-86. 257. Di Pietro, S.M., et al., BLOC-1 interacts with BLOC-2 and the AP-3 complex to facilitate protein trafficking on endosomes. Mol Biol Cell, 2006. 17(9): p. 4027-38. 258. Rabbitts, B.M., et al., glo-3, a novel Caenorhabditis elegans gene, is required for lysosome-related organelle biogenesis. Genetics, 2008. 180(2): p. 857-71. 259. Delahaye, J.L., et al., Caenorhabditis elegans HOPS and CCZ-1 mediate trafficking to lysosome-related organelles independently of RAB-7 and SAND-1. Mol Biol Cell, 2014. 25(7): p. 1073-96. 260. Hermann, G.J., et al., Genetic analysis of lysosomal trafficking in Caenorhabditis elegans. Mol Biol Cell, 2005. 16(7): p. 3273-88. 261. Teasdale, R.D. and B.M. Collins, Insights into the PX (phox-homology) domain and SNX (sorting nexin) protein families: structures, functions and roles in disease. Biochem J, 2012. 441(1): p. 39-59. 262. Sakai, N., et al., The intestinal TORC2 signaling pathway contributes to associative learning in Caenorhabditis elegans. PLoS One, 2017. 12(5): p. e0177900. 263. deHart, A.K., et al., The conserved Pkh-Ypk kinase cascade is required for endocytosis in yeast. J Cell Biol, 2002. 156(2): p. 241-8. 264. Zhang, B., et al., Environmental Temperature Differentially Modulates C. elegans Longevity through a Thermosensitive TRP Channel. Cell Rep, 2015. 11(9): p. 1414-24. 265. He, P., et al., Serum- and glucocorticoid-induced kinase 3 in recycling endosomes mediates acute activation of Na+/H+ exchanger NHE3 by glucocorticoids. Mol Biol Cell, 2011. 22(20): p. 3812-25. 266. Zhu, M., et al., Serum- and Glucocorticoid-Inducible Kinase-1 (SGK-1) Plays a Role in Membrane Trafficking in Caenorhabditis elegans. PLoS One, 2015. 10(6): p. e0130778. 267. Muir, A., et al., TORC2-dependent protein kinase Ypk1 phosphorylates ceramide synthase to stimulate synthesis of complex sphingolipids. Elife, 2014. 3. 268. Niles, B.J., et al., TOR complex 2-Ypk1 signaling maintains sphingolipid homeostasis by sensing and regulating ROS accumulation. Cell Rep, 2014. 6(3): p. 541-52. 269. Roelants, F.M., et al., A protein kinase network regulates the function of aminophospholipid flippases. Proc Natl Acad Sci U S A, 2010. 107(1): p. 34-9. 270. Niles, B.J., et al., Plasma membrane recruitment and activation of the AGC kinase Ypk1 is mediated by target of rapamycin complex 2 (TORC2) and its effector proteins Slm1 and Slm2. Proc Natl Acad Sci U S A, 2012. 109(5): p. 1536-41. 271. Balla, T., Phosphoinositides: tiny lipids with giant impact on cell regulation. Physiol Rev, 2013. 93(3): p. 1019-137. 272. Marat, A.L., et al., mTORC1 activity repression by late endosomal phosphatidylinositol 3,4-bisphosphate. Science, 2017. 356(6341): p. 968-972. 273. Naguib, A., et al., PTEN functions by recruitment to cytoplasmic vesicles. Mol Cell, 2015. 58(2): p. 255-68. 274. Berwick, D.C., et al., Protein kinase B phosphorylation of PIKfyve regulates the trafficking of GLUT4 vesicles. J Cell Sci, 2004. 117(Pt 25): p. 5985-93. 275. Law, F., et al., The VPS34 PI3K negatively regulates RAB-5 during endosome maturation. J Cell Sci, 2017. 130(12): p. 2007-2017. 276. Andersson, E.R., The role of endocytosis in activating and regulating signal transduction. Cell Mol Life Sci, 2012. 69(11): p. 1755-71.

REFERENCES | 117 277. Palfy, M., A. Remenyi, and T. Korcsmaros, Endosomal crosstalk: meeting points for signaling pathways. Trends Cell Biol, 2012. 22(9): p. 447-56. 278. Vieira, A.V., C. Lamaze, and S.L. Schmid, Control of EGF receptor signaling by clathrin-mediated endocytosis. Science, 1996. 274(5295): p. 2086-9. 279. Fortian, A. and A. Sorkin, Live-cell fluorescence imaging reveals high stoichiometry of Grb2 binding to the EGF receptor sustained during endocytosis. J Cell Sci, 2014. 127(Pt 2): p. 432-44. 280. Ye, H., et al., Evidence in support of signaling endosome-based retrograde survival of sympathetic neurons. Neuron, 2003. 39(1): p. 57-68. 281. Teis, D., et al., p14-MP1-MEK1 signaling regulates endosomal traffic and cellular proliferation during tissue homeostasis. J Cell Biol, 2006. 175(6): p. 861-8. 282. Sancak, Y., et al., Ragulator-Rag complex targets mTORC1 to the lysosomal surface and is necessary for its activation by amino acids. Cell, 2010. 141(2): p. 290-303. 283. Panopoulou, E., et al., Early endosomal regulation of Smad-dependent signaling in endothelial cells. J Biol Chem, 2002. 277(20): p. 18046-52. 284. Lee, C.T., et al., Serum- and glucocorticoid-inducible kinase (SGK) is a target of the MAPK/ERK signaling pathway that mediates memory formation in rats. Eur J Neurosci, 2006. 23: p. 1311-1320. 285. Lamothe, S.M. and S. Zhang, The Serum- and Glucocorticoid-inducible Kinases SGK1 and SGK3 Regulate hERG Channel Expression via Ubiquitin Ligase Nedd4-2 and GTPase Rab11. J Biol Chem, 2013. 288: p. 15075-15084. 286. Betz, C. and M.N. Hall, Where is mTOR and what is it doing there? J Cell Biol, 2013. 203(4): p. 563-74.

REFERENCES | 118 6 ACKNOWLEDGEMENTS

After six year living and study in the small and beautiful city Freiburg, it is the time to say goodbye. The completion of this thesis would not have been possible without the help and support of those lovely people whom I am very happy to shout out and to whom I am indebted for making my life in Freiburg happy, fulfilling and productive. First of all, I am deeply grateful to my mentor Prof. Dr. Ralf Baumeister for giving me the opportunity to work in his lab as a PhD student. Throughout these years he provided ample constructive feedback on my work and I managed to greatly improve my scientific soft skills under his supervision. I truly thank Dr. Wenjing Qi for being an amazing colleague and becoming a wonderful friend, the innumerable occasions when I had fruitful discussions with her will always be remembered. My deep appreciation to Dr. Ekkehard Schulze for sharing his expertise in microscopy with me, and for providing critical feedback on my work. I have learnt a great deal thanks to him. Many thanks to Dr. Wolfgang Maier, Dr. Mark Seifert, Dr. Bettina Schulze, Tim Wolf, Qian Zhao, Lena Aspernig, Claudio Goll, Dipak Gangurde and all other students being the lab for inspiring working environment and the great moments outside of the realms of the lab. My deeply appreciate to our wonderful technicians Erika Donner von Gromoff, Birgit Holzwarth and Ruth Jähne. Furthermore, I would like to thank all former and present members of the Baumeister lab for the nice working atmosphere, their help and scientific support throughout this study. I am grateful to the China Scholarship Council for granting me the opportunity to become a PhD student in the University of Freiburg. Special thanks go also to my ex lab mates and friends Dr. Xu Huang and Dr. Yimin Wang for the countless times that I had productive discussions with them, from trivial daily work matters to serious scientific discussions, as well as for the social bondings. I am very thankful to my amazing friends Dr. Wenyi Li and Dr. Zhenzhong Yu for their interest, conversations, and times that we shared, imprinting so many pleasant moments in my memory during these years.

ACKNOWLEDGEMENTS | 119 I have to say thank you my dear friend Dr. Lingzhi Zhang, I will never forget the trips and wanderings we experienced together. Thank you sharing in my happiest moments. Thank you for being the only person I ever want to confide in. If I could still request a music video for you, it would be Kelly Clarkson’s “My Life Would Suck Without You”. Finally, I thank Mom, Dad and my younger sister Yicui. It is impossible to thank you enough for all that you have done for me. I will not try to put anything in words, other than to offer the above work as thanks to you. So, thanks to all at once.

ACKNOWLEDGEMENTS | 120

7 APPENDIXES

7.1 Abbreviation list

2-ME β-mercaptoethanol aa Amino acid AP Alkaline phosphatases ATCC American type culture collection BSA Bovine serum albumin C. elegans Caenorhabditis elegans CCPs Clathrin-coated pits CDE Clatrin dependent endocytosis CHIP C-terminus Hsc70 interacting protein CIE Clatrin independent endocytosis CORVET Class C core vacuole/endosome tethering CRISPR Clustered regularly interspaced short palindromic repeats CUP Coelomocyte uptake defective DIC Differential interference contrast DYT Double yeast trytone E. coli Escherichia coli ECVs Endosomal carrier vesicles EEs Early endosomes EMT Endomembrane trafficking ENaC Epithelial Na+ channel ER Endoplasmic reticulum ESCRT Endosomal sorting complex required for transport FBS Fetal bovine serum FOXO Forkhead box O GAPs GTPase-activating proteins GDFs GDI displacement factors GDIs GDP dissociation inhibitors GEFs Guanine-nucleotide exchange factors GFP Green fluorescence protein HOPS Homotypic fusion and protein sorting hTAC Human IL-2 receptor α-chain hTfR Human transferrin receptor IIS Insulin/IGF-1 signaling ILPs Insulin like peptides IPTG Isopropyl β-D-1-thiogalactopyranoside IVLs Intraluminal vesicles LB Luria-Bertani LBPA Lysobisphosphatidic acid LEs Late endosomes LROs Lysosome-related organelles MAPKs Mitogen-activated protein kinases MEF Mouse embryonic fibroblasts MPRs Mannose-6-phosphate receptors MT Microtubule mTORC2 Mammalian target of rapamycin complex 2

APPENDIXES | 121 MVBs Multivesicular bodies NCBI National center for biotechnological information NGM Nematode growth medium PH Pleckstrin homology domain PI3K Phosphatidylinositide 3 kinase PI(3,4,5)P3 Phosphatidylinositol (3,4,5)-trisphosphate PI(3,5)P2 Phosphatidylinositol 3,5-biphosphate PI(3)P Phosphatidylinositol 3-phosphate PI(4,5)P2 Phosphatidylinositol 4,5-bisphosphate PI(5)P Phosphatidylinositol 5-phosphate PIF PDK1-interacting fragment pocket PVDF Polyvinylidene difluoride PX Phox homology domain PY Proline-tyrosine qRT-PCR Quantitative real-time PCR REs Recycling endosomes RT Room temperature S. cerevisiae Saccharomyces cerevisiae SDS-PAGE Sodium dodecyl sulphate polyacrylamid-gel electrophoresis Sma Small body size ssGFP Secretory GFP SW-PCR Single worm PCR TGN trans-Golgi network TRPs Transient receptor potential channels UBAP1 Ubiquitin-associated protein 1 VLSs Vacuole like structures X. laevis Xenopus laevis

APPENDIXES | 122

7.2 Bacteria strains, mammalian cell lines and antibodies

Bacteria Strain Genotype Description OP50 ura- Food resource HT115(DE3) F-, mcrA, mcrB, IN(rrnD-rrnE)1, lambda-,rnc14::Tn10(DE3 RNAi feeding lysogen:lacUV5 promoter-T7polymerase, RNAse III minus) TOP10 F-, mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 recA1 Molecular clone araD139Δ(araleu)7697 galU galK rpsL (StrR) endA1 nupG

- - - + BL21(DE3) F , ampT hsdS (rB mB ) dcm Tetr galλ(DE3) endA The*argU ileY Protein expression leuWCamr Cell lines Description HEK293T Human Embryonic Kidney 293 cells, containing the SV40 Large T-antigen that allows for episomal replication of transfected plasmids containing the SV40 origin of replication. Ordered from DMSZ. JIMT-1 Established from the pleural effusion of a 62-year-old woman with ductal breast cancer (grade 3 invasive T2N1M0) after postoperative radiation, with high basal expression level of SGKs. Ordered from DMSZ Antibodies Description anti-CeSGK-1 Produced in rabbit, in cooperation with Dr. A. Karabinos, Slowekei anti-Actin Produced in mouse, monoclonal antibody, purchased from MP Biomedicals, 08691001 anti-GST Produced in rabbit, polyclonal antibody, purchased from Sigma Aldrich, G7781

APPENDIXES | 123 7.3 C. elegans strains used in the study

Strain Genotype Description

BR10 wild type Wild type N2 strain (Bristol isolate) BR2620 daf-16(mu86)II CGC, outcrossed 11x BR2773 byEx193[Psgk-1::sgk-1::GFP; rol-6(su1006)] Maren Hertweck, this lab BR3358 pdk-1(sa680)X CGC BR3393 daf-2(e1370)III CGC BR4705 sgk-1(ok538)X CGC, outcrossed 8x BR5203 pdk-1(sa680)X;daf-16(mu86)I CGC BR5519 byEx781[Psgk-1::GFP;rol-6(su1006)] Wenjing Qi, this lab BR5611 rict-1(mg360)II CGC BR5612 rict-1(ft7)II CGC BR6575 byIs207[Psgk-1::sgk-1::GFP;rol-6(su1006)] Tim Wolf, this lab BR6580 byIs208[Psgk-1::sgk-1::GFP;rol-6(su1006)] Tim Wolf, this lab BR6662 byEx1223[Psgk-1::GFP::sgk-1;rol-6(su1006)] Wenjing Qi, this lab BR6866 pqm-1(ok485)II CGC, outcrossed 6x BR6869 daf-16(mu86)II;byIs207[Psgk-1::sgk-1::GFP;rol-6(su1006)] This study BR6870 daf-2(e1370)III;daf-16(mu86)II;byIs207[Psgk-1::sgk- This study 1::GFP;rol-6(su1006)] BR6908 pqm-1(ok485)II;byIs207[Psgk-1::sgk-1::GFP;rol-6(su1006)] This study BR6934 svls23[num-1(+);unc-4(+)] Simon Tuck lab BR6945 rme-1(b1045)V CGC, Outcrossed 8x BR6946 rab-10(q373)I CGC, Outcrossed 8x BR6975 rab-10(q373)I;byIs207[Psgk-1::sgk-1::GFP;rol-6(su1006)] This study BR6977 rme-1(b1045)V;byIs207[Psgk-1::sgk-1::GFP;rol-6(su1006)] This study BR6979 sgk-1(ok538)X;pwIs91[Pvha-6::hTfR::GFP;unc-119(+)] This study BR6980 sgk-1(ok538)X; pwIs111[Pvha-6::hTAC::GFP;unc-119(+)] This study BR6981 sgk-1(ok538)X;arIs37[Pmyo-3::ssGFP;dpy-20(+)] This study BR6982 sgk-1(ok538)X;pwIs23[vit-2::GFP] This study BR6983 sgk-1(ok538)X;pwIs72[Pvha-6::GFP::rab-5;unc-119(+)] This study BR6984 sgk-1(ok538)X;pwIs170[Pvha-6::GFP::rab-7;unc-119(+)] This study BR6985 sgk-1(ok538)X;pwIs206[Pvha-6::GFP::rab-10;unc-119(+)] This study BR6986 sgk-1(ok538)X; pwIs69[Pvha-6::GFP::rab-11; unc-119(+)] This study BR6987 sgk-1(ok538)X;svls23[num-1(+);unc-4(+)] This study BR6989 sgk-1(ok538)X;rme-1(b1045)V This study BR6990 sgk-1(ok538)X;rab-10(q373)I This study BR7026 sgk-1(ok538)X;pwIs87[Pvha-6::GFP::rme-1; unc-119(+)] This study BR7150 pkc-2(ok328)X;byIs207[Psgk-1::sgk-1::GFP;rol-6(su1006)] This study BR7153 sgk-1(ok538)X;pwIs50[lmp-1::GFP;unc-119(+)] This study BR7173 byEx1329[Psgk-1::sgk-1::mCherry;rol-6(su1006)]; This study pwIs72[Pvha-6::GFP::rab-5;unc-119(+)] BR7174 byEx1329[Psgk-1::sgk-1::mCherry;rol-6(su1006)]; This study pwIs170[Pvha-6::GFP::rab-7;unc-119(+)] BR7175 byEx1329[Psgk-1::sgk-1::mCherry; rol-6(su1006)]; This study pwIs206[Pvha-6::GFP::rab-10;unc-119(+)] BR7176 byEx1329[Psgk-1::sgk-1::mCherry; rol-6(su1006)]; This study pwIs69[Pvha-6::GFP::rab-11;unc-119(+)] BR7177 byEx1329[Psgk-1::sgk-1::mCherry;rol-6(su1006)]; This study pwIs87[Pvha-6::GFP::rme-1;unc-119(+)] BR7178 byEx1329[Psgk-1::sgk-1::mCherry;rol-6(su1006)]; This study

APPENDIXES | 124

pwIs50[lmp-1::GFP;unc-119(+)] BR7312 byEx1329[Psgk-1::sgk-1::mCherry;rol- This study 6(su1006)];arIs37[Pmyo-3::ssGFP] BR7313 byEx1329[Psgk-1::sgk-1::mCherry;rol-6(su1006)];pwIs23[vit- This study 2::GFP] BR7234 pwIs765[Pvha-6::mig-14::GFP;unc-119(+)] Barth Grant lab BR7314 byEx1329[Psgk-1::sgk-1::mCherry;rol-6(su1006)]; This study pwIs765[Pvha-6::mig-14::GFP;unc-119(+)] BR7318 sgk-1(ok538)X;pwIs765[Pvha-6::mig-14::GFP;unc-119(+)] This study BR7319 sgk-1(ok538)X;pwIs717[Pvha-6::hTfR::GFP;unc-119(+)] This study BR7321 sgk-1(ok538)X;pwIs1255 [Pvha-6::tgn-38::GFP;unc-119(+)] This study BR7343 sgk-1(by192[T293A])X Bettina Schulze, this lab BR7393 sgk-1(by192[T293A])X;rab-10(q373)I This study BR7399 pdk-1(sa680)X;daf-16(mu86)II;byIs207[Psgk-1::sgk- This study 1::GFP;rol-6(su1006)] BR7453 rict-1(ft7)II;byIs207[Psgk-1::sgk-1::GFP;rol-6(su1006)] This study BR7454-7456 byEx1426[Psgk-1::sgk-1(TGA);rol-6(su1006)] This study, injection of pBY3847 in N2 background BR7458-7460 sgk-1(ok538)X;byEx1429[Psgk-1::sgk-1(TGA);rol-6(su1006)] This study, pBY3847 in sgk- 1 background BR7569 rab-10(q373)I;rict-1(ft7)II This study BR7590 rict-1(mg360)II;byIs207[Psgk-1::sgk-1::GFP;rol-6(su1006)] This study BR7591 ppk-3(n2668)X;byIs207[Psgk-1::sgk-1::GFP;rol-6(su1006)] This study BR7595-7597 byEx1469[Psgk-1::3xFlAG::sgk-1b;rol-6(su1006)] This study, injection of pBY3859 in N2 background BR7620 Y92H12A.2(ok3321)I/Nedd4.2 CGC, outcrossed 6x BR7665 rab-10(q373)I;pdk-1(sa680)X This study BR7666 rab-10(q373)daf-16(mu86)I This study BR7667 rab-10(q373)daf-16(mu86)I;pdk-1(sa680)X This study BR7674 rab-10(q373)I;rict-1(ft7)II;sgk-1(ft15)X This study BR7697 rab-10(q373)I;sgk-1(ft15)X This study BR7699 pkc-2(ok328)X CGC, outcrossed 6x BR7701 Y92H12A.2(ok3321)I;byIs207[Psgk-1::sgk-1::GFP;rol- This study 6(su1006)] BR7702 rab-10(q373)I;pkc-2(ok328)X This study BR7718 tbc-2(tm2241)II Stefan Eimer lab BR7721 pdk-1(sa680)X; byIs207[Psgk-1::sgk-1::GFP;rol-6(su1006)] This study BR7733 tbc-2(tm2241)II;sgk-1(ok538)X This study BR7734 tbc-2(tm2241)II;byIs207[Psgk-1::sgk-1::GFP;rol-6(su1006)] This study BR7735 rab-10(q373)I;sinh-1(pe420)II This study BR7736 tbc-2(tm2241)II;pwIs170[Pvha-6::GFP::rab-7;unc-119(+)] This study BR7750-7752 byEx1512[Punc-122::mCherry::sgk-1(cDNA);rol-6(su1006)] This study, injection of pBY3914 BR7777-7779 sgk-1(ok538)X;byEx1532[Psgk-1::sgk-1;rol-6(su1006)] This study, injection of pBY3859 BR7780 ppk-3(n2668)X;pwIs50[lmp-1::GFP;unc-119(+)] This study BR7784-7786 byEx1535[Psgk-1::3xFlag::sgk-1a;rol-6(su1006)] This study, 3XFLAG tagged SGK-1 isoformA, pBY3922 in N2 background BR7826 rab-10(q373)I;rict-1(mg360)II This study BR7829 sgk-1(ok538)X;tbc-1(tm2241)II;pwIs170[Pvha-6::GFP::rab- This study

APPENDIXES | 125 7;unc-119(+)] BR7855-7857 sgk-1(ok538)X;byEx1563[Psgk-1::3xFlag::sgk-1a,rol- This study, injection of 6(su1006)] pBY3922 BR7903-7905 byEx1582[Psgk-1::mCherry::sgk-1;rol-6(su1006)] This study, injection of pBY3936 in N2 background BR7906-7908 sgk-1(ok538)X;byEx1585[Psgk-1::mCherry::sgk-1;rol- This study, injection of 6(su1006)] pBY3936 BR7909-7911 sgk-1(ok538)X;byEx1588[Prab-3::mCherry::sgk-1;rol- This study, neuronal 6(su1006)] specific rescue of sgk-1, injection of pBY3942 BR7912-7914 sgk-1(ok538)X;byEx1591[Pvha-6::mCherry::sgk-1;rol- This study, intestinal 6(su1006)] specific rescue of sgk-1, injection of pBY3915 BR7915-7917 sgk-1(ok538)X;rab-10(q373)I;byEx1594[Prab- This study, injection of 3::mCherry::sgk-1;rol-6(su1006)] pBY3942 in sgk-1;rab-10 background BR7918-7920 sgk-1(ok538)X;rab-10(q373)I;byEx1597[Pvha- This study, injection of 6::mCherry::sgk-1;rol-6(su1006)] pBY3915 in sgk-1;rab-10 background BR7926 rab-10(q373)I;rict-1(mg360)II;sgk-1(ft15)X This study BR7937-7939 sgk-1(ok538)X;byEx1603[Pvha-6::mCherry::sgk- This study, R83A point 1(R83A,cDNA);rol-6(su1006)] mutation for the PX domain of sgk-1 cDNA, pBY3943 BR7971 byEx1582[Psgk-1::mCherry::sgk-1;rol- This study 6(su1006)];pwIs72[Pvha-6::GFP::rab-5;unc-119(+)] BR7972 byEx1582[Psgk-1::mCherry::sgk-1;rol- This study 6(su1006)];pwIs170[Pvha-6::GFP::rab-7;unc-119(+)] BR7994-7996 sgk-1(ok538)X;byEx1610[Psgk-1::GFP::sgk-1(R83A);rol- This study, pBY3966, R83A 6(su1006)] of genomic sgk-1, low injection concentration BR7998 pwIs765[Pvha-6::mig-14::GFP;unc-119(+)];byEx1582[Psgk- This study 1::mCherry::sgk-1;rol-6(su1006)] BR7999 pwIs214[Prab-10::GFP::rab-10;unc-119(+)];byEx1582[Psgk- This study 1::mCherry::sgk-1;rol-6(su1006)] BR8000 pwIs69[Pvha-6::GFP::rab-11;unc-119(+)];byEx1582[Psgk- This study 1::mCherry::sgk-1;rol-6(su1006)] BR8001 pwIs87[Pvha-6::GFP::rme-1;unc-119(+)];byEx1582[Psgk- This study 1::mCherry::sgk-1;rol-6(su1006)] BR8002 pwIs1255[Pvha-6::tgn-38::GFP;unc-119(+)];byEx1582[Psgk- This study 1::mCherry::sgk-1;rol-6(su1006)] BR8004-8006 rab-10(q373)I;sgk-1(ok538)X;byEx1617[Psgk- This study, injection of 1::mCherry::sgk-1;rol-6(su1006)] pBY3936 in sgk-1;rab-10 background BR8044-8046 sgk-1(ok538)X;byEx1628[Psgk-1::GFP::sgk-1;rol-6(su1006)] This study, pBY3707 BR8047-8049 sgk-1(ok538)X;byEx1631[Psgk-1::GFP::sgk-1(ΔPX);rol- This study, rescue of sgk-1 6(su1006)] without PX domain, injection of pBY3971 BR8060-8062 sgk-1(ok538)X;byEx1638[Psgk-1::GFP::sgk-1(R83A);rol- This study, pBY3966, R83A 6(su1006)] of genomic sgk-1, high injection concentration

APPENDIXES | 126

BR8143 sgk-1(ok538)glo-1(zu391)X This study BR8144 sgk-1(ft15)glo-1(zu391)X This study BR8167-8169 sgk-1(ok538)X;byEx1659[PsgK-1::GFP::sgk3;rol-6(su1006)] This study, express human SGK3 in C. elegans, injection of pBY3983 BR8173-8175 byEx1665[Psgk-1::Scarlet::sgk-1;rol-6(su1006)] This study, pBY3991 BR8208 byEx1665[Psgk-1::Scarlet::sgk-1;rol- This study 6(su1006)];pwIs446[Pvha-6::PH::GFP;unc-119(+)] BR8209 byEx1665[Psgk-1::Scarlet::sgk-1;rol- This study 6(su1006)];pwIs140[Pvha-6::GFP::2XFYVE;unc-119(+)] BR8210 byEx1665[Psgk-1::Scarlet::sgk-1;rol- This study 6(su1006)];pwIs890[Phva-6::Akt-PH::GFP;unc-119(+)] BR8211 sgk-1(ok538)X;pwIs446[Pvha-6::PH::GFP] This study BR8212 sgk-1(ok538)X;pwIs140[Pvha-6::GFP::2xFYVE] This study BR8213 sgk-1(ok538)X;pwIs890[Pvha-6::Akt-PH::GFP] This study BR8134 pwIs446[Pvha-6::PH::GFP;unc-119(+)] Barth Grant lab BR8135 pwIs140[Pvha-6::GFP::2xFYVE;unc-119(+)] Barth Grant lab BR8136 pwIs890[Phva-6::Akt-PH::GFP;unc-119(+)] Barth Grant lab BR8216 sinh-1(pe420)II;byIs207[Psgk-1::sgk-1::GFP;rol-6(su1006)] This study BR8217 sgk-1(ok538)X;hjIs9[Pges-1::glo-1::GFP;unc-119(+)] This study BR8236 pwIs72[Pvha-6::GFP::rab-5;unc-119(+)];byEx1469[Psgk- This study 1::3xFLAG::sgk-1;rol-6(su1006)] BR8237 pwIs170[Pvha-6::GFP::rab-7; unc-119(+)];byEx1469[Psgk- This study 1::3xFLAG::sgk-1;rol-6(su1006)] BR8238 pwIs91[Pvha-6::hTfR::GFP;unc-119(+)];byEx1469[Psgk- This study 1::3xFLAG::sgk-1;rol-6(su1006)] BR8239 pwIs111[Pvha-6::hTAC::GFP;unc-119(+)];byEx1469[Psgk- This study 1::3xFLAG::sgk-1;rol-6(su1006)] BR8240 arIs37[Pmyo-3::ssGFP;dpy-20(+)];byEx1469[Psgk- This study 1::3xFLAG::sgk-1;rol-6(su1006)] BR8241 pwIs1255[Pvha-6::tgn-38::GFP;unc-119(+)];byEx1469[Psgk- This study 1::3xFLAG::sgk-1;rol-6(su1006)] BR8245 sgk-1(ok538)ppk-3(n2668)X;pwIs50[lmp-1::GFP;unc-119(+)] This study BR8251 hjIs9[Pges-1::glo-1::GFP;unc-119(+)];byEx1665[Psgk- This study 1::Scarlet::sgk-1;rol-6(su1006)] BR8252 pwIs91[Pvha-6::hTfR::GFP; unc-119(+)];byEx1665[Psgk- This study 1::Scarlet::sgk-1;rol-6(su1006)] BR8253 pwIs111[Pvha-6::hTAC::GFP; unc-119(+)];byEx1665[Psgk- This study 1::Scarlet::sgk-1;rol-6(su1006)] BR8254 wwp-1(ok1102)I;byEx1665[Psgk-1::Scarlet::sgk-1;rol- This study 6(su1006)] BR8256 pwIs50[lmp-1::GFP;unc-119(+)];byEx1665[Psgk- This study 1::Scarlet::sgk-1;rol-6(su1006)] BR8259 rab-10(q373)I;sgk-1(ok538)X;byEx1610[Psgk-1::GFP::sgk- This study 1(R83A);rol-6(su1006)] BR8260 rab-10(q373)I;sgk-1(ok538)X;byEx1611[Psgk-1::GFP::sgk- This study 1(R83A);rol-6(su1006)] BR8306 wwp-1(ok1102)I;byEx1223 [Psgk-1::GFP::sgk-1;rol- This study 6(su1006)] BR8325 rab-10(q373)I;sgk-1(ok538)X;byEx1638[Psgk-1::GFP::sgk- This study 1(R83A);rol-6(su1006)] BR8326 pwIs50[lmp-1::GFP;unc-119(+)];byEx1582[Psgk- This study

APPENDIXES | 127 1::mCherry::sgk-1;rol-6(su1006)] BR8330 rab-10(q373)I;sgk-1(ok538)X;byEx1639[Psgk-1::GFP::sgk- This study 1(R83A);rol-6(su1006)] BR8334 rabx-5(ok1763)III;byEx1665[Psgk-1::Scarlet::sgk-1;rol- This study 6(su1006)] BR8336-8338 sgk-1(ok538)X;byEx1724[Psgk-1::GFP::sgk-1(K164R);rol- This study, pBY4011 6(su1006)] BR8339-8041 sgk-1(ok538)X;byEx1727[Psgk-1::GFP::sgk-1(T293A);rol- This study, pBY4012 6(su1006)] BR8342-8344 sgk-1(ok538)X;byEx1730[Psgk-1::GFP::sgk-1(S434A, This study, pBY4013 T454A);rol-6(su1006)] BR8362 sgk-1(ok538)X;cdIs184[Pelt-2::GFP::cup-5;unc-119(+);myo- This study 2::GFP] BR8363 cdIs184[Pelt-2::GFP::cup-5;unc-119(+);myo- This study 2::GFP];byEx1665[Psgk-1::Scarlet::sgk-1;rol-6(su1006)] Only the byEx number for the first line of the sequential transgenes that generated form the injection of same plasmid is presented in the table.

APPENDIXES | 128

7.4 Oligonucleotides used in the study

Oligo ID Sequence (5’-3’) Description RB6050 TCTACGGGTCCGTCTATTGC To detect Y92H12A.2(ok3321)I RB6051 ACTTCGAAACACTTTCCGGC RB6035 CCACCATTCCCATGAAACGC To detect pkc-2(ok328)X RB6036 AGCAGAACGTTGGCTGTTTG RB6037 CCCGTCTCGTTCGAGCATAA RB4314 ATTTTTCCGTCTGCGTTTCT To detect daf-16(mu86)II RB4315 TAG GAG GAA AAG CCATTT GT RB4316 TTGGATCGTTCACGTGTACG RB6043 TCCAGAATCGATCGCGGATA To detect rme-1(b1045)V RB6044 AGAGAAGGGGGTCGTATCACA RB6045 TATGCGTGAACCTTGGCGAG RB6109 CAGCTCTCAGCGAATCGACA To detect tbc-2(tm2241)II RB6110 TCAGACAATCGAAAGCCCAGA RB6111 TGCGCTGGAATGTAGTTCAGA RB6138 CGCGATGACCGGAAATATGC To detect sgk-1(ok538)X RB6139 ACCTCCAACGCGAGAAACAT RB6140 AGCGCAATAGAACTCTGCCG RB6235 AGATGCTGACTAATCACAAGGATCCAAACACGT To introduce R83A point GCTTTCTCG mutation into sgk-1 cDNA RB6236 ATCAAGTTTGCCGGAAATGTCTAGAGGG RB6199 CCGCTCGAGACATGCAAAGAGATCACACCATGG To clone human sgk3 cDNA RB6200 GGGCCCGGGTCACAAAAATAAGTCTTCTGAAGG RB6227 ACGTAATTCGACATGAGCTTC To detect sinh-1(pe420)II RB6228 ATATCATCAAATCCCGCATCC Lyophilized oligonucleotides were purchased from Sigma-Aldrich and stored as 100 μM aqueous stock solution at -20°C, if not stated otherwise.

APPENDIXES | 129 7.5 Plasmids used in the study

Plasmid ID Name Description pBY260 pRF4 Microinjection marker, contain rol-6(su1006) variant, impose roller phenotype pBY2826 Psgk-1::sgk-1::GFP C terminal fusion of GFP with SGK-1 in the pPD95.75 backbone (from Venera Gashaj, this lab) pBY2870 Psgk-1::GFP Transcriptional fusion reporter for SGK-1 (from Venera Gashaj, this lab) pBY2924 pEGFP-C1 Commercial EGFP plasmid, which were used as the backbone to construct transgenic worms pBY3063 L4440 Control plasmid for RNAi experiment pBY3109 pmCherry-C1 Commercial mCherry plasmid, which were used as the backbone to construct transgenic worms pBY3667 Psgk-1::GFP::sgk-1(cDNA) Transcriptional fusion reporter for the cDNA of SGK-1 (from Wenjing Qi, this lab) pBY3707 Psgk-1::GFP::sgk-1 Transcriptional fusion reporter for the genomic SGK-1 (from Wenjing Qi, this lab) pBY3847 Psgk-1::sgk-1 Overexpression of SGK-1 with endogenous promoter pBY3855 pT7::gst::sgk-1 N terminal GST tagged SGK-1 for the bacterial expression of SGK-1 pBY3856 pT7::gst(ΔPX)sgk-1 N terminal GST tagged (ΔPX)SGK-1 for the bacterial expression of SGK-1 without PX domain pBY3858 Punc-122::sgk-1(cDNA)::mCherry Coelomocyte expression of SGK-1 with the C terminal fusion of mCherry pBY3859 Psgk-1::3xFLAG::sgk-1b N terminal 3xFLAG tag of SGK-1 isoformB pBY3880 pT7::gst::PX(sgk-1) N terminal GST tagged PX domian for the bacterial expression the PX domain of SGK-1 pBY3914 Punc-122::mCherry::sgk-1(cDNA) Coelomocyte expression of SGK-1 with the N terminal fusion of mCherry pBY3915 Pvha-6::mCherry::sgk-1(cDNA) Intestinal expression of SGK-1 with the N terminal fusion of mCherry pBY3922 Psgk-1:: 3xFLAG::sgk-1a N terminal 3xFLAG tag of SGK-1 isoformA pBY3936 Psgk-1::mCherry::sgk-1 Genomic SGK-1 with a N terminal mCherry fusion driven by endogenous promoter pBY3942 Prab-3::mCherry::sgk-1(cDNA) Neuronal expression of SGK-1 pBY3943 Psgk-1::GFP::sgk-1(R83A)_cDNA Arginine 83 in the PX domain of SGK-1 cDNA was mutated into alanine pBY3966 Psgk-1::GFP::sgk-1(R83A)_genomic Arginine 83 in the PX domain of genomic SGK-1 was mutated into alanine pBY3971 Psgk-1::GFP::ΔPXsgk-1(cDNA) The PX domain of SGK-1 was deleted pBY3973 pCMV::sgk-1(cDNA)::GST To express cDNA of SGK-1 with a C terminal GST tag in mammalian cell culture pBY3983 Psgk-1::GFP::sgk3 Express human SGK3 in C. elegans pBY3990 pCMV::PX(sgk-1)::GST To express PX domain of SGK-1 with a C terminal GST tag in mammalian cell culture pBY3991 Psgk-1::Scarlet::sgk-1 Genomic SGK-1 with a N terminal Scarlet

APPENDIXES | 130

fusion driven by endogenous promoter pBY3992 Pvha-6::mCherry::sgk3 Intestinal expression of human SGK3 in C. elegans pBY4011 Psgk-1::GFP::sgk-1(K164R) Kinase dead construct for genomic SGK-1 pBY4012 Psgk-1::GFP::sgk-1(T293A) The threonine phosphorylation site of PDK-1 in SGK-1 was mutated into alanine pBY4013 Psgk-1::GFP::sgk-1(S434A, T454A) The pseudo phosphorylation sites of TORC2 in SGK-1 was mutated into alanine pBY4014 Psgk-1::GFP::sgk-1(S434E, T454E) The pseudo phosphorylation sites of TORC2 in SGK-1 was mutated into glutamic acid to gain a constitutively active SGK-1 pBY4021 pCMV::PX(R83A)::GST A point mutation of R83A was introduced into the PX domain of SGK-1, and expressed in HEK293T with a C terminal GST tag

APPENDIXES | 131 7.6 Softwares used in the study

Name Distributor Endnote X7 Thomson Reuters, Carlsbad, USA Electronic Lab Notebook Contur Software AB, Stockholm, Sweden UniPro UGENE [246] ImageJ 1.51s [245] GraphPad Prism 7.0 GraphPad Prism Software Inc Microsoft Office Microssoft, Unterschleissheim, Germany Axiovision software 4.8.1 Carl Zeiss Microscopy GmbH, Germany Multigauge V3.0 Fujifilm, Duesseldorf, Germany Image Reader LAS-4000 Fujifilm, Duesseldorf, Germany VisionCapt v16.13 Analis, Belgium GIMP 2.8.20 The GIMP Team Inkscape 0.92.1 The Inkscape Project Rotor Gene 3000 6.1.81 Corbett, Sydney, Australia NIS-Elements AR Analysis 4.00.12 Nikon GmbH, Duesseldorf, Germany ZEN Black Carl Zeiss Microscopy GmbH, Jena, Germany LAS X 3.3.0 Leica Mikrosysteme Vertrieb GmbH, Wetzlar, Germany IrfanView 4.42 Irfan Skiljan Huygens Essential 14.10 Scientific Volume Imaging b.V., Hilversum, The Netherland IMARIS 9.0.2 Bitplane, Zurich, Switzerland

APPENDIXES | 132

7.7 Supplemental figure

Supplemental figure: (A) The mean fluorescence intensity of SGK-1::GFP in the pqm-1(ok485) mutant

APPENDIXES | 133 background. More than 60 animals of each strain from three independent tests were analyzed. (B) Western blot for the endogenous SGK-1. The assay was conducted by Erika Donner von Gromoff and Dr. Wenjing Qi. (C) The mean fluorescence intensity of ssGFP in the wild type and sgk-1(ok538) backgrounds. More than 60 animals of each strain from three independent tests were analyzed. (D) DIC images for day one adults of wild type, sgk-1(ok538), sgk-1(T293A) and sgk-1(S434A, T454A) transgenic strains. Synchronized animals were mounted onto 2% agarose pad and images were taken under a compound microscope with a 10x objective. Arrow head, VSL. Scale bar, 50 µm. (E) Sma phenotype of wild type, sgk-1(ok538), and indicated transgenic strains. (F) Percentage of worms showing VLSs of the sgk-1(S434A, T454A) transgenic strains. (G) Localization pattern of mCherry::sgk-1 driven by coelomocyte specific promoter Punc-122, arrow heads indicate the endosomal luminal localization of mCherry::SGK-1, scale bar, 5 µm.

APPENDIXES | 134

『不忘初心，方得始终』

The very beginning mind itself is the most accomplished mind of true enlightenment -Avatamsaka Sutra