Evaluation of IL-1Β and IL-18 As Genetic Adjuvants in Adenoviral Immunizations Against Influenza a Viruses

Evaluation of IL-1β and IL-18 as genetic adjuvants in adenoviral immunizations against influenza A viruses

Dissertation

submitted to the Graduate School of Chemistry and Biochemistry for the Degree of Doctor of Natural Sciences (Dr. rer. nat.) by Dennis Lapuente

prepared at the Department for Molecular and Medical Virology, Institute for Hygiene and Microbiology, Ruhr-University Bochum

Head of the Department: Prof. Dr. M. Tenbusch

Bochum, 04.01.2017 Table of contents

Table of contents

Table of contents ...... I

List of abbreviations ...... IV

List of figures ...... VI

List of tables ...... VII

Summary ...... 1

1 Introduction ...... 3

1.1 Influenza A ...... 3 1.1.1 Structure and variability ...... 3 1.1.2 Innate immune recognition ...... 5 1.1.3 Adaptive immune responses ...... 7 1.1.4 Immune memory ...... 9 1.1.5 Tissue-resident memory T cells ...... 10

1.2 Influenza A vaccines ...... 12 1.2.1 Current vaccination strategies ...... 12 1.2.2 Universal influenza vaccine approaches ...... 13

1.3 Aims of the study ...... 16

2 Materials and methods...... 17

2.1 Materials ...... 17 2.1.1 Chemicals and reagents ...... 17 2.1.2 Consumables ...... 18 2.1.3 Instruments ...... 19 2.1.4 Nucleic acids ...... 21 2.1.4.1 Plasmids ...... 21 2.1.4.2 Oligonucleotides ...... 23 2.1.5 Standards ...... 24 2.1.6 Peptides and pentamers ...... 24 2.1.7 Antibodies ...... 24 2.1.8 Enzymes ...... 26 2.1.9 Kits ...... 26 2.1.10 Buffers and media ...... 26 2.1.10.1 Buffers and media for molecular biological methods ...... 27

Table of contents

2.1.10.2 Buffers and media for protein biochemical methods ...... 28 2.1.10.3 Buffers and media for cytological methods ...... 29 2.1.10.4 Buffers and media for immunological methods ...... 30 2.1.11 Viruses ...... 31 2.1.12 Bacteria...... 31 2.1.13 Eukaryotic cell lines ...... 32 2.1.14 Animals ...... 32

2.2 Methods ...... 33 2.2.1 Molecular biological methods ...... 33 2.2.1.1 Isolation of plasmid DNA ...... 33 2.2.1.2 Determination of DNA concentrations ...... 33 2.2.1.3 Digestion of DNA with restriction endonucleases ...... 33 2.2.1.4 Agarose gel electrophoresis ...... 33 2.2.1.5 Gel extraction of DNA fragments ...... 34 2.2.1.6 Polymerase chain reaction ...... 34 2.2.1.7 Ligation of DNA fragments ...... 35 2.2.1.8 Heat-shock transformation of bacteria ...... 35 2.2.1.9 Electrical transformation of bacteria and homologous recombination ...... 35 2.2.1.10 RNA isolation from lung tissue or bronchoalveolar lavage fluid ...... 36 2.2.1.11 Quantitative reverse-transcription real-time PCR ...... 36 2.2.2 Protein biochemical methods ...... 37 2.2.2.1 SDS-polyacrylamide gel electrophoresis ...... 37 2.2.2.2 Western blot ...... 38 2.2.2.3 Determination of protein concentrations ...... 38 2.2.3 Cytological methods ...... 38 2.2.3.1 Cultivation of cell lines ...... 38 2.2.3.2 Transfection of cells ...... 39 2.2.3.3 Production and purification of recombinant adenoviruses ...... 39 2.2.3.4 Determination of the optical and infectious virus particle concentration ...... 40 2.2.3.5 Transduction of cells ...... 40 2.2.3.6 Promoter reporter assay ...... 41 2.2.4 Immunological methods ...... 41 2.2.4.1 Immunization of mice ...... 41 2.2.4.2 Collection of sera and PBMCs ...... 41 2.2.4.3 Bronchoalveolar lavage ...... 42 2.2.4.4 Isolation of immune cells from lung and spleen ...... 42 2.2.4.5 In vitro restimulation of lymphocytes and intracellular cytokine staining ...... 42 II

Table of contents

2.2.4.6 Pentamer staining ...... 43 2.2.4.7 Intravascular staining ...... 44 2.2.4.8 Surface staining of immune cells ...... 44 2.2.4.9 Influenza infections ...... 45 2.2.4.10 Depletion of CD8+ T cells and FTY720 treatment ...... 46 2.2.4.11 Lung function measurement ...... 46 2.2.4.12 Cytokine-specific ELISA and multiplex analysis ...... 47 2.2.4.13 Antigen-specific antibody ELISA ...... 47 2.2.4.14 FACS-based antibody analysis ...... 47 2.2.4.15 Microneutralization assay ...... 48

3 Results ...... 49

3.1 Production and characterization of rAd-IL-1β and rAd-IL-18 ...... 49 3.2 Titration of antigen-encoding vectors ...... 51 3.3 Evaluation of rAd-IL-1β and rAd-IL-18 as adjuvants...... 54 3.3.1 Systemic and mucosal antibody responses ...... 55 3.3.2 Functional T cell responses in spleen and lung ...... 58 3.3.3 Memory phenotype of mucosal T cells ...... 60 3.3.4 Vaccine efficacy against homologous IAV infections ...... 64 3.3.5 Vaccine efficacy against divergent IAV infections ...... 66 3.3.6 Heterosubtypic immunity in absence of circulating and mucosal T cells ...... 71 3.3.7 Local inflammation and cellular infiltration after immunization ...... 74 3.3.8 Immunizations with lower doses of rAd-IL-1β ...... 81 3.3.9 Impact of rAd-IL-1β on lung function ...... 86

4 Discussion ...... 88

5 Bibliography ...... 101

III

List of abbreviations

% per cent EDTA ethylenediaminetetraacetic °C degree Celsius acid α anti EEF2 eukaryotic elongation µ micro factor 2 Ω ohm ELISA enzyme-Linked Ab antibody immunosorbent assay ACK ammonium-chloride- et al and other (el alii) potassium F farad alv. alveolar FACS fluorescent-activated cell AP-1 activator protein 1 sorting APC allophycocyanin FCS fetal calf serum APS ammonium persulfate FITC fluorescein isothiocyanate ASC apoptosis-associated FSC forward scatter speck-like protein g gram containing a CARD g acceleration of gravity AUC area under the curve G tissue damping BAFF B cell activating factor of the H tissue elastance TNF family HA hemagglutinin BALF bronchoalveolar lavage fluid HBSS Hank’s balanced salt BCA bicinchoninic acid assay solution BFP blue fluorescent protein HEK human embryonic kidney bp base pairs HEPES 4-(2-hydroxyethyl)-1- BSA bovine serum albumin piperazineethanesulfonic CARD caspase recruitment domain acid CCL C-C-chemokine ligand HRP horseradish peroxidase CCR C-C chemokine receptor HSI heterosubtypic immunity CD cluster of differentiation i.n. intranasal cm centimeter i.p. intraperitoneal CMV cytomegalovirus i.v. intravenous CTL cytotoxic CD8+ IAV influenza A T lymphocyte IFN interferon CXCL C-X-C motif ligand Ig immunoglobulin CXCR C-X-C chemokine receptor IIV inactivated influenza Cy7 cyanine 7 vaccine Da dalton IL interleukin DC dendritic cell infl. inflammatory DMEM Dulbecco’s modified Eagle’s int. interstitial medium IPS1 interferon-beta promoter DMSO dimethyl sulfoxide stimulator 1 DNA deoxyribonucleic acid IRF interferon regulatory factor dNTP deoxyribonucleic ISRE interferon-sensitive triphosphate response element E. coli Escherichia coli k kilo ECL enhanced kb kilobases chemiluminescence KLRG1 killer cell lectin-like receptor subfamily G member 1 IV

List of abbreviations l liter pH1N1 pandemic H1N1 LAIV live-attenuated influenza PR8 A/Puerto Rico/8/1934 vaccine pro premature LAL limulus amebocyte lysate PRR pattern recognition receptor LB lysogeny broth QIV quadrivalent influenza

LD50 median lethal dose vaccine LRI lower respiratory tract qRT-PCR quantitative reverse- infection transcription real-time PCR M1 matrix protein 1 rAd recombinant adenovirus M2 matrix protein 2 RIG-I retinoic acid-inducible MDCK Madin-Darby canine kidney gene I MFI median fluorescence RLU relative light units

intensity RN airway resistence MHC major histocompatibility RNA ribonucleic acid complex RT reverse transcriptase min minutes RT room temperature MOI multiplicity of infection SDS sodium dodecyl sulfate mRNA messenger RNA sec seconds MyD88 myeloid differentiation SEM standard error of the mean primary response gene 88 ss single-stranded NA neuraminidase SSC side scatter NF-κB nuclear factor 'kappa-light- STAT3 signal transducer and chain-enhancer' of activated activator of transcription 3 B-cells TAE tris acetate EDTA NK natural killer TBE tris borate EDTA

NLRP3 NACHT, LRR and PYD TCID50 50 % tissue culture infective domains-containing dose + protein 3 TCM central memory CD8 T n nano cells + NP nucleoprotein TEFF effector CD8 T cells + NT neutralization titer TEM effector memory CD8 T OD optical density cells OLLAS E.coli OmpF linker and TEMED tetramethylethylenediamine mouse langerin fusion TGF transforming growth factor sequence TIV trivalent influenza vaccine PA polymerase acidic protein TLR Toll-like receptor PAGE polyacrylamide gel TNF tumor necrosis factor electrophoresis TPA tissue plasminogen PB1 polymerase basic protein 1 activator

PB2 polymerase basic protein 2 TRM tissue-resident memory PBMC peripheral blood CD8+ T cells mononuclear cell UBC ubiquitin C PBS phosphate-buffered saline URI upper respiratory tract PCR polymerase chain reaction infection PE phycoerythrin UV ultraviolet PEI polyethylenimine V volt PerCP peridinin chlorophyll VCAM1 vascular cell adhesion PFU plaque-forming unit molecule 1

List of figures

Figure 1.1: Schematic structure of influenza A...... 3 Figure 1.2: Genetic diversity of influenza A HA subtypes...... 4 Figure 1.3: Innate recognition of IAV in infected cells...... 6 Figure 1.4: Time course of primary and secondary IAV infections...... 8 Figure 3.1: Expression cassettes and Western blot analysis of adjuvant vectors...... 49 Figure 3.2: In vitro bioactivity of vector-encoded IL-1β and IL-18...... 50 Figure 3.3: Humoral responses after immunization with different vaccine doses...... 51 Figure 3.4: CD8+ T cell responses after immunization with different vaccine doses...... 52 Figure 3.5: Heterologous protection after intranasal immunization with different vaccine doses...... 53 Figure 3.6: Schedule for experimental treatments and analyses...... 54 Figure 3.7: Humoral responses against the homologous IAV in sera and BALF...... 55 Figure 3.8: Specificity and subclass distribution of homologous antibody responses...... 56 Figure 3.9: Neutralization of the homologous PR8 strain...... 56 Figure 3.10: Humoral responses against heterologous IAV...... 57 Figure 3.11: Gating strategy for intracellular cytokine staining...... 58 Figure 3.12: Functional T cell responses measured by intracellular cytokine staining...... 59 Figure 3.13: Phenotypic analysis of NP-specific T cell responses in the lung...... 62

Figure 3.14: Intravascular staining of lung TRM...... 63 Figure 3.15: Weight loss and virus replication upon homologous infection...... 65 Figure 3.16: Heterologous protection against pH1N1...... 66 Figure 3.17: Gating strategy for the analysis of immune cells in BALF...... 67 Figure 3.18: Infiltration of immune cells upon the heterologous infection with pH1N1...... 68 Figure 3.19: Long-term protection against pH1N1...... 68 Figure 3.20: Protection against pH1N1 after immunization with rAd-IL-1β but without antigen-encoding vectors...... 69 Figure 3.21: Heterosubtypic immunity against H3N2 and H7N7...... 71 Figure 3.22: Establishment of depletion strategies for the specific elimination of circulating and lung-resident CD8+ T cells...... 72 Figure 3.23: Heterosubtypic protection upon depletion of circulating and lung- resident CD8+ T cells...... 73 Figure 3.24: Transcriptional analysis of lung inflammation after immunization...... 75 Figure 3.25: Mucosal cytokines and chemokines after immunization...... 77 Figure 3.26: Gating strategy for the analysis of infiltrating immune cells after immunization...... 79

List of tables

Figure 3.27: Infiltration of immune cells into the lung after immunization...... 80 Figure 3.28: Phenotypic analysis of the early CD8+ T cell response...... 81 Figure 3.29: Humoral responses after immunization with different adjuvant doses...... 82 Figure 3.30: Functional T cell responses after immunization with different adjuvant doses...... 83 Figure 3.31: Phenotypic analysis of CD8+ T cell responses after immunization with different adjuvant doses...... 84 Figure 3.32: Protection against H3N2 after immunization with different adjuvant doses...... 85 Figure 3.33: Assessment of the lung function after immunization with different adjuvant doses...... 87

List of tables

Table 1: Amino acid identities among H1N1-derived vaccine components and heterologous influenza strains ...... 45 Table 2: Treatment scheme for depletion experiments...... 72

VII

Summary

Commonly used influenza vaccines induce strain-specific antibody responses against the highly variable surface proteins hemagglutinin (HA) and neuraminidase (NA). In consequence, these vaccines confer protection against the strains included in the immunization but not against divergent influenza viruses like pandemic ones. Therefore, the focus of current research is on developing universal influenza vaccines, which would provide a long-lasting and effective immunity against a broad range of influenza virus subtypes, including seasonal and novel strains. A moderate level of such broad immunity is observed after the clearance of a natural influenza A virus (IAV) infection. This immunity is most probably mediated by cross-reactive T cell responses directed against conserved virus proteins like the internal nucleoprotein (NP). In particular, cross-reactive T cells that persist in the lung mucosa are connected to an efficient protection against heterologous reinfections. The present study evaluated a vaccine strategy, which was aimed to imitate both the location and the inflammation of a natural infection. Recombinant adenoviral vectors (rAd) encoding the viral antigens HA and NP were used for intranasal immunizations of BALB/c mice. To induce an inflammation similar to an infection, rAd that encode the murine interleukin-(IL)-1β or IL-18 were included in the vaccine and their influence on the immunogenicity and efficacy was tested. The inclusion of rAd-IL-1β but not rAd-IL-18 enhanced the HA-specific humoral responses significantly, which resulted in a 32-fold increased neutralization titer compared to the immunization without an adjuvant. Antibody responses against the conserved NP were detected, but their quantity was not influenced by the inclusion of the adjuvants. Most likely by the elevated neutralization titer, rAd-IL-1β-treated mice displayed an improved, sterile protection against the homologous influenza strain, while the other immunized groups were not protected from an initial infection. In general, the antigen-encoding vectors were able to elicit cross-reactive T cell responses. However, rAd-IL-1β further enhanced these responses drastically with the strongest increase observed in the lung T cell compartment. The phenotypic analysis of these lung T cells revealed that the co-delivery of rAd-IL-1β

+ specifically increased the number of tissue-resident memory CD8 T cells (TRM). All vaccination strategies provided protection against divergent IAV strains, namely H1N1, H3N2 and H7N7 viruses. Most strikingly, animals that received rAd-IL-1β displayed a further reduction of weight loss, virus replication and tissue damage upon the infections. It is unlikely that the heterologous protection was mediated by humoral responses. First of all, because heterologous HA variants were not efficiently recognized and especially not neutralized by the vaccine-induced antibody response. Moreover, the quantity of antibodies

Summary directed against the conserved NP was not affected by rAd-IL-1β. Therefore, it was most probably the elevated T cell response in the lung, which contributed to the broad immunity. Mechanistic analyses revealed that several important checkpoints in the development of lung-resident memory T cells were initiated by the mucosal expression of IL-1β. In particular, the adjuvant increased the transcription of the endothelial adhesion molecules E- and P-selectin as well as the production of a broad range of chemokines and proinflammatory cytokines. This pronounced tissue activation allowed an efficient recruitment of several innate immune cell subsets, including CD103+ dendritic cells (DCs) that have an important role in the priming of committed TRM precursors. Accordingly, drastically increased numbers of killer cell lectin-like receptor subfamily G member 1 (KLRG1)-negative TRM precursors accumulated in the lung of rAd-IL-1β-treated mice. However, not only the priming in lymphoid tissues was improved, but also the local TRM phenotype imprinting in the lung was more efficient as indicated by the increased expression of the TRM marker CD103 and CD69. Upon the co-delivery of 109 particles rAd-IL-1β, mice displayed slight side effects. Therefore, the inclusion of lower adjuvant doses in the vaccine was evaluated and their impact on the lung function was assessed. Even a 100-fold reduced dose of the adjuvant was sufficient to improve the heterologous protection in the complete absence of obvious side effects. The lung function was not affected by the administration of up to 109 particles of rAd-IL-1β, indicating that the side effects did not arise from a pathological phenotype in the lungs. In conclusion, the present study demonstrates that rAd-IL-1β but not rAd-IL-18 is a potent adjuvant to increase both humoral and cellular immune responses. The elevated immunity provided by rAd-IL-1β translated into an improved protection against a broad range of IAV strains. Impressively, rAd-IL-1β revealed a hitherto unprecedented ability to specifically induce cross-reactive, lung-resident memory CD8+ T cells. Since these local T cells contribute to a rapid and effective clearance of airway infections, the results presented in this thesis may have important implications for the design of vaccines against respiratory viruses in the future.

Introduction

1 Introduction

1.1 Influenza A

Influenza viruses are the major cause of severe viral respiratory tract infections and lead to 250 000 - 500 000 deaths a year in seasonal epidemics1. Vaccination is the most effective prophylactic measure against an infection, but current immunization strategies provide only a narrow window of immunity against the strains that are included in the vaccine. The occurrence of unexpected novel strains remains a major public health threat. Therefore, a universal influenza vaccine, which would provide protection against a broad range of influenza viruses, is urgently needed.

1.1.1 Structure and variability

Influenza viruses belong to the Orthomyxoviridae family and consist of four genera: A, B, C and genus D, which was isolated recently2. Most human infections are caused by IAV. However, influenza B strains are also responsible for seasonal outbreaks. IAV form particles approximately 80 nm to 120 nm in diameter that are enveloped by a lipid bilayer derived from infected host cells. Three proteins are embedded in this bilayer: the two glycoproteins HA and neuraminidase as well as the proton channel matrix protein 2 (M2; Fig. 1.1). The inner virus shell consists of matrix protein 1 (M1) and shapes the nucleocapsid, which shelters the segmented single-stranded (-)-RNA genome. Each of the eight gene segments is bound to multiple NP proteins and forms together with the polymerase machinery separate ribonucleoprotein complexes3.

Figure 1.1: Schematic structure of influenza A. The viral particle is enveloped by a plasma membrane derived from infected host cells and displays the three surface proteins HA, NA and M2. The inner virus shell consists of M1 proteins and surrounds the segmented viral RNA genome. Each segment is located in a separate complex together with multiple NP proteins and the polymerase machinery, which includes the polymerase acidic protein (PA) as well as the polymerase basic proteins 1 and 2 (PB1, PB2). The illustration is derived from Horimoto and Kawaoka, 2005191.

Introduction

The IAV glycoproteins NA and HA are the most important targets for the humoral immunity. Especially neutralizing antibodies against HA are effective in preventing infections. Unfortunately, these surface proteins are highly variable. Until now, 18 HA and 11 NA subtypes have been described and determine the nomenclature of IAV strains. Recently, this classification has been complemented by the two bat-derived HA subtypes H17 and H184. In addition, HA subtypes are classified into two phylogenetic lineages (group 1 and 2, Fig. 1.2), each subdivided into several virus clades and subclades5–9.

Figure 1.2: Genetic diversity of influenza A HA subtypes. A phylogenetic tree analysis divides the 18 HA variants into group 1 and group 2 antigens. Bat-derived H17 and H18 (each marked with a star) cannot bind to canonical sialic acid receptors. The illustration is derived from Wu et al., 20144.

The high variability of the surface proteins is caused by two mechanisms, namely the antigenic drift and the antigenic shift. The antigenic drift is a result from the viral RNA polymerase, which lacks a proofreading activity. This leads to relatively high mutational rates of 10-5 to 10-6 substitutions per nucleotide per cell infection10. In combination with the short replication time and high viral titers during an infection, this mutational rate allows a rapid adaption to environmental factors and escape from existing immunity. Thus, the antigenic drift is the driving force behind continuous alterations within the surface proteins of seasonal IAV strains11,12. In contrast, the antigenic shift is the prerequisite for the introduction of pandemic strains into the human population. This mechanism is based on the segmented nature of the IAV genome. When animal reservoirs are infected with two or more IAV strains simultaneously, these gene segments can be rearranged and give rise to novel subtype combinations called reassortants13. Since only H3N2 and H1N1 strains currently circulate in humans, herd immunity exists solely against these two subtypes. If reassortants of other subtypes skip the species barrier and establish human-to-human transmission chains, these viruses can spread very efficiently and can cause pandemics with incalculable outcomes. A special case was the pandemic in 2009, in which a heavily reassorted swine-origin H1N1 strain was introduced into humans that had remarkable antigenic differences compared to the seasonal H1N1 viruses14. In light of the pandemic potential of reassortant strains, animal

Introduction reservoirs are continuously under surveillance to identify emerging subtypes as early as possible. Especially live poultry markets in Asia15 and migrating wild bird populations16 are continuously monitored. However, since 2009 a swine origin pandemic strain occurred, also other species than birds are in focus17,18.

1.1.2 Innate immune recognition

IAV infections show a marked seasonality in temperate climates, peaking on the Northern Hemisphere between November and March. Dry and cold weather conditions during these winter months are optimal for virus stability and transmission via aerosol or droplets19,20. Once inoculated, the HA of human IAV strains specifically binds to α-2,6-linked sialic acid on epithelial cells in the respiratory tract21. In these cells, virus replication peaks within 48 to 72 hours after the initial infection22. With increasing viral titers, respiratory immune cells like macrophages and DCs get also infected23. At this stage, several mechanisms allow the immune system to sense the infection and to initiate innate immune responses. These responses prevent further virus spread and concomitantly induce the adaptive immunity to eventually clear the infection. The innate recognition of an IAV infection by epithelial and immune cells relies on the activation of pattern recognition receptors (PRRs). Specifically, four receptors are involved in this process: Toll-like receptors 3 and 7 (TLR3/7), retinoic acid-inducible gene I (RIG-I) and NOD-like receptor family member NOD-, LRR- and pyrin domains-containing 3 (NLRP3; Fig. 1.3). The endosomal TLR3 recognizes an infection indirectly by the detection of double- stranded host RNA from phagocytosed apoptotic cells24. TLR7 senses virus-derived single- stranded RNA in endosomes but that does not rely on an infection of these cells25. Moreover, RIG-I recognizes viral nucleic acids in infected cells, in particular single-stranded 5’-triphosphate RNA species in the cytosol26. These three receptors have in common to stimulate the expression of proinflammatory cytokines via NF-κB (nuclear factor 'kappa-light- chain-enhancer' of activated B-cells) and type I interferons (type I IFNs) via interferon- regulatory factor 3 and 7 (IRF3/7)27. The resulting antiviral state promotes the expression of a plethora of interferon-stimulated genes and alters cellular processes to inhibit virus replication28. However, some studies suggest that these inflammatory responses can also enhance virus replication and lead to a higher mortality upon an IAV infection29,30. Interestingly, despite a role in generating B cell responses, the above mentioned receptors seem dispensable for the induction of T cell responses28,31,32.

Introduction

Figure 1.3: Innate recognition of IAV in infected cells. Multiple pattern recognition receptors allow the detection of an IAV infection. (i) TLR7 recognizes viral single-stranded RNA (ssRNA) in endosomes. (ii) Virus- derived single-stranded 5’-triphosphate RNA activates RIG-I in the cytoplasm. Both RIG-I and TLR7 activate respective adaptor molecules (myeloid differentiation primary response gene 88, MyD88; IFNβ promoter stimulator 1, IPS1), which in turn phosphorylate IRF3 and IRF7 leading to the transcription of type I IFNs. Moreover, both signaling pathways initiate NF-κB to induce the transcription of proinflammatory cytokines, including premature IL-1β (Pro-IL-1β) and premature IL-18 (Pro-IL-18). (iii) The proton channel activity of the M2 protein induces the formation of the NLRP3 inflammasome, which consists of the components NLRP3, ASC and pro-caspase 1. The activation of caspase-1 leads to the cleavage and secretion of biologically active IL-1β and IL-18. The illustration is derived from Pang and Iwasaki, 201133.

The NLRP3 inflammasome is a protein complex consisting of NLRP3, the adaptor protein ASC (apoptosis-associated speck-like protein containing a CARD) and pro- caspase 1. The formation of the NLRP3 inflammasome relies on the recognition of cellular stress. Various stimuli are documented, but upon an IAV infection, it is the M2 proton channel activity in the Golgi apparatus that alters the intracellular pH value and thereby activates NLRP334. The inflammasome formation initiates an autocatalytic cleavage of pro- caspase 1 into its active form, which subsequently cleaves premature IL-1β and IL-18 into its biologically active, mature variants. The initial expression of the premature cytokines is regulated separately by the above mentioned PRRs27. In contrast to these PRRs, the activation of NLRP3 and the concomitant secretion of mature IL-1β and IL-18 does not lead to an antiviral state35,36. However, two reports published by Ichinohe et al. demonstrated a pivotal role of the NLRP3 inflammasome in the initiation of adaptive T cell responses and virus clearance. Specifically, they observed decreased CD4+ and CD8+ T cell responses after

Introduction

IAV infections of mice deficient for ASC, caspase 1 or the IL-1 receptor, despite an unaltered virus replication compared to wildtype mice until day five post-infection34. In a follow-up study, these effects were traced back to IL-1β. In particular, it was shown that IL-1 receptor signaling in respiratory CD103+ DCs is required and sufficient to promote CD8+ T cell responses upon a sublethal IAV infection37.

1.1.3 Adaptive immune responses

The coordinated activation of PRRs and downstream effectors create a complex milieu of cytokines and chemokines. This milieu attracts several immune cell subsets, which in turn also contribute to this inflammatory environment. Within three to six hours after the infection, the first wave of cytokines is induced. It consists of type I and III IFNs, IL-1α/β and tumor necrosis factor α (TNFα). Within a day, IL-6 and the chemokines CXCL1, CXCL10, CCL2, CCL3, CCL5, CCL10 and CCL20 represent a second inflammatory wave. Most of these factors are produced by airway epithelia cells38,39. In response to IL-1β and TNFα, epithelial cells upregulate adhesion molecules, which act in concert with chemokines to mediate tissue infiltration of leucocytes via transendothelial migration40. Professional antigen-presenting cells are of great importance for the initiation of adaptive immune responses. Especially DCs combine efficient antigen-processing and -presentation with co-stimulatory signals to activate naïve T cells. Two main subsets of DCs reside in the lung and play sophisticated roles in cytokine production and antigen presentation. CD103+CD11b- DCs efficiently prime naïve T cells but are decent cytokine producers. Vice versa, activated CD103-CD11b+ DCs are major sources of cytokines but present antigens less efficiently37,41–43. After activation and maturation, which is directly influenced by inflammatory factors like IL-1β, these DCs leave the inflamed tissue via CCR7- and sphingosine-1-phosphate receptor 1-mediated egress. The gradients of respective ligands guide DCs toward the draining lymph nodes37,44,45. There, infected DCs as well as DCs capable of cross-presentation prime naïve CD8+ T cells via major histocompatibility complex (MHC)-I antigen presentation. CD4+ T cells recognize their cognate antigen on DCs via MHC-II presentation. A clonal expansion of antigen-specific T cell populations in lymphoid tissues can be observed within three to four days post-infection. It takes two more days until detectable numbers of IAV-specific T cells occur in the lung46,47. During the acute phase of the infection, most of the antigen-specific T cells display an effector phenotype (TEFF) with surface expression of the effector marker KLRG1 and the absence of the IL-7 receptor α

(CD127). These TEFF can enter nearly all tissues and are specialized in cytolytic activities and cytokine secretion48,49. In the case of IAV infections, infected epithelial cells are recognized by CD8+ T cells in a MHC-I-dependent manner and subsequently eliminated by lytic effector functions50,51. However, CD4+ T cells are also described to lyse infected cells 52. With the

Introduction help of these effector cells, otherwise healthy individuals clear a primary IAV infection within 7 – 10 days (Fig. 1.4)22. After the elimination of the virus, the specific T cell compartment contracts drastically, primarily because of the apoptosis of TEFF. Remaining T cells represent

- + effector memory T cells (TEM) positive for both KLRG1 and CD127 as well as KLRG1 CD127 central memory T cells (TCM). While TEM shuttle between lymphoid organs and peripheral tissues, TCM exclusively sample lymphoid organs. Both subsets can persist for several months through homeostatic self-renewal dependent on IL-7 and IL-15. However, at late stages of the memory response, TEM also vanish and the remaining systemic response

48,49 consists only of TCM . A relatively new finding is that T cell memory can also reside locally in the tissue without any circulation53. These tissue-resident memory T cells are discussed in detail in section 1.1.5. In addition to cytotoxic CD8+ T lymphocytes (CTL), B cells also contribute to the clearance of primary IAV infections in mice. In particular, the secretion of immunoglobulin (Ig) of the subclass M during the acute phase leads to the neutralization of free virions54. However, high-affinity class-switched IgG or mucosal IgA responses are not fully unfolded until weeks after the acute infection and therefore are more relevant for immune memory (Fig. 1.4)55.

Figure 1.4: Time course of primary and secondary IAV infections. Upon a primary infection, IAV replicates both in the upper and lower respiratory tract (upper/lower respiratory tract infection, URI/LRI). Viral titers peak around two to three days post-infection and correlate with disease symptoms like fever. CD8+ T cell responses begin to rise at a similar time point and start to eliminate the virus in the respiratory tract a few days later. T cell responses rapidly contract after virus clearance, but a memory population remains. In contrast, antibodies (Ab) in serum and mucosa reach their highest levels weeks after the acute infection and are sustained. Upon a secondary infection both an accelerated T cell response and sustained antibody responses can attenuate the infection. Consequently, replication is restricted to the upper respiratory tract and disease symptoms are reduced. The illustration is derived from Subbarao et al., 200656.

Introduction

1.1.4 Immune memory

Upon a reinfection with IAV, both the sustained production of antibodies as well as memory T cells can mediate protection. In an optimal setting, neutralizing antibodies specific to the surface protein HA bind to the virus, inhibit viral entry and thereby provide sterile protection. Specifically, mucosal IgA is in a prime position to neutralize infectious virus before it crosses anatomical barriers57. However, since HA is subjected to continuous antigenic changes, the humoral response can rarely prevent infections with divergent drift or shift strains. Antibodies directed against the other two exposed proteins NA and M2 are not able to prevent viral entry and at least NA shows an antigenic instability similar to HA. Nevertheless, these non-neutralizing antibodies can attenuate the infection by inhibiting the virus release and by mediating antibody-dependent cellular cytotoxicity58,59. In contrast to neutralizing antibodies, memory T cells are not restricted to proteins exposed on the surface. Instead, they show a substantial specificity for internal proteins like NP, M1 or the polymerase proteins, which are highly conserved among IAV strains60–62. As a result, these cross-reactive memory T cells are able to recognize infections with divergent IAV viruses and even provide immunity against different subtypes of IAV (heterosubtypic immunity, HSI). Despite the fact that an initial reinfection is not prevented, the relatively high number of circulating memory T cells provides an accelerated clonal expansion in draining lymph nodes. This expansion is mainly mediated by highly proliferative TCM, which give rise

49 to secondary TEFF . However, the localization of IAV-specific secondary TEFF in the airways

46 still takes four to five days (Fig. 1.4) . In contrast, TRM stably reside in lung tissue and can mediate immediate effector functions without previous expansion53. Therefore, it seems most likely that a combination of TRM responding immediately followed by the delayed arrival of secondary TEFF is required for an efficient HSI. The cellular immunity induced by a primary IAV infection is able to provide a moderate level of HSI. Viral titers drop two to three days earlier compared to a primary infection, which leads to a reduced morbidity and mortality as demonstrated extensively in mouse models46,53,63–66. Importantly, observational studies conducted during the swine flu pandemic in 2009 provided a unique chance to evaluate the role of cross-reactive T cells in human IAV infections. Since the pandemic virus was a novel strain, HA-specific antibody responses were almost absent at the population level. Therefore, a protection against this novel strain relied mostly on preexisting cross-reactive T cells. Interestingly, a study of 1,700 individuals conducted by Hayward et al. detected IAV-specific T cell responses at baseline in 43 % of the participants. The response was dominated by cross-reactive CD8+ T cells specific for NP. A subsequent follow up of the participants revealed that the preexistence of NP-specific CD8+ T cells at baseline correlated with the protection against symptomatic infections with the novel strain67. A second study came to similar conclusions and even

Introduction observed a direct correlation between the frequency of cross-reactive T cells and the disease severity68. Thus, these studies demonstrate that strong T cell responses mediate a broad protection even against pandemic IAV outbreaks.

1.1.5 Tissue-resident memory T cells

For a long time, the T cell memory was only observed from a systemic perspective, which unambiguously divided between lymph node-skipping TCM and peripheral tissue- sampling TEM. Corresponding to this dogma, all cells found in peripheral tissues were assigned to the latter compartment. However, a seminal study by Klonowski et al. demonstrated that joining the blood supply of two mice equilibrates T cells from both animals in the blood but not in all tissues69. These data showed for the first time that local, non- circulating memory T cell populations exist in several tissues. Later studies provided insight into the localization, phenotype and function of these populations leading to the current view of tissue-resident memory T cells. Tissue-residency is best described for CD8+ T cells, therefore this section will focus on this subset. Nevertheless, it should be noted that CD4+ counterparts exist but are much

53,70 less understood. Specialized TRM are found in most if not all tissues, including the lung , skin71–73, brain74 and intestines75,76. Depending on the location of their lodgment, different phenotypes of TRM are described. Particularly in the lung, the identification of TRM was difficult due to the high vascularization and thus presence of circulating T cells in this organ. However, a technique called intravascular staining makes it possible to identify non-vascular immune cells in murine tissues. As part of this technique, fluorophore-coupled antibodies specific for immune cell lineages are administered by an intravenous (i.v.) injection. Consequently, immune cell populations in the vascular system are stained, but tissue- resident cells are not reached by the antibody and remain unstained. In combination with ex vivo staining for different surface molecules, it was possible to determine specific phenotypic

70 signatures of TRM . At present, the most stringent phenotype of lung TRM is the simultaneous expression of the C-type lectin CD69 and αE integrin CD103, but TRM subsets negative for both markers also exist53,70,77–79.

Upon a secondary pathogen encounter, immediate effector functions of TRM close the gap between early innate immune responses and the delayed arrival of systemic memory T cells at the site of infection. These functions include the production of IFNγ, which induces an inflammatory state in the tissue and thereby attracts leucocytes from the circulation80.

81 Although TRM express granzyme B, it is unclear whether they can lyse infected cells .

Nevertheless, the protective capacity of TRM against respiratory infections in mice is

53,79 unquestioned . Importantly, investigations of TRM populations in human tissues have been carried out and so far their results suggest a great similarity between murine and human TRM.

Introduction

+ + According to these studies, CD103 CD69 TRM are found in the human alveolar epithelium and even show an enriched specificity for IAV but not for systemic pathogens. Impressively, the estimated number of T cells in the human lung parenchyma equals the total number of T cells in the human blood82–86. Moreover, when adult volunteers were experimentally infected with the respiratory syncytial virus, the presence of virus-specific CD103+CD69+ lung-resident memory T cells before the infection correlated with reduced disease symptoms

87 and virus replication . Thus, the function and phenotype of human TRM seem to be highly comparable to the murine counterpart. Recent studies have begun to elaborate the mechanistic requirements for the formation of tissue-resident memory T cells. Iborra et al. demonstrated that antigen cross- presentation by CD103+ DCs in the draining lymph nodes is essential for the priming of

88 - committed TRM precursors . These precursors are KLRG1 effector-type cells, while short- lived KLRG1+ cells do not have the potential to become tissue-resident73. At the steady state, several tissues are not accessible for immune cells, including the lung airways and the skin epithelium. Therefore, tissue entry of TRM precursors relies on inflammatory factors that promote transendothelial migration. As described earlier, the upregulation of adhesion molecules and the production of chemokines are crucial in this process (1.1.3). According to Mackay et al., the CXCR3 ligands CXCL9 and CXCL10 are essential for the recruitment of

73 TRM precursors into the skin epithelium . Others reported that the chemokine receptor CCR5 plays an important role in the lung infiltration of early memory CD8+ T cells89. After the transendothelial migration into the inflamed organ, tissue-derived signals determine the differentiation of precursor cells into TRM. First of all, T cell-receptor signaling in combination with inflammatory stimuli drives the upregulation of CD69 in these precursors. In particular, local antigen presentation by CD103+ DCs seems required in this process88,90. In turn, CD69 inhibits the expression of the egress receptor sphingosine 1-phosphate receptor 1 and

91,92 thereby prevents tissue exit of TRM precursors . Moreover, the local production of transforming growth factor β (TGFβ) induces the surface expression of CD103. This integrin binds to E-cadherin on epithelial cells and mediates adhesion to the local tissue93. Although

+ TRM populations that are negative for CD69 or CD103 exist, CD8 T cells deficient for these factors fail to become tissue-resident in the skin73. It has to be noted that the mechanism of

TRM maintenance is generally not well understood. Conventional T cell memory persists under homeostatic conditions dependent on IL-7 or IL-1549. However, studies have provided controversial viewpoints when discussing the role of these cytokines in the maintenance of tissue-resident memory T cells94–97.

Introduction

1.2 Influenza A vaccines

1.2.1 Current vaccination strategies

The first effective vaccines against influenza viruses were developed in 194598,99. These vaccines consisted of chemically inactivated viruses grown in embryonated chicken eggs. The vaccine-induced protection was dependent on neutralizing antibodies directed against HA. Very soon it became clear that the antigenic instability of the HA and the constant co-circulation of several IAV subtypes required a continuous adaption of the vaccine100. Therefore, bivalent vaccinations were introduced in order to match at least the two most dominant circulating IAV strains101. In addition, inactivated whole-virus vaccines were withdrawn and replaced with split and subunit vaccines in order to reduce reactogenicity102,103. These vaccines are called inactivated influenza vaccines (IIV). Despite minor modifications, the immunological principle and the related disadvantages of recent IIV have not changed since 1945. Every year, the World Health Organization evaluates the recent epidemiological situation in the Northern and Southern Hemisphere. Based on this evaluation, a combination of two IAV and one or two influenza B strains is selected to be included in the vaccine for the upcoming season (trivalent or quadrivalent influenza vaccine, TIV/QIV). Subsequently, the vaccine production process starts. It includes the optimization of viral growth in embryonated chicken eggs, bulk manufacturing, quality control, clinical trials (only in Europe), vaccine release, and finally vaccine distribution and administration. This production cycle normally starts six to nine months before vaccination campaigns begin103,104. Unfortunately, during the vaccine production process, the dominant IAV strains can change or mutate, which leads to vaccine mismatches. The protection provided by IIV relies solely on strain-specific antibody responses, while cross-reactive T cells are not induced62, Therefore, their effectiveness is strongly dependent on the precise match between the selected vaccine strains and the strains that are actually circulating in the population. For example, a mismatch between the H3N2 vaccine component and the then circulating H3N2 virus occurred in the 2014/2015 season and led to higher excess mortality rates especially among the elderly105,106. Similarly, due to the time-consuming vaccine adaption process, it was not possible to provide a strain- specific vaccine during the acute phase of the unexpected 2009 swine flu pandemic107. However, even if the seasonal vaccine matches the circulating IAV strains, its effectiveness usually does not exceed 75 %. Especially for elderly individuals, the most vulnerable age group, the effectiveness declines drastically compared to children or adults108,109. For this reason, recent developments have specifically targeted the immunogenicity in the elderly population, for example through high-dose and adjuvanted vaccine formulations. In addition, recombinant or cell culture-produced vaccines are available, which are independent of egg-

Introduction supply and can slightly speed up the production process107. Nevertheless, these technologies are still designed to elicit strain-specific antibody responses and thus are not able to protect against mismatched strains. In contrast to IIV, recently licensed live-attenuated influenza vaccines (LAIV) do not only elicit strain-specific humoral responses but also cross-reactive T cell responses against highly conserved internal proteins like NP62. These vaccines are based on replication- competent but cold-adapted IAV strains. After the intranasal spray administration, the vaccine viruses can replicate to some extent in the upper airways but do not lead to a disease phenotype. Compared to IIV, LAIV showed a superior vaccine efficacy against matched strains in young children and even induced an improved immunity against drifted IAV strains110. However, a meta-analysis of 34 randomized clinical trials demonstrated that LAIV increase the protection against heterologous IAV strains only moderately compared to IIV111. An evaluation of the 2015/2016 LAIV revealed a vaccine effectiveness of only 3 % against any IAV strain in young children compared to an effectiveness of 63 % by IIV. This indicates virtually no LAIV-induced protection at all. As a consequence, several national vaccination committees changed their recommendations about this vaccine112. Recent evidence suggests that a low replicative fitness of the H1N1 LAIV strains decreases the vaccine effectiveness. In particular, these attenuated strains seem to have a reduced binding to sialic acid receptors and therefore show a diminished replication in human alveolar cells113. Moreover, the use of LAIV is restricted to a specific target group, namely healthy individuals below the age of 18. The effectiveness in adults and the elderly is diminished, probably by preexisting immunity, which prevents LAIV replication114. Furthermore, pregnant women as well as chronically ill and immunocompromised individuals cannot be immunized with replication-competent viruses due to possible side effects. Taken together, recent IAV vaccines rely mostly on the induction of protective antibody responses and have to be reformulated almost annually. Although vaccinations with LAIV induce cross-reactive T cell responses, the protection against heterologous IAV strains is only moderately increased. Moreover, the restricted target group and its fluctuating effectiveness are major obstacles for a wide use of LAIV.

1.2.2 Universal influenza vaccine approaches

Recent vaccination strategies against IAV confer mostly strain-specific protection and leave vaccinated individuals vulnerable to divergent strains. Therefore, much scientific effort focuses on the development of a universal influenza vaccine. Such a vaccine should provide effective and long-lasting protection against a broad range of IAV, including both seasonal and novel strains. In general, two types of approaches are currently being studied. One class of vaccination strategies is aimed at eliciting antibodies against conserved regions of the

Introduction otherwise variable HA. The second class exploits vaccine platforms that induce strong cross- reactive T cell responses. The gold standard of vaccination remains the complete prevention of infections mediated by neutralizing antibodies. Such protection can be achieved with IIV, but the protective response is focused on the most variable part of the HA, the globular head region12,115. However, although rarely found in humans, some studies identified monoclonal antibodies able to neutralize all IAV strains, both group 1 and group 2 IAV, and even influenza B viruses116,117. Most of these broadly neutralizing antibodies are directed against the subdominant, membrane-proximal stalk region of HA. Therefore, one possible universal vaccine approach is to overcome the immunodominance of the HA head in order to induce a stem-directed response. In 2015, two groups published independent designs of so-called stem-only or headless HA antigens that were able to confer HSI in different animal models. However, the HSI was observed in absence of vaccine-induced broadly neutralizing antibodies, which indicates that secondary antibody effector functions may play a role in this protection118,119. Another approach to induce stem-directed responses is the sequential immunization with different HA subtype variants. This immunization sequence leads to repeated boost responses against the conserved stalk region, while the variable head regions always elicit primary responses. Through this technique, Krammer et al. were able to induce HSI against group 1 HA strains in mice and ferrets. However, cross-protection against group 2 viruses was not observed120,121. Although these promising approaches mediate HSI in animal models, an immunodominance is much more difficult to overcome in the presence of preexisting immunity and repeated contacts with circulating IAV strains. Moreover, such complex vaccination schedules are difficult to implement on population level. The second type of universal influenza vaccine approaches focuses on the induction of cross-reactive T cell responses. As described earlier, cellular responses do not confer sterile protection, but they lower the disease burden, virus replication and transmission. Several T cell-inducing vaccine platforms are under investigation and some even progressed toward clinical studies. One of the first alternative technologies exploited in animal models for that purpose were DNA immunizations. DNA plasmids encoding for conserved virus proteins induced HSI in mice and ferrets122–124. Despite these promising results, DNA vaccines lacked immunogenicity in humans at this time. Since then, several methods have been developed to increase the immunogenicity in humans. These include electroporation, gene gun or heterologous prime-boost regimens125,126. Viral vector vaccines generally provide an excellent immunogenicity and elicit strong T cell responses. The most advanced vector vaccine against IAV is a replication-deficient Modified Vaccinia Virus Ankara, which encodes the IAV proteins NP and M1. Clinical phase 1 and 2a studies showed its safety and efficacy in inducing cross-reactive T cell

Introduction responses127–130. However, one of these studies investigated the protection against an experimental H3N2 infection and demonstrated only a moderate vaccine-induced protection129. Specifically, nine out of 11 vaccinated individuals were protected from an infection, but even in 6 out of 11 control subjects virus replication and disease symptoms were absent. This indicates that the challenge dose was rather low and raises the question whether the vaccine would also show efficacy in infections with higher doses. Recombinant adenoviruses are another well described vector system. In animal models, vaccinations with replication-deficient vectors encoding NP, M1 or M2 resulted in HSI, which was mostly dependent on cross-reactive T cell responses131–134. The most studied rAd variant is based on the human serotype 5. In clinical trials, this viral vector was safe, well tolerated and showed high immunogenicity135. With regard to the high prevalence of preexisting immunity against this serotype136, chimpanzee serotype vectors were also exploited for IAV vaccinations. For example, a NP-encoding vaccine based on the chimpanzee serotype 7 induced similar immune responses and HSI as observed with a conventional human serotype 5 vector in mice137. This indicates that preexisting immunity can be circumvented by the use of non-human vector systems. Importantly, the intranasal application of viral vector vaccines seems to be more immunogenic and protective than systemic approaches. In a clinical trial, vaccinations with rAd via the intranasal route were superior in inducing serum antibody responses compared to a 1000-fold higher dose of the same vaccine administrated subcutaneously135. Unfortunately, the vaccine-induced T cell responses were not evaluated in this study. However, Price et al. showed in mice that the intranasal immunization with rAd-NP and rAd-M2 induces a more efficient T cell-mediated protection against heterologous IAV strains than a systemic vaccination route132. Both administration modes resulted in similar humoral responses in the serum, while only the intranasal vaccine induced local IgA. Nevertheless, virus-specific IgA was not essential for the HSI as demonstrated in IgA-deficient mice, indicating that the protection is T cell-mediated. Splenic T cell responses were higher in systemically immunized animals, but only the intranasal vaccine provided strong mucosal T cell responses. Considering the enhanced protection in animals that received the intranasal vaccine, these data demonstrate that the induction of mucosal T cells is a crucial requirement for an effective HSI. Thus, these findings fit well with the emerging role of lung- resident memory T cells, which provide a superior protection against infections with divergent influenza strains53,79.

Introduction

1.3 Aims of the study

Community-acquired influenza infections are capable to establish a moderate level of heterologous immunity by inducing cross-reactive T cell responses. Especially lung-resident T cells provide efficient immunity against heterologous reinfections. Recent studies suggest that the local antigen delivery and the mucosal inflammatory environment upon an infection are essential for the induction of such responses. Based on these findings, the current study was aimed at developing a universal IAV vaccine that mimics the immunological characteristics of a natural infection. Specifically, intranasal immunizations with adenoviral vectors encoding HA and NP were intended to stimulate local immune responses similar to a respiratory infection. Since NP is highly conserved among IAV, this component should induce cross-reactive T cells. Moreover, vectors encoding the cytokines IL-1β and IL-18 were included in the vaccine to mimic the inflammatory environment during an infection. Both cytokines are usually induced upon a natural IAV infection and have shown a non-redundant role in initiating adaptive immune responses. Therefore, one aim of this study was the evaluation of rAd-IL-1β and rAd-IL-18 in regard to their immunostimulatory effects. In the course of this project, adjuvant vectors were developed and their bioactivity was tested in vitro. In a mouse model, the vaccine-induced, mucosal inflammation and the concomitant initiation of innate and adaptive immune responses were investigated. Systemic and mucosal memory responses were characterized in depth. The induction of lung-resident memory T cells was of particular interest. The vaccine efficacy against the vaccine-matching strain but also against divergent IAV strains was evaluated through the experimental infections of animals. Moreover, different depletion strategies were used to determine the contribution of tissue-resident memory T cells to heterologous protection. In the end, this study should provide a detailed analysis of the adjuvant properties of rAd-IL-1β and rAd-IL-18 with regard of their suitability for a universal influenza vaccine approach.

Materials and methods

2 Materials and methods

2.1 Materials

2.1.1 Chemicals and reagents

0.9 % Sodium chloride SteriPharm 2-Propanol J. T. Baker ACK lysis buffer Lonza Acrylamide solution 30 % AppliChem Agar AppliChem Agarose Roth Ampicillin sodium salt AppliChem APS Roth Bovine serum albumin Sigma-Aldrich/PAA Bromphenol blue Fluka Calcium chloride J. T. Baker Crystal violet Sigma-Aldrich D(+)-Glucose AppliChem DMSO J. T. Baker dNTPs Amersham Biosciences Ethanol Sigma-Aldrich Ethidium bromide AppliChem FCS Gibco Fixable Viability Dye eFluor 780 eBioscience FTY720 Sigma-Aldrich Glycerol J. T. Baker Glycine Roth Heparin sodium salt AppliChem HEPES AppliChem Hydrogen peroxide 30 % J. T. Baker Isoflurane CP-Pharma Kanamycin sulfate AppliChem Ketamine CP-Pharma L-Glutamine Gibco Luminol sodium salt Sigma-Aldrich Methanol Sigma-Aldrich Monensin sodium salt Sigma-Aldrich

Materials and methods p-Coumaric acid Sigma-Aldrich Pancuronium Sigma-Aldrich Paraformaldehyde Riedel-de Haën Penicillin-Streptomycin Gibco Polyethylenimine Sigma-Aldrich Saponin Sigma-Aldrich SDS AppliChem Skimmed milk powder Heirler Sodium azide AppliChem Sodium carbonate J. T. Baker Sodium chloride J. T. Baker Sodium hydrogen carbonate J. T. Baker Sodium hydroxide J. T. Baker Sodium hypochlorite AppliChem SYBR Green Molecular Probes TAE 50x AppliChem TBE 5x AppliChem TEMED Merck Trizma base Sigma-Aldrich Trypsin Gibco Trypsin/EDTA Gibco Tryptone AppliChem Tween 20 AppliChem Water B. Braun Xylavet CP-Pharma Yeast extract AppliChem Yeast RNA Boehringer Mannheim GmbH β-Mercaptoethanol AppliChem

2.1.2 Consumables

Bacterial culture tubes, 13 ml Sarstedt Blotting paper Macherey & Nagel Catheter, 24G, 0.7 mm Jelco Cell culture flasks, 25/75/175 cm2 Greiner Bio One Cell scraper TPP Cell strainer, 70 µm BD Falcon/Greiner Bio One

Materials and methods

Electroporation cuvette Bio-Rad GentleMACS M tubes Miltenyi Biotec Hematocrit capillaries, 10 µl, Na-heparin Hirschmann Laborgeräte Multiwell plate, 6/24/48/96 wells Falcon, Nunc, Sarstedt, Greiner Bio One Nitrocellulose membrane, 0.45 µm GE Healthcare Pipette tips, 10/20/200/1000 µl Starlab Pipettes, 5/10/25 ml Greiner Bio One Pleated filters Macherey & Nagel QIAshredder Qiagen Reaction tubes, 0.2/1.5/2.0/15/20 ml Greiner Bio One Rotor-Gene Strip tubes, 0.1 ml LTF-Labortechnik Syringe filter units, 0.20/0.45 µm Sarstedt Syringes, 0.5/1/2/5/20/50 ml B. Brain, Terumo, BD Medical, Henry Schein

2.1.3 Instruments

Alphaimager HP ProteinSimple Analytical balance SBA31 Scaltec Autoclave 75S/135S H+P Labortechnik GmbH BioPhotometer Eppendorf Centrifuge 5415 Eppendorf Centrifuge 5417C Eppendorf Centrifuge 6K15 Sigma Centrifuge Allegra X-15A Beckman Coulter Centrifuge Avanti J-25 Beckman Coulter Centrifuge Rotina 420R Hettich Zentrifugen Coulter particle counter Z2 Beckman Coulter Cryosystem 6000 MVE Dissociator GentleMACS Miltenyi Biotec Electrophoresis system Mini-PROTEAN Bio-Rad Tetra Cell and Mini Trans-Blot Cell Electrophoresis system PerfectBlue PeqLab Electroporator Gene Pulser Xcell Bio-Rad Flow cytometer FACS Canto II BD Biosciences Freezer -20 °C Siemens, Bosch, Liebherr, AEG

Materials and methods

Freezer -86 °C Sanyo, Ewald Ice maker AF 100 Scotsman Incubator Aerotron Infors HT Incubator Hera cell 240 Heraeus Incubator HS 12 Heraeus Incubator Unitron Infors HT Luminometer Hamamatsu Photonics Magnetic stirrer RCT standard IKA Microplate luminometer Orion Berthold Detection Systems Microplate reader Sunrise Tecan Microplate washer Wellwash 4 MK2 Thermo Scientific Microscope TMS-F Nikon Microwave oven R-22A Sharp Mixer Centomat SII B. Braun Biotech international Mixer DRS 12 Neolab Mixer Polymax 1040 Heidolph Mixer REAX 2000 Heidolph Mixer Roller Drum Bellco Glass, Inc. Mixer UZUSIO VTX-3000L LMS Mixer Vortex Genie 2 Scientific Industries Mixer Vortex Genius 3 IKA Multiplex system Luminex 100/200 Luminex Corporation pH meter pH211 HANNA instruments Pipettor pipetus Hirschmann Laborgeräte Powersupply E835 Consort Powersupply PowerPack P25 Biometra Precision balance SPB63 Scaltec Real-time PCR cycler Rotor-Gene RG-3000 Corbett Research Refrigerator Siemens, Bosch Sterilizer T6420 Heraeus Thermocycler PTC-100 MJ Research Thermocycler PTC-200 MJ Research Thermomixer comfort Eppendorf Ultrasonic bath Merck Eurolab Variable volume pipettes Abimet, Eppendorf, Gilson, Thermo Scientific Waterbath Breda Scientific, GFL

Materials and methods

2.1.4 Nucleic acids

2.1.4.1 Plasmids pAdEasy-1: A backbone plasmid containing the adenovirus serotype 5 genome with deleted E1 and E3 regions. Adenoviral sequences (“arms”) allow homologous recombination with pShuttle plasmids and the production of recombinant adenoviral genomes138. pAd-IL-18: A pAdEasy-1 plasmid encoding the mature, murine IL-18 obtained after homologous recombination of pS-IL-18 and pAdEasy-1. A tissue plasminogen activator (TPA) leader sequence was added N-terminally to the transgene and an OLLAS (E. coli OmpF linker and mouse langerin fusion sequence) tag was fused C-terminally. pAd-IL-1β: A pAdEasy-1 plasmid encoding the mature, murine IL-1β obtained after homologous recombination of pS-IL-1β and pAdEasy-1. A TPA leader sequence was added N-terminally to the transgene and an OLLAS tag was fused C-terminally. pDsRed: A plasmid encoding the Discosoma sp. red fluorescent protein. The expression is driven by the cytomegalovirus (CMV) immediate early promoter. pHW-HAHK68: A pHW-2000 vector encoding for the HA of A/Hong Kong/1968/1. The expression is driven by the CMV immediate early promoter. pmTagBFP2-N1: A plasmid encoding the monomeric blue fluorescent protein (BFP). The expression is driven by the CMV immediate early promoter139. pRep-AP1-Luc: A promoter reporter plasmid, in which the reporter gene expression of P. pyralis luciferase is induced by the binding of the activator protein 1 to its specific binding site in the plasmid. pRep-ISRE-Luc: A promoter reporter plasmid, in which the reporter gene expression of P. pyralis luciferase is induced by the activation of the interferon-sensitive response element in the plasmid. pRep-NFKB-Luc: A promoter reporter plasmid, in which the reporter gene expression of P. pyralis luciferase is induced by the binding of NF-κB to its specific binding site in the plasmid.

Materials and methods pRep-p53-Luc: A promoter reporter plasmid, in which the reporter gene expression of P. pyralis luciferase is induced by the activation of the Tp53 promoter region. pRep-STAT3-Luc: A promoter reporter plasmid, in which the reporter gene expression of P. pyralis luciferase is induced by the activation of the Stat3 promoter region. pShuttle: A vector backbone that is used for the insertion of exogenous transgene sequences. It contains adenoviral sequences (“arms”) flanking the transgene insertion site that allow homologous recombination with pAdEasy-1 and the production of recombinant adenoviral genomes138. pS-IL-18: A pShuttle plasmid encoding for the mature variant of the murine IL-18. A TPA leader sequence was added N-terminally and an OLLAS tag was fused C-terminally. pS-IL-1β: A pShuttle plasmid encoding for the mature variant of the murine IL-1β. A TPA leader sequence was added N-terminally and an OLLAS tag was fused C-terminally. pTATA-IFNb-Luc: A promoter reporter plasmid based on pGL2-TATA-inr (Stratagene). The reporter gene expression of P. pyralis luciferase is regulated by the complete Ifnb-promoter region. pTATA-IRF3-Luc: A promoter reporter plasmid based on pGL2-TATA-inr (Stratagene). The reporter gene expression of P. pyralis luciferase is regulated by the Irf3-promoter region. pVax1: A vector specifically designed for the use in the development of DNA vaccines. It contains the cytomegalovirus (CMV) immediate early promoter and the bovine growth hormone polyadenylation signal (Invitrogen). pV-HAHH09: A pVax1 vector encoding for the HA of A/Hamburg/4/2009. The transgene sequence is codon-optimized and an OLLAS tag was added C-terminally. pV-HAHH09dOH: A vector similar to pV-HAHH09 but without OLLAS tag. pV-HAPR8: A pVax1 vector encoding for the HA of A/Puerto Rico/8/1934. The transgene sequence is codon-optimized and an OLLAS tag was added C-terminally. pV-HAPR8dOH: A vector similar to pV-HAPR8 but without OLLAS tag.

Materials and methods pV-IL-18: A pVax1 vector encoding for the mature variant of the murine IL-18. A TPA leader sequence was added N-terminally and an OLLAS tag was fused C-terminally. pV-IL-1β: A pVax1 vector encoding for the mature variant of the murine IL-1β. A TPA leader sequence was added N-terminally and an OLLAS tag was fused C-terminally. pV-NPPR8: A pVax1 vector encoding for the NP of A/Puerto Rico/8/1934. The transgene sequence is codon-optimized and an OLLAS tag was added C-terminally. pV-NPPR8dOH: A vector similar to pV-NPPR8 but without OLLAS tag.

2.1.4.2 Oligonucleotides

All oligonucleotides were purchased from Biomers and are represented in 5’ to 3’ orientation.

Cdh1 for CTGTCAATAGGGACACCGGG rev TGACCCTGATACGTGCTTGG

Eef2 for ATCGCTGAACGCATCAAGC rev TGCGCTGGAAGGTCTGGTA

Il1b for TGTAATGAAAGACGGCACACC rev TCTTCTTTGGGTATTGCTTGG

Il6 for GAAACCGCTATGAAGTTCCTCTCTG rev TGTTGGGAGTGGTATCCTCTGTGA

Influenza M2 for CTTCTAACCGAGGTCGAAACG rev AGGGCATTTTGGACAAAG/TCGTCTA

Sele for AGCCTGCCATGTGGTTGAAT rev CTTTGCATGATGGCGTCTCG

Selp for AGTGTGACGCTGTGCAATGT rev AGGTTGGCAGTGGTTCACTC

Materials and methods

Tgfb1 for CTCCCGTGGCTTCTAGTGC rev GCCTTAGTTTGGACAGGATCTG

Ubc for GCCCAGTGTTACCACCAAGA rev CCCATCACACCCAAGAACA

Vcam1 for AGCCTCCGGACTTTCGATCT rev TGTTTGTGCTCTCCTGGGTC

2.1.5 Standards

GeneRuler 100 bp and GeneRuler 1 kb Plus (Thermo Scientific) were used as size standards for agarose gel electrophoresis. Precision Plus Protein Dual Color Standard (Bio- Rad) served as size standard in SDS-PAGE.

2.1.6 Peptides and pentamers

HA518-526 MHC I IYSTVASSL Genescript

HA110-120 MHC II SFERFEIFPKE Genescript

NP147-155 MHC I TYQRTRALV Genescript

NP55-69 MHC II RLIQNSLTIERMVL Genescript

NP147-155 -APC MHC I TYQRTRALV ProImmune

2.1.7 Antibodies

Antibody Reactivity Clonality Conjugation Source α-CD103 Mouse 2E7 PE eBioscience α-CD107a Mouse eBio1D4B AlexaFluor488 eBioscience α-CD11b Mouse M1/70 APC-Cy7 BD Biosciences α-CD11c Mouse HL3 BV510 BD Biosciences α-CD11c Mouse HL3 V450 BD Biosciences α-CD127 Mouse A7R34 FITC eBioscience α-CD16/32 Mouse 93 - BD Biosciences α-CD19 Mouse 1D3 PE-Cy7 BD Biosciences α-CD24 Mouse M1/69 APC BD Biosciences

Materials and methods

α-CD28 Mouse 37.51 - BD Biosciences α-CD3 Mouse 145-2C11 - BD Biosciences α-CD3 Mouse 145-2C11 BV510 BD Biosciences α-CD4 Mouse GK1.5 AlexaFluor488 eBioscience α-CD4 Mouse RM4-5 PerCP-eFluor710 eBioscience α-CD45 Mouse 30-F11 FITC Biolegend α-CD45 Mouse 30-F11 PerCP-Cy5.5 BD Biosciences α-CD45 Mouse 30-F11 BV510 BD Biosciences α-CD45.2 Mouse 104 APC-Cy7 Biolegend α-CD49b Mouse DX5 APC-eFluor780 eBioscience α-CD49b Mouse DX5 PE eBioscience α-CD64 Mouse X54-5/7.1 PE Biolegend α-CD69 Mouse H1.2F3 PerCP-Cy5.5 BD Biosciences α-CD8 Mouse 2.43 - own department α-CD8 Mouse 53-6.7 APC BD Biosciences α-CD8 Mouse 53-6.7 Pacific Blue BD Biosciences α-F4/80 Mouse BM8 APC eBioscience α-Gr-1 Mouse RB6-8C5 AlexaFluor488 eBioscience α-I-A/I-E Mouse M5/114.15.2 PerCP-Cy5.5 Biolegend α-IFNγ Mouse XMG1.2 PE eBioscience α-Ig Mouse Polyclonal FITC BD Biosciences α-Ig Mouse Polyclonal HRP Dako α-Ig Rat Polyclonal HRP Dako α-IgA Mouse Polyclonal HRP Bethyl Laboratories α-IgG1 Mouse X56 APC BD Biosciences α-IgG1 Mouse X56 HRP BD Biosciences α-IgG2a Mouse R19-15 FITC BD Biosciences α-IgG2a Mouse R19-15 HRP BD Biosciences α-IL-2 Mouse JES6-5H4 APC BD Biosciences α-KLRG1 Mouse 2F1 PE-Cy7 eBioscience α-Ly6G Mouse 1A8 PE-Cy7 BD Biosciences α-OLLAS Mouse L2 - own department α-TNFα Mouse MP6-XT22 PE-Cy7 BD Biosciences

Materials and methods

2.1.8 Enzymes

Collagenase D Sigma-Aldrich DNase I AppliChem Expand-High-Fidelity DNA polymerase Roche Restriction endonucleases New England Biolabs

2.1.9 Kits

Method Kit Manufacturer DNA purification Nucleospin Gel and PCR Clean-up Macherey & Nagel DNA removal TURBO DNA-free Kit Ambion ELISA Mouse TGF-beta1 Platinum ELISA eBioscience Endotoxin quantification QCL-1000 Chromogenic LAL Lonza Ligation Ligation Kit Ver. 2.1 TaKaRa Luciferase assay Bright-Glo Luciferase Assay System Promega Multiplex Mouse Luminex Premixed R&D System Multi-Analyte Kit Plasmid isolation JETstar 2.0 Plasmid Purification Genomed MAXI Kit Plasmid isolation NucleoBond Xtra Maxi EF Macherey & Nagel Plasmid isolation RotiPrep Plasmid MINI Roth Protein quantification BCA Protein Assay Kit Pierce qRT-PCR QuantiTect Probe PCR Kit Qiagen RNA isolation RNeasy Mini Kit Qiagen RNA isolation NucleoSpin RNA Virus Macherey & Nagel Virus purification Vivapure AdenoPACK 20 Sartorius Western blot ChemiGlow West Alpha Innotech

2.1.10 Buffers and media

Buffers and media were usually prepared with demineralized water. If sterile solutions were needed, water purchased from B. Braun Melsungen AG was used. Dulbecco’s phosphate-buffered saline served as a basic buffer system in several buffers and media and is composed as follows:

Materials and methods

DPBS, 10x (Gibco) 26.7 mM KCl

14.7 mM KH2PO4 1.38 M NaCl

80.6 mM Na2HPO4 pH 7.4

2.1.10.1 Buffers and media for molecular biological methods

DNA loading buffer 4 M Urea 50 % w/v Sucrose 0.1 M EDTA tip of spatula Bromphenol blue

LB medium 5 g/l Yeast extract 10 g/l Tryptone 5 g/l NaCl pH 7.0

LB agar 1.5 % w/v Agar in LB medium

SOC medium (Invitrogen) 2 % w/v Tryptone 0.5 % w/v Yeast extract 10 mM NaCl 2.5 mM KCl

10 mM MgCl2

10 mM MgSO4 20 mM Glucose pH 7.0

TAE, 50x (AppliChem) 0.05 M EDTA 1 M Acetic acid 2 M Tris pH 8.5

Materials and methods

TBE, 5x (AppliChem) 0.445 M Boric acid 0.01 M EDTA 0.445 M Tris pH 8.5

2.1.10.2 Buffers and media for protein biochemical methods

SDS sample buffer 150 mM Tris 30 % v/v Glycerol 1.2 % w/v SDS 0.018 % w/v Bromphenol blue 15 % v/v β-Mercaptoethanol

Tris-glycine buffer 2.5 mM Trizma base 19 mM Glycine 0.1 % w/v SDS

Tris/HCl pH 6.8 0.5 M Trizma base pH 6.8 with HCl

Tris/HCl pH 8.8 2 M Trizma base pH 8.8 with HCl

Western blot washing buffer 0.1 % v/v Tween 20 in PBS

Western blot blocking buffer 5 % w/v Skimmed milk powder in Western blot washing buffer

Western blot transfer buffer 2 mM Trizma base 15.2 mM Glycine 20 % v/v Methanol

Materials and methods

2.1.10.3 Buffers and media for cytological methods

Adenovirus lysis buffer 0.1 % w/v SDS 10 mM Tris-HCl pH 7.4 1 mM EDTA

Adenovirus storage buffer 20 mM Tris/HCl pH 7.4 25 mM NaCl 2.5 % w/v Glycerol pH 8.0

Crystal violet stock solution 1 % w/v Crystal violet 20 % v/v Ethanol

Crystal violet working solution 13.3 % v/v Crystal violet stock solution 26.7 % v/v Methanol

Cell culture growth medium 10 % v/v FCS 1 % v/v Penicillin-Streptomycin in DMEM (Invitrogen)

Microneutralization medium 1 % v/v Penicillin-Streptomycin 0.6 % v/v BSA (35 %, PAA) 1.2 µl/ml Trypsin in DMEM

R10 lymphocyte medium 10 % v/v FCS 10 mM HEPES 2 mM L-Glutamine 1 % v/v Penicillin-Streptomycin 50 µM β-Mercaptoethanol in RPMI 1640 (Invitrogen)

PEI solution 1 mg/ml Polyethylenimine pH 7.0

Materials and methods

10x Trypsin-EDTA (Invitrogen) 147 mM NaCl 4.8 mM EDTA 5 g/ml Trypsin

2.1.10.4 Buffers and media for immunological methods

ACK lysis buffer 150 mM NH4Cl

10 mM KHCO3 0.01 mM EDTA

ELISA coating buffer 8.4 g/l NaHCO3

3.56 g/l Na2CO3

ELISA washing buffer 0.05 % v/v Tween 20 in PBS

ELISA blocking buffer 5 % w/v Skimmed milk powder in ELISA washing buffer

ELISA dilution buffer 2 % w/v Skimmed milk powder in ELISA washing buffer

ECL solution Solution A 0.1 M Tris/HCl pH 8.6 250 mg/l Luminol

Solution B 1.1 mg/ml p-Coumaric acid in DMSO

ECL working solution 1 % v/v Solution B

0.01 % v/v H2O2 in Solution A

FACS buffer 0.5 % w/v BSA

1 mM NaN3 in PBS

Materials and methods

Fixation buffer 4 % w/v Paraformaldehyde in PBS

HBSS (Gibco) 5.33 mM KCl

0.44 mM KH2PO4

4.17 mM NaHCO3 137.93 mM NaCl

0.34 mM Na2HPO4 5.55 mM D-Glucose

Heparin solution 250 U/ml Heparin in HBSS

Permeabilization buffer 1 % w/v Saponin in FACS buffer

2.1.11 Viruses

All influenza strains are mouse-adapted to induce a disease phenotype in mice.

Virus Strain Source Influenza A H1N1 A/Puerto Rico/8/1934 own department Influenza A pH1N1 A/Hamburg/4/2009 C. Ehrhardt Influenza A H3N2 A/Hong Kong/1/1968 R. Kochs Influenza A H7N7 A/Seal/Massachusetts/1/1980; SC35M M. Schwemmle Adenovirus 5 recombinant rAd-empty W. Bayer

2.1.12 Bacteria

Strain Genotype Manufacturer E. coli BJ5183 endA1 sbcBC recBC galK met thi-1 bioT Stratagene hsdR (Strr) E. coli DH5 alpha fhuA2 Δ(argF-lacZ)U169 phoA glnV44 New England Φ80 Δ(lacZ)M15 gyrA96 recA1 relA1 Biolabs endA1 thi-1 hsdR17

Materials and methods

E. coli DH10 beta Δ(ara-leu) 7697 araD139 fhuA ΔlacX74 New England galK16 galE15 e14- ϕ80dlacZΔM15 Biolabs recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 Δ(mrr-hsdRMS-mcrBC)

2.1.13 Eukaryotic cell lines

HEK 293A: A human embryonic kidney cell line transformed with the adenovirus serotype 5. The cells contain a stably integrated copy of the E1 gene that provides expression of E1A and E1B for the production of recombinant adenoviruses140.

HEK 293T: A human embryonic kidney cell line transformed with the adenovirus serotype 5 and expressing the large T antigen of the simian virus 40 (ATCC CRL-11268)141.

MDCK-II: Madin-Darby canine kidney cells express both human and avian sialic acid receptors and therefore are highly susceptible to a broad range of influenza viruses (ATCC CRL-2936).

2.1.14 Animals

Six to eight weeks old female BALB/cJRj mice were purchased from Janvier (Le Genest-Saint-Isle, France). Animals were housed in the S2 facility in individually ventilated cages. Mice had access to food and drinking water ad libitum. Studies were performed in accordance with German law and institutional guidelines. The project was approved by an external ethics committee authorized by the North Rhine-Westphalia State Office for Consumer Protection and Food Safety and performed under the project license AZ 84- 02.04.2013-.A371.

Materials and methods

2.2 Methods

2.2.1 Molecular biological methods

2.2.1.1 Isolation of plasmid DNA

DNA plasmids were isolated from bacterial suspensions according to the manufacturer’s instructions. Small scale isolations for analytic purposes were performed with the RotiPrep Plasmid MINI Kit (Roth). The JETstar 2.0 Plasmid Purification MAXI Kit (Genomed) was used for quantitative scale isolations. Endotoxin-free isolations of DNA plasmids were performed with the Xtra Maxi EF Kit (Macherey & Nagel).

2.2.1.2 Determination of DNA concentrations

The concentration of plasmid DNA in solution was determined by measurement of the optical density at 260 nm (OD260) with a BioPhotometer (Eppendorf). One OD260 value corresponds to a concentration of 50 µg/ml double-stranded DNA. The ratio of OD260/OD280 was measured to determine the DNA purity, which is optimal at a ratio between 1.8 and 2.0. Generally, DNA plasmid preparations were diluted to an optimal working concentration of 1.0 – 2.0 µg/µl.

2.2.1.3 Digestion of DNA with restriction endonucleases

Restriction endonucleases were used to generate insert fragments and plasmid backbones with complementary overhangs for subcloning and to verify the identity of isolated DNA plasmids. The restriction enzymes were purchased from New England Biolabs and used according to the manufacturer’s instructions.

2.2.1.4 Agarose gel electrophoresis

Agarose gel electrophoresis was used to separate DNA fragments after DNA restrictions (2.2.1.3) or polymerase chain reactions (2.2.1.6). To this end, agarose was solved in heated TAE or for the analysis of smaller fragments (<100 bp) in heated TAE to a final concentration of 0.8 % to 2.0 %. The solution was cooled down (~50 °C) and subsequently 1 µl/ml ethidium bromide was added. The solution was then poured into an electrophoresis chamber and the comb was inserted to form the pockets. After hardening, the comb was taken out and the electrophoresis chamber was filled with TAE or TBE. The samples were mixed with a sixth loading buffer and filled separately into the gel pockets. A size standard was also filled into one pocket to determine the size of the observed DNA

Materials and methods fragments. The electrophoresis was performed with a voltage of 140 V until the bromphenol blue dye reached the desired distance. Subsequently, the gel was analyzed under ultraviolet light at 306 nm on an AlphaImager (Protein Simple).

2.2.1.5 Gel extraction of DNA fragments

Preparative gels, which were intended for the extraction of specific DNA fragments, were exposed to low energy ultraviolet light at 365 nm. DNA fragments were excised and weighed before the gel extraction was performed with the Nucleospin gel extraction and PCR Clean-up Kit (Macherey & Nagel) according to the manufacturer’s instructions.

2.2.1.6 Polymerase chain reaction

This method was used to amplify specific gene sequences for subsequent cloning. In general, a polymerase chain reaction (PCR) consists of three consecutive steps, namely denaturation, primer annealing and elongation. During the denaturation at approximately 95 °C, the double-stranded DNA melts and thereby yields single-stranded molecules. The subsequent annealing step allows the binding of specific oligonucleotides (primer) to the complementary sequence on the sense and antisense DNA strands. This step is performed at a temperature between 55 °C and 65 °C, depending on the length and sequence of the complementary regions. During the elongation step, the bound primers are extended by a heat-stable DNA polymerase in the 5’ to 3’ direction complementary to the template strand. In consequence, each PCR cycle duplicates the number of double-stranded DNA molecules. The use of a high-fidelity polymerase with a proofreading activity decreases the error rate during the strand synthesis. PCRs were performed as follows:

PCR mix 1 µl template DNA (~100 ng) 5 µl PCR buffer (10x) 1 µl dNTPs (10 µM each) 5 µl sense primer (10 µM) 5 µl antisense primer (10 µM) 0.5 µl Expand-High-Fidelity DNA polymerase ad 50 µl water

Materials and methods

PCR program Step Temperature Time Initial denaturation 95 °C 2 min

Cycle 40x Denaturation 95 °C 45 sec Annealing 55 - 65 °C 45 sec Elongation 72 °C 1 min/1 kb

Final elongation 72 °C 10 min Storage 4 °C -

2.2.1.7 Ligation of DNA fragments

The TaKaRa ligation system Ver. 2.1 was used for the ligation of DNA fragments derived from endonuclease restrictions (2.2.1.3). 1 µl vector backbone, 4 µl insert and 5 µl TaKaRa ligation mix were combined and incubated for one hour at 16 °C.

2.2.1.8 Heat-shock transformation of bacteria

To amplify plasmids that were generated during the ligation, competent DH5 alpha bacteria were transformed by the heat shock method. To this end, bacteria were incubated with 2.5 µl of the ligation solution (2.2.1.7) for 15 min on ice. Subsequently, the mixture was heated on 42 °C for 45 sec before 200 µl SOC medium was added. To allow the expression of the antibiotic resistance gene, the bacteria were incubated for one hour at 37 °C under constant shaking. Afterwards, the solution was dispensed on LB agar plates, which contained the respective antibiotic, and incubated overnight at 37 °C. The next day, single bacterial colonies were isolated and cultivated in small scale suspension cultures.

2.2.1.9 Electrical transformation of bacteria and homologous recombination

Electrical transformation was used to insert pAdEasy-1 and a respective pShuttle plasmid into E. coli BJ5183 bacteria in order to obtain a recombinant adenoviral genome by homologous recombination. First of all, 50 µl bacteria were mixed with 0.15 µg pAdEasy-1 and 1 µg linearized pShuttle plasmid and incubated for 10 min on ice. Subsequently, the mix was filled into a cooled electroporation cuvette and subjected to an electrical pulse (2500 V, 25 µF, 200 Ω) on a Gene Pulser Xcell electroporator (Bio-Rad). The bacteria were then mixed with 300 µl SOC medium and incubated for 20 min at 37 °C under constant shaking. Afterwards, the solution was dispensed on LB agar plates, which contained the respective

Materials and methods antibiotic, and incubated overnight at 37 °C. The next day, single bacterial colonies were isolated and cultivated in small scale suspension cultures. If the desired plasmid was retrieved, it was transformed by the heat-shock method (2.2.1.8) into DH10 beta bacteria to avoid further recombination and to obtain greater yields of DNA.

2.2.1.10 RNA isolation from lung tissue or bronchoalveolar lavage fluid

The RNeasy Mini Kit (Qiagen) was used to isolate total RNA from single cell suspensions of the lung (2.2.4.4). One fifth of the total cell suspension was homogenized with a QIAshredder (Qiagen) and the RNA was isolated according to the manufacturer’s instructions. To eliminate contaminations with genomic DNA, the eluted RNA was further subjected to a DNase I treatment with the TURBO DNA-free Kit (Ambion) according to the manufacturer’s instructions. For the determination of virus replication in infected mice (2.2.4.3), viral RNA was isolated from bronchoalveolar lavage fluid (BALF). A cell-free sample volume of 150 µl was subjected to the RNA isolation with the NucleoSpin RNA Virus Kit (Macherey & Nagel) according the to manufacturer’s instructions.

2.2.1.11 Quantitative reverse-transcription real-time PCR

The quantitative reverse-transcription real-time PCR (qRT-PCR) was used determine the amount of viral RNA in BALF and to analyze the transcription of specific genes in isolated lung tissues. The basic principle of this method is a reverse transcription of the specific target RNA into copy DNA followed by a conventional PCR procedure (2.2.1.6). Since an intercalating dye (SYBR Green) is present in the reaction, the amount of double-stranded DNA can be measured after every PCR cycle. Consequently, the fluorescence signal increases proportionally to the amount of double-stranded DNA in the reaction. A specific threshold value for the fluorescence is defined and the cycle, in which the sample fluorescence exceeds this threshold, is in a direct relationship to the initial copy number of the target RNA in the sample. The inclusion of separate standards with known copy numbers allows the generation of a standard curve and the determination of the absolute copy number in the sample. qRT-PCR analyses were performed with the QuantiTect Probe PCR Kit (Qiagen) according to the manufacturer’s instructions. Instead of a probe, SYBR Green (Molecular Probes) was used as an intercalating dye for the quantification. Analyses were performed on a Rotor-Gene RG-3000 (Corbett Research) as follows:

Materials and methods qRT-PCR mix 5 µl RNA sample 10 µl RT buffer mix (2x) 0.2 µl RT polymerase mix 1 µl SYBR Green (1:500 v/v) 1 µl sense primer (10 µM) 1 µl antisense primer (10 µM) 1 µl yeast carrier RNA (500 ng) 0.8 µl water

qRT-PCR program Step Temperature Time Reverse transcription 50 °C 20 min Inactivation RT 95 °C 15 min

Cycle 40x Denaturation 95 °C 10 sec Annealing/elongation 61 °C 60 sec Fluorescence 1 72 °C 30 sec Fluorescence 2 variable 15 sec

Melt 50 °C – 99 °C

2.2.2 Protein biochemical methods

2.2.2.1 SDS-polyacrylamide gel electrophoresis

The SDS-polyacrylamide gel electrophoresis (SDS-PAGE) allows the separation of proteins on the basis of their size. It was used to confirm transgene expression after the transfection or transduction of cells. Upon the sample preparation with SDS sample buffer (contains SDS and β-mercaptoethanol), the secondary, tertiary and quaternary structures of the sample proteins are denatured and provided with a uniformly negative charge. Samples were mixed 1:1 with SDS sample buffer and incubated for 15 min at 95 °C. The separation was performed in a polyacrylamide gel consisting of a 4.2 % stacking gel in pH 6.8 Tris/HCl and a 12.5 % separation gel in pH 8.9 Tris/HCl. A size standard was included to determine the mass of the sample proteins. The electrophoresis was performed at a voltage of 150 V for 75 to 120 min in Tris-glycine buffer in a Mini-PROTEAN Tetra Cell system (Bio-Rad).

Materials and methods

2.2.2.2 Western blot

Western immunoblotting allows the transfer of separated proteins from a SDS-PAGE gel to a nitrocellulose membrane, on which target proteins can be visualized with suitable primary and detection antibodies. First of all, the SDS-PAGE stacking gel was released from the electrophoresis system and covered with a nitrocellulose membrane. The duo was further covered by a layer of Whatman paper followed by transfer puffer-wetted sponges on each side. The stack was fixed in a Western blot holder cassette, inserted in the electronic nodule and placed in the buffer chamber of the Mini Trans-Blot transfer cell system (Bio-Rad), which was filled with transfer buffer. The transfer was performed for one hour at a voltage of 100 V. Subsequently, the nitrocellulose membrane was retrieved and incubated for one hour in blocking buffer under constant shaking to block vacant binding sites. Afterwards, the membrane was washed five times with Western blot washing buffer before the primary antibody diluted in blocking buffer was added to the membrane for three hours or overnight. After the incubation, the membrane was washed as described before and incubated with the HRP-coupled detection antibody diluted in blocking buffer. After one hour incubation and another washing procedure, the membrane was wetted with ChemiGlow West chemiluminescence substrate (Protein simple) and analyzed on a luminometer (Hamamatsu Photonics).

2.2.2.3 Determination of protein concentrations

The protein concentration in cell-free BALF was measured with the BCA Protein Assay Kit (Pierce) according to the manufacturer’s instructions. The 96-well plate protocol was performed and the data were acquired on a Sunrise microplate reader (Tecan).

2.2.3 Cytological methods

2.2.3.1 Cultivation of cell lines

Cell culture was routinely carried out in 25 cm2, 75 cm2 and 175 cm2 cell culture flasks. All cell lines used in the current study were adherent cells grown in DMEM supplemented with 10 % FCS and 1 % penicillin/streptomycin. The cells were cultivated in a humidified atmosphere with 5 % CO2 at 37 °C and subcultured every two to three days. To this end, the medium was decanted, the cells were washed once with 10 ml PBS and incubated with 1 ml to 2 ml Trypsin/EDTA for 3 - 10 min at 37 °C. After detachment of the cells, growth medium was added to a final volume of 10 ml and the cells were resuspended by gentle pipetting. One third to one tenth of the suspension was transferred back into the flask and growth medium was added to a final volume of 5 - 20 ml before the cells were

Materials and methods further cultivated under the above mentioned conditions. For long-term storage, the cells were detached at a subconfluent state with EDTA/Trypsin as described above. After adding growth medium to inhibit further digestion, the cells were centrifuged for 6 min at 400x g and 4 °C. The cell pellet was then resuspended in cooled growth medium containing 10 % DMSO and the solution was subsequently distributed into 2 ml cryo tubes on ice. The tubes were slowly adapted to -80 °C in a cryo vessel before kept in a liquid nitrogen freezer. If required, a cryo tube was thawed, cells resuspended in 10 ml growth medium and centrifuged for 6 min at 400x g and 4 °C. The supernatant was discarded and the cells were resuspended in 10 ml growth medium to cultivate them in a 75 cm2 flask.

2.2.3.2 Transfection of cells

The chemical transfection of cells was performed with polyethylenimine (PEI). This chemical forms positively charged complexes with the DNA in solution, which bind to the cell membrane and are taken up by endocytosis. HEK 293T or 293A cells were seeded to reach 60 - 90 % confluence on the day of transfection. The respective amount of DNA was mixed with the same amount of PEI in 500 µl FCS-free DMEM and the mix was incubated for 15 min at room temperature (RT) to allow the complex formation. In the meantime, the medium of the cells was exchanged with fresh growth medium. After the incubation, the DNA solution was added to the cells and the flasks or plates were cultivated for 48 hours before further procedures were performed.

2.2.3.3 Production and purification of recombinant adenoviruses

Recombinant adenoviral particles were produced in HEK 293A cells, which provide the essential adenoviral proteins E1A and E1B in trans. To this end, 4 µg of the adenoviral genome obtained by homologous recombination (2.2.1.9) were linearized and transfected into HEK 293A cells, which were seeded in a 25 cm2 to reach a confluence of 50 % on the day of the transfection. Within ten to 14 days after the transfection, the cells showed signs of cytopathic effects and were harvested with the help of a cell scraper. Subsequently, the suspension was subjected to three freeze-thaw cycles in liquid nitrogen and a water bath at RT in order to lyse the cells. Afterwards, the suspension was centrifuged for 6 min at 400x g and 4 °C. A small volume of the supernatant was then used for the reinfection of fresh HEK 293A cells. The scale of the infection was increased stepwise by repeating this procedure until the desired volume of supernatant was yielded for a subsequent purification. The virus purification was performed with the Vivapure AdenoPACK 20 Kit (Sartorius) according to the manufacturer’s instructions. The virus preparations were stored in adenovirus storage buffer at -80 °C. The integrity of the expression cassettes was confirmed by PCR and the transgene

Materials and methods expression was detected by a Western blot analysis. Endotoxin levels were measured by QCL-1000 Chromogenic LAL assay according to the manufacturer’s instructions (Lonza; all preparations <0.0001 endotoxin units/immunization dose).

2.2.3.4 Determination of the optical and infectious virus particle concentration

The optical concentration of adenoviral particles in solution was determined by measuring the viral DNA. For that purpose, 5 µl of the virus preparation was diluted in 95 µl adenovirus lysis buffer. After an incubation of 5 min at RT, the absorbance at 260 nm was measured on a BioPhotometer (Eppendorf). The optical particle concentration was determined as follows: 푂퐷 × 20 표푝푡𝑖푐푎푙 푝푎푟푡𝑖푐푙푒푠 푝푒푟 푚푙 = 260 9.09 × 10−13

The infectious particle concentration was determined by the TCID50 (50 % tissue culture infective dose) method142. For that purpose, 2x104 HEK 293A cells per well were seeded in a 96-well plate and cultivated for 24 hours. Ten-fold serial dilutions of the virus solution were prepared and 100 µl of each dilution were added to ten wells, respectively. Ten to 14 days after the infection, the cells were analyzed under a light microscope in regard of cytopathic effects as a sign of infection. The proportion of infected wells was determined for each dilution and the TCID50 value was calculated as follows:

0.5−푑+푆 푇퐶퐼퐷50 푝푒푟 푚푙 = 10

푑 = 푙표푔10 표푓 푡ℎ푒 푠푡푎푟푡𝑖푛푔 푑𝑖푙푢푡𝑖표푛 푆 = 푠푢푚 표푓 푡ℎ푒 𝑖푛푓푒푐푡푒푑 푝푟표푝표푟푡𝑖표푛 표푓 푒푣푒푟푦 푑𝑖푙푢푡𝑖표푛

2.2.3.5 Transduction of cells

To confirm the transgene expression induced by the adenoviral vectors, HEK 293T cells were transduced with the respective construct. To this end, cells were seeded to reach 60 - 90 % confluence on the next day. Twenty-four hours later, the medium was discarded and exchanged with fresh growth medium containing the appropriate amount of virus. Transductions were usually performed at a multiplicity of infection (MOI) of ten. After two days of cultivation, the cell lysate or supernatant was harvested for a following SDS- PAGE (2.2.2.1) and Western blot analysis (2.2.2.2).

Materials and methods

2.2.3.6 Promoter reporter assay

To confirm the bioactivity of the vector-encoded adjuvants, promoter reporter assays were conducted. To this end, 2x104 HEK 293T cells were seeded in 100 µl growth medium in a flat-bottom 96-well plate. The next day, the cells of each well were transfected with a mix of 0.1 µg reporter plasmid and 0.1 µg PEI in 50 µl FCS-free DMEM. Twenty-four hours after the transfection, each well was infected with the respective adenoviral construct at a MOI of 10 by adding the virus in a volume of 50 µl growth medium. After two days cultivation, the supernatant was discarded, 100 µl Bright-Glo lysis buffer (Promega) was given in each well and the plate was incubated for 10 min at RT. Subsequently, 25 µl Bright-Glo luciferase substrate (Promega) was added to each well and the luciferase activity was measured three minutes later on an Orion microplate luminometer (Berthold Detection Systems).

2.2.4 Immunological methods

2.2.4.1 Immunization of mice

Animals were allowed to accustom to the new conditions for 2 - 3 weeks after the delivery. For adenoviral immunizations, BALB/c mice were treated intranasally with doses between 107 and 1010 optical particles of each antigen- or adjuvant-encoding vector. The vaccine components were given in a total volume of 50 µl sterile PBS per mouse. The administration was performed under anesthesia (100 mg/kg ketamine and 15 mg/kg xylazine, intraperitoneally, i.p.) by pipetting the solution slowly into one nostril.

2.2.4.2 Collection of sera and PBMCs

Blood samples were collected by puncturing the retro-orbital sinus with a 10 µl heparinized hematocrit capillary under light anesthesia with inhaled isoflurane. If cellular responses in PBMCs were analyzed, blood clotting was prevented by placing 2.5 units heparin in the collection tube. The blood samples were subsequently centrifuged for 5 min at 2600x g and RT. The serum was separated from the cell pellet and stored at -20 °C. For the isolation of PBMCs, the cells were subjected to an ammonium-chloride-potassium lysis with 5 ml ACK lysis buffer (Lonza) in order to destroy erythrocytes. After an incubation of 12 min at RT, the reaction was stopped by adding 10 ml HBSS and the suspension was centrifuged for 6 min at 400x g and 4 °C. The supernatant was discarded until not more than 500 µl remained in the tube and the cells were resuspended in this volume. The desired volume of the cell suspension was then filled in the cavities of a round-bottom 96-well plate. After adding 100 µl of FACS buffer and a subsequent centrifugation for 2.5 min at 2000x g and

Materials and methods

4 °C, the cells were subjected to in vitro restimulation and intracellular cytokine staining (2.2.4.5) or to FACS surface staining (2.2.4.8).

2.2.4.3 Bronchoalveolar lavage

Mice were euthanized with an overdose of inhaled isoflurane and the trachea was exposed and canulated with a catheter. Subsequently, the lungs were rinsed twice with 1 ml cold PBS and the obtained solution was centrifuged for 5 min at 2600x g and RT. The BALF was separated from the cellular fraction and stored at -20 °C for further analyses. The cellular fraction was resuspended in 400 µl FACS buffer and subjected to surface staining (2.2.4.8).

2.2.4.4 Isolation of immune cells from lung and spleen

Lymphocytes were isolated from lung and spleen tissues to investigate the vaccine- induced T cell responses or the immune cell infiltration (only for lung tissues). For this purpose, mice were sacrificed with an overdose of inhaled isoflurane and lungs as well as spleens were collected in 5 ml HBSS. Lung tissue was cut into small pieces and treated for 45 min at 37 °C with 500 units Collagenase D and 160 units DNase I in 2 ml R10 lymphocyte medium. The lung suspensions and the spleens were mashed through a 70 µm cell strainer using the plunger of a 5 ml syringe. The cell strainer was washed with 5 ml HBSS and the whole suspension was centrifuged for 6 min at 400x g and 4 °C. After discarding the supernatant, the cells were resuspended in 1 ml ACK lysis buffer (Lonza). After an incubation period of 7 min at RT, 9 ml HBSS were added and the suspension was centrifuged for 6 min at 400x g and 4 °C. Subsequently, the lung cells were resuspended 500 - 700 µl R10 lymphocyte medium, while the spleen lymphocytes were diluted with the appropriate volume of medium to obtain a concentration of 1x107 cells/ml. The suspensions were then subjected to in vitro restimulation (2.2.4.5) or FACS surface staining (2.2.4.6 and 2.2.4.8).

2.2.4.5 In vitro restimulation of lymphocytes and intracellular cytokine staining

To investigate the amplitude and functionality of antigen-specific T cell responses, PBMCs (2.2.4.2) or single cell suspensions from the lung or spleen (2.2.4.4) were restimulated with peptides derived from the vaccine antigens followed by intracellular cytokine staining. To this end, 106 spleen-derived lymphocytes or one fifth of the total PBMC/lung cell suspension were plated per well in a 96-well round-bottom plate. The cells were stimulated for six hours at 37 °C in 200 µl R10 lymphocyte medium in the presence of monensin (2 µM), α-CD28 (1 µg/ml) and α-CD107a-FITC (1 µl) with 5 µg/ml of the peptides

Materials and methods

HA110-120 (SFERFEIFPKE), HA518-526 (IYSTVASSL), NP55-69 (RLIQNSLTIERMVL) or NP147-155 (TYQRTRALV), respectively. Positive controls were stimulated with α-CD28 (1 µg/ml) and α-CD3 (2 µg/ml). Moreover, non-stimulated samples were included for later subtraction of unspecific background cytokine production. After the stimulation, the cells were centrifuged for 2.5 min at 2000x g and 4 °C and were washed with 180 µl FACS buffer. Subsequently, the cells were stained with α-CD8a-Pacific blue (1:300), α-CD4-PerCP (1:2000) and Fixable Viability Dye eFluor 780 (1:4000) diluted in FACS buffer for 20 min at 4 °C in the dark. After the incubation, 100 µl PBS were added and the cells were centrifuged for 2.5 min at 2000x g and 4 °C. The lymphocytes were washed once with 180 µl PBS and centrifuged for 2.5 min at 2000x g and 4 °C. Next, the cells were resuspended in 100 µl PBS and 100 µl fixation buffer were added in order to fixate the cells for 20 min at 4 °C in the dark. After centrifugation for 2.5 min at 2000x g and 4 °C, the cells were permeabilized by resuspending them in 150 µl permeabilization buffer with 0.5 µl α-CD16/32 to block unspecific binding of antibodies via Fc receptors. Following an incubation period of 10 min at 4 °C in the dark, the plate was centrifuged for 2.5 min at 2000x g and 4 °C. Subsequently, the cells were stained intracellularly with α-IL-2-APC, α-TNFα-PE-Cy7 and α-IFNy-PE diluted 1:300 in 100 µl permeabilization buffer. The staining was conducted for 30 min at 4 °C in the dark. Afterwards, 100 µl permeabilization buffer were added and the cells were centrifuged for 2.5 min at 2000x g and 4 °C. Next, they were washed twice with 180 µl permeabilization buffer and once with FACS buffer before they were resuspended in a volume between 100 µl and 150 µl FACS buffer. Data were acquired on a BD FACSCanto II and analyzed using FlowJo software (Tree Star Inc.).

2.2.4.6 Pentamer staining

Lymphocytes were isolated from lung tissues as described above (2.2.4.4) and 100 µl of the suspension were filled in the cavity of a round-bottom 96-well plate. FACS buffer was added to a final volume of 200 µl. The plate was centrifuged for 2.5 min at 2000x g and 4 °C before the cells were resuspended in a volume of 100 µl FACS buffer with 2.5 µl APC-

D labeled H-2K NP147-155 pentamer (ProImmune) for 20 min at 4 °C in the dark. After this incubation, 100 µl FACS buffer were added and the plate was centrifuged for 2.5 min at 2000x g and 4 °C. Subsequently, a second staining step followed with α-CD127-FITC (1:300), α-CD103-PE (1:300), α-CD69-PerCP (1:200), α-KLRG1-PE-Cy7 (1:300), α-CD8a- Pacific-Blue (1:300) and α-CD45.2-APC-Cy7 (1:300) in 100 µl FACS buffer for 20 min at 4 °C in the dark. Afterwards, the cells were centrifuged for 2.5 min at 2000x g and 4 °C and resuspended in 100 µl PBS. 100 µl fixation buffer were added and incubated for 20 min at 4 °C in the dark. After a final washing step with 180 µl FACS buffer, the cells were

Materials and methods resuspended in a volume between 100 µl and 150 µl FACS buffer. Data were acquired on a BD FACSCanto II and analyzed using FlowJo software (Tree Star Inc.).

2.2.4.7 Intravascular staining

Intravascular staining was performed to discriminate circulating and tissue-resident memory T cells. To this end, immunized mice received an i.v. injection of 300 µl PBS with 3 µg α-CD45-BV510 into the tail vein. Three minutes later, they were euthanized with an overdose of inhaled isoflurane. This incubation time allowed the binding of the administrated antibody to all immune cells in the blood circulation, while tissue-resident cells were protected from the staining. Subsequently, lungs were harvested, lymphocytes isolated and the pentamer staining performed as described above (2.2.4.6).

2.2.4.8 Surface staining of immune cells

To analyze the cellular infiltration upon an IAV infection, the cellular fraction of the bronchoalveolar lavage was subjected to a surface staining. The cells were obtained as described above (2.2.4.3) and one fourth (100 µl) of the suspension was distributed in a 96- well round-bottom plate. After adding 100 µl FACS buffer and subsequent centrifugation for 2.5 min at 2000x g and 4 °C, the cells were stained in a volume of 100 µl FACS buffer with α-Gr1-FITC (1:1000), α-CD49b-PE (1:500), α-CD45-PerCP (1:300), α-CD19-PE-Cy7 (1:1000), α-F4/80-APC (1:300), α-CD11b-APC-Cy7 (1:300), α-CD11c-Pacific-Blue (1:300) and α-CD3e-BV510 (1:200). After the incubation for 20 min at 4 °C in the dark, 100 µl PBS were added and the cells were centrifuged for 2.5 min at 2000x g and 4 °C. Afterwards, the cells were resuspended in 100 µl PBS, 100 µl fixation buffer were added and the plate incubated for 20 min at 4 °C in the dark. Finally, the cells were washed with 180 µl FACS buffer, centrifuged as before and resuspended in a volume between 100 µl and 250 µl FACS buffer. Data were acquired on a BD FACSCanto II and analyzed using FlowJo software (Tree Star Inc.). To investigate the infiltrating immune cells after the immunization, lymphocytes were isolated from lung tissues as described above (2.2.4.4). A volume of 100 µl of the respective cell suspension was subjected to each of the following two staining panels. The staining procedure was the same as described before in this paragraph. Panel I included the antibodies α-CD49b-PE (1:500), α-CD45-PerCP (1:300), α-CD19-PE-Cy7 (1:1000), α-CD11b-APC-Cy7 (1:300), α-CD11c-Pacific-Blue (1:300), α-CD3e-BV510 (1:200), α-CD4- FITC (1:300) and α-CD8a-APC (1:300). Panel II included the antibodies α-I-A/I-E-PerCP (1:300), α-Ly6G-PE-Cy7 (1:300), α-CD24-APC (1:300), α-CD11b-APC-Cy7 (1:300), α-Ly6C- Pacific-Blue (1:300), α-CD11c-BV510 (1:100), α-CD64-PE (1:100) and α-CD45-FITC (1:300).

Materials and methods

Moreover, in order to verify the depletion of circulatory T cells, 100 µl of the obtained PBMC suspension (2.2.4.2) were stained with α-CD45-PerCP (1:300), α-CD19-PE-Cy7 (1:1000), α-CD3e-BV510 (1:200), α-CD4-FITC (1:300) and α-CD8a-APC (1:300), using an identical staining procedure as described above in this section.

2.2.4.9 Influenza infections

To analyze the vaccine-induced protection, animals were infected with 104 plaque- forming units (PFU) of different mouse-adapted IAV strains (2.1.11). Table 1 illustrates the antigenic identities of HA and NP among these viruses. For the infection, mice were anesthetized (100 mg/kg ketamine and 15 mg/kg xylazine, i.p.) and the virus, which was diluted in 50 µl sterile PBS, was pipetted slowly into one nostril. The weight loss was monitored daily throughout the infection and was calculated as percentage of the initial weight before the challenge. Mice were euthanized if they had lost more than 25 % of their initial body weight and did not gain weight again within 48 hours. Mice that lost more than 30 % of their initial body weight were also euthanized with an overdose of inhaled isoflurane. In some experiments, animals were euthanized at the acute stage of the infection with an overdose of inhaled isoflurane and BALF were obtained as described above (2.2.4.3) to analyze tissue damage, virus replication and cellular infiltration. Tissue destruction was determined indirectly by detecting total protein in cell-free BALF (2.2.2.3). Virus replication was analyzed by qRT-PCR (2.2.1.11).

Table 1: Amino acid identities among H1N1-derived vaccine components and heterologous influenza strains

Virus strain Subtype Identity HA Identity NP A/Puerto Rico/8/1934 H1N1 A/Hamburg/4/2009 pH1N1 80.9 % 91.2 % A/Hong Kong/1/1968 H3N2 41.3 % 93.6 % A/Seal/Massachusetts/1/1980 H7N7 41.7 % 94.4 %

Amino acid sequences and respective alignments were retrieved from the Universal Protein Resource database (UniprotKB). UniProt identifiers for HA and NP proteins, respectively: H1N1 P03452 and P03466, pH1N1 C4RU35 and C4RU37, H3N2 Q91MA7 and P22435, H7N7 Q6LEJ4 and P26053. HA, hemagglutinin; NP, nucleoprotein; pH1N1, pandemic H1N1.

Materials and methods

2.2.4.10 Depletion of CD8+ T cells and FTY720 treatment

The depletion of local and systemic CD8+ T cells was performed to investigate the contribution of these subsets to the vaccine-induced protection. Systemic depletions with 200 µg CD8-depleting antibodies (clone 2.43) were conducted by i.v. injections into the tail vein three and one days before as well as three days after the influenza infection. If both systemic and lung-resident CD8+ T cells should be eliminated, the mice got in addition 100 µg of the depleting antibody intranasally. The intranasal treatment was conducted three and one days before the influenza infection in a volume of 50 µl sterile PBS under anesthesia with inhaled isoflurane. To inhibit the circulation of memory T cells, mice were treated i.p. with 1 mg/kg FTY720. The daily treatment began three days before and was maintained throughout the infection. The inhibition of circulating T cells was confirmed by a FACS analysis of PBMCs at the end of the infection (2.2.4.8).

2.2.4.11 Lung function measurement

To investigate whether the lung function is affected by the adjuvant treatments, a forced oscillation technique was performed three days after the immunization. Mice were anesthetized (125 mg/kg ketamine and 18.75 mg/kg xylazine, i.p.) and spontaneous breathing was prevented by the use of the muscle relaxant pancuronium (0.8 mg/kg, i.p.). The trachea was exposed, canulated and connected to a ventilation device (FlexiVent, SCIREQ). The airway and lung tissue reactivity was investigated by a forced oscillation technique. Specifically, the airway resistance (RN), tissue damping (G) and tissue elastance (H) were investigated at the baseline state and upon vaporization of increasing concentrations of methacholine (0, 6.125, 12.5, 25 mg/ml), which provokes bronchoconstriction. Within two minutes after the vaporization of each concentration, five Quick Prime 3 maneuvers were performed. Measurements were included in the analysis only if the coefficient of determination was above 0.90. The mean value for each parameter of the five measurements was calculated and is plotted against the administrated methacholine dose. Moreover, the area under the curve (AUC) of all administrated doses was calculated and represents the reactivity upon the complete methacholine challenge in one value per animal.

Materials and methods

2.2.4.12 Cytokine-specific ELISA and multiplex analysis

The Mouse TGF-beta1 Platinum ELISA Kit (eBioscience) was used according to the manufacturer's instructions for the measurement of latent TGFβ1 in cell-free BALF. The analysis was performed on a Sunrise microplate reader (Tecan). The concentrations of BAFF, CCL3, CCL5, CCL20, CCL21, CXCL1, CXCL10, CXCL12, IL-1β, IL-6, IL-17 and TNFα in cell-free BALF were determined with the help of a customized Mouse Luminex Screening Assay (R&D Systems). The data were acquired on a Luminex 100™ IS system (Luminex Corporation) according to the manufacturer’s instructions. Standard samples must result in a median fluorescence intensity at least two units above the background signal to be included in the 5-PL curve fitting. Consequently, the detection limit for each analyte was set to the concentration of the lowest standard fulfilling this criterion.

2.2.4.13 Antigen-specific antibody ELISA

96-well ELISA plates (Lumitrac, high binding, Greiner Bio-One) were coated with 5x105 PFU heat-inactivated (30 min, 56 °C) influenza particles per well diluted in 100 µl ELISA coating buffer overnight at 4 °C. Afterwards, the plate was washed three times with ELISA washing buffer before remaining binding sites were blocked with 200 µl ELISA blocking buffer for one hour at RT. Subsequently, the plate was washed three times with washing buffer and sera or BALF samples diluted in 100 µl dilution buffer were added to incubate for one hour at RT. After the incubation, the plate was washed three times and HRP-coupled α-mouse IgG1 (1:1000), α-mouse IgG2a (1:1000), α-mouse Ig (1:1000) or α- mouse IgA (1:5000) detection antibodies were added in 100 µl dilution buffer for one hour at RT. After washing the plate five times, 50 µl of the ECL substrate were added and the luminescence data were acquired on a microplate luminometer (Orion L, Titertek Berthold).

2.2.4.14 FACS-based antibody analysis

The flow cytometric analysis allows the detection of antibodies binding to cognate antigens in their natural conformation, which are presented on the surface or in the cytoplasm of HEK 293T cells. For that purpose, HEK 293T cells were seeded in a 75 cm2 flask to reach 60 - 90 % confluence the next day. Subsequently, the cells were transfected with 20 µg plasmid DNA encoding the antigen of interest (pV-NPPR8dOH, pV-HAPR8dOH, pV-HAHH09dOH or pHW-HAHK68) together with 5 µg plasmid DNA encoding a fluorescent protein (pDsRed or pmTagBFP2-N1). Two days after the transfection, the antigen-expressing cells were harvested with the help of a cell scraper and resuspended by gentle pipetting. The suspension was centrifuged for 6 min at 400x g and 4 °C. After resuspending in an adequate

Materials and methods volume of FACS buffer, 2x105 cells were put in each well of a 96-well round-bottom plate. The cells were centrifuged for 2.5 min at 2000x g and 4 °C and were subsequently washed once with 180 µl FACS buffer. Serum or BALF samples were diluted in FACS buffer or permeabilization buffer depending on the antibody specificity that was investigated. For the surface antigen HA, all procedures were performed in FACS buffer. Since NP is localized intracellularly, the procedures for this antigen were performed in permeabilization buffer. The cells were then resuspended with 100 µl of the sample dilution and incubated for 30 min at 4 °C. Thereafter, 100 µl of the respective buffer were added and the plate was centrifuged for 2.5 min at 2000x g and 4 °C. Subsequently, the cells were washed once with 180 µl FACS or permeabilization buffer and centrifuged for 2.5 min at 2000x g and 4 °C. Specifically bound antibodies were then detected with polyclonal α-mouse Ig-FITC, α-mouse IgG1-APC or α-mouse IgG2a-FITC diluted 1:300 in FACS buffer or permeabilization buffer. After 30 min incubation at 4 °C in the dark, the final wash steps were performed. HA-producing cells were washed twice with FACS PBS, while the NP-producing cells were washed two times with permeabilization buffer followed by one wash step with 180 µl FACS buffer. Finally, the cells were resuspended in 100 µl FACS buffer and measured on a BD FACSCanto II and analyzed using FlowJo software (Tree Star Inc.). The median FITC or APC fluorescence intensity of transfected cells (DsRed+ or BFP+) correlates in this analysis with the amount of antigen-specific antibodies in the sample.

2.2.4.15 Microneutralization assay

To determine the neutralizing antibody titers against different IAV strains, a microneutralization assay on MDCK-II cells was performed. First of all, 5x104 MDCK-II cells were seeded in a flat-bottom 96-well plate and cultivated for 24 hours. The next day, two-fold serial dilutions of serum or BALF samples in 100 µl microneutralization medium were incubated with 2000 PFU of the respective IAV strain per well in a round-bottom 96-well plate for 45 min at 37 °C. Afterwards, the medium of the prepared MDCK-II cells was discarded, the serum-virus mix was added and incubated for 90 min at 37 °C. Subsequently, 150 µl microneutralization medium was added to each well. After four days cultivation at 37 °C, the supernatant was discarded and 100 µl crystal violet working solution were put into each well. Ten minutes later, the plate was washed gently in a water bath and plaques in the otherwise confluent cell layer were identified. The highest reciprocal sample dilution, which completely inhibited an infection, was considered as the neutralization titer.

Results

3 Results

3.1 Production and characterization of rAd-IL-1β and rAd-IL-18

In the first part of this project, viral vectors for IL-1β and IL-18 were designed and the expression of the adjuvants as well as their bioactivity was analyzed. Briefly, the expression cassettes of mature IL-1β and IL-18 were excised from respective DNA plasmids and cloned into viral vector genomes according to the pAdEasy system138. The transfection of HEK 293A cells with the vector genomes resulted in the production of replication-deficient adenoviruses. In these viral vectors, the expression of the transgene is regulated by a CMV promoter and the inclusion of a polyadenylation signal improves mRNA stability (Fig. 3.1 A). Since mature IL-1β and IL-18 do not have a conventional secretion signal, the adjuvants were fused to the export signal of TPA in order to provide an efficient secretion. Moreover, the transgene sequences contain an OLLAS tag143 for a simplified detection in Western blots. The transduction of HEK 293A cells with rAd-IL-1β or rAd-IL-18 followed by a Western blot analysis confirmed that the viral vectors provide an expression of the respective adjuvant (Fig. 3.1 B and C). In this Western blot analysis, IL-1β showed a characteristic band at approximately 20 kDa, while the signals for IL-18 indicated a protein size slightly below 20 kDa. However, it is important to note that IL-1β showed a much stronger expression compared to IL-18.

Figure 3.1: Expression cassettes and Western blot analysis of adjuvant vectors. (A) The expression cassettes encode the mature variants of IL-1β and IL-18, both fused to a TPA export signal sequence and an OLLAS tag. Transgene expression is regulated by a CMV promoter and a polyadenylation signal (Poly(A)). (B and C) HEK 293A cells were transduced with adjuvant vectors at a MOI of 10 and were harvested 48 hours later. Untreated HEK 293A cells (control) served as control. Expression was verified by Western blot using α-OLLAS antibody followed by a HRP- conjugated detection antibody. kDa, kilodalton.

Results

Figure 3.2: In vitro bioactivity of vector-encoded IL-1β and IL-18. (A-G) HEK 293T cells were transfected with the respective promoter reporter plasmid and 24 hours later, they were transduced with rAd-IL-1β, rAd-IL-18 or rAd-empty at a MOI of 10. After another 24 hours, cells were lysed and luciferase substrate was added in order to quantify the luciferase reporter gene expression. Depicted are means + SEM of technical replicates (n=3) and statistical significances were analyzed by one-way ANOVA followed by Tukey’s post test; #, p<0.05 vs. empty. RLU/s, relative light units per second.

To confirm the bioactivity of the vector-encoded adjuvants, promoter reporter assays for several signaling pathways were conducted. In these assays, HEK 293T cells were transfected with reporter plasmids, which encode the reporter protein firefly luciferase under the transcriptional control of the promoter of interest. One day later, these cells were transduced with the rAd-IL-1β, rAd-IL-18 or a control vector (rAd-empty, vector without transgene insertion). After another 24 hours, the influence of the transgene expression on the respective signaling pathway was evaluated by measuring the luciferase activity. Compared to rAd-empty, both adjuvants stimulated the type I IFN axis, as indicated by the activation of the IFNβ promoter (Fig. 3.2 A). This promoter region contains several binding sites for transcription factors, including IRF3, activator protein 1 (AP-1) and NF-κB that are also involved in other inflammatory and cellular processes than type I IFN signaling. Indeed, rAd-IL-1β initiated the transcription of IRF3 and activated the binding element of AP-1, but the strongest activation was observed for the NF-κB pathway (Fig. 3.2 B-D). The activation of the respective promoters by rAd-IL-18 was less pronounced, but at least for AP-1 evident as a trend. However, also secondary signaling cascades were induced by both adjuvants as indicated by the initiation of the interferon-sensitive response element (ISRE; Fig. 3.2 E) and by trend of the signal transducer and activator of transcription 3 (STAT3; Fig. 3.2 F). Moreover, rAd-IL-1β induced the expression of the apoptosis-associated protein

Results p53 (Fig. 3.2 G). Taken together, these results indicate that the vector-encoded adjuvants are expressed and have the ability to activate proinflammatory pathways.

3.2 Titration of antigen-encoding vectors

For in vivo studies, Balb/c mice were treated intranasally with adenoviral vectors encoding full length HA and NP derived from the H1N1 strain A/Puerto Rico/8/1934, which is subsequently denoted PR8. The following experiment was conducted to determine a vaccine dose that provides protection from mortality upon a heterologous IAV infection, but prevents weight loss and virus replication only to a suboptimal extent. Such a suboptimal immunity would allow the evaluation of beneficial adjuvant effects in following experiments. For that purpose, animals were treated with doses ranging from 107 to 1010 particles of each antigen- encoding vector. Twenty-seven days after the immunization, antigen-specific humoral and cellular responses were analyzed in blood samples. Five weeks post-vaccination, the animals were infected with the pandemic H1N1 strain A/Hamburg/4/2009 (subsequently denoted pH1N1) to assess the heterologous protection.

Figure 3.3: Humoral responses after immunization with different vaccine doses. Blood samples were taken 27 days after the intranasal immunization with the indicated amounts of rAd-HA and rAd-NP. (A and B) A FACS- based antibody analysis was used for the detection of NP- (A) and HA-specific (B) antibodies in serum samples (1:100 dilution). (C) The neutralizing capacity of serum samples against the PR8 strain was analyzed by a microneutralization assay. The dashed line represents the detection limit (NT=5). Depicted are individual values with the group’s median. Statistical significances were analyzed by one-way ANOVA followed by Tukey’s post test (n=3; data were log-transformed before statistical analysis); #, p<0.05 vs. naïve. MFI, median fluorescence intensity; NT, neutralization titer.

Humoral responses against the PR8-derived (homologous) variants of NP or HA were investigated by a FACS-based antibody analysis that allows to determine the amount of antibodies against one specific antigen. A dose-dependent induction of NP-specific antibodies was observed in animals treated with 1010, 109 or 108 particles, while 107 particles did not elicit such responses (Fig. 3.3 A). In contrast, HA-directed antibodies were only detected in animals, which got the two highest vaccine doses (Fig. 3.3 B). The neutralization

Results of the homologous PR8 strain, which depends on an inhibition of the HA-mediated cell entry, correlated with the amount of HA-specific antibodies (Fig. 3.3 C). Specifically, a significant neutralization was induced by the 1010 or 109 dose, while only the serum of one animal that received 108 particles displayed virus neutralization. The lowest vaccine dose was generally unable to induce a detectable homologous neutralization. Moreover, none of the vaccinations elicited humoral responses that were able to neutralize the divergent pH1N1 (data not shown). Antigen-specific CTL responses in peripheral blood were investigated by stimulating isolated lymphocytes with peptides derived from HA or NP followed by staining for intracellular cytokines. NP-specific T cells positive for at least one marker as well as cells positive for all measured markers (polyfunctional) were detected in animals immunized with a dose of 1010, 109 or 108 particles (Fig. 3.4 A). Degranulation, as indicated by staining for CD107a, and the production of IFNγ were the most pronounced effector functions. While the 108 group showed by trend lower NP-specific CD8+ T cell responses compared to the two higher doses, a dose dependency between the latter ones was not observed. Moreover, statistically significant differences compared to naïve mice were not obtained in all of these groups, probably due to the small group size. Independent of the vaccine dose, HA-specific CD8+ T cells were less efficiently induced in peripheral blood (Fig. 3.4 B). Compared to naïve mice, low frequencies of T cells showed an activation and these trends are neither statistically significant nor stringent between the analyzed markers or vaccine doses.

Figure 3.4: CD8+ T cell responses after immunization with different vaccine doses. Twenty-seven days after the immunization with the indicated amounts of rAd-HA and rAd-NP, peripheral blood lymphocytes were restimulated with MHC-I-restricted peptides derived from NP (A) or HA (B). Afterwards, cells were stained for CD8 and CD107a on their surface and for IFNy, IL-2 and TNFα intracellularly. The frequency of CD8+ T cells expressing the respective marker or all markers (poly) is depicted as mean + SEM. Statistical significances were analyzed by one-way ANOVA followed by Tukey’s post test (n=3); #, p<0.05 vs. naïve.

Results

To evaluate the efficacy of the vaccinations, animals were infected intranasally with

4 10 PFU (~20-fold median lethal dose, LD50) of the divergent pH1N1 strain. Upon this infection, mice that were vaccinated with 107 or 108 particles lost 23.3 ±1.22 % and 22.0 ±1.77 % of their initial weight within eight days, respectively, and thereby experienced only slightly less weight loss than unvaccinated mice (25.5 ±2.57 %; Fig. 3.5 A). In sharp contrast, the immunization with the two highest doses prevented weight loss almost completely. The virus replication was determined by a qRT-PCR analysis of viral RNA in BALF, which were taken on day eight post-infection. In accordance with the weight curves, mice that received 107 or 108 particles of rAd-HA/NP showed a similar virus replication as observed in naïve animals, while vaccinations with 109 or 1010 particles led to a statistically significant reduction of the virus replication in a dose-dependent manner (Fig. 3.5 B). In conclusion, the NP-encoding vaccine vector seems to be more immunogenic than the HA component. The intranasal administration of 1010 or 109 particles of each vaccine vector induced immune responses that were sufficient to reduce weight loss and virus replication upon a heterologous infection. A dose of 108 particles induced to some extent NP-specific responses but was not sufficient to provide heterologous protection.

Figure 3.5: Heterologous protection after intranasal immunization with different vaccine doses. Thirty-five days after the immunization with the indicated amounts of rAd-HA and rAd-NP, mice were infected intranasally with 104 PFU pH1N1. (A) Weight loss was monitored daily and is expressed as percentage of the initial weight on day 0. (B) On day eight, mice were sacrificed and viral RNA was quantified in BALF by qRT-PCR. The dashed line represents the detection limit (3300 copies/ml). Depicted are means + SEM (A) or individual values with the group’s median (B). Statistical significances were analyzed by one-way ANOVA followed by Tukey’s post test (n=3; data of B were log-transformed before statistical analysis); #, p<0.05 vs. naïve.

Results

3.3 Evaluation of rAd-IL-1β and rAd-IL-18 as adjuvants

Based on the findings of the previous titration experiment, a dose of 2x108 adenoviral particles of each antigen-encoding vector was used for following experiments. This dose was expected to mediate survival upon heterologous infections but only with a suboptimal prevention of weight loss and virus replication. This suboptimal protection allows the investigation of potential adjuvant effects of rAd-IL-1β and rAd-IL18. Specifically, an adjuvant dose of 109 particles of either rAd-IL-1β or rAd-IL-18 was included in the vaccine. As a vaccinated control group without adjuvant treatment, mice were immunized with the antigen- encoding vectors and 109 particles rAd-empty to normalize the amount of adenoviral particles in all vaccinations. Humoral responses were investigated in serum samples of day 42 and in BALF obtained of days 56 after the immunization. Also on day 56, T cell responses were characterized in the spleen and lung in regard to the functionality and memory phenotype. Fifty-two days after the immunization, the vaccine efficacy was evaluated in experimental infections with several influenza strains (Fig. 3.6).

day 0 42 T cell assays BALF Ab 52 intranasal serum Ab weight loss immunization

IAV viral load infection tissue damage infiltration

Figure 3.6: Schedule for experimental treatments and analyses. On day 0, mice were immunized intranasally with adenoviral vectors, which encode HA and NP derived from the PR8 strain. A vaccine dose of 2x108 particles rAd-HA and rAd-NP was supplemented by 109 particles rAd-IL-1β, rAd-IL-18 or rAd-empty (n=8-12). Six weeks after the immunization, blood samples were obtained for the analysis of humoral responses in the serum. Four to six animals per group were sacrificed on day 56 to investigate T cell responses in spleen and lung. Moreover, BALF were obtained from these animals and were analyzed for mucosal antibody responses. The other animals were infected intranasally with different IAV strains. Weight loss was determined daily throughout the infections. Depending on the experiment, mice were sacrificed on different time points after infection and viral load, tissue damage and immune cell infiltration into the lung were investigated. Ab, antibodies.

Results

3.3.1 Systemic and mucosal antibody responses

The vaccine-induced antibody responses were analyzed in the serum six weeks and in the BALF eight weeks after the immunization. In ELISAs with whole-virus as coating antigen, all vaccinated animals mounted antibody responses against the homologous PR8 strain in serum samples (Fig. 3.7 A) and in BALF (Fig. 3.7 B). The inclusion of adjuvants did not significantly increase the amount of total antigen-specific antibodies in sera. However, in BALF, rAd-IL-1β-treated mice showed significantly higher antibody levels than the group HA/NP+empty. Only low amounts of systemic IgA were found in serum samples, while BALF contained high amounts of this mainly mucosally produced antibody subclass. Nevertheless, the adjuvants did not affect this humoral parameter.

Figure 3.7: Humoral responses against the homologous IAV in sera and BALF. Total Ig and IgA responses against the homologous vaccine strain PR8 were measured by whole-virus ELISAs. The antibody levels were investigated in serum samples of day 42 (A, 1:10 000 dilution) and in BALF of day 52 (B, 1:100 dilution). Depicted are medians + interquartile range. Statistical significances were analyzed by one-way ANOVA followed by Tukey’s post test (n=8-12 in A; n=7-10 in B; data were log-transformed before statistical analysis); #, p<0.05 vs. naïve; *, p<0.05 vs. HA/NP+empty.

Since whole-virus ELISAs do not allow a differentiation between HA- and NP-specific antibodies, a FACS-based analysis was used in order to determine the antigen specificity of the humoral response. In serum (Fig. 3.8 A) and BALF (Fig. 3.8 B), the amount of NP- specific antibodies was similar among all vaccinated groups. In contrast, HA-specific antibodies were in both body fluids significantly increased by the co-administration of rAd- IL-1β. Although HA-specific IgG1 and IgG2a were both elevated in this group (Fig. 3.8 D), the increase of the subclass IgG1 was much more pronounced. Similar to the HA-directed response, also NP-specific antibodies showed a slight increase of IgG1 in mice that were treated with rAd-IL-1β (Fig. 3.8 C). However, this increase was probably too weak to be visible in the analysis of NP-specific total Ig (Fig. 3.8 A). In general, the NP component of the vaccine elicited stronger antibody responses than the HA component. Therefore, it is possible that the elevated HA-specific response in rAd-IL-1β-treated mice was not observed in the whole virus ELISAs (Fig. 3.7 A) due to the higher contribution of NP-directed antibodies in this assay.

Results

Figure 3.8: Specificity and subclass distribution of homologous antibody responses. A FACS-based antibody analysis was used for the detection of antigen-specific antibodies in serum samples (A, C, D; 1:100 dilution) and in BALF (B, 1:20 dilution). HEK 293T cells producing either PR8-derived NP or HA were incubated with samples and specifically bound antibodies were detected with α-mouse Ig-FITC (A and B), α-mouse IgG1- APC (left figures of C and D) or α-mouse IgG2a-FITC (right figures of C and D). Depicted are medians + interquartile range. Statistical significances were analyzed by one-way ANOVA followed by Tukey’s post test (n=8-12 in A, C, D; n=7-10 in B; data were log-transformed before statistical analysis); #, p<0.05 vs. naïve; *, p<0.05 vs. HA/NP+empty.

In line with the increased amount of HA-directed antibodies in rAd-IL-1β-treated animals, the sera of these mice had a 32-fold increased capacity to neutralize the homologous PR8 strain compared to animals of the group HA/NP+empty (Fig. 3.9). Some animals of the groups HA/NP+empty and HA/NP+IL-18 showed no neutralization at all, while all rAd-IL-1β-treated mice exhibited at least a neutralization titer equal or greater than 20. Neutralizing activity of BALF was generally not detected.

Figure 3.9: Neutralization of the homologous PR8 strain. An in vitro microneutralization assay was used to determine the neutralizing capacity of serum samples against the PR8 strain. The dashed line represents the detection limit (NT=5). Depicted are individual values with the group’s median. Statistical significances were analyzed by one-way ANOVA followed by Tukey’s post test (n=8-12; data were log-transformed before statistical analysis); #, p<0.05 vs. naïve; *, p<0.05 vs. HA/NP+empty.

Results

To investigate the recognition of divergent IAV strains by the vaccine-induced antibody response, ELISAs were conducted with the pH1N1 or a H3N2 strain (A/Hong Kong/1/1968) as coating antigen. Compared to the naïve group, immunized animals demonstrated a cross-reactivity of the vaccine-induced antibody response to these heterologous strains (Fig. 3.10 A). However, the FACS-based analysis revealed only marginal amounts of antibodies, which recognized the pH1N1 HA, and no detectable binding to the H3N2 HA variant (Fig. 3.10 B). Interestingly, due to the elevated HA-specific response mediated by rAd-IL-1β, antibody binding to the few conserved epitopes in the pH1N1 HA was also increased in this group. Thus, these data indicate that it is mostly the antibody response against the conserved NP, which mediates the recognition of heterologous IAV in the whole- virus ELISAs. In line with that, the vaccine-induced antibody response was not able to neutralize these heterologous strains in vitro (data not shown). Taken together, rAd-IL-1β but not rAd-IL-18 increased the humoral responses against the HA variant that was included in the vaccine. However, similar to recent IAV vaccines, the HA-specific antibody response was not able to efficiently recognize divergent IAV. Although cross-reactive antibodies against the conserved NP were induced, these responses were only marginally influenced by the adjuvant treatment. Moreover, their protective role is currently a subject of controversy144,145.

Figure 3.10: Humoral responses against heterologous IAV. (A) Total Ig responses against heterologous pH1N1 and H3N2 were measured by whole-virus ELISAs. The antibody levels were investigated in serum samples of day 42 (1:100 dilution). (B) A FACS-based antibody analysis was used for the detection of antigen- specific antibodies in serum samples (1:20 dilution). HEK 293T cells producing HA derived from heterologous pH1N1 or H3N2 were incubated with samples and specifically bound antibodies were detected with α-mouse Ig- FITC. Sera of mice recovered from a sublethal pH1N1 or H3N2 infection were used as positive controls. Depicted are medians + interquartile range. Statistical significances were analyzed by one-way ANOVA followed by Tukey’s post test (n=4-12; data were log-transformed before statistical analysis); #, p<0.05 vs. naïve; *, p<0.05 vs. HA/NP+empty.

Results

3.3.2 Functional T cell responses in spleen and lung

In contrast to HA, internal IAV proteins like NP are highly conserved among IAV strains (Table 1). Therefore, cellular responses directed against these proteins are capable of mediating heterologous protection against divergent virus strains131. To investigate cellular responses, lymphocytes were obtained from spleen and lung tissue 56 days after the immunization. The cells were restimulated in vitro with immunodominant peptides derived from NP and HA. The staining for effector cytokines and a degranulation marker allowed the functional identification of antigen-specific T cells (Fig. 3.11).

Figure 3.11: Gating strategy for intracellular cytokine staining. After the selection of single cells (Singlets) and lymphocytes on the basis of the forward (FSC) and side scatter (SSC), dead cells were excluded with the help of live-dead-dye staining. Subsequently, CD4+ and CD8+ T cells were selected and their cytokine production as well as degranulation (indicated by CD107a staining, only in CD8+ T cells) allowed the identification of antigen- specific T cells within these populations.

Results

Figure 3.12: Functional T cell responses measured by intracellular cytokine staining. Mice were immunized as described before (Fig. 3.6) and 56 days later, lymphocytes were isolated from spleen and lung tissues. These cells were restimulated with MHC-I- and MCH-II-restricted peptides derived from NP (A) or HA (B). Surface staining identified CD8+ T cells, CD4+ T cells as well as degranulation via CD107a (only analyzed in CD8+ T cells). Production of IFNγ, IL-2 and TNFα was determined by intracellular staining. The frequencies of respective T cell populations positive for one or all markers (poly) are depicted as means + SEM. Statistical significances were analyzed by one-way ANOVA followed by Tukey’s post test (n=4-6); #, p<0.05 vs. naïve; *, p<0.05 vs. HA/NP+empty.

Results

All vaccination strategies induced T cell responses against the highly conserved NP (Fig. 3.12 A). However, compared to naïve mice, only moderate, non-significant CD4+ and CD8+ T cell responses were detected in the groups HA/NP+empty and HA/NP+IL-18. In sharp contrast, rAd-IL-1β greatly increased the formation of NP-specific T cells. Generally, the beneficial effects of rAd-IL-1β were more pronounced in the lung T cell compartment than in the spleen. For example, the co-administration of rAd-IL-1β induced a 14-fold increase of IFNγ-producing CD4+ T cells (0.14 ±0.03 % vs. 0.01 ±0.006 %) and a 5.5-fold increase of IFNγ-producing CD8+ T cells in the lung compared to HA/NP+empty (2.01 ±0.42 % vs. 0.36 ±0.09 %). Similar increases were observed for T cells producing TNFα and IL-2 in response to the stimulation with NP peptides and also for the degranulation of CD8+ T cells, as indicated by the staining for the exocytosis marker CD107a. A considerable frequency of these antigen-specific T cells even exerted all analyzed effector functions, which indicates a polyfunctional effector profile. In comparison to the NP-directed response, HA-specific responses were generally weaker in all vaccinated groups (Fig. 3.12 B). Nevertheless, the strongest responses were found in the group HA/NP+IL-1β and even reached statistical significance in some effector populations like IFNγ-producing CD4+ T cells (11.7-fold, 0.021 ±0.006 % vs. 0.0018 ±0.001 %) and CD8+ T cells (3.8-fold, 0.162 ±0.039 % vs. 0.043 ±0.006 %) in the lung compared to the group HA/NP+empty. In summary, rAd-IL-1β increased the functional T cell responses in the spleen and the lung, but the local responses in the lung were influenced much more than the systemic responses in the spleen.

3.3.3 Memory phenotype of mucosal T cells

The inclusion of rAd-IL-1β in the vaccine elevated the T cell responses in the lung specifically. Since such pronounced increases were not observed in the spleen, it was tempting to speculate that the adjuvant had induced tissue-resident memory T cells in the lung. In contrast to circulating memory T cell subsets, TRM stably persist in front line tissues like the skin or the lung. Upon secondary pathogen encounter, these cells provide immediate effector functions and also initiate the recruitment of circulating immune cells80. Importantly, compared to circulating memory T cells, TRM provide a superior protection against IAV infections and contribute to an effective heterologous immunity53,79. To get insight into the phenotypic occurrence of the vaccine-induced CTL response, lymphocytes were isolated from lung tissue and were subjected to a surface staining for several lineage and differentiation markers. First of all, the total CD8+ T cell population was investigated independent of their specificity (Fig. 3.13 A). Interestingly, both the absolute number as well as the frequency of lung CTL correlated with the magnitude of antigen- specific cells found in the functional analysis (Fig. 3.12 A). This indicates that the vaccine- induced immune response is already obvious by the total CTL numbers. Subsequently,

Results pentamer staining was used to identify CTL specific for the immunodominant peptide of NP (Fig. 3.13 B). Pentamer-stained CTL were found in all vaccinated mice, but the inclusion of rAd-IL-1β led to a 5.5-fold increase of these specific CTL compared to the group HA/NP+empty (1420 ±329 cells vs. 259 ±74 cells). Moreover, also the frequency of CTL, which were pentamer-positive, was elevated by the co-administration of rAd-IL-1β. Next, a gating strategy based on different phenotypic markers was used to determine the memory phenotype of the pentamer-stained cells. The gating strategy is shown in figure 3.13 C.

- Briefly, TEFF and TEM were identified based on the expression of CD127 and KLRG1. KLRG1

cells expressing CD103 or CD69 were further divided into potential TRM populations. Subsequently, remaining CD103-CD69- cells with an expression of CD127 were determined as TCM. The analysis of the conventional memory T cell phenotypes revealed that 56 days after the immunization mainly long-lived TCM remain in circulation, while the numbers of TEFF and TEM were substantially lower (Fig. 3.13 D). However, all these subsets were slightly increased in the lungs of rAd-IL-1β-treated mice and TEFF even showed a statistically significant elevation compared to the group HA/NP+empty. Different phenotypes of tissue- resident memory T cells are described, but expression of CD103 and CD69 appears to be the most stringent phenotype of lung TRM. The analysis of this memory compartment revealed that most of the pentamer-stained cells showed this distinct TRM phenotype (Fig. 3.13 E). The co-administration of rAd-IL-1β specifically increased the numbers of

+ + CD103 CD69 TRM compared to the group HA/NP+empty (8.8-fold, 1004 ±217 cells vs. 114 ±38 cells). In addition, CD103+CD69+ but not CD103-CD69+ CTL showed a moderate increase in rAd-IL-1β-treated mice. This indicates that the increased CTL response in the lung of rAd-IL-1β-treated mice mostly comprises of lung TRM.

Results

Figure 3.13: Phenotypic analysis of NP-specific T cell responses in the lung. Mice were immunized as described before (Fig. 3.6) and 56 days later, lymphocytes were isolated from lung tissues. (A) CD8+ T cells were identified by staining for CD45 as well as CD8 and are depicted in total numbers and frequencies relative to the + parental CD45 population. (B) Pentamer staining determined the absolute and relative numbers of NP147-155- specific CD8+ T cells. (C) Staining for the phenotypic markers CD127, KLRG1, CD69 and CD103 was used to identify different memory T cell populations as illustrated in the gating scheme. (D) Absolute numbers of circulating memory T cell subsets and (E) potential tissue-resident memory T cell subsets were determined in the pentamer-stained population. Depicted are means + SEM. Statistical significances were analyzed by one-way ANOVA followed by Tukey’s post test (n=4-6); #, p<0.05 vs. naïve; *, p<0.05 vs. HA/NP+empty.

Results

To clarify which of these phenotypes concretely represent lung TRM, an intravascular staining technique was used to differentiate between circulating and tissue-located T cells. For that purpose, animals got an i.v. injection of a fluorophore-coupled α-CD45 antibody and were sacrificed three minutes later. This incubation time allowed antibody-binding to all cells directly connected to blood vessels, while tissue-resident cells were protected from staining. Combined with the above mentioned phenotypic analysis, it was possible to determine, to which extent each subset was tissue-resident in the group HA/NP+IL-1β. As expected, CD103+CD69+ CTL were mostly protected from intravascular CD45 staining (Fig. 3.14). 98.4 ±0.35 % of these cells were protected and thus located within the lung tissue. Similarly, CD103-CD69+ CTL were also largely protected from staining (96.4 ±0.79 % unstained), whereas approximately one fourth of the CD103+CD69- CTL was located in blood vessels. Therefore, CD103+CD69+ and CD103-CD69+ but not CD103+CD69- CTL are reliable lung

TRM. Taken together, these results indicate that the co-administration of rAd-IL-1β not only increases systemic and mucosal T cell responses but also specifically induce CD103+CD69+ lung TRM.

Figure 3.14: Intravascular staining of lung TRM. Mice were immunized with rAd- HA, rAd-NP and rAd-IL-1β as described before (Fig. 3.6). Fifty-six days after the immunization, the animals received an intravenous injection of 3 µg α-CD45- BV510 and were sacrificed three minutes later. Lymphocytes were isolated from lung tissues and stained ex vivo as described above (Fig. 3.13). KLRG1- negative CD8+ T cells were gated into potential TRM subsets based on their expression of CD103 and CD69. The three subsets were then examined in regard to intravascular antibody binding. Depicted are representative plots of HA/NP+IL-1β- immunized mice. Frequencies are depicted as means + SEM (n=4).

Results

3.3.4 Vaccine efficacy against homologous IAV infections

Fifty-two days after the immunization, mice were infected intranasally with

4 10 PFU (~1000 LD50) PR8 in order to determine the vaccine efficacy against the homologous IAV strain. The weight loss was monitored daily and the virus replication was analyzed in BALF by qRT-PCR at two time points. For that purpose, four animals of each vaccinated group were sacrificed three and eight days post-infection, respectively. Naïve mice were sacrificed on day three (four animals), day six (one animal) and day seven (three animals), because the latter four animals reached the endpoint criteria before day eight. Naïve started to rapidly lose weight on day three and subsequently lost more than 25 % percent of their initial weight within six or seven days (Fig. 3.15 A). Great differences were observed in the weight curves within the groups HA/NP+empty (Fig. 3.15 B) and HA/NP+IL-18 (Fig. 3.15 D). From the four animals, which were sacrificed in each group at day eight, two and one mice, respectively, showed excessive weight loss, while the others displayed no disease progression. In accordance with the heterogeneous weight curves, these groups exhibited a very different extent of virus replication (Fig. 3.15 E). On day three post-infection, all sacrificed animals of the groups HA/NP+empty and HA/NP+IL-18 showed an initial replication but with a large intra-group variance ranging from 104 to 109 viral RNA copies/ml BALF. Some of these animals almost reached virus RNA levels similar to those in naïve mice. Interestingly, even animals without obvious weight loss on day three displayed an initial virus replication. On day eight, at least half of the remaining animals in these groups cleared the infection. In sharp contrast, rAd-IL-1β-treated mice showed no weight loss upon the infection and also virus replication was undetectable on day three and day eight (Fig. 3.15 C and E). Thus, the susceptibility against the homologous infection correlates with the vaccine-induced virus neutralization (Fig. 3.9). These data indicate that the inclusion of rAd-IL-1β in the vaccine even mediates neutralization titers strong enough to confer a sterile protection, which was not observed in other immunized animals.

Results

Figure 3.15: Weight loss and virus replication upon homologous infection. Mice were immunized as described before (Fig. 3.6). Fifty-two days later, the animals were infected intranasally with 104 PFU PR8. (A-D) Weight loss was monitored daily and is expressed as percentage of the initial weight on day 0. Each curve represents one animal of the respective group. Three and eight days post-infection, four mice per group were sacrificed and BALF were obtained. Due to excessive weight loss, naïve mice were sacrificed at day three and day six/seven (no BALF analysis of the animal sacrificed on day six). (E) Viral RNA was isolated from BALF and quantified by qRT-PCR. The dashed line represents the detection limit (3300 copies/ml). Depicted are individual curves (A-D) or individual values with the group’s median (E). Statistical significances were analyzed by one-way ANOVA followed by Tukey’s post test (n=3-4 per group per time point; data of E were log-transformed before statistical analysis); #, p<0.05 vs. naïve; *, p<0.05 vs. HA/NP+empty.

Results

3.3.5 Vaccine efficacy against divergent IAV infections

4 Next, the vaccine efficacy against an infection with 10 PFU (~20 LD50) of the heterologous pH1N1 strain was evaluated. Naïve mice displayed a substantial weight loss starting three days after the infection and subsequently lost 27.4 ±0.9 % of their initial weight within eight days (Fig. 3.16 A). In general, vaccinated animals lost less weight compared to naïve mice and even started to recover. However, the inclusion of rAd-IL-1β in the vaccine resulted in an improved heterologous protection. Specifically, these mice showed a maximal weight loss of 3.7 ±1.0 % on day four, while the groups HA/NP+empty and HA/NP+IL-18 lost 10.9 ±1.3 % and 12.9 ±1.4 % until day six, respectively. In consequence, rAd-IL-1β-treated mice started earlier to recover and reached almost their initial weight on day six, the time point at which the other immunized animals displayed the lowest weight. The qRT-PCR analysis of the virus replication confirmed these trends (Fig. 3.16 B). The vaccinations generally decreased the viral RNA in BALF compared to naïve animals, but the group HA/NP+IL-1β showed a further 13-fold reduction compared to the group HA/NP+empty (3.05x105 copies/ml vs. 4.04x106 copies/ml). Similarly, the amount of total protein in BALF, which was determined as a surrogate for tissue damage, showed a significant reduction upon the infection of immunized animals and was further reduced by trend in the rAd-IL-1β- treated group (Fig. 3.16 C).

Figure 3.16: Heterologous protection against pH1N1. Mice were immunized as described before (Fig. 3.6). Fifty-two days later, the animals were infected intranasally with 104 PFU pH1N1. (A) Weight loss was monitored daily and is expressed as percentage of the initial weight on day 0. Eight days post-infection mice were sacrificed and BALF were analyzed. (B) Viral RNA was quantified by qRT-PCR. The dashed line represents the detection limit (3300 copies/ml). (C) The amount of total protein was quantified by BCA. Depicted are means + SEM (A and C) or medians + interquartile range (B). Statistical significances were analyzed by one-way ANOVA followed by Tukey’s post test (n=4-6; data of B were log-transformed before statistical analysis); #, p<0.05 vs. naïve; *, p<0.05 vs. HA/NP+empty.

Results

Moreover, the cellular fraction was separated from the BALF and analyzed by multicolor flow cytometry in order to determine the infiltration of immune cells into the airways as a further measure of disease severity. The gating strategy is depicted in figure 3.17. In this analysis, vaccinated mice experienced a significantly reduced infiltration of neutrophils and natural killer cells compared to unvaccinated mice (Fig. 3.18). However, the inclusion of rAd-IL-1β in the vaccine reduced this infiltration further. Inflammatory monocytes were found in lungs of naïve animals and in the groups HA/NP+empty and HA/NP+IL-18 in comparable numbers, but in the group HA/NP+IL-1β this cell type was more than 13-fold decreased (8.10x103 cells vs. 1.08x105 cells in HA/NP+empty). In contrast to these inflammatory immune cell subsets, alveolar macrophages and B cells correlated inversely with the disease severity. Compared to the group HA/NP+empty, rAd-IL-1β-treated mice showed significantly elevated absolute numbers and increased relative contributions of these cells to the CD45+ influx. Especially the absence of alveolar macrophages usually coincides with uncontrolled virus replication in experimental IAV infections.

Figure 3.17: Gating strategy for the analysis of immune cells in BALF. The FACS plots illustrate the gating strategy applied to determine the different immune cell subsets. Solid arrows indicate positive gating, while dashed arrows indicate negative gating (exclusion of the marked population).

Results

Figure 3.18: Infiltration of immune cells upon the heterologous infection with pH1N1. Immunized animals were infected with pH1N1 as described in Fig. 3.16. On day eight post-infection, BALF were taken and the cellular fraction was investigated by multicolor flow cytometry. Total numbers (left) and relative contributions to the parental CD45+ population (right) are shown for the indicated subsets. Depicted are medians + interquartile range (left) or means + SEM (right). Statistical significances were analyzed by one-way ANOVA followed by Tukey’s post test (n=4-6); #, p<0.05 vs. naïve; *, p<0.05 vs. HA/NP+empty. infl., inflammatory; NK, natural killer; alv., alveolar.

To determine whether the heterologous protection is still evident in later phases of the memory response, mice were infected 100 days after the immunization under the same conditions as performed above (Fig. 3.16). Despite a slightly increased virus replication in all groups, the general trends in weight changes, virus replication, tissue damage and immune cell infiltration were highly similar to those observed upon the infection on day 52 after the immunization (Fig. 3.19). Thus, the vaccine-induced heterologous protection is evident for at least 100 days after the immunization.

Figure 3.19: Long-term protection against pH1N1.

Results

Figure 3.19 continued: Long-term protection against pH1N1. Mice were immunized as described before (Fig. 3.6). One-hundred days later, the animals were infected intranasally with 104 PFU pH1N1. (A) Weight loss was monitored daily and is expressed as percentage of the initial weight on day 0. Seven days post-infection, mice were sacrificed and BALF were analyzed. (B) Viral RNA was quantified by qRT-PCR. The dashed line represents the detection limit (3300 copies/ml). (C) The amount of total protein was quantified by BCA. (D) The cellular fraction was investigated via multicolor flow cytometry. Total numbers (left) and relative contributions to the parental CD45+ population (right) are shown for the indicated immune cell subsets. Depicted are means + SEM (A, C, D right) or medians + interquartile range (B, D left). Statistical significances were analyzed by one- way ANOVA followed by Tukey’s post test (n=4-6; data of B were log-transformed before statistical analysis); #, p<0.05 vs. naïve; *, p<0.05 vs. HA/NP+empty.

To show that the improved heterologous protection mediated by the inclusion of rAd- IL-1β relies on adaptive immune memory and not on unspecific alterations in the lung, intranasal immunizations with rAd-IL-1β but without antigen-encoding vectors were performed. Upon the infection with pH1N1, neither the weight loss (Fig. 3.20 A) nor the virus replication (Fig. 3.20 B) differed significantly between rAd-IL-1β-treated and naïve animals. Thus, the observed improvement of heterologous immunity is clearly dependent on antigen- specific immune responses. Taken together, the all vaccination strategies prevented mortality upon a heterologous infection with pH1N1, although an initial virus replication and a moderate weight loss was observed. Importantly, the disease was clearly attenuated if rAd- IL-1β was included in the vaccine as indicated by reduced weight loss, virus replication, tissue damage and cellular infiltration upon the infection. This improved protection requires antigen-specific responses and is not observed after the administration of rAd-IL-1β without antigen. Moreover, the vaccine-induced protection is durable for at least 100 days after the immunization.

Figure 3.20: Protection against pH1N1 after immunization with rAd-IL-1β but without antigen-encoding vectors. Fifty-two days after the immunization with 109 particles rAd-IL-1β but without the antigen-encoding vectors, mice were infected intranasally with 104 PFU pH1N1. (A) Weight loss was monitored daily and is expressed as percentage of the initial weight on day 0. Eight days post-infection, mice were sacrificed and BALF were analyzed. (B) Viral RNA was quantified by qRT-PCR. The dashed line represents the detection limit (3300 copies/ml). Depicted are means + SEM (A) or medians + interquartile range (B). No statistically significant differences were obtained by two-tailed Student’s t test (n=4; data of B were log-transformed before statistical analysis).

Results

In the previous experiments, rAd-IL-1β increased the heterologous protection against a divergent pH1N1 strain. It is likely that the improved protection resulted from the elevated T cell response in this group. However, since low amounts of cross-reactive antibodies able to bind the pH1N1 HA were induced upon the immunization (Fig. 3.10 B), a contribution of these antibodies to the protection cannot be excluded. To test whether the vaccine-induced immunity protects also against more divergent strains, animals were infected with 104 PFU of the heterosubtypic group 2 viruses H3N2 (A/Hong Kong/1/1968; ~10 LD50) and H7N7

(A/Seal/Massachusetts/1/1980, SC35M; ~40 LD50). The HA variants of these subtypes show a substantial antigenic distance compared to the HA variant included in the vaccine (Table 1). The FACS-based antibody analysis showed that the vaccine-induced antibody response does not cross-react with the HA derived from the H3N2 strain (Fig. 3.10 B). Therefore, HA-specific antibodies should not play a role in these heterosubtypic infections. The adenoviral vaccine clearly conferred HSI in both infection models. While all vaccinated mice survived the H7N7 infection (Fig. 3.21 B), one rAd-IL-18-treated animal was sacrificed due to the excessive weight loss upon the H3N2 infection (Fig. 3.21 A). Moreover, these experiments confirmed the adjuvant properties of rAd-IL-1β again, as indicated by a greatly reduced weight loss in this group. In the H3N2 model, these mice reached the maximum weight loss on day four with 8.2 ±1.1 % compared to the group HA/NP+empty, which displayed a maximum weight loss of 21.7 ±0.9 % on day seven. Subsequently, rAd- IL-1β-treated mice recovered rapidly and showed 99.8 ±1.0 % of their initial weight on day nine. In contrast, the group HA/NP+empty reached their initial weight not until day 23 post- infection. Interestingly, also rAd-IL-18-treated mice showed an improved protection compared to the control group as indicated by reduced weight loss upon the infection. However, one animal of this group succumbed to the infection. The beneficial effects of the co-administration of rAd-IL-1β were less pronounced upon the H7N7 infection, perhaps due to the higher LD50 used in this experiment. Nevertheless, compared to the other vaccinated animals, the group HA/NP+IL-1β showed less weight loss upon the acute phase of the infection. The most pronounced and only significant differences were observed on day five post-infection, when rAd-IL-1β-treated mice showed a weight loss of 9.4 ±1.0 %, while the group HA/NP+empty displayed a weight loss of 16.2 ±1.8 %. In conclusion, these experiments demonstrate that the vaccination strategy used in the present study is not only protective against heterologous viruses of the same subtype but also effective against heterosubtypic IAV strains. The protection does not rely on HA-specific antibodies and thereby is most likely mediated by vaccine-induced T cells. In line with that, animals that received rAd-IL-1β mounted greatly enhanced T cell responses (Fig. 3.12), which translated into a more efficient HSI.

Results

Figure 3.21: Heterosubtypic immunity against H3N2 and H7N7. Mice were immunized as described before (Fig. 3.6). Fifty-two days later, the animals were infected intranasally with 104 PFU H3N2 (A) or H7N7 (B). Weight loss was monitored daily and is expressed as percentage of the initial weight on day 0. One rAd-IL-18-treated animal was sacrificed due to excessive weight loss on day ten upon the H3N2 infection (as indicated by §). Statistical significances were analyzed by one-way ANOVA followed by Tukey’s post test (n=4-7); *, p<0.05 vs. HA/NP+empty.

3.3.6 Heterosubtypic immunity in absence of circulating and mucosal T cells

Since the co-administration of rAd-IL-1β specifically induced lung-resident memory T cells, it was of particular interest to determine the contribution of these cells to heterosubtypic protection. For that purpose, different strategies were used to deplete circulating and tissue-resident memory T cells. Specifically, the systemic administration (i.p.) of depleting antibodies against CD8 was used to eliminate systemic CTL in the circulation. The combined administration of depleting antibodies via systemic injection and intranasal inoculation was intended to deplete systemic CTL and lung TRM. In addition, a third depletion strategy relied on injections with FTY720 to inhibit the migration of systemic T cells. This chemical compound blocks to the sphingosine-1-phosphate receptor 1 and thereby inhibits the egress of T cells from lymphoid tissues. In a pilot study, each strategy was applied once to one animal and 24 hours later the depletion was evaluated. Intravascular staining was used to differentiate between systemic and tissue-resident CD8+ T cells in the lung (Fig. 3.22). As intended, the administration of the depleting α-CD8 antibody via the systemic route eliminated circulating CTL, but tissue-resident CTL were still detectable. However, compared to the untreated mouse, a slight relative reduction of TRM was evident, perhaps indicating that systemically applied antibodies also deplete local T cells. The combined systemic plus intranasal depletion (i.p./i.n.) eliminated both circulating CTL and TRM almost completely. In contrast, the FTY720 treatment did not reveal an absolute elimination of CD8+ T cells from the circulation, but there was a relative reduction of circulating CTL compared to

TRM.

Results

Figure 3.22: Establishment of depletion strategies for the specific elimination of circulating and lung-resident CD8+ T cells. Naïve mice received either 200 µg α-CD8 (i.p.), 200 µg α-CD8 (i.p.) plus 100 µg α-CD8 (i.n.), or 25 µg FTY720 (i.p.). An untreated mouse served as control. Twenty-four hours after the treatments, intravascular staining was performed by injecting 3 µg of α-CD45 (i.v.). The mice were sacrificed three minutes later, lungs were harvested and single cell suspensions stained for the lineage markers CD45.2 and CD8. The frequency of the respective population is shown for each quadrant. One mouse per treatment was used.

After the validation of the depletion strategies, the treatments were applied to mice that were vaccinated with rAd-HA/NP and rAd-IL-1β as performed before (Fig. 3.6). Intraperitoneal injections of depleting antibodies were done three and one days before as well as one day after the IAV infection. Intranasal depletions were only performed one and three days before the infection. FTY720 treatments were repeated daily, beginning three days before and continued throughout the infection (Table 2).

Table 2: Treatment scheme for depletion experiments.

Vaccination α-CD8 i.p. α-CD8 i.n. FTY720 HA/NP+IL-1β 200 µg 100 µg 25 µg days -3, -1, +3 days -3, -1 daily naïve no depletion X α-CD8 i.p. X X α-CD8 i.p./i.n. X X X FTY720 X X

4 The mice were challenged with 10 PFU (~10 LD50) H3N2 and weight loss was monitored thereafter. Interestingly, all vaccinated groups showed similar weight curves until day five post-infection and lost approximately 10 % of their initial weight (Fig. 3.23 A). The systemically depleted group (α-CD8 i.p.) lost weight for another day, while the other immunized groups started to regain weight. Although, the systemically depleted group started to gain weight only one day later, these animals on average showed a slightly

Results delayed recovery until the end of the experiment. In accordance with the weight curves, all immunized animals experienced a reduced virus replication in BALF compared to naïve mice (Fig. 3.23 B). The systemically depleted group showed the highest disease burden, whereas the other depleted groups displayed a comparable virus replication as non-depleted animals. Similarly, the determination of total protein in BALF as an indicator for tissue damage, showed the same trends as observed for the viral RNA (Fig. 3.23 C). Unexpectedly, animals that were depleted of both circulating and local CD8+ T cells (α-CD8 i.p./i.n.) showed generally no significant differences in weight loss, virus replication or tissue damage compared to immunized but non-depleted mice. Moreover, also the FTY720-treated group showed a similar protection compared to non-depleted mice. The analysis of peripheral blood cells eight days post-infection in these mice demonstrated that the FTY720 treatment greatly reduced circulating T cells but also affected the CD19+ B cell compartment (Fig. 3.23 D). Therefore, these results demonstrate that circulatory T cells are not required for the heterosubtypic protection. However, the local depletion of CD8+ T cells did also not alter the

+ protection, questioning either the protective efficacy of CD8 TRM in HSI or the efficiency of the local depletion strategy during the infection. Unfortunately, the actual absence of local and systemic CTL upon the infection in antibody-depleted animals was not investigated.

Figure 3.23: Heterosubtypic protection upon depletion of circulating and lung-resident CD8+ T cells.

Results

Figure 3.23 continued: Heterosubtypic protection upon depletion of circulating and lung-resident CD8+ T cells. Mice were immunized with 2x108 particles rAd-HA and rAd-NP plus 109 particles rAd-IL-1β. Before the animals were infected with 104 PFU H3N2 on day 52, different depletion strategies were applied as described in table 2. (A) Weight loss was monitored daily and is expressed as percentage of the initial weight on day 0. Eight days after the infection, mice were sacrificed and BALF were obtained for the analysis of viral RNA (B) and the total amount of protein (C). (D) Blood samples were collected from non-depleted and FTY720-treated mice eight days after the infection and were analyzed for circulating CD45+, CD8+, CD4+ and CD19+ cells via multicolor flow cytomety. Depicted are means + SEM (A, C, D) or medians + interquartile range (B). Statistical significances were analyzed by one-way ANOVA followed by Tukey’s post test (B and C; n=5-6; data of B were log-transformed before statistical analysis) or two-tailed Student’s t test (D; n=5-6); #, p<0.05 vs. naïve; *, p<0.05 vs. HA/NP+empty; +, p<0.05 vs. HA/NP+IL-1β.

3.3.7 Local inflammation and cellular infiltration after immunization

The formation of tissue-resident memory T cells requires a complex developmental pathway with several checkpoints, including an inflammation of the respective tissue, priming

93 of committed TRM precursors in lymphoid tissues and the local differentiation into TRM . The following experiment was conducted to determine how the mucosal expression of IL-1β affects the development of TRM. As done in previous studies, mice were immunized with rAd- empty or rAd-IL-1β in addition to the antigen-encoding vectors. One, four, seven and 14 days after the immunization, mice were sacrificed and BALF as well as lungs were obtained. These samples were investigated via qRT-PCR, cytokine assays and FACS analysis in regard to the inflammation of the lung tissue and the infiltration of innate and adaptive immune cells. A group of naïve animals served as steady-state controls. A qRT-PCR analysis allowed the transcriptional quantification of inflammatory cytokines and adhesion molecules in the lung. Since a considerable infiltration of immune cells into the lung was expected, messenger RNA (mRNA) levels of ubiquitin C (Ubc) and eukaryotic elongation factor 2 (Eef2) were determined for the normalization of the target gene transcription. Indeed, compared to the groups naïve or HA/NP+empty, the transcription of these reference genes was increased in rAd-IL-1β-treated animals (Fig. 3.24 A and B).

Results

Figure 3.24: Transcriptional analysis of lung inflammation after immunization. Animals were immunized with 2x108 particles HA- and NP-encoding vectors as well as with 109 particles rAd-empty or rAd-IL-1β. One, four, seven and 14 days after the immunization, lungs were harvested and RNA was isolated from these tissues to quantify gene transcription by qRT-PCR. (A and B) The reference gene transcription is shown as relative increase to naïve animals. (C-H) The respective target gene transcription was normalized with the geometrical mean of Ubc+Eef2 copy numbers and is shown relative to the normalized levels in naïve mice. The dashed line and the values at day 0 represent the transcription at the steady state in a naïve group. Depicted are means + SEM and statistical significances were analyzed by two-tailed Student’s t test (n=4 per time point); *, p<0.05 vs. HA/NP+empty.

The analysis of Il1b mRNA (sensitive for endogenous and vector-encoded transcripts) revealed a peak transcription in rAd-IL-1β-treated mice on day four with an approximately 56-fold increase compared to naïve mice (Fig. 3.24 C). Immunization with the antigen- encoding vectors plus rAd-empty did not induce transcription of Il1b. Moreover, the inclusion of rAd-IL-1β in the vaccine resulted in significantly increased levels of Il6 (Fig. 3.24 D) and Tgfb1 mRNA (Fig. 3.24 E). In line with this transcriptional induction of inflammatory cytokines, mRNA levels of the endothelial adhesion molecules P-selectin (Selp, Fig. 3.24 F) and E-selectin (Sele, Fig. 3.24 G) were also elevated in rAd-IL-1β-treated mice. The transcription of vascular cell adhesion molecule 1 (Vcam1) was also elevated, but only 14 days after the immunization (Fig. 3.24 H). This could indicate an indirect induction of this adhesion molecule by infiltrating immune cells rather than a direct effect of IL-1β. In addition, it was also investigated whether E-cadherin, the primary ligand for CD103, was affected by the adjuvant. However, the normalized transcription of the E-cadherin gene Cdh1 showed a higher upregulation after the immunization without an adjuvant than after the co- administration of rAd-IL-1β (Fig. 3.24 I).

Results

In addition to the transcriptional quantification, the induction of various cytokines and chemokines in BALF was determined by cytokine ELISA and a bead-based multiplex array. In contrast to the qRT-PCR analysis, the transgene expression of IL-1β peaked sharply one day after the vaccination and dropped thereafter (Fig. 3.25 A). Two weeks after the immunization, the levels of IL-1β were below the detection limit. The immunization with rAd- HA/NP and rAd-empty did not induce a detectable production of endogenous IL-1β. Consistent with the transcriptional analysis, an immediate inflammatory response was observed in rAd-IL-1β-treated lungs. Specifically, the inflammatory cytokines IL-6 (Fig. 3.25 B) and TNFα (Fig. 3.25 C) as well as the chemokines CCL3, CCL5, CCL20 and CXCL1 (Fig. 3.25 F-J) were increased as early as 24 hours after the immunization. Despite a minimal induction of TNFα and CCL3, the vaccination without the adjuvant did not promote such an immediate and broad inflammation. At later time points, elevated levels of TGFβ (Fig. 3.25 D), IL-17 (Fig. 3.25 E), CCL21 (Fig. 3.25 I) and CXCL10 (Fig. 3.25 K) were found almost exclusively after the immunization with rAd-IL-1β. In contrast, CCL5 (Fig. 3.25 G) and CXCL12 (Fig. 3.25 L) were increased in both immunized groups during the late inflammatory response, despite slight kinetic differences in the latter one. BAFF (B cell activating factor of the TNF family, Fig. 3.25 M) was also induced by both vaccination strategies, but showed a drastically increased production upon the inclusion of rAd-IL-1β in the vaccine. Taken together, the short-term expression of IL-1β in the lung promotes a complex inflammatory sequence, including the production of cytokines and chemokines as well as the upregulation of adhesion molecules. This activation might be a prerequisite for an effective recruitment of circulating immune cells into the lung.

Results

Figure 3.25: Mucosal cytokines and chemokines after immunization. Animals were immunized with 2x108 particles HA- and NP-encoding vectors as well as with 109 particles rAd-empty or rAd-IL-1β. One, four, seven and 14 days after the immunization, BALF were obtained and the indicated factors were quantified by a bead-based multiplex analysis or ELISA (only TGFβ). The dashed line represents the respective detection limit. Day 0 indicates values of one naïve group. Depicted are means + SEM and statistical significances were analyzed by two-tailed Student’s t test (n=4 per time point); *, p<0.05 vs. HA/NP+empty.

At several time points after the immunization, the recruitment of innate and adaptive immune cells into the lung was analyzed by multicolor flow cytometry. Two antibody panels were used and the respective gating strategies are depicted in figure 3.26. First of all, the analysis revealed a marginal infiltration of innate and adaptive immune cells following the immunization without an adjuvant (Fig. 3.27 A). Compared to naïve mice, only CD103+ DCs (2.4-fold, 534 ±88 cells vs. 222 ±26 cells) and interstitial macrophages (3.6-fold, 1020 ±270 cells vs. 283 ±25 cells) were elevated noteworthy 14 days after the immunization. In sharp contrast, rAd-IL-1β-treated mice displayed a massive influx of all investigated cell

Results subsets (Fig. 3.27 B). The first immune cells elevated in the lungs of these animals were neutrophils. Due to the high abundance at the steady state, the relative increase was rather moderate on day one, but in absolute numbers, these cells showed a marked infiltration (2.3-fold compared to naïve, 1.39x105 ±2.63x104 cells vs. 6.04x104 ±1.22x104 cells). Other innate immune cell subsets followed four days after the immunization with rAd-IL-1β. Specifically, alveolar macrophages, CD103-CD11b+DCs and Ly6C- monocytes were moderately increased, while Ly6C+ monocytes showed a 25-fold increase on day four (8.77x104 ±3.47x103 cells vs. 3.51x103 ±6.93x102 cells in naïve). However, the most pronounced increases were observed for respiratory CD103+ dendritic cells (52-fold compared to naïve, 1.16x104 ±2.81x102 cells vs. 2.22x102 ±2.61x101 cells) and interstitial macrophages (69-fold compared to naïve, 1.96x104 ±5.18x102 cells vs. 2.83x102 ±2.54x101 cells) on day 14, when the other innate immune cells already had started to decline. Adaptive T and B cells began to infiltrate at day seven and then further accumulated until day 14. Specifically, B cells showed the most pronounced infiltration of these cells with a 10.5-fold increase compared to naïve mice on day 14 (3.76x105 ±3.22x104 cells vs. 3.75x104 ±2.66x103 cells). A 8.2-fold increase was observed for CD8+ T cells (1.97x105 ±9.22x103 cells vs. 2.39x104 ±1.62x103 cells), while CD4+ T cells showed a 6.3-fold elevation (2.62x105 ±1.80x104 cells vs. 4.18x104 ±4.49x103 cells). In regard to the absolute numbers, B cells, CD4+ T cells and CD8+ T cells were among the most abundant immune cell types in the lung. Thus, the inflammation in the lung, which is induced by rAd-IL-1β, also translates into an efficient recruitment of both innate and adaptive immune cells.

Results

Figure 3.26: Gating strategy for the analysis of infiltrating immune cells after immunization. Single cell suspensions of homogenized lungs were stained with two antibody panels for multicolor flow cytometry (2.2.4.8). Solid arrows indicate positive gating, while dashed arrows indicate negative gating (exclusion of the marked population). alv., alveolar; Mono, monocytes.

Results

Figure 3.27: Infiltration of immune cells into the lung after immunization. Animals were immunized with 2x108 particles HA- and NP-encoding vectors as well as with 109 particles rAd-empty (A) or rAd-IL-1β (B). One, four, seven and 14 days after the immunization, mice were sacrificed and lungs harvested. Single cell suspensions of homogenized lungs were stained with two antibody panels (2.2.4.8, Fig. 3.26). The upper figures show the relative increase compared to the steady state in naïve animals (day 0), which is also indicated by the dashed line. The lower figures illustrate the absolute cell counts of the respective subset. Depicted are means + SEM (upper figures) or medians + interquartile range (lower figures). alv., alveolar; int., interstitial.

Next, the TRM phenotype imprinting at early stages of the primary response was investigated. To this end, pentamer staining was used to identify antigen-specific CTL in the

+ lung. In accordance with the infiltration kinetic of total CD8 T cells (Fig. 3.27), NP147-155- specific cells were not observed until day seven (Fig. 3.28 A). Already at this early time point, NP-specific CTL were increased in the group HA/NP+IL-1β. These differences were further pronounced 14 days post-immunization, which was evident as a 9.6-fold higher number of pentamer-stained cells in the lungs of rAd-IL-1β-treated mice (7076 ±1764 cells vs. 739 ±362 cells). The analysis of the effector marker KLRG1 revealed that most of the antigen- specific CTL had a KLRG1- phenotype (Fig. 3.28 B). Especially 14 days after the immunization with rAd-IL-1β, almost all antigen-specific cells in the lung were KLRG1-. Since

- 73 KLRG1 CTL are potential TRM precursors , these data indicate that the improved T cell response induced by rAd-IL-1β is highly capable to become tissue-resident. Strikingly, the KLRG1- compartment was not only quantitatively improved by rAd-IL-1β but also showed an increased TRM phenotype imprinting early after the immunization (Fig. 3.28 C). First of all, the potential TRM upregulated CD69 earlier if rAd-IL-1β was included in the vaccine. However, 14 days after the vaccination, both immunized groups had a similar proportion of CD69+ lung CTL. Impressively, on day 14, 79.8 ±3.16 % of the pentamer-stained KLRG1- CTL in rAd- IL-1β-treated mice showed an expression of CD103, while only 31.6 ±7.16 % of these cells were positive for CD103 in the group without adjuvant treatment. Moreover, rAd-IL-1β led

Results also to a more stable CD127+ phenotype, indicating an increased potential for homeostatic self-renewal. Taken together, the mucosal expression of IL-1β led to an extensive attraction

- of NP-specific KLRG1 TRM precursor cells into the lung. In addition, these cells showed an enhanced phenotype imprinting for tissue-residency as indicated by an earlier induction of CD69+ and higher frequencies of CD103+ CTL.

Figure 3.28: Phenotypic analysis of the early CD8+ T cell response. Animals were immunized with 2x108 particles HA- and NP-encoding vectors as well as with 109 particles rAd-empty or rAd-IL-1β. Seven and 14 days after the immunization, mice were sacrificed and lungs harvested. CD8+ T cells were identified by + staining for CD45 as well as CD8. (A) Pentamer staining identified NP147-155-specific CD8 T cells. (B) Staining for KLRG1 determined the number of potential TRM precursor cells within the pentamer-positive population. (C) Within - NP-specific KLRG1 cells, the expression of CD69, CD103 and CD127 was investigated to follow the TRM phenotype imprinting. Depicted are means + SEM and statistical significances were analyzed by two-tailed Student’s t test (n=4); *, p<0.05 vs. HA/NP+empty.

3.3.8 Immunizations with lower doses of rAd-IL-1β

A dose of 109 particles rAd-IL-1β was found to increase the immunogenicity of intranasal vector-immunizations substantially and concomitantly improved the protection against infections with IAV. However, the administration of the adjuvant induced moderate side effects for three to five days, including a general lethargy and ruffled fur. To determine whether lower doses of rAd-IL-1β improve the protection in the absence of side effects, animals were treated with 107, 108 or 109 particles of the adjuvant together with 2x108 particles of each antigen-encoding vector. Similar to previous studies, the immunogenicity and vaccine efficacy was compared to a group that was immunized with the

Results same amount of antigen-encoding vectors plus 109 particles rAd-empty. Experimental procedures were performed as described before (Fig. 3.6) with the exception that blood samples were obtained 45 days after the immunization in this experiment. Importantly, mice that received 108 or 107 particles of rAd-IL-1β displayed no obvious signs of the mentioned side effects and were phenotypically undistinguishable from untreated mice. The analysis of the humoral responses revealed that NP-specific antibody responses were induced in all immunized animals but were not affected by the adjuvant treatments (Fig. 3.29 A). Similar to the previous experiments, a dose of 109 particles rAd-IL-1β increased the HA-specific humoral response as indicated by elevated antibody levels against the homologous HA variant (Fig. 3.29 B) and an improved neutralization of the homologous PR8 strain (Fig. 3.29 C). Compared to the group HA/NP+empty, also the 108 dose increased the HA- specific responses significantly, while 107 particles of the adjuvant improved the neutralization slightly but not the general antibody levels.

Figure 3.29: Humoral responses after immunization with different adjuvant doses. Animals were immunized with 2x108 particles HA- and NP-encoding vectors as well as with the indicated amount of rAd-IL-1β or 109 particles rAd-empty. Blood samples were collected 45 days after the immunization and a FACS-based antibody analysis was used for the detection of antibodies directed against the PR8-derived variants of NP (A) or HA (B) in serum samples (1:100 dilution). (C) The neutralizing capacity of serum samples against the PR8 strain was analyzed by a microneutralization assay. The dashed line represents the detection limit (NT=5). Depicted are medians + interquartile range (A and B) or individual values with the group’s median (C). Statistical significances were analyzed by one-way ANOVA followed by Tukey’s post test (n=4; data were log-transformed before statistical analysis); #, p<0.05 vs. naïve; *, p<0.05 vs. HA/NP+empty.

The assessment of NP-specific T cell responses by intracellular cytokine staining confirmed once again the immunostimulatory effects of 109 particles rAd-IL-1β (Fig. 3.30 A). On the contrary, lower doses of the adjuvant did not substantially improve NP-specific CD8+ T cell responses compared to the group HA/NP+empty. However, animals that received the 107 or 108 adjuvant dose showed a trend toward higher NP-specific CD4+ T cell responses in the lung and spleen. Interestingly, the vaccination without rAd-IL-1β resulted only in barely detectable NP-specific CD4+ T cell responses in the lung. The analysis of CD4+ T cell responses against HA was difficult to interpret due to a low frequency of responding T cells

Results and substantial scatter (Fig. 3.30 B). HA-specific CTL responses in the spleen were also weak and showed a slight dose-dependent increase, but overall the differences were marginally among the immunized groups. Compared to the group HA/NP+empty, HA-specific lung CTL producing IFNγ, IL-2 or TNFα were moderately increased by the highest dose of rAd-IL-1β, while the lower adjuvant doses had no substantial effects.

Figure 3.30: Functional T cell responses after immunization with different adjuvant doses. Animals were immunized with 2x108 particles HA- and NP-encoding vectors as well as with the indicated amount of rAd-IL-1β or 109 particles rAd-empty. Fifty-six days after the immunization, lymphocytes were isolated from spleen and lung. These cells were restimulated with MHC-I- and MCH-II-restricted peptides derived from NP (A) or HA (B). Surface staining identified CD8+ and CD4+ T cells as well as degranulation via CD107a (only for CD8+ T cells). Production of IFNγ, IL-2 and TNFα was determined by intracellular staining. The frequency of the respective population positive for one or all markers (poly) is depicted as means + SEM. Statistical significances were analyzed by one- way ANOVA followed by Tukey’s post test (n=4); #, p<0.05 vs. naïve; *, p<0.05 vs. HA/NP+empty.

Results

Moreover, the memory phenotype of the induced CD8+ T cell response was investigated. Unfortunately, due to technical issues, the identification of antigen-specific CTL by pentamer staining was not successful. Nevertheless, since the vaccine-induced immune response is visible on the whole CD8+ T cell population (Fig. 3.13 A), the phenotypic analysis was conducted in an antigen-unspecific manner. Indeed, the two highest adjuvant doses promoted significantly increased numbers of total CD8+ T cells in the lung, while the 107 particle dose and the group HA/NP+empty showed only marginal increases compared to naïve mice (Fig. 3.31 A). As observed in previous experiments, 109 particles rAd-IL-1β induced significantly elevated levels of CD103+CD69+ and CD103+CD69- CTL, but CD103- CD69+ CTL were also increased (Fig. 3.31 B). The group that received 108 particles rAd- IL-1β showed a comparable elevation of the CD103+CD69- phenotype, but as described earlier, this phenotype does not exclusively represent TRM (Fig. 3.14). Nevertheless, the

8 10 dose group also showed a trend toward higher numbers of the two reliable TRM phenotypes CD103+CD69+ and CD103-CD69+. The co-administration of 107 particles of the adjuvant did not induce higher quantities of TRM than observed in the immunized control group without adjuvant treatment.

Figure 3.31: Phenotypic analysis of CD8+ T cell responses after immunization with different adjuvant doses. Animals were immunized with 2x108 particles HA- and NP-encoding vectors as well as with the indicated amount of rAd-IL-1β or 109 particles rAd-empty. Fifty-six days after the immunization, lymphocytes were isolated from spleen and lung tissues. (A) CD8+ T cells were identified by staining for CD45 as well as CD8 and are depicted in total numbers. (B) Staining for the phenotypic markers CD127, KLRG1, CD69 and CD103 was used to + determine the number of potential TRM cells among CD8 T cells (gating strategy depicted in Fig. 3.13). Depicted are means + SEM and statistical significances were analyzed by one-way ANOVA followed by Tukey’s post test (n=4); #, p<0.05 vs. naïve; *, p<0.05 vs. HA/NP+empty.

Fifty-two days after the immunization, the vaccine efficacy was evaluated by an

4 experimental infection with 10 PFU (~10 LD50) the H3N2 strain. Compared to naïve mice, all vaccinated groups showed a reduced weight loss upon the infection and started to regain weight between day four and six (Fig. 3.32 A). However, among the immunized animals, the group HA/NP+empty started to regain weight as last and the weight on day five and day six post-infection was significantly lower than those observed in any rAd-IL-1β-treated group.

Results

Specifically, these mice displayed the highest weight loss with 20.4 ±3.0 % on day six, while animals that received 109 particles rAd-IL-1β showed a maximal weight loss of 10.6 ±0.9 % on day four and started to recover subsequently. The lower adjuvant doses also reduced the morbidity, as indicated by a maximal weight loss of 12.3 ±0.39 % (108 particles) and 14.1 ±0.8 % (107 particles) on day five. Therefore, the weight curves indicate a slight dose- dependent effect on the disease progression. Compared to naïve animals, the virus replication was generally reduced in immunized mice, but the group HA/NP+empty on average showed the most pronounced replication among these (Fig. 3.32 B). While the differences to the two lowest adjuvant doses were only trends, the two highest doses of rAd- IL-1β reduced the virus replication significantly. Moreover, the inclusion of 108 and 109 particles of the adjuvant reduced the tissue damage significantly, as analyzed by the total amount of protein in BALF (Fig. 3.32 C). The 107 particle dose decreased this parameter by trend. Taken together, the administration of 107 or 108 particles of rAd-IL-1β does not provoke side effects but still improves the protection against a heterologous H3N2 strain, although less efficiently than 109 particles. Interestingly, beneficial effects of the lower adjuvant doses on the CD8+ T cell responses in the lung were hardly detectable, while they induced enhanced CD4+ T cell responses at least by trend. Therefore, these data could indicate that at lower adjuvant doses, CD4+ T cells mediate an improved HSI.

Figure 3.32: Protection against H3N2 after immunization with different adjuvant doses. Animals were immunized with 2x108 particles HA- and NP-encoding vectors as well as with the indicated amount of rAd-IL-1β or 109 particles rAd-empty. Fifty-two days after the immunization, mice were infected with 104 PFU H3N2. (A) Weight loss was monitored daily and is expressed as percentage of the initial weight on day 0. Seven days after the infection, mice were sacrificed and BALF were analyzed. (B) Viral RNA was quantified by qRT-PCR. The dashed line represents the detection limit (3300 copies/ml). (C) The amount of total protein was quantified by BCA. Depicted are means + SEM (A and C) or medians + interquartile range (B). Statistical significances were analyzed by one-way ANOVA followed by Tukey’s post test (n=6; data of B were log-transformed before statistical analysis); #, p<0.05 vs. naïve; *, p<0.05 vs. HA/NP+empty.

Results

3.3.9 Impact of rAd-IL-1β on lung function

The intranasal administration of rAd-IL-1β induced a substantial inflammation, as indicated by the massive influx of immune cells, production of proinflammatory cytokines and upregulation of adhesion molecules. Although the adjuvant treatment was beneficial for the establishment of an efficient immune response, it caused moderate side effects at higher doses. To investigate more specifically whether the mucosal adjuvant affects the lung function, a forced oscillation technique was exploited. To this end, mice were immunized intranasally with a dose of 107, 108 or 109 particles rAd-IL-1β in combination to rAd-HA and rAd-NP (each 2x108 particles). In order to exclude non-specific effects by the intranasal application of the vehicle, naïve mice were treated with the same volume of PBS. Three days after the immunization, anesthetized mice were tracheotomized and connected to a ventilation device. The device mediates a forced ventilation of the murine respiratory system and thereby allows the analysis of several lung function parameters. In the current study, the airway resistance (RN), tissue elastance (H) and tissue damping (G) were evaluated. In addition to the baseline state, the tissue reactivity was also characterized in response to increasing concentrations of the bronchoconstrictor methacholine.

The evaluation of the airway resistance RN showed similar baseline values and methacholine-induced increases in immunized and naïve animals (Fig. 3.33 A). Nevertheless, upon the two highest methacholine doses, a slightly elevated responsiveness was observed in animals that received a dose of 108 particles rAd-IL-1β. The area under the curve (AUC) analysis confirmed these non-significant differences. Interestingly, these effects were not dose-dependent, because the immunization with 109 particles did not result in an increased airway resistance. The assessment of the tissue damping G also demonstrated only minor differences between naïve and immunized animals with slightly elevated values after the administration of 109 particles rAd-IL-1β (Fig. 3.33 B). Specifically, the baseline values were increased from on average 3.43 cm ±0.11 H2O/ml in naïve mice to 4.09

±0.33 cm H2O/ml and this trend was also evident upon exposure with 6.125 mg/ml and 12.5 mg/ml methacholine. This trend is also displayed in the AUC analysis and indicates a slight dose-dependent increase of the tissue damping. However, the differences are minimal and not statistically significant. The third acquired lung function parameter was the tissue elastance H. The average baseline elastance of the rAd-IL-1β-treated groups was slightly lower than that observed in naïve animals (Fig. 3.33 C). Upon the methacholine challenge, the group treated with 107 particles rAd-IL-1β and naïve animals displayed a similarly moderate increase in the tissue elastance, while the other two immunized groups showed a non-significantly lowered responsiveness. The AUC analysis indicates also a slight dose- dependent decrease of the tissue elastance H upon different adjuvant doses. Taken together, the intranasal administration of up to 109 particles rAd-IL-1β does not affect the

Results airway resistance, tissue damping or tissue elastance. Therefore, the observed side effects after the administration of higher adjuvant doses are not caused by an altered lung function.

Figure 3.33: Assessment of the lung function after immunization with different adjuvant doses. Animals were immunized with 2x108 particles HA- and NP-encoding vectors as well as with the indicated amount of rAd- IL-1β. Three days after the immunization, mice were anesthetized and the trachea canulated to connect the murine respiratory system to a ventilation device. Animals were exposed to increasing concentrations of vaporized methacholine to provoke bronchoconstriction. The baseline data were recorded without any vaporization, whereas “0” indicates the vaporization of the vehicle (PBS). For the assessment of the baseline values and after the vaporization of each concentration, forced oscillation maneuvers were performed to measure the airway resistance RN (A), tissue damping G (B) and tissue elastance H (C). Depicted are the respective parameters plotted against the vaporized methacholine concentration (left figures) and the respective AUC analysis (right figures), which covers the whole methacholine challenge. Data in curves and bars are represented as means + SEM and statistical significances were analyzed by one-way ANOVA followed by Tukey’s post test (n=3-4; no statistically significant differences observed).

Discussion

4 Discussion

Conventional IAV vaccines induce highly strain-specific antibody responses against the variable surface proteins HA and NA. In consequence, these vaccines provide protection against the virus strains included in the immunization but do not protect against unexpectedly occurring strains. In contrast, natural influenza infections confer a moderate level of immunity against heterologous infections by inducing cross-reactive memory T cell responses specific for conserved virus proteins. The present study evaluated an influenza vaccine approach, which was aimed to mimic a natural infection in immunological regard. Specifically, intranasal immunizations with adenoviral vectors encoding the virus proteins HA and NP were used to imitate the route of a natural infection, while rAd-IL-1β or rAd-IL-18 were included to induce an infection-like inflammation. In the first part of the current study, the adenoviral vectors encoding the adjuvants IL-1β or IL-18 were constructed and tested for their expression. Both vectors led to the expression of the respective transgene, although IL-18 was produced less efficiently. Since the expression in both vector constructs is controlled by the same CMV promoter and the genomic integrity of the expression cassettes was confirmed by PCR and sequencing, it is likely that post-transcriptional or post-translational mechanisms inhibited the production of IL-18. Although IL-18 seems to be relatively long-lived and stable on the protein level146, specific microRNA species for example can silence the translation of its mRNA147. In a series of in vitro experiments, the bioactivity of both cytokines was confirmed by the activation of various promoters involved in type I IFN and NF-κB signaling. The initiation of the type I IFN axis, including the activation of IFNβ, IRF3 and ISRE was rather unexpected, since the NLRP3 and the type I IFN pathway are believed to have an antagonistic relationship. However, while the inhibitory effects of IFNα/β on the inflammasome function and subsequent IL-1β/18 processing is well described, the effects of IL-1β signaling on the type I IFN axis are largely unknown148,149. Moreover, the bioactivity studies were conducted in immortalized human embryonic kidney cells, which represent an uncomplicated but rather artificial system for the investigation of complex inflammatory processes. Also important in this regard, the in vivo studies in the second part of this study revealed that the mucosal expression of IL-1β does not induce detectable amounts of type I IFNs in the BALF (data not shown). Apart from that, rAd-IL-1β but not rAd-IL-18 led to an intense activation of the transcription factor NF-κB, which is involved in the expression of more than 500 genes, including proinflammatory cytokines, chemokines and adhesion molecules150. It has been demonstrated before that IL-1β is a potent activator of NF-κB signaling151. However, although the IL-18 signaling cascade is nearly identical to that of IL-1β152 and some reports have shown an activation of the NF-κB pathway by IL-18153, other

Discussion publications were not able to find an effect of IL-18 on this transcription factor151. A possible bottleneck for an efficient NF-κB activation could be the availability of IL-12 in the respective experimental system, because this cytokine was shown to be an essential synergistic factor for IL-18-induced NF-κB signaling154. Moreover, rAd-IL-1β initiated the promoter of the apoptosis-associated protein p53. Evidence for an interplay of the two pathways is scarce but one study suggests that IL-1β induces p53-mediated apoptosis in neural precursor cells155. Whether this mechanism also plays a role in mucosal immunizations is unclear, but it could affect the duration of antigen availability by selective apoptosis of antigen-producing cells. For the immunization studies in mice, the antigen-encoding vectors were titrated in order to find a dose, which protects against mortality upon a heterologous H1N1 infection but that prevents weight loss and virus replication only to a suboptimal extent. This suboptimal vaccine dose would allow the monitoring of beneficial adjuvant effects in later experiments. The immunization with 109 particles of rAd-HA and rAd-NP was found to be completely protective in terms of mortality and weight loss but still allowed moderate levels of virus replication. In contrast, the 108 particle dose did not prevent weight loss or virus replication, although weak humoral and cellular responses were detected. Based on these findings, a dose of 2x108 particles of each antigen-encoding vector was suspected to induce immune responses that are protective but suboptimal. In subsequent immunizations, rAd-IL-1β and rAd-IL-18 were included in the vaccine to evaluate their adjuvant effects. Analysis of the humoral responses against the vaccine antigens HA and NP revealed no beneficial effects mediated by the inclusion of rAd-IL-18. On the contrary, rAd-IL-1β increased the amount of antibodies directed toward HA in sera and BALF, while NP-specific antibody responses were not affected quantitatively. One explanation for the differential impact of rAd-IL-1β on the two antigens can be differences in the antigen-processing of internal and surface proteins, which is already described for other viral antigens156,157. Moreover, the inclusion of rAd-IL-1β not only increased the quantity of HA-specific antibodies but also altered the quality, which was mostly evident as a specific bias toward the antibody subclass IgG1. The qualitative and quantitative effects of rAd-IL-1β on the humoral immune response are probably related to the increased numbers of antigen- specific CD4+ T cells in this group. Supporting this notion, Ben-Sasson et al. demonstrated

+ that exogenous IL-1β enhances the antigen-induced expansion of CD4 TH2 cells in mice,

158 which in turn promotes elevated levels of IgG1 . The rather selective action of IL-1β on TH2 cells could be explained by the diminished or absent expression of the IL-1 receptor on TH1 cells159.

Discussion

In general, the murine antibody subclass IgG1 is less capable than IgG2a to bind to activating Fcγ receptors and therefore induces secondary effector functions like antibody- dependent cellular cytotoxicity or phagocytosis less efficiently160. However, while these mechanisms seem essential for the protective efficacy of rare HA stem-directed antibodies, the neutralization mediated by the more abundant globular head-directed antibodies does not rely on Fc receptor binding161. Accordingly, the IgG1-dominated humoral response, which resulted from the co-delivery of rAd-IL-1β, was highly capable to neutralize the homologous IAV strain in vitro. The neutralizing activity of serum samples correlated with the protection against infections with the homologous strain. Animals that received rAd-IL-1β showed neither weight loss nor virus replication upon the infection, which indicates a sterile protection induced by the elevated virus neutralization. In contrast, the immunization with rAd-IL-18 or without an adjuvant resulted in varying but overall lower neutralization titers. Consequently, all animals of these groups showed an initial virus replication and some even displayed excessive weight loss upon the infection. Therefore, these data implicate that IL-1β might be a potential adjuvant to enhance the immunogenicity of antibody-eliciting vaccines. However, far more relevant for HSI is the induction of cross-reactive T cell responses. Community-acquired natural influenza infections induce CD4+ and CD8+ T cells that are directed against conserved virus proteins like NP or the matrix proteins60–62. These responses mediate protection against a broad spectrum of IAV strains and even provide immunity against emerging pandemic viruses in humans67,68. In the current study, the intranasal immunization with adenoviral vectors induced T cell responses against both vaccine antigens, but stronger responses were observed toward the highly conserved NP. The inclusion of rAd-IL-1β but not rAd-IL-18 drastically elevated the T cell responses with the highest increases found locally in the lung. Upon restimulation, these antigen-specific T cells produced the effector cytokines IFNγ, IL-2 as well as TNFα and CTL displayed degranulation as indicated by the staining for CD107a. A substantial part of these cells even exerted all measured effector functions, which indicates a highly polyfunctional effector profile. These results are in line with contributions from Ben-Sasson et al., which found a direct stimulatory effect of exogenous IL-1β on the proliferation and differentiation of effector CD4+ and CD8+ T cells158,162. In addition, a complementary report indicates that the deficiency of IL-1 receptor signaling upon an IAV infection diminishes the induction of lung CTL37. The intranasal immunization in combination with the co-delivery of rAd-IL-1β increased T cell responses in the lung drastically. To determine the memory phenotype of lung CTL, a pentamer staining approach was used. Analysis of the circulatory memory phenotypes revealed that 56 days after the immunization mainly TCM remained, while antigen-specific TEFF and TEM were clearly lower in numbers. These findings are in

49 concordance with the classical view of TCM as the most long-lived circulating memory CTL .

Discussion

Moreover, all of these circulatory CTL subsets were found moderately increased by the inclusion of rAd-IL-1β in the vaccine. However, the presence of these memory subsets in the lung is most probably the result of contaminations with blood-borne cells due to the high vascularization of this organ rather than representing tissue-resident lymphocytes70. In contrast, lung CTL expressing the surface proteins CD103 and CD69 have clearly been shown to be tissue-resident53,70,77–79. Impressively, the increase of local NP-specific T cells in the rAd-IL-1β-treated group was mostly located in this TRM subset. Animals treated with the adjuvant showed almost a nine-fold increase of CD103+CD69+ CTL compared to immunized animals without adjuvant treatment. In addition, also the number of CD103+CD69- CTL was increased but to a lower extent. Intravascular staining confirmed that CD103+CD69+ CTL were mostly protected from intravascular staining (>96 %) and thus they clearly represent

+ - non-circulating TRM. CD103 CD69 CTL were also mostly tissue-resident but included a significant proportion of blood-born cells as well (~24 %).

A hallmark attribute of TRM is their ability to respond immediately upon antigen re- exposure without the need of activation or expansion in lymphoid tissues80. In contrast, circulating memory T cells, especially TCM, cannot directly enter inflamed tissues but instead have to undergo proliferation in lymphoid tissues in order to give rise to secondary effector populations163. Animal studies have illustrated the important contribution of cross-reactive

53,79 TRM in the protection against reinfections with heterologous IAV . The important role of TRM in defending against respiratory tract infections has been also demonstrated in experimental human infections with the respiratory syncytial virus87. Specifically, it was observed that

+ + preexisting, virus-specific CD103 CD69 TRM correlated with reduced disease symptoms and lower virus replication upon intranasal infections. Thus, this implies that the principles of murine TRM can be translated into humans. Upon the challenge with a divergent H1N1 strain 52 days after the immunization, all vaccinated mice were generally protected from mortality and also the morbidity was significantly attenuated. Mice that received an immunization with rAd-IL-1β displayed the most effective immunity, as indicated by a further reduction of weight loss, virus replication, cellular infiltration and tissue damage. The long-term immunity against the heterologous H1N1 strain was evaluated 100 days after the immunization and showed a similar protection as observed upon infections on day 52 after the immunization. Importantly, the administration of rAd-IL-1β without rAd-HA/NP did not affect the virus replication or weight loss upon the infection compared to untreated mice. Therefore, the improved immunity in rAd-IL-1β-treated mice is mediated by antigen-specific immune responses and not by unspecific alterations in the lung or a sustained production of IL-1β.

Discussion

The vaccine-induced heterologous protection was also evaluated against the group 2 viruses H3N2 and H7N7. In general, the vaccination conferred protection against mortality upon the infection with these distant IAV strains, but the immunized mice experienced substantial weight loss. In accordance to the previous experiments, the inclusion of rAd-IL-1β elicited a more efficient protection as indicated by reduced weight loss and a faster recovery. It is unlikely that the protection against the divergent influenza strains is mediated by antibody responses. Similar to conventional influenza vaccines, the vaccine-induced humoral response was largely unable to recognize HA variants from divergent IAV strains. In line with the decreasing identities among the PR8, H1N1 and H3N2 HA variants, small amounts of non-neutralizing antibodies recognized the divergent H1N1 HA, while antibody binding to the H3N2 HA was completely absent. In contrast, antibodies directed against the conserved NP were induced efficiently. However, the quantity of these antibodies was similar in all immunized groups and the bias toward the subclass IgG1 indicates a decreased potential for secondary effector functions160. Moreover, it is unclear to which extent and by which mechanism these responses could contribute to the protection. A few studies suggest that NP-specific antibodies can mediate HSI144,164, perhaps by binding to surface-exposed NP on virus particles or infected cells165,166. However, the amount of surface-exposed NP is very different among several IAV strains and in particular PR8 infections seem to promote only low amounts of NP on infected cells. In addition, NP-specific antibodies were not able to neutralize an infection, to activate the complement system or to improve antigen presentation via opsonization in in vitro experiments145. Thus, it is unlikely that the vaccine-induced antibody response contributes to the HSI in the present study. Nevertheless, to definitely rule out such a contribution, infection experiments should be performed with immunized but antibody-deficient mice or with mice that received a serum transfer from immunized mice. Considering the above mentioned arguments, it is most likely the cross-reactive T cell response, which mediates the heterologous immunity in the current study. In particular, the drastic increase of NP-specific CD4+ and CD8+ T cells in the group HA/NP+IL-1β correlates with the improved protection against the divergent IAV strains. In accordance to previous reports, the T cell-mediated HSI was not able to prevent the initial infection but attenuated morbidity and disease severity46,63–66. Most probably as a result of the induction of these cross-reactive T cell responses, the vaccination strategy in the current study was able to confer a broad protection against both group 1 and group 2 viruses. Specifically, the vaccination was not only protective against the two currently circulating subtypes in humans (H3N2 and pH1N1) but also against a seal-origin H7N7 virus. Therefore, this kind of immunity would decrease morbidity and mortality upon the occurrence of pandemic viruses that crossed species barriers, which is currently not provided by IIV. In contrast, LAIV in principle induce such cross-reactive T cell responses62, but several characteristics of these

Discussion vaccines do not allow a deployment in large vaccine campaigns. These characteristics include the highly restricted use of LAIV in healthy young children, while individuals at high risk like elderly and chronically ill individuals as well as pregnant women cannot be treated with this vaccine. More recently, LAIV revealed major deficits in their immunogenicity and thus are not recommended to use anymore by the health authorities in some countries112.

In an attempt to attribute the heterologous immunity to the presence of TRM in the lung, several depletion strategies were exploited. First of all, a treatment with FTY720 was used to inhibit the circulation of memory T cells. Indeed, the absence of a systemic T cell response did not reduce the protection against a divergent H3N2 strain in HA/NP+IL-1β vaccinated mice. This indicates that the lung-resident memory T cells are sufficient for the heterologous protection. Similarly, FTY720 treatments did also not alter HSI in two studies, in which mice were immunized via sublethal IAV infections53,79. The current study also deployed antibody-mediated depletion strategies to eliminate either systemic memory CTL (i.p. treatment) or systemic and local CTL populations (i.p.+i.n. treatment). While in the absence of systemic CD8+ T cells the virus replication and the tissue damage were slightly increased upon a H3N2 infection, the combined depletion of systemic and local CD8+ T cells did not result in a decreased protection compared to non-depleted mice. Unfortunately, the actual absence of CD8+ T cells upon the infection was not investigated. Thus, one cannot exclude that the depletion strategies were less efficient than expected. Moreover, after the i.p.

+ depletion of CD8 T cells in the pilot study, the TRM compartment seemed also slightly affected, possibly indicating that the systemic depletion might also eliminate lung-resident T cells. Taken together, the depletion experiments demonstrated that circulating T cells are not required for the HSI induced by rAd-IL-1β, but the intended depletion of local CD8+ T cells did also not decrease the protection.

Although the depletion experiments were not completely conclusive, the role of TRM in HSI is indisputable53,79. Recent research has started to understand the mechanistic requirements for the formation of these valuable memory cells. Several important

- developmental checkpoints were identified, including (i) priming of committed KLRG1 TRM precursors, (ii) tissue inflammation and the concomitant infiltration of TRM precursors, (iii)

93 tissue instruction for the differentiation of TRM and (iv) retention and persistence of TRM . The current study clearly shows that intranasal immunizations with rAd-IL-1β drastically increase

+ + T cell responses with a preferential establishment of CD103 CD69 TRM in the lung. Therefore, it represents probably the first report about an adjuvant, which specifically induces lung TRM. To investigate mechanistically, which of the critical checkpoints in the development of TRM are initiated by rAd-IL-1β, the early activation of innate and adaptive immune components was followed in detail.

Discussion

One of the earliest events upon an infection that contributes to the formation of lung

TRM is the activation of epithelial cells. This step is required, because some organs like the lung, skin epidermis and vaginal mucosa are restricted tissues that are not accessible for immune cells at the uninflamed steady state93. IL-1β and TNFα are widely accepted as the main mediators of tissue activation and even function in a synergistic manner40,167. In the current study, the transgene expression of IL-1β was transient and peaked between one and three days post-immunization, while the qRT-PCR analysis revealed a peak transcription on day four. An interesting explanation for these differences could be that neutrophils express a decoy receptor for IL-1β (IL-1 receptor type 2), which binds IL-1β but does not induce any signaling168. Therefore, it is possible that the pronounced infiltration of neutrophils upon the immunization absorbs IL-1β and thereby prevents the detection of this cytokine by ELISA. Moreover, rAd-IL-1β led to an immediate production of TNFα and IL-6, most probably by activated epithelial cells. However, the production of TNFα was maintained for at least 14 days, even if the IL-1β expression was already terminated. It is likely that at these later time points, infiltrating effector T cells, which recognize their cognate antigen on transduced epithelial cells, produce TNFα and thereby maintain the levels of this cytokine. Epithelial cells that are activated by IL-1β and TNFα have been described to upregulate adhesion molecules and produce secondary cytokines and chemokines, which subsequently lead to the transendothelial migration of immune cells from the circulation into the inflamed tissue40,169. Indeed, immunizations with rAd-IL-1β led to an immediate transcriptional upregulation of the adhesion molecules P-selectin and E-selectin. Respective ligands for these selectins are expressed widely on leucocytes, including neutrophils, monocytes, DCs and T cells169,170. In contrast, an upregulation of VCAM1 was only observed on day 14. Interestingly, it is described that activated TRM promote the expression of VCAM1 on endothelial cells by secreting IFNγ171. Therefore, it is possible that the pronounced increase of TRM on day 14 mediates the upregulation of this adhesion molecule. Moreover, several chemokines were upregulated within 24 hours post-immunization. CXCL1, the murine homolog to human IL-8 and the major chemoattractant for neutrophils, is known to be directly induced by IL-1β172,173 and was immediately produced after the immunization. Correspondingly, neutrophils were the first cell type found elevated in the lung. Although neutrophils are described as decent cytokine producers, the high abundance of these cells might contribute to the inflammatory milieu and the concomitant initiation of adaptive immune responses174. Furthermore, the chemokines CCL3, CCL5 and CCL20, which bind to CCR1/4/5, CCR5 and CCR6, respectively, were found elevated early after the immunization. These chemokines can be directly induced by IL-1β signaling and have a general impact on the recruitment of immune cells, specifically on the infiltration of DCs and T cells89,175–177.

Discussion

As a result of this broad chemokine profile, not only neutrophils but also an extensive infiltration of other innate immune cell subsets, including DCs, monocytes and macrophages was observed upon the co-delivery of rAd-IL-1β. For example, the number of respiratory CD103-CD11b+ and CD103+CD11b- DCs in the lung was substantially increased. These two subsets have sophisticated roles in cytokine production and antigen presentation42,43 and thereby have a direct impact on the induction of adaptive immune responses (see below). Similarly, monocytes also contribute to the inflammatory environment by the secretion of several cytokines. Alveolar macrophages in contrast seem dispensable for the induction of adaptive immune responses45. Taken together, the short-term expression of IL-1β was sufficient to start a complex inflammatory sequence, which is, despite the fact that type I IFNs were not detected (data not shown), highly similar to a natural influenza infection38,39,178. Thus, one major objective of this study was achieved, the imitation of an influenza infection in immunological regard. After the initiation of innate immune responses, the priming of naïve T cells in the lung-draining lymph nodes is the next critical step in the formation of TRM. A recent publication from Iborra et al. shows the essential requirement of respiratory CD103+ DCs to

88 induce committed TRM precursors by cross-presentation of antigen in lymphoid tissues . Interestingly, in the present study the mucosal expression of IL-1β led to a 52-fold increase of CD103+ DCs in the lung. It is tempting to speculate that this also translates into a more efficient antigen presentation and a concomitantly enhanced TRM precursor priming in the draining lymph nodes. In particular, because another report found that IL-1β directly initiates the maturation and migration of CD103+ DCs upon an IAV infection and therefore is required for an optimal CTL induction37. However, not only the migration of CD103+ DCs toward draining lymph nodes but also a local antigen presentation by these cells in the lung to TRM precursors is required for the differentiation into lung-resident memory T cells90. Thus,

+ respiratory CD103 DCs seem to influence the formation of TRM both in lymphoid tissues and locally in the lung. The co-delivery of rAd-IL-1β led to an elevated recruitment of adaptive immune cells like CD4+ and CD8+ T cells as well as B cells starting at day seven. This elevation was also observed for NP-specific CTL with a particular accumulation of KLRG1- cells. Importantly, it has been described that only KLRG1- effector-type CD8+ T cells can differentiate into

+ + CD103 TRM, while KLRG1 cells are already terminally differentiated and thus cannot become tissue-resident. The recruitment of these cells relies on the CXCR3-binding chemokines CXCL9 and CXCL1073. In the present study, the mucosal expression of IL-1β induced the secretion of CXCL10 into the BALF at day seven post-immunization, which coincided with the beginning infiltration of antigen-specific KLRG1- CTL. Therefore, most likely a combination of an improved priming by CD103+ DCs followed by an efficient

Discussion

- recruitment into the inflamed lung leads to the accumulation of KLRG1 TRM precursors upon the administration of rAd-IL-1β.

The final differentiation of the precursor cells into TRM occurs in the tissue and requires certain tissue-derived signals. First of all, local antigen presentation by respiratory

+ 90 CD103 DCs is required for the upregulation of CD69 on TRM precursors . Inflammatory cytokines like TGFβ have also been described to be important in this process92. In turn, CD69 inhibits the expression of the sphingosine 1-phosphate receptor 1, a crucial component for the tissue egress of effector T cells toward lymphoid tissues92. Indeed, probably by the elevated antigen presentation by respiratory DCs in the lung plus the presence of TGFβ and other cytokines, KLRG1- CTL showed an earlier CD69 upregulation upon the rAd-IL-1β treatment compared to non-adjuvanted vaccinations. A second important tissue-egress mechanism is the CCR7-chemokine gradient, which guides CTL toward lymphoid tissues. It is tempting to speculate that the pronounced local production of the CCR7 ligand CCL21 is an additional measure to prevent tissue exit and thereby increases the efficiency of the TRM imprinting. In line with this hypothesis, Mackay et al. showed that

73 CCR7-deficient CTL resulted in higher numbers of differentiated TRM in the skin . Moreover, upon the mucosal administration of rAd-IL-1β, not only CD69 but also the expression of CD103 on NP-specific lung CTL was drastically increased. It is probably the elevated production of mucosal TGFβ, which mediates this upregulation, since this cytokine is the most important regulator of CD103 expression on CTL96. Interestingly, respiratory CD103+ DCs have been described as potent producers and activators of latent TGFβ into its active state90, adding one more important feature to this DC subset. The upregulation of CD103 on

TRM is important, because it contributes to the tissue retention by mediating the binding of CTL to E-cadherin on tissue cells179,180. The transcription of the E-cadherin gene Cdh1 was investigated in the lung tissue but did not show an upregulation by rAd-IL-1β, it even revealed a slight decrease of the normalized transcription. These normalized values were obtained by dividing the absolute mRNA copy number of the target gene by the copy numbers of reference genes. However, the used reference genes Eef2 and Ubc are expressed ubiquitously and were strongly influenced by the infiltration of immune cells. In contrast, E-cadherin is mainly expressed in (the stable number of) tissue cells indicating that the normalization underestimates Cdh1 levels in the rAd-IL-1β group. Indeed, the comparison of the absolute copy numbers reveals an increased Cdh1 transcription four and seven days post-immunization in rAd-IL-1β-treated mice (data not shown). Thereby, it suggests that in addition to CD103, its ligand is also upregulated by IL-1β.

Not only the differentiation of TRM and a concomitant retention in peripheral tissues, but also the persistence of these cells is required for a long-lived mucosal T cell response. In this regard, lung TRM are considered as moderately long-lived, since they vanish over a time

Discussion of several months53. The role of IL-7 and IL-15 in the homeostatic self-renewal of peripheral CTL is still being discussed controversially94,96,97, but these cytokines were not detected in the BALF within 14 days after the rAd-IL-1β treatment (data not shown). However, it cannot be excluded that these cytokines are not secreted into the BALF or were upregulated later after the immunization. Nevertheless, the vaccine-induced KLRG1- CTL showed a more stable expression of CD127 (IL-7 receptor α), which indicates an enhanced potential for homeostasis. As already discussed above, the vaccination strategy used in the present study induced a broad immunity durable for at least 100 days. Whether the improved quantity or quality of the T cell memory induced by the co-application of rAd-IL-1β also influences the longevity of these responses should be elaborated in further studies. Taken together, the mechanistic investigations demonstrated that the inclusion of rAd-IL-1β in intranasal vaccinations initiates several checkpoints in the priming, recruitment, and differentiation of lung TRM. One key finding is that rAd-IL-1β activates the lung tissue, which is essential for the recruitment of innate and adaptive immune cells but also provides a suitable inflammatory environment for the differentiation and persistence of TRM. Interestingly,

+ several of the above mentioned checkpoints for the development of CD8 TRM are also

+ 93 + required for the formation of CD4 TRM . Thus, it is possible that CD4 TRM are also induced more efficiently through the administration of rAd-IL-1β. Therefore, future studies should

+ investigate the ability of the present vaccination strategy to promote CD4 TRM and their role in HSI. It is of note that previous studies, in which mice were immunized intramuscularly with HA/NP-encoding DNA plasmids, demonstrated virtually no beneficial effects of a co- administration of IL-1β-encoding plasmids. Neither the immunogenicity nor the protection against homologous or heterologous IAV strains was improved (data not shown). Thus, the interaction of IL-1β with the mucosal epithelium might be an essential requirement for its adjuvancy. The absence of an effective tissue activation could also explain why rAd-IL-18 did not improve T cell responses. Stromal cells normally express the IL-18 receptor subunit α but lack expression of the subunit β. This incomplete receptor binds IL-18 but does not induce downstream signaling, thus resembling a decoy receptor. In contrast, immune cells like DCs and T cells are responsive to IL-18152. Assuming that IL-18 does not activate the lung epithelium, immune cells cannot efficiently enter the lung mucosa, which results in a lack of IL-18-responsive cells. However, a potential strategy to harness the adjuvant properties of IL-18 could be a combinatory co-administration of rAd-IL-18 and rAd-IL-1β, in which the mucosal expression of the latter one would attract IL-18-responsive target cells. A remaining question is, whether rAd-IL-1β only starts a self-sustaining inflammation with the activation of the lung tissue or whether it also directly influences infiltrated immune cells. Based on the kinetics of the IL-1β expression and the cellular infiltration, it is

Discussion conceivable that the adjuvant interacts with immune cells of the innate immune system early after the immunization, for example with dendritic cells or monocytes. However, upon the arrival of the first T and B cells, the adjuvant expression is mostly diminished. Supporting the notion that the interaction of IL-1β with DCs is important for its adjuvant activity, Pang et al. have reported that an efficient induction of lung CTL upon an IAV infection requires IL-1 receptor signaling in CD103+ DCs37. Interestingly, the absence of IL-1 receptor expression in lung tissue did not affect the CTL response in this study. A possible explanation for this finding could be that IL-1 receptor signaling in tissue cells might be redundant upon a natural IAV infection due to the induction of other inflammatory factors with similar downstream effects, for example TNFα. In contrast, another report describes that the adjuvancy of exogenous IL-1β mostly relies on IL-1β signaling in CTL, but the localization of these cells to the lung requires the expression of the IL-1 receptor in tissue cells162. IL-1 signaling in DCs was not required for the adjuvant effects. Since IL-1β was given systemically in these experiments, the cytokine might have had direct contact with circulating T cells, while respiratory DCs were probably not involved in that administration mode. However, in regard of these contradicting results, further studies should elaborate the effects of vector-encoded IL-1β on the respective immune cells and the lung tissue. Immunizations of bone marrow chimeras181, in which either stromal or hematopoietic cells are deficient for the IL-1 receptor, can be helpful to determine the contribution of either cell compartment to the rAd-IL-1β adjuvant effects. Moreover, a conditional knockout of the IL-1 receptor in CD8+ T cells could be used to determine the requirement of intrinsic IL-1 receptor signaling in these cells. IL-1β is one of the most potent cytokines and shows already at doses of 1 ng/kg biological activity in humans. Subcutaneous administrations can lead to swelling, local pain and erythema, while i.v. injections with high doses (>100 ng/kg) induce fatigue, headache, fever and hypotension182. In the current study, the intranasal administration of 109 particles rAd-IL-1β induced slight side effects within the first days after the immunization, mostly evident as a moderate lethargy and ruffled fur. Other studies found that the intranasal delivery of rAd-IL-1β to rats and mice resulted in acute lung injury and fibrosis183,184. However, it is important to note that these experiments were performed with 10- to 50-fold higher vector doses (weight-normalized) compared to the highest dose of rAd-IL-1β (109 particles) administrated in the present study. Licensed vaccine adjuvants like alum185 and also mild respiratory tract infections with rhinoviruses186 induce elevated levels of IL-1β without acute or irreversible damage. Therefore, it is likely that harmful side effects arise only at higher, unphysiological doses. With the intention to minimize side effects, lower adjuvant doses were administrated and the immunogenicity and the vaccine efficacy were analyzed. For that purpose, animals were vaccinated with 107, 108 or 109 particles rAd-IL-1β in combination with rAd-HA/NP.

Discussion

Importantly, the above mentioned side effects were completely absent in mice that got the 108 or 107 adjuvant dose, but the inclusion of 107 particles in the vaccine was already sufficient to reduce the weight loss upon an infection with a divergent H3N2 strain. HA- specific humoral responses were improved by all adjuvant doses, but the 107 dose induced only slight differences. However, while the number and the TRM phenotype imprinting of the total CD8+ T cells were increased with the 109 and 108 adjuvant doses, the NP-specific CD8+ T cell responses were not increased in the 107 and 108 dose groups compared to vaccinations without an adjuvant. Antigen-specific CD4+ T cells seemed at least by trend elevated in all rAd-IL-1β-treated groups. This could indicate that at lower adjuvant doses, CD4+ T cells mediate the improved HSI. However, the most important finding is that low dose administrations of rAd-IL-1β increase the protection against divergent IAV in the absence of obvious side effects. A forced ventilation technique in combination with a methacholine provocation challenge was exploited to measure the lung function after the treatment with the above mentioned adjuvant doses. Specifically, the airway resistance (RN), tissue elastance (H) and tissue damping (G) were evaluated three days after the immunization. Compared to naïve mice, the tissue damping was minimally elevated with increasing doses of rAd-IL-1β, while the tissue elastance decreased. The airway resistance was slightly elevated in the 108 particle group, while higher or lower doses did not affect this parameter. However, the differences were overall negligible and none of the parameters indicated a pathological phenotype. For example, infections with IAV or the syncytial respiratory virus, which lead to the destruction of airway epithelial cells and a concomitant recruitment of inflammatory cells, increase the airway responsiveness (RN, G and H) significantly upon a methacholine challenge187,188. Moreover, it has been described that fibrotic alterations in the lung result in higher tissue damping G and tissue elastance H189, which was not observed after the immunization with rAd-IL-1β in the present study. On the other hand, fibrosis is often observed at later time points after a harmful treatment190. However, upon an infection with IAV, rAd-IL-1β-treated mice (without rAd-HA/NP) did not show any differences in weight loss or virus replication compared to untreated mice. This indicates the absence of a chronic lung pathology, which would probably worsen the disease phenotype. Taken together, these data demonstrate that although many immunological characteristics of a natural IAV infection are mimicked, the lung function is not affected by rAd-IL-1β. Furthermore, the side effects observed after the administration of 109 particles of the adjuvant were not due to a pathological phenotype of the lung and can be circumvented by the use of lower doses. In conclusion, the present thesis identified rAd-IL-1β as a potent adjuvant in intranasal vector immunizations against influenza A. The mucosal expression of IL-1β elevated both humoral as well as cellular immune responses and consequently improved the protection

Discussion against homologous and heterologous influenza strains. Most impressively, rAd-IL-1β specifically induced lung-resident memory CD8+ T cells by the initiation of several critical checkpoints in the formation of TRM. Given the phenotypic and functional similarities of murine and human TRM, this vaccination strategy seems applicable to human individuals. Since these frontline immune cells provide an immediate and efficient clearance of respiratory infections, the results presented here have implications for the design of vaccines against other respiratory infections. Moreover, several chemokines and cytokines that were induced by rAd-IL-1β have not yet been connected to the formation of lung TRM. It might be possible to bypass IL-1β and to use some of these downstream factors instead to promote the establishment of TRM. Taken together, rAd-IL-1β revealed in this study a hitherto unprecedented ability to stimulate local T cell responses and thereby induced a broad immunity against several unrelated IAV strains. Considering the importance of TRM-mediated protection at mucosal barriers, this study has profound implications for the vaccine development.

100

Bibliography

5 Bibliography

1. World Health Organization. Influenza (seasonal). Fact sheet no. 211 (2009). Available at: http://www.who.int/mediacentre/factsheets/fs211/en/. (Accessed: 16th September 2016) 2. Hause, B. M., Collin, E. A., Liu, R., Huang, B., Sheng, Z., Lu, W., Wang, D., Nelson, E. A. & Li, F. Characterization of a Novel Influenza Virus in Cattle and Swine: Proposal for a New Genus in the Orthomyxoviridae Family. MBio 5, e00031-14- e00031-14 (2014). 3. Webster, R. G., Bean, W. J., Gorman, O. T., Chambers, T. M. & Kawaoka, Y. Evolution and ecology of influenza A viruses. Microbiol. Rev. 56, 152–79 (1992). 4. Wu, Y., Wu, Y., Tefsen, B., Shi, Y. & Gao, G. F. Bat-derived influenza-like viruses H17N10 and H18N11. Trends Microbiol. 22, 183–191 (2014). 5. Air, G. M. Sequence relationships among the hemagglutinin genes of 12 subtypes of influenza A virus differ greatly , cysteine and some other amino acid residues are mally derived from viruses circulating or sequestered in species using as primer a synthetic dodecanu. Proc. Natl. Acad. Sci. U. S. A. 78, 7639–7643 (1981). 6. Nobusawa, E., Aoyama, T., Kato, H., Suzuki, Y., Tateno, Y. & Nakajima, K. Comparison of complete amino acid sequences and receptor-binding properties among 13 serotypes of hemagglutinins of influenza A viruses. Virology 182, 475–485 (1991). 7. Russell, R. J., Gamblin, S. J., Haire, L. F., Stevens, D. J., Xiao, B., Ha, Y. & Skehel, J. J. H1 and H7 influenza haemagglutinin structures extend a structural classification of haemagglutinin subtypes. Virology 325, 287–96 (2004). 8. Fouchier, R. A. M., Munster, V., Wallensten, A., Bestebroer, T. M., Herfst, S., Smith, D., Rimmelzwaan, G. F., Olsen, B. & Osterhaus, A. D. M. E. Characterization of a novel influenza A virus hemagglutinin subtype (H16) obtained from black-headed gulls. J. Virol. 79, 2814–22 (2005). 9. Tong, S., Zhu, X., Li, Y., Shi, M., Zhang, J., Bourgeois, M., Yang, H., Chen, X., Recuenco, S., Gomez, J., Chen, L.-M., Johnson, A., Tao, Y., Dreyfus, C., Yu, W., McBride, R., Carney, P. J., Gilbert, A. T., Chang, J., Guo, Z., Davis, C. T., Paulson, J. C., Stevens, J., Rupprecht, C. E., Holmes, E. C., Wilson, I. A. & Donis, R. O. New World Bats Harbor Diverse Influenza A Viruses. PLoS Pathog. 9, e1003657 (2013). 10. Sanjuan, R., Nebot, M. R., Chirico, N., Mansky, L. M. & Belshaw, R. Viral Mutation Rates. J. Virol. 84, 9733–9748 (2010). 11. Smith, D. J., Forrest, S., Ackley, D. H. & Perelson, A. S. Variable efficacy of repeated annual influenza vaccination. Proc. Natl. Acad. Sci. U. S. A. 96, 14001–6 (1999). 12. Smith, D. J., Lapedes, A. S., de Jong, J. C., Bestebroer, T. M., Rimmelzwaan, G. F., Osterhaus, A. D. M. E. & Fouchier, R. a M. Mapping the antigenic and genetic evolution of influenza virus. Science 305, 371–6 (2004). 13. Medina, R. a & García-Sastre, A. Influenza A viruses: new research developments. Nat. Rev. Microbiol. 9, 590–603 (2011). 14. Garten, R. J., Davis, C. T., Russell, C. A., Shu, B., Lindstrom, S., Balish, A., Sessions, W. M., Cox, N. J., et al. Antigenic and Genetic Characteristics of Swine- Origin 2009 A(H1N1) Influenza Viruses Circulating in Humans. Science (80-. ). 325, 197–201 (2009). 15. Lam, T. T.-Y., Zhou, B., Wang, J., Chai, Y., Shen, Y., Chen, X., Ma, C., Hong, W., Chen, Y., Zhang, Y., Duan, L., Chen, P., Jiang, J., Zhang, Y., Li, L., Poon, L. L. M., Webby, R. J., Smith, D. K., Leung, G. M., Peiris, J. S. M., Holmes, E. C., Guan, Y. & Zhu, H. Dissemination, divergence and establishment of H7N9 influenza viruses in China. Nature 522, 102–105 (2015). 16. Olsen, B., Munster, V. J., Wallensten, A., Waldenstrom, J., Osterhaus, A. D. M. E. & Fouchier, R. A. M. Global Patterns of Influenza A Virus in Wild Birds. Science (80-.

101

Bibliography

). 312, 384–388 (2006). 17. Peiris, J. S., Guan, Y., Markwell, D., Ghose, P., Webster, R. G. & Shortridge, K. F. Cocirculation of avian H9N2 and contemporary ‘human’ H3N2 influenza A viruses in pigs in southeastern China: potential for genetic reassortment? J. Virol. 75, 9679–86 (2001). 18. Vijaykrishna, D., Poon, L. L. M., Zhu, H. C., Ma, S. K., Li, O. T. W., Cheung, C. L., Smith, G. J. D., Peiris, J. S. M. & Guan, Y. Reassortment of Pandemic H1N1/2009 Influenza A Virus in Swine. Science (80-. ). 328, 1529–1529 (2010). 19. Lowen, A. C., Mubareka, S., Steel, J. & Palese, P. Influenza Virus Transmission Is Dependent on Relative Humidity and Temperature. PLoS Pathog. 3, e151 (2007). 20. Cowling, B. J., Ip, D. K. M., Fang, V. J., Suntarattiwong, P., Olsen, S. J., Levy, J., Uyeki, T. M., Leung, G. M., Malik Peiris, J. S., Chotpitayasunondh, T., Nishiura, H. & Mark Simmerman, J. Aerosol transmission is an important mode of influenza A virus spread. Nat. Commun. 4, 1935 (2013). 21. Shinya, K., Ebina, M., Yamada, S., Ono, M., Kasai, N. & Kawaoka, Y. Avian flu: influenza virus receptors in the human airway. Nature 440, 435–6 (2006). 22. Taubenberger, J. K. & Morens, D. M. The pathology of influenza virus infections. Annu. Rev. Pathol. 3, 499–522 (2008). 23. Manicassamy, B., Manicassamy, S., Belicha-Villanueva, A., Pisanelli, G., Pulendran, B. & Garcia-Sastre, A. Analysis of in vivo dynamics of influenza virus infection in mice using a GFP reporter virus. Proc. Natl. Acad. Sci. 107, 11531–11536 (2010). 24. Schulz, O., Diebold, S. S., Chen, M., Näslund, T. I., Nolte, M. A., Alexopoulou, L., Azuma, Y.-T., Flavell, R. A., Liljeström, P. & Reis e Sousa, C. Toll-like receptor 3 promotes cross-priming to virus-infected cells. Nature 433, 887–92 (2005). 25. Diebold, S. S., Kaisho, T., Hemmi, H., Akira, S. & Reis e Sousa, C. Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA. Science 303, 1529–31 (2004). 26. Pichlmair, A., Schulz, O., Tan, C. P., Naslund, T. I., Liljestrom, P., Weber, F. & Reis e Sousa, C. RIG-I-Mediated Antiviral Responses to Single-Stranded RNA Bearing 5’-Phosphates. Science (80-. ). 314, 997–1001 (2006). 27. Iwasaki, A. & Pillai, P. S. Innate immunity to influenza virus infection. Nat. Rev. Immunol. 14, 315–28 (2014). 28. Seo, S.-U., Kwon, H.-J., Song, J.-H., Byun, Y.-H., Seong, B. L., Kawai, T., Akira, S. & Kweon, M.-N. MyD88 signaling is indispensable for primary influenza A virus infection but dispensable for secondary infection. J. Virol. 84, 12713–22 (2010). 29. Le Goffic, R., Balloy, V., Lagranderie, M., Alexopoulou, L., Escriou, N., Flavell, R., Chignard, M. & Si-Tahar, M. Detrimental contribution of the Toll-like receptor (TLR)3 to influenza A virus-induced acute pneumonia. PLoS Pathog. 2, e53 (2006). 30. Pang, I. K., Pillai, P. S. & Iwasaki, A. Efficient influenza A virus replication in the respiratory tract requires signals from TLR7 and RIG-I. Proc. Natl. Acad. Sci. U. S. A. 110, (2013). 31. Koyama, S., Ishii, K. J., Kumar, H., Tanimoto, T., Coban, C., Uematsu, S., Kawai, T. & Akira, S. Differential role of TLR- and RLR-signaling in the immune responses to influenza A virus infection and vaccination. J. Immunol. 179, 4711–20 (2007). 32. Heer, A. K., Shamshiev, A., Donda, A., Uematsu, S., Akira, S., Kopf, M. & Marsland, B. J. TLR Signaling Fine-Tunes Anti-Influenza B Cell Responses without Regulating Effector T Cell Responses. J. Immunol. 178, 2182–2191 (2007). 33. Pang, I. K. & Iwasaki, A. Inflammasomes as mediators of immunity against influenza virus. Trends Immunol. 32, 34–41 (2011). 34. Ichinohe, T., Pang, I. K. & Iwasaki, A. Influenza virus activates inflammasomes via its intracellular M2 ion channel. Nat. Immunol. 11, 404–410 (2010). 35. Van Der Sluijs, K. F., Van Elden, L. J. R., Arens, R., Nijhuis, M., Schuurman, R., Florquin, S., Kwakkel, J., Akira, S., Jansen, H. M., Lutter, R. & Van Der Polls, T. Enhanced viral clearance in interleukin-18 gene-deficient mice after pulmonary infection with influenza A virus. Immunology 114, 112–20 (2005).

102

Bibliography

36. Schmitz, N., Kurrer, M., Bachmann, M. F. & Kopf, M. Interleukin-1 is responsible for acute lung immunopathology but increases survival of respiratory influenza virus infection. J. Virol. 79, 6441–8 (2005). 37. Pang, I. K., Ichinohe, T. & Iwasaki, A. IL-1R signaling in dendritic cells replaces pattern-recognition receptors in promoting CD8+ T cell responses to influenza A virus. Nat. Immunol. 14, 246–53 (2013). 38. Sanders, C. J., Doherty, P. C. & Thomas, P. G. Respiratory epithelial cells in innate immunity to influenza virus infection. Cell Tissue Res. 343, 13–21 (2011). 39. Oslund, K. L. & Baumgarth, N. Influenza-induced innate immunity: regulators of viral replication, respiratory tract pathology & adaptive immunity. Future Virol. 6, 951– 962 (2011). 40. Pober, J. S. & Sessa, W. C. Evolving functions of endothelial cells in inflammation. Nat. Rev. Immunol. 7, 803–815 (2007). 41. GeurtsvanKessel, C. H., Willart, M. A. M., van Rijt, L. S., Muskens, F., Kool, M., Baas, C., Thielemans, K., Bennett, C., Clausen, B. E., Hoogsteden, H. C., Osterhaus, A. D. M. E., Rimmelzwaan, G. F. & Lambrecht, B. N. Clearance of influenza virus from the lung depends on migratory langerin + CD11b − but not plasmacytoid dendritic cells. J. Exp. Med. 205, 1621–1634 (2008). 42. Kim, T. S. & Braciale, T. J. Respiratory Dendritic Cell Subsets Differ in Their Capacity to Support the Induction of Virus-Specific Cytotoxic CD8+ T Cell Responses. PLoS One 4, e4204 (2009). 43. Ho, A. W. S., Prabhu, N., Betts, R. J., Ge, M. Q., Dai, X., Hutchinson, P. E., Lew, F. C., Wong, K. L., Hanson, B. J., Macary, P. A. & Kemeny, D. M. Lung CD103+ Dendritic Cells Efficiently Transport Influenza Virus to the Lymph Node and Load Viral Antigen onto MHC Class I for Presentation to CD8 T Cells. J. Immunol. 187, 6011– 6021 (2011). 44. Heer, A. K., Harris, N. L., Kopf, M. & Marsland, B. J. CD4+ and CD8+ T cells exhibit differential requirements for CCR7-mediated antigen transport during influenza infection. J. Immunol. 181, 6984–94 (2008). 45. Braciale, T. J., Sun, J. & Kim, T. S. Regulating the adaptive immune response to respiratory virus infection. Nat. Rev. Immunol. 12, 295–305 (2012). 46. Flynn, K. J., Belz, G. T., Altman, J. D., Ahmed, R., Woodland, D. L. & Doherty, P. C. Virus-specific CD8+ T cells in primary and secondary influenza pneumonia. Immunity 8, 683–91 (1998). 47. Lawrence, C. W. & Braciale, T. J. Activation, differentiation, and migration of naive virus-specific CD8+ T cells during pulmonary influenza virus infection. J. Immunol. 173, 1209–18 (2004). 48. Joshi, N. S., Cui, W., Chandele, A., Lee, H. K., Urso, D. R., Hagman, J., Gapin, L. & Kaech, S. M. Inflammation Directs Memory Precursor and Short-Lived Effector CD8+ T Cell Fates via the Graded Expression of T-bet Transcription Factor. Immunity 27, 281–295 (2007). 49. Kaech, S. M. & Wherry, E. J. Heterogeneity and Cell-Fate Decisions in Effector and Memory CD8+ T Cell Differentiation during Viral Infection. Immunity 27, 393–405 (2007). 50. Topham, D. J., Tripp, R. A. & Doherty, P. C. CD8+ T cells clear influenza virus by perforin or Fas-dependent processes. J. Immunol. 159, 5197–200 (1997). 51. Brincks, E. L., Katewa, A., Kucaba, T. A., Griffith, T. S. & Legge, K. L. CD8 T cells utilize TRAIL to control influenza virus infection. J. Immunol. 181, 4918–25 (2008). 52. Brown, D. M., Lee, S., Garcia-Hernandez, M. D. L. L. & Swain, S. L. Multifunctional CD4 cells expressing gamma interferon and perforin mediate protection against lethal influenza virus infection. J. Virol. 86, 6792–803 (2012). 53. Wu, T., Hu, Y., Lee, Y.-T., Bouchard, K. R., Benechet, A., Khanna, K. & Cauley, L. S. Lung-resident memory CD8 T cells (TRM) are indispensable for optimal cross- protection against pulmonary virus infection. J. Leukoc. Biol. 95, 215–224 (2014). 54. Graham, M. B. & Braciale, T. J. Resistance to and recovery from lethal influenza virus infection in B lymphocyte-deficient mice. J. Exp. Med. 186, 2063–8 (1997).

103

Bibliography

55. Miao, H., Hollenbaugh, J. A., Zand, M. S., Holden-Wiltse, J., Mosmann, T. R., Perelson, A. S., Wu, H. & Topham, D. J. Quantifying the Early Immune Response and Adaptive Immune Response Kinetics in Mice Infected with Influenza A Virus. J. Virol. 84, 6687–6698 (2010). 56. Subbarao, K., Murphy, B. R. & Fauci, A. S. Development of effective vaccines against pandemic influenza. Immunity 24, 5–9 (2006). 57. Renegar, K. B., Small, P. A., Boykins, L. G. & Wright, P. F. Role of IgA versus IgG in the Control of Influenza Viral Infection in the Murine Respiratory Tract. J. Immunol. 173, 1978–1986 (2004). 58. Couch, R. B., Kasel, J. A., Gerin, J. L., Schulman, J. L. & Kilbourne, E. D. Induction of partial immunity to influenza by a neuraminidase-specific vaccine. J. Infect. Dis. 129, 411–20 (1974). 59. Ramos, E. L., Mitcham, J. L., Koller, T. D., Bonavia, A., Usner, D. W., Balaratnam, G., Fredlund, P. & Swiderek, K. M. Efficacy and Safety of Treatment With an Anti- M2e Monoclonal Antibody in Experimental Human Influenza. J. Infect. Dis. 211, 1038– 1044 (2015). 60. Bui, H.-H., Peters, B., Assarsson, E., Mbawuike, I. & Sette, A. Ab and T cell epitopes of influenza A virus, knowledge and opportunities. Proc. Natl. Acad. Sci. 104, 246–251 (2007). 61. Assarsson, E., Bui, H.-H., Sidney, J., Zhang, Q., Glenn, J., Oseroff, C., Mbawuike, I. N., Alexander, J., Newman, M. J., Grey, H. & Sette, A. Immunomic Analysis of the Repertoire of T-Cell Specificities for Influenza A Virus in Humans. J. Virol. 82, 12241– 12251 (2008). 62. Hoft, D. F., Babusis, E., Worku, S., Spencer, C. T., Lottenbach, K., Truscott, S. M., Abate, G., Sakala, I. G., Edwards, K. M., Creech, C. B., Gerber, M. a, Bernstein, D. I., Newman, F., Graham, I., Anderson, E. L. & Belshe, R. B. Live and inactivated influenza vaccines induce similar humoral responses, but only live vaccines induce diverse T-cell responses in young children. J. Infect. Dis. 204, 845–53 (2011). 63. Schulman, J. L. & Kilbourne, E. D. Induction of partial specific heterotypic immunity in mice by a single infection with influenza A virus. J. Bacteriol. 89, 170–4 (1965). 64. Liang, S., Mozdzanowska, K., Palladino, G. & Gerhard, W. Heterosubtypic immunity to influenza type A virus in mice. Effector mechanisms and their longevity. J. Immunol. 152, 1653–61 (1994). 65. Powell, T. J., Strutt, T., Reome, J., Hollenbaugh, J. A., Roberts, A. D., Woodland, D. L., Swain, S. L. & Dutton, R. W. Priming with Cold-Adapted Influenza A Does Not Prevent Infection but Elicits Long-Lived Protection against Supralethal Challenge with Heterosubtypic Virus. J. Immunol. 178, 1030–1038 (2007). 66. Lanthier, P. A., Huston, G. E., Moquin, A., Eaton, S. M., Szaba, F. M., Kummer, L. W., Tighe, M. P., Kohlmeier, J. E., Blair, P. J., Broderick, M., Smiley, S. T. & Haynes, L. Live attenuated influenza vaccine (LAIV) impacts innate and adaptive immune responses. Vaccine 29, 7849–7856 (2011). 67. Hayward, A. C., Wang, L., Goonetilleke, N., Fragaszy, E. B., Bermingham, A., Copas, A., Dukes, O., Millett, E. R. C., Nazareth, I., Nguyen-Van-Tam, J. S., Watson, J. M., Zambon, M., Johnson, A. M. & McMichael, A. J. Natural T Cell– mediated Protection against Seasonal and Pandemic Influenza. Results of the Flu Watch Cohort Study. Am. J. Respir. Crit. Care Med. 191, 1422–1431 (2015). 68. Sridhar, S., Begom, S., Bermingham, A., Hoschler, K., Adamson, W., Carman, W., Bean, T., Barclay, W., Deeks, J. J. & Lalvani, A. Cellular immune correlates of protection against symptomatic pandemic influenza. Nat. Med. 19, 1305–1312 (2013). 69. Klonowski, K. D., Williams, K. J., Marzo, A. L., Blair, D. A., Lingenheld, E. G. & Lefrançois, L. Dynamics of Blood-Borne CD8 Memory T Cell Migration In Vivo. Immunity 20, 551–562 (2004). 70. Anderson, K. G., Sung, H., Skon, C. N., Lefrancois, L., Deisinger, A., Vezys, V. & Masopust, D. Cutting Edge: Intravascular Staining Redefines Lung CD8 T Cell Responses. J. Immunol. 189, 2702–2706 (2012). 71. Gebhardt, T., Wakim, L. M., Eidsmo, L., Reading, P. C., Heath, W. R. & Carbone,

104

Bibliography

F. R. Memory T cells in nonlymphoid tissue that provide enhanced local immunity during infection with herpes simplex virus. Nat. Immunol. 10, 524–530 (2009). 72. Jiang, X., Clark, R. A., Liu, L., Wagers, A. J., Fuhlbrigge, R. C. & Kupper, T. S. Skin infection generates non-migratory memory CD8+ TRM cells providing global skin immunity. Nature 483, 227–231 (2012). 73. Mackay, L. K., Rahimpour, A., Ma, J. Z., Collins, N., Stock, A. T., Hafon, M.-L., Vega-Ramos, J., Lauzurica, P., Mueller, S. N., Stefanovic, T., Tscharke, D. C., Heath, W. R., Inouye, M., Carbone, F. R. & Gebhardt, T. The developmental pathway for CD103+CD8+ tissue-resident memory T cells of skin. Nat. Immunol. 14, 1294–1301 (2013). 74. Wakim, L. M., Woodward-Davis, A. & Bevan, M. J. Memory T cells persisting within the brain after local infection show functional adaptations to their tissue of residence. Proc. Natl. Acad. Sci. 107, 17872–17879 (2010). 75. Masopust, D., Choo, D., Vezys, V., Wherry, E. J., Duraiswamy, J., Akondy, R., Wang, J., Casey, K. A., Barber, D. L., Kawamura, K. S., Fraser, K. A., Webby, R. J., Brinkmann, V., Butcher, E. C., Newell, K. A. & Ahmed, R. Dynamic T cell migration program provides resident memory within intestinal epithelium. J. Exp. Med. 207, 553–564 (2010). 76. Bergsbaken, T. & Bevan, M. J. Proinflammatory microenvironments within the intestine regulate the differentiation of tissue-resident CD8+ T cells responding to infection. Nat. Immunol. 16, 406–414 (2015). 77. Lee, Y.-T., Suarez-Ramirez, J. E., Wu, T., Redman, J. M., Bouchard, K., Hadley, G. A. & Cauley, L. S. Environmental and Antigen Receptor-Derived Signals Support Sustained Surveillance of the Lungs by Pathogen-Specific Cytotoxic T Lymphocytes. J. Virol. 85, 4085–4094 (2011). 78. Knudson, C. J., Weiss, K. A., Hartwig, S. M. & Varga, S. M. The Pulmonary Localization of Virus-Specific T Lymphocytes Is Governed by the Tissue Tropism of Infection. J. Virol. 88, 9010–9016 (2014). 79. Zens, K. D., Chen, J. K. & Farber, D. L. Vaccine-generated lung tissue–resident memory T cells provide heterosubtypic protection to influenza infection. JCI Insight 1, (2016). 80. Schenkel, J. M., Fraser, K. a, Vezys, V. & Masopust, D. Sensing and alarm function of resident memory CD8(+) T cells. Nat. Immunol. 14, 509–13 (2013). 81. Mueller, S. N. & Mackay, L. K. Tissue-resident memory T cells: local specialists in immune defence. Nat. Rev. Immunol. 16, 79–89 (2015). 82. Purwar, R., Campbell, J., Murphy, G., Richards, W. G., Clark, R. A. & Kupper, T. S. Resident Memory T Cells (TRM) Are Abundant in Human Lung: Diversity, Function, and Antigen Specificity. PLoS One 6, e16245 (2011). 83. Piet, B., de Bree, G. J., Smids-Dierdorp, B. S., van der Loos, C. M., Remmerswaal, E. B. M., von der Thüsen, J. H., van Haarst, J. M. W., Eerenberg, J. P., ten Brinke, A., van der Bij, W., Timens, W., van Lier, R. A. W. & Jonkers, R. E. CD8+ T cells with an intraepithelial phenotype upregulate cytotoxic function upon influenza infection in human lung. J. Clin. Invest. 121, 2254–2263 (2011). 84. Sathaliyawala, T., Kubota, M., Yudanin, N., Turner, D., Camp, P., Thome, J. J. C., Bickham, K. L., Lerner, H., Goldstein, M., Sykes, M., Kato, T. & Farber, D. L. Distribution and Compartmentalization of Human Circulating and Tissue-Resident Memory T Cell Subsets. Immunity 38, 187–197 (2013). 85. Thome, J. J. C., Yudanin, N., Ohmura, Y., Kubota, M., Grinshpun, B., Sathaliyawala, T., Kato, T., Lerner, H., Shen, Y. & Farber, D. L. Spatial Map of Human T Cell Compartmentalization and Maintenance over Decades of Life. Cell 159, 814–828 (2014). 86. Turner, D. L., Bickham, K. L., Thome, J. J., Kim, C. Y., D’Ovidio, F., Wherry, E. J. & Farber, D. L. Lung niches for the generation and maintenance of tissue-resident memory T cells. Mucosal Immunol. 7, 501–510 (2014). 87. Jozwik, A., Habibi, M. S., Paras, A., Zhu, J., Guvenel, A., Dhariwal, J., Almond, M., Wong, E. H. C., Sykes, A., Maybeno, M., Del Rosario, J., Trujillo-Torralbo, M.-

105

Bibliography

B., Mallia, P., Sidney, J., Peters, B., Kon, O. M., Sette, A., Johnston, S. L., Openshaw, P. J. & Chiu, C. RSV-specific airway resident memory CD8+ T cells and differential disease severity after experimental human infection. Nat. Commun. 6, 10224 (2015). 88. Iborra, S., Martínez-López, M., Khouili, S. C., Enamorado, M., Cueto, F. J., Conde- Garrosa, R., del Fresno, C. & Sancho, D. Optimal Generation of Tissue-Resident but Not Circulating Memory T Cells during Viral Infection Requires Crosspriming by DNGR-1+ Dendritic Cells. Immunity 45, 847–860 (2016). 89. Kohlmeier, J. E., Miller, S. C., Smith, J., Lu, B., Gerard, C., Cookenham, T., Roberts, A. D. & Woodland, D. L. The Chemokine Receptor CCR5 Plays a Key Role in the Early Memory CD8+ T Cell Response to Respiratory Virus Infections. Immunity 29, 101–113 (2008). 90. Wakim, L. M., Smith, J., Caminschi, I., Lahoud, M. H. & Villadangos, J. A. Antibody-targeted vaccination to lung dendritic cells generates tissue-resident memory CD8 T cells that are highly protective against influenza virus infection. Mucosal Immunol. 8, 1060–1071 (2015). 91. Shiow, L. R., Rosen, D. B., Brdičková, N., Xu, Y., An, J., Lanier, L. L., Cyster, J. G. & Matloubian, M. CD69 acts downstream of interferon-α/β to inhibit S1P1 and lymphocyte egress from lymphoid organs. Nature 440, 540–544 (2006). 92. Skon, C. N., Lee, J.-Y., Anderson, K. G., Masopust, D., Hogquist, K. A. & Jameson, S. C. Transcriptional downregulation of S1pr1 is required for the establishment of resident memory CD8+ T cells. Nat. Immunol. 14, 1285–1293 (2013). 93. Iijima, N. & Iwasaki, A. Tissue instruction for migration and retention of TRM cells. Trends Immunol. 36, 556–564 (2015). 94. Woodland, D. L. & Kohlmeier, J. E. Migration, maintenance and recall of memory T cells in peripheral tissues. Nat. Rev. Immunol. 9, 153–61 (2009). 95. Verbist, K. C., Field, M. B. & Klonowski, K. D. Cutting Edge: IL-15-Independent Maintenance of Mucosally Generated Memory CD8 T Cells. J. Immunol. 186, 6667– 6671 (2011). 96. Mackay, L. K., Wynne-Jones, E., Freestone, D., Pellicci, D. G., Mielke, L. A., Newman, D. M., Braun, A., Masson, F., Kallies, A., Belz, G. T. & Carbone, F. R. T- box Transcription Factors Combine with the Cytokines TGF-β and IL-15 to Control Tissue-Resident Memory T Cell Fate. Immunity 43, 1101–1111 (2015). 97. Schenkel, J. M., Fraser, K. A., Casey, K. A., Beura, L. K., Pauken, K. E., Vezys, V. & Masopust, D. IL-15-Independent Maintenance of Tissue-Resident and Boosted Effector Memory CD8 T Cells. J. Immunol. 196, 3920–3926 (2016). 98. Francis, T., Salk, J. E., Pearson, H. E. & Brown, P. N. Protective Effects of Vaccination Against Induced Influenza A 1. J. Clin. Invest. 24, 536–546 (1945). 99. Salk, J. E., Pearson, H. E., Brown, P. N. & Francis, T. Protective Effects of Vaccination Against Induced Influenza A 1. J. Clin. Invest. 24, 547–53 (1945). 100. Salk, J. E. & Suriano, P. C. Importance of antigenic composition of influenza virus vaccine in protecting against the natural disease; observations during the winter of 1947-1948. Am. J. Public Health Nations. Health 39, 345–55 (1949). 101. Allison, J. E., Glezen, W. P., Taber, L. H., Paredes, A. & Webster, R. G. Reactogenicity and immunogenicity of bivalent influenza A and monovalent influenza B virus vaccines in high-risk children. J. Infect. Dis. 136 Suppl, S672-6 (1977). 102. Davenport, F. M., Hennessy, A. V, Brandon, F. M., Webster, R. G., Barrett, C. D. & Lease, G. O. Comparisons Of Serologic And Febrile Responses In Humans To Vaccination With Influenza A Viruses Or Their Hemagglutinins. J. Lab. Clin. Med. 63, 5–13 (1964). 103. Gerdil, C. The annual production cycle for influenza vaccine. Vaccine 21, 1776–1779 (2003). 104. Fedson, D. S. Vaccine development for an imminent pandemic: why we should worry, what we must do. Hum. Vaccin. 2, 38–42 (2006). 105. Skowronski, D., Chambers, C., Sabaiduc, S., De Serres, G., Dickinson, J., Winter, A., Drews, S., Fonseca, K., Charest, H., Gubbay, J., Petric, M., Krajden, M.,

106

Bibliography

Kwindt, T., Martineau, C., Eshaghi, A., Bastien, N. & Li, Y. Interim estimates of 2014/15 vaccine effectiveness against influenza A(H3N2) from Canada’s Sentinel Physician Surveillance Network, January 2015. Eurosurveillance 20, 21022 (2015). 106. Mølbak, K., Espenhain, L., Nielsen, J., Tersago, K., Bossuyt, N., Denissov, G., Baburin, A., Virtanen, M., Fouillet, A., Sideroglou, T., Gkolfinopoulou, K., Paldy, A., Bobvos, J., van Asten, L., de Lange, M., Nunes, B., da Silva, S., Larrauri, A., Gómez, I., Tsoumanis, A., Junker, C., Green, H., Pebody, R., McMenamin, J., Reynolds, A. & Mazick, A. Excess mortality among the elderly in European countries, December 2014 to February 2015. Eurosurveillance 20, 21065 (2015). 107. Krammer, F. & Palese, P. Advances in the development of influenza virus vaccines. Nat. Rev. Drug Discov. 14, 167–182 (2015). 108. Beyer, W. E. P., McElhaney, J., Smith, D. J., Monto, A. S., Nguyen-Van-Tam, J. S. & Osterhaus, A. D. M. E. Cochrane re-arranged: Support for policies to vaccinate elderly people against influenza. Vaccine 31, 6030–6033 (2013). 109. Ohmit, S. E., Petrie, J. G., Malosh, R. E., Cowling, B. J., Thompson, M. G., Shay, D. K. & Monto, A. S. Influenza Vaccine Effectiveness in the Community and the Household. Clin. Infect. Dis. 56, 1363–1369 (2013). 110. Belshe, R. B., Edwards, K. M., Vesikari, T., Black, S. V, Walker, R. E., Hultquist, M., Kemble, G. & Connor, E. M. Live attenuated versus inactivated influenza vaccine in infants and young children. N. Engl. J. Med. 356, 685–96 (2007). 111. Tricco, A. C., Chit, A., Soobiah, C., Hallett, D., Meier, G., Chen, M. H., Tashkandi, M., Bauch, C. T. & Loeb, M. Comparing influenza vaccine efficacy against mismatched and matched strains: a systematic review and meta-analysis. BMC Med. 11, 153 (2013). 112. Grohskopf, L. A., Sokolow, L. Z., Broder, K. R., Olsen, S. J., Karron, R. A., Jernigan, D. B. & Bresee, J. S. Prevention and Control of Seasonal Influenza with Vaccines. MMWR. Recomm. Reports 65, 1–54 (2016). 113. Ambrose, C. S., Bright, H. & Mallory, R. Letter to the editor: Potential causes of the decreased effectiveness of the influenza A(H1N1)pdm09 strain in live attenuated influenza vaccines. Eurosurveillance 21, 30394 (2016). 114. Ambrose, C. S., Levin, M. J. & Belshe, R. B. The relative efficacy of trivalent live attenuated and inactivated influenza vaccines in children and adults. Influenza Other Respi. Viruses 5, 67–75 (2011). 115. Margine, I., Hai, R., Albrecht, R. A., Obermoser, G., Harrod, A. C., Banchereau, J., Palucka, K., Garcia-Sastre, A., Palese, P., Treanor, J. J. & Krammer, F. H3N2 Influenza Virus Infection Induces Broadly Reactive Hemagglutinin Stalk Antibodies in Humans and Mice. J. Virol. 87, 4728–4737 (2013). 116. Corti, D., Voss, J., Gamblin, S. J., Codoni, G., Macagno, A., Jarrossay, D., Vachieri, S. G., Pinna, D., Minola, A., Vanzetta, F., Silacci, C., Fernandez- Rodriguez, B. M., Agatic, G., Bianchi, S., Giacchetto-Sasselli, I., Calder, L., Sallusto, F., Collins, P., Haire, L. F., Temperton, N., Langedijk, J. P. M., Skehel, J. J. & Lanzavecchia, A. A neutralizing antibody selected from plasma cells that binds to group 1 and group 2 influenza A hemagglutinins. Science 333, 850–6 (2011). 117. Dreyfus, C., Laursen, N. S., Kwaks, T., Zuijdgeest, D., Khayat, R., Ekiert, D. C., Lee, J. H., Metlagel, Z., Bujny, M. V., Jongeneelen, M., van der Vlugt, R., Lamrani, M., Korse, H. J. W. M., Geelen, E., Sahin, O., Sieuwerts, M., Brakenhoff, J. P. J., Vogels, R., Li, O. T. W., Poon, L. L. M., Peiris, M., Koudstaal, W., Ward, A. B., Wilson, I. A., Goudsmit, J. & Friesen, R. H. E. Highly Conserved Protective Epitopes on Influenza B Viruses. Science (80-. ). 337, 1343–1348 (2012). 118. Yassine, H. M., Boyington, J. C., McTamney, P. M., Wei, C.-J., Kanekiyo, M., Kong, W.-P., Gallagher, J. R., Wang, L., Zhang, Y., Joyce, M. G., Lingwood, D., Moin, S. M., Andersen, H., Okuno, Y., Rao, S. S., Harris, A. K., Kwong, P. D., Mascola, J. R., Nabel, G. J. & Graham, B. S. Hemagglutinin-stem nanoparticles generate heterosubtypic influenza protection. Nat. Med. 21, 1065–1070 (2015). 119. Impagliazzo, A., Milder, F., Kuipers, H., Wagner, M. V., Zhu, X., Hoffman, R. M. B., van Meersbergen, R., Huizingh, J., Wanningen, P., Verspuij, J., de Man, M., Ding,

107

Bibliography

Z., Apetri, A., Kukrer, B., Sneekes-Vriese, E., Tomkiewicz, D., Laursen, N. S., Lee, P. S., Zakrzewska, A., Dekking, L., Tolboom, J., Tettero, L., van Meerten, S., Yu, W., Koudstaal, W., Goudsmit, J., Ward, A. B., Meijberg, W., Wilson, I. A. & Rado evi, K. A stable trimeric influenza hemagglutinin stem as a broadly protective immunogen. Science (80-. ). 349, 1301–1306 (2015). 120. Krammer, F., Pica, N., Hai, R., Margine, I. & Palese, P. Chimeric hemagglutinin influenza virus vaccine constructs elicit broadly protective stalk-specific antibodies. J. Virol. 87, 6542–50 (2013). 121. Krammer, F., Hai, R., Yondola, M., Tan, G. S., Leyva-Grado, V. H., Ryder, A. B., Miller, M. S., Rose, J. K., Palese, P., Garcia-Sastre, A. & Albrecht, R. A. Assessment of Influenza Virus Hemagglutinin Stalk-Based Immunity in Ferrets. J. Virol. 88, 3432–3442 (2014). 122. Ulmer, J. B., Donnelly, J. J., Parker, S. E., Rhodes, G. H., Felgner, P. L., Dwarki, V. J., Gromkowski, S. H., Deck, R. R., DeWitt, C. M. & Friedman, a. Heterologous protection against influenza by injection of DNA encoding a viral protein. Science 259, 1745–9 (1993). 123. Donnelly, J. J., Friedman, A., Martinez, D., Montgomery, D. L., Shiver, J. W., Motzel, S. L., Ulmer, J. B. & Liu, M. A. Preclinical efficacy of a prototype DNA vaccine: enhanced protection against antigenic drift in influenza virus. Nat. Med. 1, 583–7 (1995). 124. Donnelly, J. J., Friedman, a, Ulmer, J. B. & Liu, M. a. Further protection against antigenic drift of influenza virus in a ferret model by DNA vaccination. Vaccine 15, 865–8 (1997). 125. Donnelly, J., Berry, K. & Ulmer, J. B. Technical and regulatory hurdles for DNA vaccines. Int. J. Parasitol. 33, 457–67 (2003). 126. Ledgerwood, J. E., Wei, C.-J., Hu, Z., Gordon, I. J., Enama, M. E., Hendel, C. S., McTamney, P. M., Pearce, M. B., Yassine, H. M., Boyington, J. C., Bailer, R., Tumpey, T. M., Koup, R. A., Mascola, J. R., Nabel, G. J. & Graham, B. S. DNA priming and influenza vaccine immunogenicity: two phase 1 open label randomised clinical trials. Lancet Infect. Dis. 11, 916–924 (2011). 127. Berthoud, T. K., Hamill, M., Lillie, P. J., Hwenda, L., Collins, K. A., Ewer, K. J., Milicic, A., Poyntz, H. C., Lambe, T., Fletcher, H. A., Hill, A. V. S. & Gilbert, S. C. Potent CD8+ T-Cell Immunogenicity in Humans of a Novel Heterosubtypic Influenza A Vaccine, MVA-NP+M1. Clin. Infect. Dis. 52, 1–7 (2011). 128. Antrobus, R. D., Lillie, P. J., Berthoud, T. K., Spencer, A. J., McLaren, J. E., Ladell, K., Lambe, T., Milicic, A., Price, D. A., Hill, A. V. S. & Gilbert, S. C. A T Cell- Inducing Influenza Vaccine for the Elderly: Safety and Immunogenicity of MVA-NP+M1 in Adults Aged over 50 Years. PLoS One 7, e48322 (2012). 129. Lillie, P. J., Berthoud, T. K., Powell, T. J., Lambe, T., Mullarkey, C., Spencer, A. J., Hamill, M., Peng, Y., Blais, M.-E., Duncan, C. J. A., Sheehy, S. H., Havelock, T., Faust, S. N., Williams, R. L., Gilbert, A., Oxford, J., Dong, T., Hill, A. V. S. & Gilbert, S. C. Preliminary Assessment of the Efficacy of a T-Cell-Based Influenza Vaccine, MVA-NP+M1, in Humans. Clin. Infect. Dis. 55, 19–25 (2012). 130. Antrobus, R. D., Berthoud, T. K., Mullarkey, C. E., Hoschler, K., Coughlan, L., Zambon, M., Hill, A. V. & Gilbert, S. C. Coadministration of Seasonal Influenza Vaccine and MVA-NP+M1 Simultaneously Achieves Potent Humoral and Cell- Mediated Responses. Mol. Ther. 22, 233–238 (2014). 131. Epstein, S. L., Kong, W., Misplon, J. a, Lo, C.-Y., Tumpey, T. M., Xu, L. & Nabel, G. J. Protection against multiple influenza A subtypes by vaccination with highly conserved nucleoprotein. Vaccine 23, 5404–10 (2005). 132. Price, G. E., Soboleski, M. R., Lo, C.-Y., Misplon, J. A., Quirion, M. R., Houser, K. V., Pearce, M. B., Pappas, C., Tumpey, T. M. & Epstein, S. L. Single-Dose Mucosal Immunization with a Candidate Universal Influenza Vaccine Provides Rapid Protection from Virulent H5N1, H3N2 and H1N1 Viruses. PLoS One 5, e13162 (2010). 133. Zhou, D., Wu, T.-L., Lasaro, M. O., Latimer, B. P., Parzych, E. M., Bian, A., Li, Y., Li, H., Erikson, J., Xiang, Z. & Ertl, H. C. J. A universal influenza A vaccine based on

108

Bibliography

adenovirus expressing matrix-2 ectodomain and nucleoprotein protects mice from lethal challenge. Mol. Ther. 18, 2182–9 (2010). 134. Vitelli, A., Quirion, M. R., Lo, C.-Y., Misplon, J. A., Grabowska, A. K., Pierantoni, A., Ammendola, V., Price, G. E., Soboleski, M. R., Cortese, R., Colloca, S., Nicosia, A. & Epstein, S. L. Vaccination to Conserved Influenza Antigens in Mice Using a Novel Simian Adenovirus Vector, PanAd3, Derived from the Bonobo Pan paniscus. PLoS One 8, e55435 (2013). 135. Van Kampen, K. R., Shi, Z., Gao, P., Zhang, J., Foster, K. W., Chen, D.-T., Marks, D., Elmets, C. A. & Tang, D. C. Safety and immunogenicity of adenovirus-vectored nasal and epicutaneous influenza vaccines in humans. Vaccine 23, 1029–36 (2005). 136. Yu, B., Zhou, Y., Wu, H., Wang, Z., Zhan, Y., Feng, X., Geng, R., Wu, Y., Kong, W. & Yu, X. Seroprevalence of neutralizing antibodies to human adenovirus type 5 in healthy adults in China. J. Med. Virol. 84, 1408–1414 (2012). 137. Roy, S., Kobinger, G. P., Lin, J., Figueredo, J., Calcedo, R., Kobasa, D. & Wilson, J. M. Partial protection against H5N1 influenza in mice with a single dose of a chimpanzee adenovirus vector expressing nucleoprotein. Vaccine 25, 6845–51 (2007). 138. He, T. C., Zhou, S., da Costa, L. T., Yu, J., Kinzler, K. W. & Vogelstein, B. A simplified system for generating recombinant adenoviruses. Proc. Natl. Acad. Sci. U. S. A. 95, 2509–14 (1998). 139. Subach, O. M., Cranfill, P. J., Davidson, M. W. & Verkhusha, V. V. An Enhanced Monomeric Blue Fluorescent Protein with the High Chemical Stability of the Chromophore. PLoS One 6, e28674 (2011). 140. Russell, W. C., Graham, F. L., Smiley, J. & Nairn, R. Characteristics of a Human Cell Line Transformed by DNA from Human Adenovirus Type 5. J. Gen. Virol. 36, 59– 72 (1977). 141. DuBridge, R. B., Tang, P., Hsia, H. C., Leong, P. M., Miller, J. H. & Calos, M. P. Analysis of mutation in human cells by using an Epstein-Barr virus shuttle system. Mol. Cell. Biol. 7, 379–87 (1987). 142. Reed, L. J. & Muench, H. A simple method of estimating fifty per cent endpoints. Am. J. Hyg. 27, 493–497 (1938). 143. Park, S. H., Cheong, C., Idoyaga, J., Kim, J. Y., Choi, J.-H., Do, Y., Lee, H., Jo, J. H., Oh, Y.-S., Im, W., Steinman, R. M. & Park, C. G. Generation and application of new rat monoclonal antibodies against synthetic FLAG and OLLAS tags for improved immunodetection. J. Immunol. Methods 331, 27–38 (2008). 144. Carragher, D. M., Kaminski, D. a, Moquin, A., Hartson, L. & Randall, T. D. A novel role for non-neutralizing antibodies against nucleoprotein in facilitating resistance to influenza virus. J. Immunol. 181, 4168–76 (2008). 145. Bodewes, R., Geelhoed-Mieras, M. M., Wrammert, J., Ahmed, R., Wilson, P. C., Fouchier, R. A. M., Osterhaus, A. D. M. E. & Rimmelzwaan, G. F. In Vitro Assessment of the Immunological Significance of a Human Monoclonal Antibody Directed to the Influenza A Virus Nucleoprotein. Clin. Vaccine Immunol. 20, 1333– 1337 (2013). 146. Gardella, S., Andrei, C., Poggi, A., Zocchi, M. R. & Rubartelli, A. Control of interleukin-18 secretion by dendritic cells: role of calcium influxes. FEBS Lett. 481, 245–248 (2000). 147. Yamamoto, K., Seike, M., Takeuchi, S., Soeno, C., Miyanaga, A., Noro, R., Minegishi, Y., Kubota, K. & Gemma, A. MiR-379/411 cluster regulates IL-18 and contributes to drug resistance in malignant pleural mesothelioma. Oncol. Rep. 32, 2365–72 (2014). 148. Guarda, G., Braun, M., Staehli, F., Tardivel, A., Mattmann, C., Förster, I., Farlik, M., Decker, T., Du Pasquier, R. a, Romero, P. & Tschopp, J. Type I interferon inhibits interleukin-1 production and inflammasome activation. Immunity 34, 213–23 (2011). 149. Mayer-Barber, K. D. & Yan, B. Clash of the Cytokine Titans: counter-regulation of interleukin-1 and type I interferon-mediated inflammatory responses. Cell. Mol.

109

Bibliography

Immunol. (2016). doi:10.1038/cmi.2016.25 150. Hoffmann, A. & Baltimore, D. Circuitry of nuclear factor kappaB signaling. Immunol. Rev. 210, 171–186 (2006). 151. Lee, J., Kim, S., Lewis, E. C., Azam, T., Reznikov, L. L. & Dinarello, C. A. Differences in signaling pathways by IL-1beta and IL-18. Proc. Natl. Acad. Sci. U. S. A. 101, 8815–20 (2004). 152. Dinarello, C. A., Novick, D., Kim, S. & Kaplanski, G. Interleukin-18 and IL-18 Binding Protein. Front. Immunol. 4, (2013). 153. Kojima, H., Aizawa, Y., Yanai, Y., Nagaoka, K., Takeuchi, M., Ohta, T., Ikegami, H., Ikeda, M. & Kurimoto, M. An essential role for NF-kappa B in IL-18-induced IFN- gamma expression in KG-1 cells. J. Immunol. 162, 5063–9 (1999). 154. Kannan, Y., Yu, J., Raices, R. M., Seshadri, S., Wei, M., Caligiuri, M. A. & Wewers, M. D. I B augments IL-12- and IL-18-mediated IFN- production in human NK cells. Blood 117, 2855–2863 (2011). 155. Guadagno, J., Swan, P., Shaikh, R. & Cregan, S. P. Microglia-derived IL-1β triggers p53-mediated cell cycle arrest and apoptosis in neural precursor cells. Cell Death Dis. 6, e1779 (2015). 156. Sant, A. J. Endogenous antigen presentation by MHC class II molecules. Immunol. Res. 13, 253–67 (1994). 157. Diepolder, H. M., Ries, G., Jung, M. C., Schlicht, H. J., Gerlach, J. T., Gr ner, N., Caselmann, W. H. & Pape, G. R. Differential antigen-processing pathways of the hepatitis B virus e and core proteins. Gastroenterology 116, 650–7 (1999). 158. Ben-Sasson, S. Z., Hu-Li, J., Quiel, J., Cauchetaux, S., Ratner, M., Shapira, I., Dinarello, C. A. & Paul, W. E. IL-1 acts directly on CD4 T cells to enhance their antigen-driven expansion and differentiation. Proc. Natl. Acad. Sci. U. S. A. 106, 7119–24 (2009). 159. Taylor-Robinson, A. W. & Phillips, R. S. Expression of the IL-1 receptor discriminates Th2 from Th1 cloned CD4+ T cells specific for Plasmodium chabaudi. Immunology 81, 216–21 (1994). 160. Nimmerjahn, F., Gordan, S. & Lux, A. Fc g R dependent mechanisms of cytotoxic , agonistic , and neutralizing antibody activities. Trends Immunol. 36, 325–336 (2015). 161. DiLillo, D. J., Tan, G. S., Palese, P. & Ravetch, J. V. Broadly neutralizing hemagglutinin stalk–specific antibodies require FcγR interactions for protection against influenza virus in vivo. Nat. Med. 20, 143–151 (2014). 162. Ben-Sasson, S. Z., Hogg, A., Hu-Li, J., Wingfield, P., Chen, X., Crank, M., Caucheteux, S., Ratner-Hurevich, M., Berzofsky, J. a., Nir-Paz, R. & Paul, W. E. IL-1 enhances expansion, effector function, tissue localization, and memory response of antigen-specific CD8 T cells. J. Exp. Med. 210, 491–502 (2013). 163. Sallusto, F., Lenig, D., Förster, R., Lipp, M. & Lanzavecchia, A. Two subsets of memory T lymphocytes with distinct homing potentials and effector functions. Nature 401, 708–712 (1999). 164. LaMere, M. W., Lam, H.-T., Moquin, A., Haynes, L., Lund, F. E., Randall, T. D. & Kaminski, D. a. Contributions of antinucleoprotein IgG to heterosubtypic immunity against influenza virus. J. Immunol. 186, 4331–9 (2011). 165. Sukeno, N., Otsuki, Y., Konno, J., Yamane, N., Odagiri, T., Arikawa, J. & Ishida, N. Anti-nucleoprotein antibody response in influenza A infection. Tohoku J. Exp. Med. 128, 241–9 (1979). 166. Yewdell, J. W., Frank, E. & Gerhard, W. Expression of influenza A virus internal antigens on the surface of infected P815 cells. J. Immunol. 126, 1814–9 (1981). 167. Saperstein, S., Chen, L., Oakes, D., Pryhuber, G. & Finkelstein, J. IL-1β Augments TNF-α–Mediated Inflammatory Responses from Lung Epithelial Cells. J. Interf. Cytokine Res. 29, 273–284 (2009). 168. Martin, P., Palmer, G., Vigne, S., Lamacchia, C., Rodriguez, E., Talabot-Ayer, D., Rose-John, S., Chalaris, A. & Gabay, C. Mouse neutrophils express the decoy type 2 interleukin-1 receptor (IL-1R2) constitutively and in acute inflammatory conditions. J. Leukoc. Biol. 94, 791–802 (2013).

110

Bibliography

169. Zarbock, A., Ley, K., McEver, R. P. & Hidalgo, A. Leukocyte ligands for endothelial selectins: specialized glycoconjugates that mediate rolling and signaling under flow. Blood 118, 6743–6751 (2011). 170. Laszik, Z., Jansen, P. J., Cummings, R. D., Tedder, T. F., McEver, R. P. & Moore, K. L. P-selectin glycoprotein ligand-1 is broadly expressed in cells of myeloid, lymphoid, and dendritic lineage and in some nonhematopoietic cells. Blood 88, 3010– 21 (1996). 171. Schenkel, J. M., Fraser, K. A., Beura, L. K., Pauken, K. E., Vezys, V. & Masopust, D. Resident memory CD8 T cells trigger protective innate and adaptive immune responses. Science (80-. ). 346, 98–101 (2014). 172. Hasegawa, M., Kamada, N., Jiao, Y., Liu, M. Z., Nunez, G. & Inohara, N. Protective Role of Commensals against Clostridium difficile Infection via an IL-1 -Mediated Positive-Feedback Loop. J. Immunol. 189, 3085–3091 (2012). 173. Lee, Y.-S., Yang, H., Yang, J.-Y., Kim, Y., Lee, S.-H., Kim, J. H., Jang, Y. J., Vallance, B. A. & Kweon, M.-N. Interleukin-1 (IL-1) Signaling in Intestinal Stromal Cells Controls KC/CXCL1 Secretion, Which Correlates with Recruitment of IL-22- Secreting Neutrophils at Early Stages of Citrobacter rodentium Infection. Infect. Immun. 83, 3257–3267 (2015). 174. Mantovani, A., Cassatella, M. A., Costantini, C. & Jaillon, S. Neutrophils in the activation and regulation of innate and adaptive immunity. Nat. Rev. Immunol. 11, 519–531 (2011). 175. Menten, P., Wuyts, A. & Van Damme, J. Macrophage inflammatory protein-1. Cytokine Growth Factor Rev. 13, 455–481 (2002). 176. Lee, A. Y. S., Eri, R., Lyons, A. B., Grimm, M. C. & Korner, H. CC Chemokine Ligand 20 and Its Cognate Receptor CCR6 in Mucosal T Cell Immunology and Inflammatory Bowel Disease: Odd Couple or Axis of Evil? Front. Immunol. 4, (2013). 177. Marques, R. E., Guabiraba, R., Russo, R. C. & Teixeira, M. M. Targeting CCL5 in inflammation. Expert Opin. Ther. Targets 17, 1439–1460 (2013). 178. Wareing, M. D. Chemokine expression during the development and resolution of a pulmonary leukocyte response to influenza A virus infection in mice. J. Leukoc. Biol. 76, 886–895 (2004). 179. Cepek, K. L., Shaw, S. K., Parker, C. M., Russell, G. J., Morrow, J. S., Rimm, D. L. & Brenner, M. B. Adhesion between epithelial cells and T lymphocytes mediated by E-cadherin and the alpha E beta 7 integrin. Nature 372, 190–3 (1994). 180. Karecla, P. I., Bowden, S. J., Green, S. J. & Kilshaw, P. J. Recognition of E- cadherin on epithelial cells by the mucosal T cell integrin alpha M290 beta 7 (alpha E beta 7). Eur. J. Immunol. 25, 852–6 (1995). 181. Gommerman, J., Gommerman, J. & Rojas, O. Creation of mixed bone marrow chimeras with appropriate controls. Protoc. Exch. (2011). doi:10.1038/protex.2011.269 182. Dinarello, C. A. Biologic basis for interleukin-1 in disease. Blood 87, 2095–147 (1996). 183. Kolb, M., Margetts, P. J., Anthony, D. C., Pitossi, F. & Gauldie, J. Transient expression of IL-1β induces acute lung injury and chronic repair leading to pulmonary fibrosis. J. Clin. Invest. 107, 1529–1536 (2001). 184. Ganter, M. T., Roux, J., Miyazawa, B., Howard, M., Frank, J. A., Su, G., Sheppard, D., Violette, S. M., Weinreb, P. H., Horan, G. S., Matthay, M. A. & Pittet, J.-F. Interleukin-1 Causes Acute Lung Injury via v 5 and v 6 Integrin-Dependent Mechanisms. Circ. Res. 102, 804–812 (2008). 185. Li, H., Nookala, S. & Re, F. Aluminum Hydroxide Adjuvants Activate Caspase-1 and Induce IL-1 and IL-18 Release. J. Immunol. 178, 5271–5276 (2007). 186. Stokes, C. A., Ismail, S., Dick, E. P., Bennett, J. A., Johnston, S. L., Edwards, M. R., Sabroe, I. & Parker, L. C. Role of Interleukin-1 and MyD88-Dependent Signaling in Rhinovirus Infection. J. Virol. 85, 7912–7921 (2011). 187. Collins, R. A., Gualano, R. C., Zosky, G. R., Atkins, C. L., Turner, D. J., Colasurdo, G. N. & Sly, P. D. Hyperresponsiveness to inhaled but not intravenous methacholine during acute respiratory syncytial virus infection in mice. Respir. Res. 6,

111

Bibliography

142 (2005). 188. Al-Garawi, A. A., Fattouh, R., Walker, T. D., Jamula, E. B., Botelho, F., Goncharova, S., Reed, J., Stampfli, M. R., O’Byrne, P. M., Coyle, A. J. & Jordana, M. Acute, but Not Resolved, Influenza A Infection Enhances Susceptibility to House Dust Mite-Induced Allergic Disease. J. Immunol. 182, 3095–3104 (2009). 189. Vanoirbeek, J. A. J., Rinaldi, M., De Vooght, V., Haenen, S., Bobic, S., Gayan- Ramirez, G., Hoet, P. H. M., Verbeken, E., Decramer, M., Nemery, B. & Janssens, W. Noninvasive and Invasive Pulmonary Function in Mouse Models of Obstructive and Restrictive Respiratory Diseases. Am. J. Respir. Cell Mol. Biol. 42, 96–104 (2010). 190. Limjunyawong, N., Mitzner, W. & Horton, M. R. A mouse model of chronic idiopathic pulmonary fibrosis. Physiol. Rep. 2, n/a-n/a (2014). 191. Horimoto, T. & Kawaoka, Y. Influenza: lessons from past pandemics, warnings from current incidents. Nat. Rev. Microbiol. 3, 591–600 (2005).

112