bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

1 loaders CAF1 and HIRA restrict Epstein-Barr virus B-cell lytic reactivation

2 Yuchen Zhang1,2,8, Chang Jiang1,3,4,7,8, Stephen J. Trudeau1,3,4, Yohei Narita1, Bo Zhao1, 3 Mingxiang Teng6, Rui Guo1,3,4*, Benjamin E Gewurz1,3,4,5* 4 5 1 Division of Infectious Disease, Department of Medicine, Brigham and Women’s Hospital, 6 Harvard Medical School, Boston, MA 02115, USA 7 2 Sun Yat-sen University Cancer Center, State Key Laboratory of Oncology in South China， 8 Guangzhou 510060, China 9 3 Department of Microbiology, Harvard Medical School, Boston, MA 02115 10 4 Broad Institute of Harvard and MIT, Cambridge, MA 02142, USA 11 5 Harvard Graduate Program in Virology, Boston, MA 02115 12 6 Department of Biostatistics and Bioinformatics, H. Lee Moffitt Cancer Center and Research 13 Institute, Tampa, FL 33612 14 7 Present address, Department of Cancer Physiology, H. Lee Moffitt Cancer Center and Research 15 Institute, Tampa, FL 33612 16 8 These authors contributed equally 17 *co-corresponding

18 Running title: Histone Loader CAF1 Restricts EBV Lytic Reactivation

19 ABSTRACT

20 Epstein-Barr virus (EBV) infects 95% of adults worldwide and causes infectious mononucleosis.

21 EBV is associated with endemic Burkitt lymphoma, Hodgkin lymphoma, post-transplant

22 lymphomas, nasopharyngeal and gastric carcinomas. In these cancers and in most infected B-cells,

23 EBV maintains a state of latency, where nearly 80 lytic cycle antigens are epigenetically

24 suppressed. To gain insights into host epigenetic factors necessary for EBV latency, we recently

25 performed a -wide CRISPR screen that identified the assembly factor

26 CAF1 as a putative Burkitt latency maintenance factor. CAF1 loads H3 and H4 onto

27 newly synthesized host DNA, though its roles in EBV genome chromatin assembly are

28 uncharacterized. Here, we identified that CAF1 depletion triggered lytic reactivation and

29 transforming virion secretion from Burkitt cells, despite strongly also inducing interferon

30 stimulated . CAF1 perturbation diminished occupancy of histones 3.1, 3.3 and repressive

31 H3K9me3 and H3K27me3 marks at multiple viral genome lytic cycle regulatory elements. bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

32 Suggestive of an early role in establishment of latency, EBV strongly upregulated CAF1

33 expression in newly infected primary human B-cells prior to the first mitosis, and histone 3.1 and

34 3.3 were loaded on the EBV genome by this timepoint. Knockout of CAF1 subunit CHAF1B

35 impaired establishment of latency in newly EBV-infected Burkitt cells. A non-redundant latency

36 maintenance role was also identified for the DNA synthesis-independent histone 3.3 loader HIRA.

37 Since EBV latency also requires histone chaperones ATRX and DAXX, EBV coopts multiple host

38 histone pathways to maintain latency, and these are potential targets for lytic induction therapeutic

39 approaches.

40

41 IMPORTANCE

42 Epstein-Barr virus (EBV) was discovered as the first human tumor virus in endemic Burkitt

43 lymphoma, the most common childhood cancer in sub-Saharan Africa. In Burkitt lymphoma and

44 in 200,000 EBV-associated cancers per year, epigenetic mechanisms maintain viral latency, where

45 lytic cycle factors are silenced. This property complicated EBV’s discovery and facilitates tumor

46 immunoevasion. DNA methylation and chromatin-based mechanisms contribute to lytic

47 silencing. Here, we identify histone chaperones CAF1 and HIRA, which have key roles in host

48 DNA replication-dependent and replication independent pathways, respectively, are each

49 important for EBV latency. EBV strongly upregulates CAF1 in newly infected B-cells, where viral

50 genomes acquire histone 3.1 and 3.3 variants prior to the first mitosis. Since histone chaperones

51 ATRX and DAXX also function in maintenance of EBV latency, our results suggest that EBV

52 coopts multiple histone pathways to reprogram viral genomes and highlights targets for lytic

53 induction therapeutic strategies.

54 bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

55 KEYWORDS: latency, lytic reactivation, histone chaperone, histone loader, epigenetic, tumor

56 virus, restriction factor, histone methylation, CRISPR, interferon stimulated gene, chromatin,

57 tumor virus, gamma-herpesvirus.

58

59 The gamma-herpesvirus Epstein-Barr virus (EBV) persistently infects nearly 95% of adults

60 worldwide (1). EBV is the etiological agent of infectious mononucleosis and is also causally-

61 associated with multiple human cancers, including endemic Burkitt lymphoma (eBL), Hodgkin

62 lymphoma, post-transplant lymphoproliferative disease, HIV-associated lymphomas,

63 nasopharyngeal carcinoma and gastric carcinoma (2). Tumor cells contain multiple copies of

64 chromatinized, non-integrated, double-stranded DNA EBV genomes, where incompletely defined

65 epigenetic pathways maintain a state of viral latency and in which most cells do not produce

66 infectious virus.

67 EBV initiates lifelong infection by translocating across the tonsillar epithelium to colonize the

68 B-cell compartment (3, 4). Virion deliver unchromatinized, encapsidated, linear EBV genomes to

69 newly infected cells, which traffic to the nucleus. Upon nuclear entry, incoming genomes are

70 circularized by host DNA ligases and chromatinized (1, 5, 6).

71 The EBV genome encodes nearly 80 , most of which are highly immunogenic. To evade

72 immune detection, EBV switches between latent and lytic genome programs, a hallmark of

73 herpesvirus infection. Multiple layers of epigenetic regulation enable EBV to establish latency in

74 newly-infected B-cells, in which a small number of viral encoded proteins and viral non-coding

75 RNAs reprogram infected cell metabolism, growth and survival pathways (7-9). Within 3 days of

76 infection, quiescent B-cells are reprogramed to become rapidly growing lymphoblasts that divide

77 as frequently as every 8 hours (10-13). bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

78 According to the germinal center model(3), EBV-infected B-cells navigate the B-cell

79 compartment to differentiate into memory cells, the reservoir for persistent EBV infection. To

80 accomplish this, a series of EBV latency programs are used, in which combinations of Epstein-

81 Barr nuclear antigens (EBNA), Latent Membrane Proteins (LMP) and ncRNA are expressed (1).

82 Memory cells exhibit the latency I program, in which Epstein-Barr nuclear antigen 1 (EBNA1) is

83 the only EBV-encoded expressed. EBNA1 tethers the EBV genome to host

84 and has key roles in propagation of viral genomes to daughter cells. EBNA1 is poorly

85 immunogenic, facilitating immune escape of latency I cells.

86 Plasma cell differentiation is a trigger for EBV lytic reactivation. Induction of two viral

87 immediate early gene transcription factors, BZLF1 and BRLF1, induce nearly 30 early genes

88 important for production of lytic genomes (10, 14, 15). How these newly synthesized EBV

89 genomes evade chromatinization by host histone loaders, including the heterotrimeric Chromatin

90 Assembly Factor 1 (CAF1) complex that delivers newly synthesized H3/H4 dimers to host

91 replication forks, is only partially understood (16, 17). EBV late genes are subsequently induced

92 and include factors required for virion assembly and spread (10). Retrograde signals support

93 ongoing lytic replication through subversion of chromatin-based repressors (18).

94 Most eBL cells utilize the latency I program, likewise enabling evasion of adaptive anti-EBV

95 responses (19). Indeed, EBV was discovered as the first human tumor virus through eBL

96 etiological studies, where the initial report noted that nearly all tumor cells did not produce

97 infectious viral particles (20). With each S-phase, EBV genomes are copied once by host cell

98 machinery and are then partitioned to daughter cells (21). Histone octamers consisting of two

99 copies of histone 2A (H2A), H2B, H3 and H4 are loaded onto leading and lagging strands. CAF1

100 has key roles in loading histones onto newly replicated and damaged host DNA, whereas the bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

101 histone chaperone HIRA is important for non-replicative histone loading onto host genomic sites

102 (16, 17). Likewise, the chaperones alpha thalassemia/mental retardation syndrome X-linked

103 chromatin remodeler (ATRX) and death domain-associated protein (DAXX) load histones onto

104 telomeric and repetitive DNA. EBV tegument protein BNLF1 downmodulates ATRX/DAXX

105 activity in newly infected cells (22), but ATRX/DAXX subsequently acquire important roles in

106 the suppression of EBV lytic reactivation in latently infected cells (23).

107 Here, we characterize histone chaperone CAF1, HIRA, ATRX and DAXX roles in Burkitt EBV

108 latency. We provide evidence that type I and II EBV strains co-opt each of these histone loaders

109 to maintain latency via non-redundant roles. EBV upregulated each of the three CAF1 subunits in

110 newly infected primary human B-cells, and CAF1 was found to have key roles in establishment of

111 latency in a Burkitt EBV infection model. Chromatin immunoprecipitation assays support key

112 CAF1 roles in deposition of repressive histone marks on EBV genome lytic control elements.

113 These data further support key chromatin roles in regulation of the EBV lytic switch.

114

115 RESULTS

116 The Histone Loader CAF1 is important for Burkitt lymphoma EBV latency

117 maintenance. To gain insights into host factors important for the maintenance of EBV latency,

118 we recently performed a human genome wide CRISPR screen (24). Briefly, Cas9+ EBV+

119 Burkitt P3HR-1 cells were transduced with the Avana single guide RNA (sgRNA) library, which

120 contains four independent sgRNAs against nearly all human genes. Cells with de-repressed

121 plasma membrane (PM) expression of the EBV late lytic antigen gp350, indicative of latency

122 reversal, were sorted at Days 6 and 9 post-transduction. sgRNAs significantly enriched in the

123 sorted versus input cell population were identified. The STARS algorithm identified 85 bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

124 statistically significant hits at a p<0.05 and fold change > 1.5 cutoff (Fig. 1A)(24, 25).

125 Unexpectedly, genes encoding two subunits of the histone loader CAF1 complex were amongst

126 top screen hits (Fig. 1A-C).

127 The heterotrimeric CAF1 complex, comprised of CHAF1A, CHAF1B and RBBP4 subunits,

128 delivers histone H3/H4 dimers to the replication fork during cell cycle S-phase, typically

129 together with histone chaperone ASF1a (17, 26) (Fig. 1D). CAF1 has well-established roles in

130 maintenance of heterochromatin and cell identity, but its function in regulating EBV latency has

131 not yet been investigated. Therefore, it was notable that multiple sgRNAs targeting CHAF1B and

132 RBBP4 were enriched amongst gp350+ sorted cells at Days 6 and 9 post-Avana library

133 transduction (Figs. 1B-C). A sgRNA targeting CHAF1A was also enriched in gp350+ cells at the

134 Day 6 timepoint (Fig. S1A). The identification of multiple sgRNAs targeting CAF1 subunits

135 suggested an important CAF1 role in maintenance of EBV latency. Notably, Burkitt lymphoma

136 are the fastest growing human tumor, and newly synthesized EBV genomes must be

137 reprogrammed to maintain latency I with each cell cycle.

138 To validate screen hit CAF1 roles in the maintenance of BL EBV latency, control or

139 independent CHAF1B targeting sgRNAs were expressed in P3HR-1, Akata and MUTU I Cas9+

140 tumor-derived endemic Burkitt lymphoma cell lines. In each of these, CHAF1B depletion

141 induced immediate early BZLF1 and early BMRF1 expression (Fig. 1E). CHAF1B depletion

142 significantly induced all seven EBV lytic transcripts measured by qRT-PCR (Fig. S1B). Since

143 Akata and MUTU I harbor type I EBV, whereas P3HR-1 carries type II EBV, these data suggest

144 a conserved CAF1 roles in maintenance of EBV latency. Likewise, CHAF1B depletion induced

145 gp350 plasma membrane expression on most Akata cells examined by flow cytometry (Fig. 1F- bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

146 G), suggesting that Burkitt cell CAF1 loss triggers a full EBV lytic cycle. CHAF1B depletion

147 also induced gp350 expression on MUTU I cells (Fig. S1C-D).

148 We next validated on-target CRISPR effects through a cDNA rescue approach. A point

149 mutation was engineered into the CHAF1B cDNA proto-spacer adjacent motif (PAM) site

150 targeted by sgRNA #1 to abrogate Cas9 editing. Akata cells with stable control GFP vs V5-

151 epitope tagged CHAF1B rescue cDNA (CHAF1BR) were established. Effects of control vs

152 CHAF1B targeting sgRNA were tested. Interestingly, depletion of endogenous CHAF1B de-

153 repressed BZLF1, BMRF1 and gp350 in control cells, but failed to do so in cells with CHAF1BR

154 rescue cDNA expression (Figs. 1H-J). Similar cDNA rescue results on BZLF1 and BMRF1

155 expression were evident in MUTU I cells (Fig. S1E). These results suggest that CHAF1B is

156 necessary for EBV latency in Burkitt cells, perhaps in loading histone H3/H4 onto newly

157 synthesized episomes.

158 CHAF1B Perturbation Induces EBV Genome Lytic Replication and IFN Stimulated

159 Genes. EBV lytic replication is controlled on many levels and partial lytic cycle induction is

160 often observed. Therefore, we next examined whether CAF1 perturbation was sufficient to

161 induce a productive lytic replication cycle. RNAseq was performed on Akata cells at Day 6 post-

162 sgRNA expression, and demonstrated significant induction of EBV 77 lytic cycle genes (Fig.

163 2A). Consistent with induction of a full lytic cycle, CHAF1B depletion induced intracellular

164 EBV genome amplification, albeit to a level less than observed with Akata immunoglobulin (Ig)

165 crosslinking. Likewise, CHAF1B sgRNAs induced secretion of DNAse-resistant EBV genomes,

166 demonstrating encapsidation (Fig. 2B). Similar results were observed in MUTU I and P3HR-1

167 cells, suggesting conserved CAF1 roles in type I and II EBV latency regulation (Fig. S2A-B). In

168 support of on-target CRISPR effects, expression of the PAM site mutant CHAF1B cDNA rescue bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

169 construct prevented EBV genome copy number increase with editing of endogenous CHAF1B

170 (Fig. S2C). Furthermore, addition of supernatant from CHAF1B depleted, but not control Akata

171 cells, stimulated human B-cell aggregation and growth transformation (Fig. 2C).

172 RNAseq analysis also demonstrated robust up-regulation of EBV latency III transcripts in

173 response to CHAF1B depletion. EBNA1, 2, 3A, 3B, 3C, LMP1, LMP2A and LMP2B were each

174 significantly up-regulated (Fig. S3A and Table S1). While these transcripts are upregulated by

175 EBV lytic reactivation (27), the magnitude of mRNA upregulation suggests that CAF1 may also

176 have important roles in chromatin-based silencing of the latency III program.

177 To test whether CAF1 perturbation and Ig-crosslinking synergistically induce lytic

178 replication, control versus CHAF1B sgRNAs were expressed in Cas9+ Akata cells in the absence

179 or presence of IgG. Interestingly, Ig-crosslinking induced higher levels of PM gp350 and

180 intracellular/extracellular EBV genome copy numbers in cells depleted for CHAF1B than in

181 control cells (Fig. 2D-E and S2D). Similar results were obtained with IgM cross-linking in

182 MUTU I cells (Fig. S2E-F). These results suggest that CAF1 not only maintains EBV latency in

183 unstimulated cells, but also limits the extent of lytic reactivation in upon B-cell receptor

184 activation.

185 We next examined changes in host mRNAs following CHAF1B depletion. Interestingly,

186 multiple interferon stimulated genes (ISGs) were amongst the most highly CHAF1B sgRNA

187 induced host genes, including IFIT1, IFIT3, IFI44, IFI44L, IRF7 and STAT1, and GO analysis

188 identified Type I interferon-mediated signaling pathway as the most highly upregulated pathway

189 (Fig. 2F-G, S3B). By contrast, mRNAs encoding histones and histone-related genes were

190 amongst the most strongly downmodulated by CHAF1B depletion (Fig. 2F-G, S3C), perhaps as

191 a result of a negative feedback in response to diminished CAF1 activity. CHAF1B-mediated bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

192 upregulation of IRF7 and IFIT1 was validated at the protein level (Fig. 2H). Interestingly, ISG

193 upregulation was not observed at the mRNA or protein level in Akata cells upon

194 immunoglobulin-crosslinking induced EBV lytic reactivation (28-30). These results suggest that

195 that EBV lytic replication itself does not underlie this host response, at least when triggered by

196 Ig-crosslinking.

197 Depletion of CAF1 Subunits CHAF1A and RBBP4 triggers EBV lytic replication.

198 CHAF1B assembles together with CHAF1B and RBBP4 subunits with 1:1:1 stoichiometry (31).

199 CHAF1A targets CAF1 to the replication fork through interaction with proliferating cell nuclear

200 antigen (PCNA), associates with histone deacetylases, and has roles in DNA repair and in

201 heterochromatin maintenance (17, 32). While RBBP4 has been implicated in CAF1 activity (33),

202 it also has additional epigenetic roles, including within the NURD transcriptional repressor

203 complex(34).

204 To investigate whether the CAF1 subunits CHAF1A and RBBP4 were similarly important for

205 the maintenance of Burkitt EBV latency I, we tested the effects of the top two Avana library

206 sgRNAs targeting the genes encoding each. Depletion of RBBP4 or CHAF1A by either sgRNA

207 induced all seven EBV lytic genes surveyed by qPCR (Fig. S4A-B) and induced BZLF1,

208 BMRF1 and gp350 at the protein level (Fig. 3A-F). RBBP4 or CHAF1A depletion likewise de-

209 repressed EBV lytic in P3HR-1 and MUTU I (Fig. S4C-D). To determine

210 effects of RBBP4 or CHAF1A depletion on EBV genome amplification, viral load analysis was

211 performed. RBBP4 and CHAF1A sgRNAs significantly increased intracellular and DNAse-

212 treated extracellular EBV genome copy numbers in three Burkitt cell lines (Fig. 3G-H, S4E-F).

213 Taken together, these results suggest that all three CAF1 subunits are critical for EBV latency in bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

214 Burkitt lymphoma cells, perhaps acting to re-program newly synthesized EBV episomes with

215 each cell cycle.

216 Roles of EBV-induced CAF1 in establishment of B-cell latency. Since CAF1 has key

217 histone deposition roles in the contexts of DNA replication or repair, we asked whether CAF1

218 subunits are expressed in resting or in newly-infected primary human B-cells. Using data from

219 recently published RNAseq and proteomic maps of EBV-mediated primary B-cell growth

220 transformation (35, 36), we noticed that there was little expression of CHAF1A or CHAF1B in

221 the resting B-cells, but that each are upregulated by 2 days post-infection (Fig. 4A, S5A).

222 RBBP4 appears to have a higher basal level, perhaps reflective of its additional epigenetic roles

223 beyond CAF1, but is also EBV-upregulated (Fig. S5A). Immunoblot analysis demonstrated

224 strong CHAF1B upregulation between 2 and 4 days post-infection (Fig. 4B), at which point

225 newly infected cells begin to rapidly proliferate as they transition from the EBV pre-latency

226 program to latency IIb (12, 37). Published LCL Chip-seq data (38-41) showed Epstein-Barr

227 nuclear antigens 2, LP, 3A, 3C and LMP1-activated NF-kB subunit occupancy at or near the

228 CHAF1A, CHAF1B and RBBP4 promoters (Fig. 4C, S5B-C). MYC occupancy was also notable

229 at the CHAF1A and RBBP4 promoters in Burkitt-like P493 B-cells (42). We therefore speculate

230 that these EBNAs, which are expressed in the EBV pre-latency and latency IIb programs, have

231 important roles in EBV-mediated CAF1 upregulation in newly infected primary B-cells.

232 We next tested CAF1’s roles in the establishment of EBV latency. Since it is not currently

233 possibly to do CRISPR editing in resting primary B-cells, we instead used an EBV-negative

234 (EBV-) subclone of Akata Burkitt cells, which were established during serial passage of the

235 original EBV+ Akata tumor cells (43). It has previously been shown that latency I is established

236 upon re-infection of these cells by EBV in vitro (44). However, since EBV- Akata cells are bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

237 difficult to infect with purified EBV, we developed a co-culture system to increase infection

238 efficiency (Fig 4D). EBV- Akata were co-cultured with EBV+ 293 producer cells, which carry a

239 recombinant EBV bacterial artificial (BAC) system that includes a GFP marker

240 (45). Lytic replication was induced in a monolayer of adherent 293-EBV+ cells by transfection

241 of genes encoding BZLF1 and BALF4. Induced 293 cells were then co-cultured with Akata

242 EBV- cells 24 hours post-transfection. EBV infection frequency was monitored by FACS 48

243 hours later, using GFP as a readout, and PM gp350 positivity was used as a marker for cells with

244 lytic replication.

245 Using this co-culture system, ~3.5% of control Akata cells were infected, as judged by

246 expression of the GFP marker, and 0.47% of cells were positive for the gp350 lytic antigen. By

247 comparison, ~6% of CHAF1B depleted cells were infected and 1.63% had gp350 PM expression

248 (Fig. 4E). Most gp350 expression was suppressed by addition of acyclovir to the co-culture

249 system, suggesting it was expressed as a late lytic gene rather than delivered by incoming or

250 attached EBV (Fig. 4E). Further suggesting an important CAF1 role in establishment of latency

251 in Akata cells, BZFL1 was more highly expressed in CHAF1B-depleted than control cells. As

252 expected, expression of this immediate early gene was not blocked by acyclovir (Fig. 4F). These

253 data are consistent with a model in which CAF1 has key roles in reprogramming the epigenetic

254 state of newly infected B-cells. However, it is possible that CAF1 plays an earlier role in this

255 rapidly growing Akata system than in primary B-cells, where the first mitosis occurs 72 hours

256 post-infection.

257

258 The Histone Chaperone HIRA exerts non-redundant Burkitt cell maintenance of EBV

259 Latency roles. The histone loader Histone Regulatory Homologue A (HIRA) interacts with ASF1a bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

260 and preferentially loads histone H3.3/H4 complexes onto DNA in a replication-independent

261 manner throughout the cell cycle, for example at areas of active transcription (17, 46). HIRA

262 regulates the alpha-herpesvirus herpes simplex virus and the beta-herpesvirus cytomegalovirus

263 latency (47-50). HIRA is also implicated in maintenance of HIV latency (51), but to our knowledge

264 has not been investigated in the regulation of gamma-herpesvirus latency.

265 To explore potential HIRA roles in the maintenance of EBV latency, we tested effects of HIRA

266 depletion in P3HR-1, Akata and MUTU I cells. In each of these BL, CRISPR HIRA editing by

267 either of two Avana sgRNAs rapidly upregulated BZLF1 and BMRF1 in Akata, P3HR-1 and

268 MUTU I cells (Fig. 5A). HIRA depletion also upregulated PM gp350 abundance, albeit to a lesser

269 extent than observed with CAF1 perturbation, perhaps explaining why our CRISPR screen was

270 more sensitive to CAF1 perturbation (Fig. 5B-C). HIRA sgRNAs increased expression of all seven

271 EBV lytic mRNAs quantified by qPCR (Fig. S6A) as well as EBV genome copy number (Fig. 5D).

272 Supernatants from HIRA-depleted cells induced primary human B-cell clumping, though clusters

273 were generally smaller than observed with CHAF1B KO, likely reflecting lower titer of secreted

274 EBV (Fig. 5D). Taken together, these results indicated that HIRA and CHAF1B have non-

275 redundant roles in the maintenance of Burkitt EBV latency, as depletion of either triggers lytic

276 reactivation.

277 In contrast to CHAF1A and CHAF1B, HIRA mRNA and protein abundance was not

278 significantly changed by primary human B-cell EBV infection, perhaps suggesting that HIRA is

279 well positioned to regulate incoming EBV genomes (Fig. 5F and S6B). We therefore tested

280 whether HIRA also had a role in latency establishment in newly-infected Akata cells. HIRA

281 sgRNA expression increased the percentage of gp350+ cells amongst newly infected GFP+ Akata

282 (Fig. 5G-H), albeit less robustly than CHAF1B sgRNA. Addition of acyclovir strongly reduced bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

283 the percentage of gp350+ cells, suggesting that lytic replication drove its expression in the context

284 of HIRA depletion. Thus, our results are consistent with a model in which HIRA and CAF1 have

285 non-redundant roles in regulation of EBV latency in Burkitt cells.

286 The histone H3.3 loaders ATRX and DAXX have roles in telomeres and have been implicated

287 in maintenance of Burkitt B-cell EBV latency. ShRNA targeting of either ATRX or DAXX

288 induces lytic antigen expression (23). Consistent with these RNAi results, we found that CRISPR

289 targeting of either ATRX or DAXX induced BZLF1 and BMRF1 expression on the mRNA and

290 protein levels, but more weakly induced plasma membrane gp350 expression (Fig. S7). Whereas

291 sgRNAs targeting DAXX induced ~2.5 fold increases in EBV copy number, ATRX sgRNAs failed

292 to do so (Fig. S7). Collectively, these data indicate that multiple histone loaders have non-

293 redundant roles in maintenance of EBV latency.

294

295 Loss of CHAF1B reduces the occupancy of H3.1 and H3.3 at EBV lytic genes’ promoters.

296 CAF1 preferentially loads H3.1/H4 histone tetramers onto newly synthesized or damaged host

297 DNA, though whether it is important for H3.1 loading onto latent EBV genomes remains unknown.

298 In addition, little is presently known about whether histone H3.1 versus 3.3 occupancy at key EBV

299 genomic sites in latency. We therefore used chromatin immunoprecipitation (ChIP) for

300 endogenous histone 3.1 and qPCR to investigate effects of CHAF1B depletion on histone 3.1

301 occupancy at key EBV genomic sites. For cross-comparison, ChIP for histone 3.3 was also

302 performed in parallel on the same samples.

303 CHAF1B depletion significantly decreased histone 3.1 (H3.1) occupancy at the immediate

304 early BZLF1 promoter, and at the late gene BLLF1 (encodes gp350) promoter. Likewise,

305 sgCHAF1B expression decreased H3.1 occupancy at both origins of lytic replication (oriLyt L and bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

306 R), which are EBV genomic enhancers with key roles in lytic gene induction and in lytic DNA

307 replication(52-54) (Fig. 6A). Similar results were obtained in acyclovir-treated cells, suggesting

308 that production of unchromatinized lytic genomes did not falsely lower the ChIP-qPCR result (Fig.

309 S8). This data suggests that latent EBV genomes may be broadly occupied by H3.1-containing

310 nucleosomes, most likely loaded in a DNA replication dependent manner in S-phase (17, 55).

311 Furthermore, CHAF1B depletion reduced H3.3 levels at BZLF1, BLLF1 and oriLyt sites,

312 suggesting that CAF1 also directly or indirectly controls H3.3 loading onto latent EBV genomes.

313 With regards to the latter possibility, RNAseq analysis demonstrated that sgCHAF1B expression

314 diminished the expression of histone and histone-like genes, and ATRX transcript by ~30%, but

315 modestly increased DAXX and HIRA mRNA levels (Table S1). We also note that upon lytic

316 induction by CHAF1B depletion, EBV early gene product BNLF1 is expressed and targets ATRX

317 and DAXX to PML bodies, which may serve to diminish H3.3 loading at these EBV genomic sites

318 (22, 23, 56). Although CHAF1B depletion diminished expression of multiple histone and histone-

319 related genes (Fig. 2F-G and S3A), sgCHAF1B expression did not reduce the steady state H3.1 or

320 H3.3 levels in EBV+ Akata cells, as judged by immunoblot analysis (Fig. 6B).

321 To enable additional cross-comparison of CHAF1B perturbation effects on EBV genomic H3.1

322 and H3.3 occupancy using a single monoclonal antibody, we established EBV+ Akata cells with

323 stable HA-epitope tagged H3.1 or H3.3 expression (49). ChIP was then performed using

324 monoclonal anti-HA antibody in cells expressing sgControl vs sgCHAF1B. Consistent with

325 observations using antibodies against endogenous H3.1 and H.3, CHAF1B depletion similarly

326 reduced HA-3.1 and HA-3.3 signals at BZLF1, BLLF1, and oriLyt sites (Fig. 6C). These results

327 further suggest that the EBV genome is occupied by H3.1- and H3.3-containing nucleosomes in

328 latency I. bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

329 To gain insights into histone H3 isoform loading onto EBV genomes in newly infected primary

330 human B-cells, ChIP-qPCR analyses were performed at 2, 4 and 7 days post EBV-infection.

331 CD19+ B-cells were purified by negative selection and infected with B95.8 EBV at a MOI of 0.2.

332 By Day 2, where infected cells have undergone remodeling but have not yet divided and where

333 most cells should contain only 1-2 EBV genomes (57), H3.1 and H3.3 loading were already

334 significantly increased. This result suggests that both H3 isoforms are loaded onto incoming EBV

335 genomes, potentially by multiple histone loaders. Notably, the EBV tegument protein BNLF1

336 targets ATRX and DAXX for sequestration in PML bodies at this timepoint (23), suggesting that

337 HIRA and newly induced CAF1 may be responsible. H3.1 and H3.3 levels remained stable at Day

338 4 post-infection, a timepoint at which cells have entered Burkitt-like hyperproliferation and divide

339 every 8-12 hours (11-13). Interestingly, after the period of Burkitt-like hyper-proliferation that

340 extends roughly from days 3-7 post-infection, H3.1 and H3.3 levels nearly doubled, even when

341 controlling for increases in EBV genome copy number over this interval. This result suggests that

342 each type of histone 3.3 is loaded by host machinery onto newly synthesized episomes, despite

343 short cell cycle times (Fig. 6D).

344 CAF1 is important for deposition of repressive H3K9me3 and H3K27me3

345 heterochromatin marks. CAF1 has important roles in host genome heterochromatin organization

346 (58-60), in part through cross-talk with deposition of repressive histone 3 lysine 9 and 27 trimethyl

347 marks (H3K9me3 and H3K27me3). For instance, in cell fate determination, depletion of CHAF1A

348 reduced H3K27me3 levels at promoters of many genes associated with pluripotency (58).

349 Deposition of H3K9me3 and H3K27me3 marks onto the EBV genome are important for silencing

350 of the lytic and latency III programs (61-66). However, roles its potential roles in regulation of

351 repressive EBV genome repressive H3 marks has not been investigated. bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

352 CRISPR knockout was used to test the effects of CHAF1B depletion on H3K9me3 and

353 H3k27me3 marks at four EBV genome lytic cycle sites known to carry these repressive marks in

354 latent B-cell lines. Following expression of control vs CHAF1B sgRNAs in EBV+ Akata cells,

355 ChIP was performed with control IgG or with antibodies against H3K9me3 or H3K27me3. qPCR

356 analysis demonstrated that CHAF1B depletion significantly reduced H3K9me3 occupancy by two

357 to three-fold at the BZLF1 and BLLF1 promoters and at both oriLyt regions (Fig. 7A). Likewise,

358 sgCHAF1B expression diminished repressive H3K27me3 marks at the sites to a similar extent

359 (Fig. 7B). These results are consistent with a model in which CAF1 histone H3/4 loading onto

360 newly replicated or perhaps DNA damaged EBV episomes is important for the subsequent

361 propagation of repressive H3K9 and H3K27 trimethel heterochromatic marks (Fig. 8).

362

363 DISCUSSION

364 EBV coopts host epigenetic pathways to regulate viral genome programs. Incoming EBV

365 genomes are organized into nucleosomes, which must then be maintained or remodeled on newly

366 synthesized, damaged or transcribed regions of EBV genomes. Burkitt lymphoma are amongst the

367 fastest growing human tumor cells, and newly EBV-infected B-cells undergo Burkitt-like

368 hyperproliferation between days 3-7 post-infection in cell culture (11-13). Host machinery must

369 therefore propagate chromatin-encoded epigenetic information with each cell cycle, which begins

370 with histone loading. The results presented here suggest that EBV coopts the CAF1 complex to

371 establish and maintain latency, reminiscent of its use by host pathways that regulate embryonic

372 development and cell fate.

373 Histone H3 was loaded onto EBV genomes by 48 hours post primary B-cell infection, by which

374 time CAF1 expression was upregulated (35, 36, 67, 68). These observations raise the question of bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

375 whether CAF1 participates in chromatin assembly on incoming viral genomes. While CRISPR

376 technical limitations currently prevent us from asking this question in resting primary B-cells, our

377 Akata cell system suggested that CAF1 may play a key role in latency establishment. However, in

378 contrast to newly infected primary cells, Akata are rapidly dividing, and our experiments did not

379 differentiate between disruption of latency establishment versus reactivation after the first cell

380 cycle, perhaps related to defects in DNA replication-coupled histone loading. It is plausible that

381 other histone chaperones, in particular HIRA, may play key roles in H3/H4 loading onto incoming

382 EBV genomes prior to mitosis in newly infected cells. CAF1 may then carry out DNA replication

383 dependent roles, beginning with entry of the newly infected cell into S-phase approximately 72

384 hours post-infection (11-13), and HIRA plays ongoing roles that remain to be defined. Notably,

385 the EBV tegument protein BNLF1 subverts DAXX/ATRX-mediated H3.3 loading on viral

386 chromatin for the first several days post-infection (22, 23) (Fig. 8), but subsequently also become

387 necessary for maintenance of EBV latency, suggesting a complex interplay between multiple

388 histone chaperones.

389 Histones 3.1 and 3.3 are loaded onto the beta-herpesvirus cytomegalovirus genomes (50), and

390 intriguingly, their deposition did not require transcription or replication of the viral genome. This

391 finding raises the possibility that conserved mechanisms may load histones onto herpesvirus

392 genomes more broadly. Histone 3.1 and 3.3 loading regulate key aspects of herpes simplex gene

393 regulation (49, 69, 70).

394 The histone chaperone ASF1 transports H3/H4 complexes to the nucleus for deposition onto

395 DNA by CAF1 or HIRA (71). While ASF1a preferentially associates with HIRA and ASF1b with

396 CAF1, they can function redundantly when co-expressed. Depletion of both ASF1A and ASF1B

397 is required to arrest human cell DNA replication (72). Since EBV B-cell infection upregulates both bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

398 ASF1a and ASF1b transcripts (36), and since ASF1a/b are highly co-expressed in Burkitt cells(73),

399 we speculate that this redundancy precluded either ASF paralogue from scoring in our latency

400 reversal CRISPR screen (24).

401 Further studies are required to identify how HIRA, ATRX and DAXX maintain latency I, but

402 permit EBNA1 and EBV non-coding RNA expression. It also remains possible that they indirectly

403 control EBV genome expression through effects host transcription factor expression, which then

404 secondarily regulate the EBV genome. Further underscoring the intricate relationship between

405 EBV and histone biology, EBNA3C downregulates the histone H2A variant H2AX shortly after

406 primary B-cell infection at the mRNA and protein levels (74).

407 MYC suppresses EBV reactivation by preventing DNA looping of oriLYT and terminal repeat

408 regions to the BZLF1 promoter (24). The results presented here raise the question of whether

409 histone loading by CAF1 or HIRA may act together with MYC to prevent long-range EBV

410 genomic DNA interactions that promote lytic reactivation, perhaps at the level of CTCF, cohesion

411 or other DNA looping factors. Perturbation of histone loading may alternatively be sufficient to

412 de-repress BZLF1. Indeed, micrococcal nuclease digestion experiments demonstrated that

413 immediate early BZLF1 and BRLF1 promoters are nucleosomal (75). Yet, open chromatin at

414 BZLF1 and BRLF1 is not sufficient for lytic reactivation (65). Furthermore, CHAF1B de-

415 repression strongly de-repressed latency III gene expression, suggesting a broader role in silencing

416 of EBV antigens.

417 We recently identified that the facilitated chromatin transcription (FACT) histone loading

418 complex is critical for EBV Burkitt latency (24). FACT remodels histones at sites of active

419 transcription to enable RNA polymerase processivity (76, 77). Further underscoring diverse

420 histone chaperone roles in maintenance of EBV latency, FACT was found to regulate EBV latency bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

421 through effects on MYC expression, consistent with its role in driving glioblastoma oncogenic N-

422 MYC expression (78). However, we observed only modest reduction in MYC mRNA expression

423 upon CHAF1B knockdown (Table 1), suggesting an alternative mechanism for its EBV latency

424 maintenance role.

425 A longstanding question has remained how lytic EBV genomes destined for packaging into

426 viral particles evade histone loading, since histones are not detectable in purified EBV viral

427 particles (79). EBV lytic replication is initiated in early S-phase, taking place in nuclear factories

428 that are devoid of histones or host DNA. CAF1 is recruited to host DNA replication forks through

429 association with the DNA clamp PCNA. While PCNA can be detected in EBV amplification

430 factories, it does not localize to sites of viral DNA synthesis (16). Abundances of CHAF1A,

431 CHAF1B, ASF1a and ASF1b decline in lytic replication in Burkitt/epithelial cell somatic hybrid

432 D98/HR1 cells, whereas HIRA and DAXX levels were stable.

433 DNA methylation is important for suppression of latency III, raising the question of how

434 CHAF1B depletion de-repressed latency III genes (Figure S3A). While we note that latency III

435 transcripts are induced in Burkitt cell EBV lytic reactivation (27), we speculate that CAF1

436 depletion may perturb maintenance of EBV genomic DNA methylation through effects on cross-

437 talk between histone and DNA methylation pathways. ChIP-seq approaches demonstrated

438 H3K9me3 and H3K27me3 repressive marks at key lytic and latency gene sites (61, 80, 81).

439 Furthermore, we recently found domains of the enzyme UHRF1 that read H3K9me2/me3, the H3

440 N-terminus and hemi-methylated DNA are essential for EBV latency I (73). We therefore

441 speculate that CHAF1B depletion may perturb UHRF1 recruitment and thereby disrupt DNA

442 methylation. bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

443 CHAF1B depletion induced a strong interferon induced signature, which we and other have not

444 observed in Burkitt cell lytic reactivation triggered by immunoglobulin cross-linking or by

445 conditional BZLF1 alleles. Therefore, we hypothesize that DNA sensing pathways may be

446 activated by CHAF1B depletion, for example in response to exposure of viral or host non-

447 chromatinized DNA. Alternatively, latency III triggers interferon induced genes, and a de-

448 repressed EBV transcript may be responsible for this phenotype (35, 36, 82). It is also worth noting

449 that CHAF1B depletion resulted in downregulation of numerous histone and histone-like genes,

450 which we speculate may result from a negative feedback loop that responds to loss of this important

451 histone chaperone complex.

452 EBV exclusively establishes infection in normal, differentiated epithelial cells (83-86).

453 Epithelial cell replication plays important roles in EBV shedding into saliva (87), and uncontrolled

454 lytic EBV replication can cause oral hairy leukoplakia in heavily immunosuppressed people. It

455 will be of significant interest to determine how CAF1, HIRA, ATRX and DAXX roles may be

456 distinct in epithelial cells to support escape from EBV latency.

457 Current Burkitt lymphoma therapies cause major side effects and increase the risk of secondary

458 malignancies. eBL management is further complicated by the risk of giving high-intensity

459 chemotherapy in resource-limited settings. Consequently, there is significant interest in developing

460 safer therapeutic regimen, including EBV lytic reactivation strategies (88). Reversal of EBV

461 Burkitt latency could selectively sensitize tumor cells to T-cell responses and to the antiviral drug

462 ganciclovir (89).

463

464

465 bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

466

467

468

469

470 Figure Legends

471 Figure 1. CHAF1B depletion triggers EBV lytic gene expression in Burkitt cells.

472 (A) Volcano plots of CRISPR screen(24) -Log10 (p-value) and Log2 (fold-change of gp350+ vs

473 input library sgRNA abundance) on Day 6 post Avana library transducton. CAF1 subunits.

474 (B, C) Top: Distribution of Log2 (fold-change gp350+ versus input library sgRNA abundance) at

475 Day 6 (B) or Day 9 (C) post sgRNA expression. Bottom: Log2 fold change for the four CHAF1B

476 (B) or RBBP4 (C) targeting sgRNAs (red lines), overlaid on gray gradient depicting overall

477 sgRNA distributions at CRISPR screen Days 6 versus 9. Average values from two screen

478 biological replicates are shown.

479 (D) Model of DNA replication-dependent histone H3 and H4 loading by CAF1 and ASF1. Also

480 shown are the CAF1 binding partner PCNA clamp and a histone chaperone loading histones

481 H2A/H2B onto DNA.

482 (E) Immunoblot analysis of whole cell lysates (WCL) from P3HR-1, Akata and MUTU I Burkitt

483 cells expressing control or CHAF1B sgRNAs.

484 (F) FACS analysis of plasma membrane (PM) gp350 expression in Akata cells expressing control

485 or CHAF1B sgRNAs.

486 (G) Mean ± standard deviation (SD) PM gp350 mean fluorescence intensities (MFI) from n=3

487 replicates, as in (F). **** p < 0.0001. bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

488 (H) Immunoblot analysis of WCL from Akata cells expressing GFP or V5-epitope tagged

489 CHAF1B rescue cDNA (CHAF1BR) and the indicated sgRNAs.

490 (I) FACS analysis of PM gp350 expression in Akata cells that stably express GFP or CHAF1BR

491 and the indicated sgRNAs.

492 (J) Mean ± SD PM gp350 MFI values from n=3 replicates, as in (I). Cells expressed GFP where

493 not indicated to express CHAF1BR, and cells expressed sgControl where not indicated to express

494 sgCHAF1B. ** p < 0.01, ns, not significant.

495 Blots in E and H are representative of n=3 replicates.

496

497 Figure 2. CHAF1B depletion triggers Burkitt cell EBV lytic reactivation and interferon stimulated

498 gene expression.

499 (A) Volcano plot comparing RNAseq -Log10 (p-value) versus Log2 (fold-change sgCHAF1B vs

500 sgControl mRNA abundance) from n=3 replicates. Significantly changed EBV lytic gene values

501 are shown in red, host genes are shown in gray.

502 (B) qPCR analysis of EBV intracellular or DNase-treated extracellular genome copy number from

503 Akata cells expressing control or CHAF1B sgRNAs. Total genomic DNA was extracted at Day 6

504 post lentivirus transduction or 48h post stimulation by anti-IgG (10µg/ml). Mean ± SD values from

505 n=3 biologically independent replicates are shown. *p<0.05, **p<0.01, ****p<0.0001.

506 (C) Phase microscopy images of human primary B cells at Day 7 or 21 post-inoculation with cell

507 culture supernatant from Akata cells expressing control or CHAF1B sgRNAs. White scale

508 bar=100µm.

509 (D) Representative FACS plots of PM gp350 expression in Akata cells expressing control or

510 CHAF1B sgRNAs and in the absence or presence of αIgG (10µg/ml) for 48 hours. bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

511 (E) Mean ± SD PM gp350 MFI values from n=3 replicates of Akata with indicated sgRNAs and

512 αIgG stimulation, as in (D). **** p < 0.0001.

513 (F) Volcano plot comparing RNAseq -Log10 (p-value) versus Log2 (fold-change sgCHAF1B vs

514 sgControl mRNA abundance) from n=3 replicates. Purple circles indicate selected interferon (IFN)

515 stimulated genes and blue circles indicate histone related genes.

516 (G) Enrichr pathway analysis of gene sets significantly upregulated (purple bars) or downregulated

517 (blue bars) by CHAF1B sgRNA expression. Shown are the -Log10 (p-values) from Enrich analysis

518 of triplicate RNAseq datasets, using Fisher exact test. See also Table S1.

519 (H) Immunoblot analysis of WCL from Akata or P3HR-1 cells expressing control or CHAF1B

520 sgRNAs, for the IFN stimulated genes IFIT1 and IRF7, CHAF1B or GAPDH, as indicated.

521 Blots in H are representative of n=2 replicates.

522

523 Figure 3. CAF1 subunits RBBP4 and CHAF1A are necessary for Burkitt cell EBV latency.

524 (A) Immunoblot analysis of WCL from Akata cells expressing control or RBBP4 sgRNAs.

525 (B) FACS analysis of PM gp350 expression in Akata cells expressing control or RBBP4 sgRNAs.

526 (C) Mean ± SD PM gp350 MFI values from n=3 replicates of Akata with the indicated sgRNAs,

527 as in (B). **** p < 0.0001.

528 (D) Immunoblot analysis of WCL from Akata expressing control or CHAF1A sgRNAs.

529 (E) FACS analysis of PM gp350 expression in Akata cells expressing control or CHAF1A sgRNAs.

530 (F) Mean ± SD PM gp350 MFI values from n=3 replicates of Akata with indicated sgRNAs, as in

531 (E). **** p < 0.0001.

532 (G and H) qPCR analysis of EBV intracellular or DNAse-treated extracellular genome copy

533 number from Akata expressing control, RBBP4 (G) or CHAF1A (H) sgRNAs. Total genomic bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

534 DNA was extracted at Day 6 post lentivirus transduction. Mean ± SD values from n=3 replicates

535 are shown. ****p<0.0001.

536 Blots in A and D are representative of n=3 replicates.

537

538 Figure 4. CAF1 complex restricts lytic cycle after EBV infection in primary human B cells

539 (A) CHAF1B, CHAF1A and RBBP4 relative protein abundances detected by tandem-mass-tag-

540 based proteomic analysis of primary human B-cells at rest and at nine time points after EBV B95.8

541 infection at a multiplicity of infection of 0.1proteomic analysis at rest and at nine time points after

542 EBV B95.8 strain infection of primary human peripheral blood B-cells at a multiplicity of infection

543 of 0.1. Data represent the average +/- SEM for n=3 independent replicates(35). For each protein,

544 the maximum level detected across the time course was set to a value of 1.

545 (B) Immunoblot analysis of WCL from primary B cells infected with B95.8 EBV at Days 0, 2, 4,

546 7, 10 and 14 post-infection.

547 (C) GM12878 ChIP-seq signals of EBV-encoded EBNA2, EBNA-LP, EBNA3A, EBNA3C,

548 LMP1 activated RelA, RelB, cRel, p50, p52 NF-kB subunits or c-Myc at the CHAF1B . Track

549 heights are indicated in the upper left.

550 (D) Schematic diagram of cell co-culture system for newly-infected Burkitt cell EBV latency

551 establishment. Transfection of BZLF1 and BALF1 expression vectors triggers lytic reactivation in

552 EBV+ 293 cells with a recombinant viral genome that harbors a GFP marker. EBV-uninfected

553 (EBV-) Akata cells are then co-cultured with induced 293 cells, in the absence or presence of

554 acyclovir. 48 hours later, cells are analyzed by FACS for expression of GFP and the late lytic

555 antigen gp350, which is expressed in cells that fail to establish latency. bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

556 (E) Control or CHAF1B KO Akata EBV- cells were co-cultured with HEK-293 2-8-15 cells

557 harboring GFP-EBV. Cells were mock treated or treated with 50µg/ml of acyclovir. Cells were

558 then subjected to GFP and PM gp350 FACS. FSC and SSC parameters were used to gate out the

559 contaminated HEK293 cells from Akata EBV negative cells. GFP vs gp350 dot plots from a

560 representative replicate were shown.

561 (F) Top: Mean ± SD PM gp350 MFI values from n=3 replicates of co-cultured Akata EBV- cells

562 with the indicated experimental conditions, as in (D). **** p < 0.0001. Bottom: Immunoblot

563 analysis of WCL from Akata EBV- cells co-cultured 293 cells under the indicated experimental

564 conditions.

565

566 Figure 5. Histone 3.3 chaperone HIRA restricts Burkitt EBV lytic reactivation.

567 (A) Immunoblot analysis of WCL from P3HR-1, Akata EBV+ or MUTU I BL cells expressing

568 control or HIRA sgRNAs.

569 (B) FACS analysis of PM gp350 expression in Akata EBV positive cells expressing control or

570 HIRA sgRNAs.

571 (C) Mean ± SD PM gp350 MFI values from n=3 replicates of Akata with indicated sgRNAs, as in

572 (B). **** p < 0.0001.

573 (D) qPCR analysis of EBV intracellular or DNAse-resistant extracellular genome copy number

574 from Akata EBV+ cells expressing control or HIRA sgRNAs. Total genomic DNA was extracted

575 at Day 6 post lentivirus transduction. Mean ±SD values from n=3 replicates are shown.

576 ****p<0.0001.

577 (E) Phase microscopy images of human primary B cells at Day 7 or 10 post-inoculation with cell

578 culture supernatant from Akata cells expressing control or HIRA sgRNAs. White scale bar=100µm. bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

579 (F) HIRA relative protein abundances detected by tandem-mass-tag-based proteomic analysis of

580 primary human B-cells at rest and at nine time points after EBV B95.8 infection at a multiplicity

581 of infection of 0.1. Data represent the average +/- SEM for n=3 independent replicates(35). For

582 each protein, the maximum level detected across the time course was set to a value of 1.

583 (G) Control or HIRA KO Akata EBV- cells were co-cultured with HEK-293 2-8-15 cells

584 harboring recombinant EBV encoding a GFP marker. Cells were mock-treated or treated with

585 50µg/ml of acyclovir. Cells were then subjected to FACS for GFP or PM gp350. GFP vs gp350

586 dot plots from a representative replicate were shown.

587 (H) Mean + SD PM gp350 MFI values from n=3 replicates Akata EBV- cells of co-cultured with

588 293 cells under the indicated experimental conditions. **** p < 0.0001.

589

590 Figure 6. CHAF1B depletion reduces histone H3.1 and H3.3 occupancy at key EBV lytic

591 cycle regulatory elements.

592 (A) ChIP was performed using antibodies against endogenous H3.1 or H3.3 on chromatin from

593 Akata EBV+ cells expressing control or CHAF1B sgRNAs, followed by qPCR with primers

594 specific for the BZLF1 or BLLF1 promoters, oriLyt R or oriLyt L. Mean ± SEM are shown for n=3

595 biologically independent replicates. p-values were calculated by two-way ANOVA with Sidak's

596 multiple comparisons test.

597 (B) Immunoblot analysis of WCL from EBV+ Akata, BL cells expressing control or independent

598 CHAF1B.

599 (C) ChIP for HA-epitope tagged H3.1 or H3.3 using anti-HA antibody and chromatin from Akata

600 EBV+ cells stably expressing HA-H3.1 or HA-H3.3 and the indicated sgRNAs. qPCR was then

601 performed with primers specific for the BZLF1 or BLLF1 promoters, oriLyt R or oriLyt L. Mean bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

602 ± SEM are shown for n=3 biologically independent replicates are shown. p-Values were calculated

603 by two-way ANOVA with Sidak's multiple comparisons test.

604 (D) ChIP for endogenous H3.1 or H3.3 was performed using antibodies targeting H3.1 or H3.3

605 on chromatin from human primary B cells infected with B95.8 EBV at 2, 4 and 7 days post

606 infection, followed by qPCR with primers specific for the BZLF1 promoter. Input DNA for each

607 time point was normalized for intracellular EBV genome copy number. Mean ± SEM are shown

608 for n=3 biologically independent replicates are shown. p-Values were calculated by two-way

609 ANOVA with Sidak's multiple comparisons test.

610

611 Figure 7. CHAF1b is important for H3K9me3 and H3k27me3 repressive marks at EBV

612 genome lytic cycle regulatory sites.

613 (A) ChIP for H3K9me3 was performed on chromatin from Akata EBV+ cells expressing control

614 or CHAF1B sgRNAs, followed by qPCR with primers specific for the BZLF1 or BLLF1 promoters,

615 oriLyt R or oriLyt L. Mean ± SEM are shown for n=3 biologically independent replicates are

616 shown. p-Values were calculated by two-way ANOVA with Sidak's multiple comparisons test.

617 (B) ChIP for H3K27me3 was performed on chromatin from Akata EBV+ cells expressing control

618 or CHAF1B sgRNAs, followed by qPCR with primers specific for the BZLF1 or BLLF1 promoters,

619 oriLyt R or oriLyt L. Mean ± SEM are shown for n=3 biologically independent replicates are

620 shown. p-Values were calculated by two-way ANOVA with Sidak's multiple comparisons test.

621

622 Figure 8. Schematic of histone loader roles in EBV genome regulation. Top, CAF1 and HIRA

623 load histones H3/H4 onto incoming EBV genomes, together with ASF1. H2A/H2B are loaded

624 onto the EBV genome by distinct histone chaperone and assemble into histone octamers. EBV bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

625 BNRF1 subverts ATRX/DAXX in newly infected cells. DNA methyltransferases and histone

626 H3K9 and H3K27 methyltransferases add repressive marks that suppress lytic cycle and latency

627 III genes. Bottom, CAF1 and HIRA roles in maintenance of latency I. EBV genomes are replicated

628 by host machinery in early S-phase, and newly synthesized genomes must be reprogrammed to

629 latency I. CAF1, HIRA and ATRX/DAXX have non-redundant roles in maintenance of latency I.

630 Cross-talk with DNA methylation machinery is important for propagation of CpG methylation

631 marks that maintain latency I.

632

633

634 Supplemental Figure Legends

635 Figure S1. CHAF1B depletion triggers EBV lytic antigens expression in Burkitt cells

636 (A) Top: Distribution of Log2 fold-change (LFC) values of sgRNAs in gp350+ sorted versus input

637 library cells for all Avana library guides at screen Day 6. Bottom: LFC for the four CHAF1A

638 targeting sgRNAs (red lines), overlaid on gray gradient depicting the overall sgRNA distribution,

639 at CRISPR screen Days 6 versus 9. Average values from two screen biological replicates are shown.

640 (B) qRT-PCR analysis of selected viral immediate early, early, and late genes in Akata EBV+ cells

641 expressing control or independent CHAF1B sgRNA. Mean + SD values from N=3 replicates, ****

642 p < 0.0001

643 (C) FACS analysis of PM gp350 expression in MUTU I cells expressing control or independent

644 CHAF1B sgRNAs.

645 (D) Mean + SD PM gp350 MFI values from n=3 replicates of Akata with indicated sgRNAs, as in

646 (C). **** p < 0.0001. bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

647 (E) Immunoblot analysis of WCL from MUTU I cells stably expressing GFP or V5 epitope tagged-

648 CHAF1B cDNAs and control or CHAF1B sgRNA, as indicated. Blot is representative of n=3

649 replicates.

650

651

652 Figure S2. Depletion of CHAF1B induces lytic reactivation in multiple EBV+ Burkitt tumor

653 cell lines.

654 (A, B) qPCR analysis of EBV intracellular genome copy number from MUTU I (A) or P3HR-1

655 (B) cells expressing control or CHAF1B sgRNAs. Total genomic DNA was extracted at Day 6

656 post-lentivirus transduction. Mean ±SD values from n=3 replicates are shown. ****p<0.0001.

657 (C) qPCR analysis of EBV intracellular or extracellular genome copy number from Akata EBV+

658 cells expressing GFP of V5-CHAF1BR cDNAs and the indicated sgRNAs. Cells expressed GFP

659 where not indicated to express CHAF1BR, and cells expressed sgControl where not indicated to

660 express sgCHAF1B. Total genomic DNA was extracted at Day 6 post lentivirus transduction.

661 Mean ± SD values from n=3 replicates are shown. ****p<0.0001, *<0.05, ns=non-significant.

662 (D) qPCR analysis of EBV intracellular or extracellular genome copy number from Akata cells

663 expressing control or CHAF1B sgRNAs comparing alone or in combination with 10µg/ml of αIgG

664 for 48 hours. Mean ±SD values from n=3 replicates are shown. ****p<0.0001.

665 (E) FACS analysis of PM gp350 expression in MUTU I cells expressing control or independent

666 CHAF1B sgRNAs, and mock-induced or induced with αIgM 10µg/ml.

667 (F) qPCR analysis of EBV intracellular or extracellular genome copy number from MUTU I

668 expressing control or CHAF1B sgRNAs alone or in combination with αIgM induction. KO cells bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

669 were mock-treated or treated with 10µg/ml of αIgM for 48 hours. Mean ±SD values from n=3

670 replicates are shown. ****p<0.0001.

671

672 Figure S3. RNAseq heatmap analyses of CHAF1 depletion effects on Akata EBV latency III,

673 interferon stimulated gene and histone gene expression.

674 (A) Heatmap representation of EBV latency III gene abundance in Akata EBV+ cells expressing

675 control or CHAF1B sgRNAs. Shown are data from n=3 biologically independent replicates.

676 (B) Heatmap representation of interferon stimulated genes whose expression was significantly

677 upregulated in sgCHAF1b versus sgControl expressing Akata EBV+ cells. Shown are data from

678 n=3 replicates.

679 (C) Heatmap representation of mRNAs encoding histones whose expression was significantly

680 different in Akata EBV+ cells expressing sgCHAF1B vs sgControl. Shown are data from n=3

681 replicates. Histone H3 genes are labeled in red.

682

683 Figure S4. CHAF1A or RBBP4 depletion trigger Burkitt cell EBV lytic reactivation.

684 (A and B) qRT-PCR analysis of selected viral immediate early, early, and late genes from Akata

685 EBV+ cells expressing control or independent RBBP4 (A) or CHAF1A (B) sgRNAs. Mean ±SD

686 values from n=3 replicates are shown. ****p<0.0001

687 (C and D) Immunoblot analysis of WCL from MUTU I or P3HR-1 cells expressing control or

688 independent RBBP4 (C) or CHAF1A (D) sgRNAs. Blots are representative of n=3 replicates.

689 (E) qPCR analysis of EBV intracellular or extracellular genome copy number from MUTU I cells

690 expressing control, CHAF1A or RBBP4 sgRNAs. Mean ±SD values from n=3 replicates are

691 shown. ****p<0.0001, ***p<0.001. bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

692 (F) qPCR analysis of EBV intracellular or extracellular genome copy number from P3HR-1 cells

693 expressing control, CHAF1A or RBBP4 sgRNAs. Mean ±SD values from n=3 replicates are

694 shown. ****p<0.0001, ***p<0.001.

695

696 Figure S5. EBV induces CAF1 in newly infected primary human B-cells.

697 (A) Normalized CHAF1B, CHAF1A, or RBBP4 mRNA levels from primary human peripheral

698 blood B-cells at the indicated day post infection (DPI) by the EBV B95.8 strain (36). Shown are

699 the mean ± SEM values from n=3 of biologically independent RNAseq datasets. ****p<0.0001,

700 ***p<0.001, **p<0.01.

701 (B and C) LCL ChIP-seq signals of EBNA2, EBNALP, EBNA3A, 3C, RelA, RelB, cRel, p50,

702 p52 and MYC at the CHAF1A (B) or RBBP4 (C) loci. Track heights are indicated in the upper left,

703 and genomic positions indicated at top of each panel.

704

705 Figure S6 HIRA depletion triggers Burkitt cell EBV lytic reactivation.

706 (A) qRT-PCR analysis of selected viral immediate early, early, and late genes from Akata EBV+

707 cells expressing control or HIRA sgRNAs. Mean + SD shown from n=3 replicates, **** p<0.0001.

708 (B) Normalized HIRA mRNA levels in primary human peripheral blood B-cells at the indicated

709 day post infection (DPI) by EBV B95.8 (36). Shown are the mean + SD values from n=3 of

710 biologically independent RNAseq replicates. *, p<0.05. ns, non-significant.

711

712 Figure S7 DAXX and ATRX depletion triggers Burkitt EBV lytic reactivation.

713 (A) Immunoblot analysis of WCL from EBV+ Akata, MUTU I and P3HR-1 cells expressing

714 control or independent ATRX sgRNAs. bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

715 (B) Immunoblot analysis of cell extracts from EBV+ Akata, MUTU I and P3HR-1 cells expressing

716 control, or DAXX sgRNAs.

717 (C) FACS analysis of PM gp350 expression in Akata EBV positive cells expressing control, ATRX,

718 or DAXX sgRNAs.

719 (D) Mean ± SD PM gp350 MFI values from n=3 replicates of Akata EBV positive cells expressing

720 control, ATRX, or DAXX sgRNAs, as in (C). **** p < 0.0001.

721 (E and F) qRT-PCR analysis of selected viral immediate early, early, and late genes in Akata

722 EBV+ cells expressing control or independent ATRX(A) or DAXX (E) sgRNAs. Mean + SD from

723 n=3 replicates, **** p<0.0001.

724 (G) qPCR analysis of EBV intracellular genome copy number from Akata EBV+ cells expressing

725 control, ATRX or DAXX sgRNAs. Mean +SD values from n=3 replicates are shown.

726 ****p<0.0001, ns=non-significant.

727 (H) ATRX or DAXX relative protein abundances detected by tandem-mass-tag-based proteomic

728 analysis of primary human B-cells at rest and at nine time points after EBV B95.8 infection at a

729 multiplicity of infection of 0.1. Data represent the average +/- SEM for n=3 independent

730 replicates(35). For each protein, the maximum level detected across the time course was set to a

731 value of one.

732 Blots in A, B are representative of n=3 replicates.

733 Figure S8. CHAF1B depletion reduces H3.1 loading at multiple EBV genomic lytic cycle

734 regulatory elements in presence of acyclovir.

735 (A) ChIP for H3.1 or H3.3 was performed using antibodies targeting endogenous H3.1 or H3.3 on

736 chromatin from Akata EBV+ cells expressing control or CHAF1B sgRNAs, treated with 100µg/ml

737 acyclovir. qPCR with primers specific for BZLF1 or BLLF1 promoters, oriLyt R or oriLyt L. Mean bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

738 ± SEM are shown for n=3 biologically independent replicates are shown, ****p<0.0001, **

739 p<0.01. p-Values were calculated by two-way ANOVA with Sidak's multiple comparisons test.

740

741

742

743

744

745 Supplementary Tables

746 Table S1 Differentially expressed genes in EBV+ Akata cells expressing control or CHAF1B

747 sgRNAs and Enrichr analysis of selected genes (p<0.05, LFC>1 or <-1)

748 Table S2 List of antibodies, reagents, kits, and oligoes used in this study.

749

750 MATERIALS AND METHODS

751 Cell lines and culture. Throughout the manuscript, all B-cell lines used stably expressed S.

752 pyogenes Cas9. The EBV+ Burkitt lymphoma cell lines P3HR-1, Akata, and MUTU I were used

753 in the study. EBV-Akata cells are a derivative cell line of the original EBV+ Akata tumor cell line

754 that spontaneously lost EBV in culture. The EBV+ Burkitt lymphoma cell lines Akata EBV+,

755 MUTU I, P3HR-1 and EBV- Akata were maintained in RMPI 1640 (Gibco, Life Technologies)

756 supplemented with 10% fetal bovine serum (Gibco). 293T were grown in Dulbecco’s Modified

757 Eagle’s Medium (DMEM) with 10% fetal bovine serum (Gibco). Cell lines with stable expression

758 of Streptococcus pyogenes Cas9 gene were generated by lentiviral transduction, followed by

759 blasticidin selection at 5 μg/ml, as reported (90). For selection of transduced cells, puromycin was

760 added at the concentration of 3 μg/ml. Hygromycin was used at 200 μg/ml for the initial 4 days, bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

761 and 100 μg/ml thereafter. Acyclovir was used at the concentration of 100 µg/ml in vitro. EBV

762 producer HEK-293 cells stably transformed by BART-repaired B95-8 based EBV BAC system

763 encoding GFP (45) were cultured in RPMI 1640 (Gibco, Life Technologies) supplemented with

764 10% fetal bovine serum (Gibco) and 1% penicillin, 50 μg/ml hygromycin. All cells used in this

765 study were cultured in a humidified incubator at 37°C with 5% CO2 and routinely tested and

766 certified as mycoplasma-free using the MycoAlert kit (Lonza). STR analysis (Idexx) was done to

767 verify identify of MUTU I cells.

768 Immunoblot analysis. Immunoblot analysis was performed as previously described (91). In

769 brief, WCL were separated by SDS-PAGE electrophoresis, transferred onto nitrocellulose

770 membranes, blocked with 5% milk in TBST buffer and then probed with primary antibodies at

771 4 °C overnight on a rocking platform, washed four times and then incubated with secondary

772 antibody (Cell Signaling Technology, cat#7074 and cat#7076) for 1 h at room temperature. Blots

773 were then developed by incubation with ECL chemiluminescence for 1 min (Millipore,

774 cat#WBLUF0500) and images were captured by Licor Fc platform. All antibodies used in this

775 study were listed in supplementary Table S2.

776 Flow cytometry analysis. For live cells staining, 1× 106 of cells were washed twice with FACS

777 buffer (PBS, 1mM EDTA, and 0.5% BSA), followed by primary antibodies incubation for 30 min

778 on ice. Labeled cells were then washed three times with FACS buffer. Data were recorded with a

779 BD FACS Calibur and analyzed with Flowjo X software (Flowjo).

780 Quantification of EBV genome copy number 781 To measure EBV genome copy number, intracellular viral DNA and virion-associated DNA

782 present in cell culture supernatant were quantitated by qPCR analysis. For intracellular viral

783 DNA extraction, total DNA from 2×106 of Burkitt cells was extracted by the Blood & Cell

784 culture DNA mini kit (Qiagen #13362). For extracellular viral DNA extraction, 500 μl of culture bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

785 supernatant was collected from the same experiment as intracellular DNA measurement, and was

786 treated with 20 μl RQ1 DNase (Promega) for 1 h at 37°C to degrade non-encapsidated EBV

787 genomes. 30 μl proteinase K (20 mg/ml, New England Biolabs, #P8107S) and 100 μl 10%

788 (wt/vol) SDS (Invitrogen, #155553-035) were then were added to the reaction mixtures, which

789 were incubated for 1 h at 65°C. DNA was purified by phenol-chloroform extraction followed by

790 isopropanol-sodium acetate precipitation and then resuspended in 50 μl nuclease-free water

791 (Thermo Fisher, #10977-023). Extracted DNA was further diluted to 10 ng/ul and subjected to

792 qPCR targeting of the EBV BALF5 gene. Standard curves were made by serial dilution of a

793 pHAGE-BALF5 miniprep DNA at 25 ng/uL. Viral DNA copy number was calculated by

794 inputting sample Ct values into the regression equation dictated by the standard curve.

795 cDNA rescue assay. V5-tagged CHAF1B cDNA with G360A PAM site mutation was

796 synthesized by Genescript (Piscataway, NJ), as described in the following table. CHAF1B sg1

797 sequence is shown. PAM sequences are underlined. Mutation site is indicated in red. Rescue

798 cDNA was synthesized by GenScript (Piscataway, NJ) and cloned into pLX-TRC313 vector.

799 Cas9 expressing B cells with stable C-terminal V5 epitope-tagged CHAF1B cDNA expression

800 was established by lentiviral transduction and hygromycin selection. bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

CHAF1B KO and Rescue sgRNA 5’ – GCTGAACAAGGAGAACTGGA – 3’ (sense) Genomic DNA 5’ – GCTGAACAAGGAGAACTGGACGGT– 3’ (#1) Rescue cDNA 5’ – GCTGAACAAGGAGAACTGGACAGT– 3’ (#1) Rescue cDNA GGAGGATCCACAGACTGGCGTCTGCCGGCGTGGACACCA sequence surrounding ATGTCAGGATCTGGAAGGTAGAAAAGGGACCAGATGGAA the PAM site mutation AAGCCATCGTGGAATTTTTGTCCAATCTTGCTCGTCATACC (in bold and shaded) AAAGCCGTCAATGTTGTGCGTTTTTCTCCAACTGGGGAAA TTTTAGCATCGGGAGGAGATGATGCTGTCATCCTATTGTG GAAGGTGAATGATAACAAGGAGCCGGAGCAGATCGCTTT TCAGGATGAGGACGAGGCCCAGCTGAACAAGGAGAACTG GACAGTTGTGAAGACTCTGCGGGGCCACTTAGAAGATGT GTATGATATTTGCTGGGCAACTGATGGGAATTTAATGGCT TCTGCCTCTGTGGATAACACAGCCATCATATGGGATGTCA GCAAAGGACAAAAGATATCAATTTTTAATGAACATAAAA GTTATGTCCAAGGAGTAACCTGGGACCCTTTGGGTCAATA TGTTGCTACTCTGAGCTGTGACAGGGTGCTGCGAGTATAC AGTATACAGAAGAAGCGTGTGGCTTTCAATGTTTCGAAGA TGCTGTCTGG 801 802

803 Chromatin Immunoprecipitation (ChIP) qPCR. Cells were crosslinked with formaldehyde

804 0.4% for 10 min at room temperature and the reaction was stopped by adding glycine (2.5M) to

805 final concentration 0.2M for 10 minutes at room temperature. The cells were washed three times

806 with PBS and then lysed by 1% SDS lysis buffer (50mM Tris pH8.1, 10mM EDTA, 1% SDS and

807 protease inhibitor) for 20min on ice. Lysate was sonicated 25 min (30 sec on / 30 sec off) in a

808 Diagenode water bath-sonicator and centrifuged at 13000 rpm for 10 min. The supernatant was

809 diluted 10 times in ChIP Dilution Buffer (SDS 0.01%, Triton X-100 1.1%, 1.2 mM EDTA pH 8,

810 16.7 mM Tris-HCl pH 8.1, 167 mM NaCl and protease inhibitor) and pre-cleared for 1 hour,

811 rotating at 4°C with blocking beads. Soluble chromatin was diluted and incubated with 4μg anti-

812 HA polyclonal antibody (Abcam, #ab9110), anti-H3.1/H3.2 polyclonal antibody (Millipore,

813 #ABE154) or anti-H3.3 polyclonal antibody (Millipore, #09-838). Specific immunocomplexes bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

814 were precipitated with protein A beads (Thermo fisher, #101041). The beads were washed, for 5

815 minutes, once in Low Salt Buffer (SDS 0.1%, Triton X-100 1%, 2 mM EDTA pH 8.1, 20 mM

816 Tris-HCl pH 8.1 and 150 mM NaCl), twice in High Salt Buffer (SDS 0.1%, Triton X-100 1%, 2

817 mM EDTA pH 8, 20 mM Tris-HCl pH 8.1 and 500 mM NaCl), once in LiCl Buffer (0.25 M LiCl,

818 NP-40 1%, Na Deoxycholate 1%, 1 mM EDTA pH 8.1 and 10 mM Tris-HCl pH 8.1) and twice in

819 TE buffer. After reverse cross-linking, DNA was purified by using QIAquick PCR purification kit

820 (Qiagen, #28106). qPCR quantified the DNA from ChIP assay and normalized it to the percent of

821 input DNA. Primers for qPCR are listed in Supplementary Table S2.

822 RT-PCR analysis. Total RNA was harvested from cells using RNeasy Mini Kit (Qiagen, #27106).

823 Genomic DNA was removed by using the RNase-Free DNase Set (Qiagen, #79254). RNA was

824 reversed transcribed by iScriptTM Reverse Transcription Supermix (Bio-Rad, #1708841). qRT-

825 PCR was performed using Power SYBR Green PCR Mix (Applied Biosystems, #4367659) on a

826 CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad), and data were normalized to

827 internal control GAPDH. Relative expression was calculated using 2-ΔΔCt method. All samples

828 were run in technical triplicates and at least three independent experiments were performed. The

829 primer sequences were listed in Supplementary Table S2.

830 Primary Human B Cells Purification Discarded, de-identified leukocyte fractions left over

831 from platelet donations were obtained from the Brigham and Women’s Hospital blood bank.

832 Peripheral blood cells were collected from platelet donors, following institutional guidelines. Since

833 these were de-identified samples, the gender was unknown. Our studies on primary human blood

834 cells were approved by the Brigham & Women’s Hospital Institutional Review Board. Primary

835 human B cells were isolated by negative selection using RosetteSep Human B Cell Enrichment

836 and EasySep Human B cell enrichment kits (Stem Cell Technologies, #15064 and #19054), bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

837 according to the manufacturers’ protocols. B cell purity was confirmed by plasma membrane

838 CD19 positivity through FACS. Cells were then cultured with RPMI 1640 with 10% FBS.

839 EBV Infection of Primary B-Cells

840 EBV B95-8 virus was produced from B95-8 cells with conditional ZTA expression. 4HT was used

841 at a concentration of 1 μM to induce EBV lytic replication, removed 24 hours later, and cells were

842 resuspended in 4HT-free RPMI/10% FBS for 96 hours. Virus-containing supernatants were

843 collected and subject to filtration through a 0.45 μm filter to remove producer cells. Titer was

844 determined experimentally by transformation assay as described previously (35). For analysis of

845 transforming EBV production in Burkitt knockout experiments, culture supernatants from Akata

846 EBV+ cells expressing control, CHAF1B or HIRA sgRNAs were harvested. Supernatants were

847 passed through a 0.80 μm filter to remove any producer cells and were then mixed with 1 million

848 purified CD19+ primary human B cells in 12 well plates. For determining histone H3.1 or H3.3

849 occupancy in newly infected primary cells, 6×10^7 purified human B cells were infected with

850 B95.8 at a MOI of 0.2. Ten million cells were harvested at 2, 4, and 7 DPI. Viral episome number

851 at each time point was quantitated by BALF5 qPCR. The recombinant vector pHAGE-BALF5 was

852 used to establish the standard curve for absolute quantification of EBV episome number. The H3

853 ChIP qPCR signals were normalized using EBV episome numbers at each time point, in order to

854 control for changes in EBV copy number in B-cells between DPI 2-7.

855 Co-cultivation of Akata EBV negative cells EBV HEK-293 producer cells. EBV producer

856 HEK-293 cells stably transformed by BART-repaired B95-8 based GFP-EBV BAC system (45).

857 EBV producer cells were seeded at a density of 0.3×10^6/ml in Corning® BioCoat™ Collagen I

858 6 Well Plate (cat#356400). After 24 hours, HEK-293 producer cells were co-transfected with

859 500µg of pCDNA-BALF4 and 500ug of pCDNA-BZLF1 per well, as described previously(92). bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

860 After incubating for additional 24h, 0.5×10^6/ml of control or CHAF1B KO of Akata EBV- cells

861 resuspended in fresh media were added onto the HEK-293 cells gently. Co-cultured cells were

862 then mock-treated or treated with 100μg/ml Acyclovir (Cat#114798, Millipore). After additional

863 48 hours, Akata cells were resuspended carefully, without disturbing the 293 monolayer,

864 transferred into a new 6 well plate and further settled for another 24 hours for the removal of

865 potentially contaminating 293 cells. Akata cells were then subjected to the gp350 PM FACS. FSC

866 and SSC parameters were used to exclude any potentially contaminating 293 producer cells.

867 RNA sequencing (RNAseq) analysis. Total RNAs were isolated with RNeasy Mini kit using the

868 manufacturer’s protocol. An in-column DNA digestion step was included to remove residual

869 genomic DNA contamination. To construct indexed libraries, 1 µg of total RNA was used for

870 polyA mRNA-selection using NEBNext Poly(A) mRNA Magnetic Isolation Module (New

871 England Biolabs), followed by library construction via NEBNext Ultra RNA Library Prep Kit for

872 Illumina (New England Biolabs). Each experimental treatment was performed in triplicate.

873 Libraries were multi-indexed, pooled and sequenced on an Illumina NextSeq 500 sequencer using

874 single-end 75 bp reads (Illunima).

875 For RNA-seq data analysis, paired-end reads were mapped to human (GENCODE v28) and the

876 Akata EBV genome. Transcripts were quantified using Salmon v0.8.2 (93) under quasi-mapping

877 and GC bias correction mode. Read count table of human and EBV genes was then normalized

878 across compared cell lines/conditions and differentially expressed genes were evaluated using

879 DESeq2 v1.18.1 (94) under default settings.

880 Volcano plots were built based on the log2 (foldchange) and -log10 (p-Value) with Graphpad

881 Prism7. Heatmaps were generated by feeding the Z-score values of selected EBV genes from

882 DESeq2 into Morpheus(https://software.broadinstitute.org/morpheus/). Enrichr was employed to bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

883 perform gene list-based gene set enrichment analysis on selected gene subset(95). Consistent

884 enriched gene sets in Top 5 terms ranked by Enrichr adjusted p-value were visualized Graphpad

885 Prism 7.

886 Statistical analysis. Data are presented as mean ± standard errors of the mean. Data were analyzed

887 using analysis of variance (ANOVA) with Sidak's multiple comparisons test or two-tailed paired

888 Student t test with Prism7 software. For all statistical tests, a cutoff of p < 0.05 was used to indicate

889 significance.

890

891

892 ACKNOWLEDGEMENTS

893 This work was supported by NIH RO1s AI137337 and CA228700 (BEG), Starr Cancer 894 Foundation Project # I11-0043, Burroughs Wellcome Career Award in Medical Sciences and 895 American Cancer Society Research Scholar Award (BEG). We thank Joe Cabral and David 896 Knipe for HA-H3.1 and 3.3 expression vectors and for technical assistance. We thank Jeff 897 Sample for MUTU I cells. We thank Molly Schineller and Emma Wolinsky for technical 898 assistance. We thank Yijie Ma for bioinformatic assistance. RNAseq data was deposited in NIH 899 GEO Omnibus, GSE148910. 900 901 902 Author contributions. Y.Z., R.G., C.J, and S.T. performed and analyzed the CRISPR and 903 biochemical experiments. C.J and S.J.T. performed the RNAseq experiments, which were 904 analyzed by R.G. and M.T. Y.N. and B.Z. provided assistance with 293 BAC experiments. 905 Bioinformatic analysis was performed by R.G. and M.T. B.E.G supervised the study. 906

907

908 1. Longnecker R, Kieff E, Cohen J. 2013. Epstein-barr virus. Fields 909 Virology, Sixth Edition 1. bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

910 2. Farrell PJ. 2019. Epstein-Barr Virus and Cancer. Annu Rev Pathol 14:29- 911 53. 912 3. Thorley-Lawson DA. 2015. EBV Persistence--Introducing the Virus. Curr 913 Top Microbiol Immunol 390:151-209. 914 4. Munz C. 2019. Latency and lytic replication in Epstein-Barr virus- 915 associated oncogenesis. Nat Rev Microbiol 17:691-700. 916 5. Lieberman PM. 2016. Epigenetics and Genetics of Viral Latency. Cell 917 Host Microbe 19:619-28. 918 6. Chiu YF, Sugden B. 2016. Epstein-Barr Virus: The Path from Latent to 919 Productive Infection. Annu Rev Virol 3:359-372. 920 7. Buschle A, Hammerschmidt W. 2020. Epigenetic lifestyle of Epstein-Barr 921 virus. Semin Immunopathol doi:10.1007/s00281-020-00792-2. 922 8. Frost TC, Gewurz BE. 2018. Epigenetic crossroads of the Epstein-Barr 923 virus B-cell relationship. Curr Opin Virol 32:15-23. 924 9. Saha A, Robertson ES. 2019. Mechanisms of B-Cell Oncogenesis Induced by 925 Epstein-Barr Virus. J Virol 93. 926 10. Chakravorty A, Sugden B, Johannsen EC. 2019. An Epigenetic Journey: 927 Epstein-Barr Virus Transcribes Chromatinized and Subsequently 928 Unchromatinized Templates during Its Lytic Cycle. J Virol 93. 929 11. Pich D, Mrozek-Gorska P, Bouvet M, Sugimoto A, Akidil E, Grundhoff A, 930 Hamperl S, Ling PD, Hammerschmidt W. 2019. First Days in the Life of 931 Naive Human B Lymphocytes Infected with Epstein-Barr Virus. MBio 10. 932 12. Nikitin PA, Yan CM, Forte E, Bocedi A, Tourigny JP, White RE, Allday MJ, 933 Patel A, Dave SS, Kim W, Hu K, Guo J, Tainter D, Rusyn E, Luftig MA. 934 2010. An ATM/Chk2-mediated DNA damage-responsive signaling pathway 935 suppresses Epstein-Barr virus transformation of primary human B cells. 936 Cell Host Microbe 8:510-22. 937 13. Wang LW, Wang Z, Ersing I, Nobre L, Guo R, Jiang S, Trudeau S, Zhao B, 938 Weekes MP, Gewurz BE. 2019. Epstein-Barr virus subverts mevalonate and 939 fatty acid pathways to promote infected B-cell proliferation and 940 survival. PLOS Pathogens 15:e1008030. 941 14. Kenney SC, Mertz JE. 2014. Regulation of the latent-lytic switch in 942 Epstein-Barr virus. Semin Cancer Biol 26:60-8. 943 15. McKenzie J, El-Guindy A. 2015. Epstein-Barr Virus Lytic Cycle 944 Reactivation. Curr Top Microbiol Immunol 391:237-61. 945 16. Chiu YF, Sugden AU, Sugden B. 2013. Epstein-Barr viral productive 946 amplification reprograms nuclear architecture, DNA replication, and 947 histone deposition. Cell Host Microbe 14:607-18. 948 17. Volk A, Crispino JD. 2015. The role of the chromatin assembly complex 949 (CAF-1) and its p60 subunit (CHAF1b) in homeostasis and disease. 950 Biochimica et biophysica acta 1849:979-986. bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

951 18. Li X, Kozlov SV, El-Guindy A, Bhaduri-McIntosh S. 2019. Retrograde 952 Regulation by the Viral Protein Kinase Epigenetically Sustains the 953 Epstein-Barr Virus Latency-to-Lytic Switch To Augment Virus Production. 954 J Virol 93. 955 19. Taylor GS, Long HM, Brooks JM, Rickinson AB, Hislop AD. 2015. The 956 immunology of Epstein-Barr virus-induced disease. Annu Rev Immunol 957 33:787-821. 958 20. Epstein A. 2012. Burkitt lymphoma and the discovery of Epstein-Barr 959 virus. Br J Haematol 156:777-9. 960 21. Nanbo A, Sugden A, Sugden B. 2007. The coupling of synthesis and 961 partitioning of EBV's plasmid replicon is revealed in live cells. Embo j 962 26:4252-62. 963 22. Tsai K, Chan L, Gibeault R, Conn K, Dheekollu J, Domsic J, Marmorstein 964 R, Schang LM, Lieberman PM. 2014. Viral reprogramming of the Daxx 965 histone H3.3 chaperone during early Epstein-Barr virus infection. J 966 Virol 88:14350-63. 967 23. Tsai K, Thikmyanova N, Wojcechowskyj JA, Delecluse HJ, Lieberman PM. 968 2011. EBV tegument protein BNRF1 disrupts DAXX-ATRX to activate viral 969 early gene transcription. PLoS Pathog 7:e1002376. 970 24. Guo R, Jiang C, Zhang Y, Govande A, Trudeau SJ, Chen F, Fry CJ, Puri R, 971 Wolinsky E, Schineller M, Frost TC, Gebre M, Zhao B, Giulino-Roth L, 972 Doench JG, Teng M, Gewurz BE. 2020. MYC Controls the Epstein-Barr Virus 973 Lytic Switch. Mol Cell doi:10.1016/j.molcel.2020.03.025. 974 25. Doench JG, Fusi N, Sullender M, Hegde M, Vaimberg EW, Donovan KF, Smith 975 I, Tothova Z, Wilen C, Orchard R, Virgin HW, Listgarten J, Root DE. 976 2016. Optimized sgRNA design to maximize activity and minimize off- 977 target effects of CRISPR-Cas9. Nature Biotechnology 34:184. 978 26. Burgess RJ, Zhang Z. 2013. Histone chaperones in nucleosome assembly 979 and human disease. Nat Struct Mol Biol 20:14-22. 980 27. Yuan J, Cahir-McFarland E, Zhao B, Kieff E. 2006. Virus and cell RNAs 981 expressed during Epstein-Barr virus replication. J Virol 80:2548-65. 982 28. O'Grady T, Cao S, Strong MJ, Concha M, Wang X, Splinter Bondurant S, 983 Adams M, Baddoo M, Srivastav SK, Lin Z, Fewell C, Yin Q, Flemington EK. 984 2014. Global bidirectional transcription of the Epstein-Barr virus 985 genome during reactivation. J Virol 88:1604-16. 986 29. Concha M, Wang X, Cao S, Baddoo M, Fewell C, Lin Z, Hulme W, Hedges D, 987 McBride J, Flemington EK. 2012. Identification of new viral genes and 988 transcript isoforms during Epstein-Barr virus reactivation using RNA- 989 Seq. J Virol 86:1458-67. 990 30. Ersing I, Nobre L, Wang LW, Soday L, Ma Y, Paulo JA, Narita Y, Ashbaugh 991 CW, Jiang C, Grayson NE, Kieff E, Gygi SP, Weekes MP, Gewurz BE. 2017. bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

992 A Temporal Proteomic Map of Epstein-Barr Virus Lytic Replication in B 993 Cells. Cell Rep 19:1479-1493. 994 31. Verreault A, Kaufman PD, Kobayashi R, Stillman B. 1996. Nucleosome 995 assembly by a complex of CAF-1 and acetylated histones H3/H4. Cell 996 87:95-104. 997 32. Shibahara K, Stillman B. 1999. Replication-dependent marking of DNA by 998 PCNA facilitates CAF-1-coupled inheritance of chromatin. Cell 96:575-85. 999 33. Tursun B, Patel T, Kratsios P, Hobert O. 2011. Direct conversion of C. 1000 elegans germ cells into specific neuron types. Science 331:304-8. 1001 34. Millard CJ, Varma N, Saleh A, Morris K, Watson PJ, Bottrill AR, Fairall 1002 L, Smith CJ, Schwabe JW. 2016. The structure of the core NuRD 1003 repression complex provides insights into its interaction with 1004 chromatin. Elife 5:e13941. 1005 35. Wang LW, Shen H, Nobre L, Ersing I, Paulo JA, Trudeau S, Wang Z, Smith 1006 NA, Ma Y, Reinstadler B, Nomburg J, Sommermann T, Cahir-McFarland E, 1007 Gygi SP, Mootha VK, Weekes MP, Gewurz BE. 2019. Epstein-Barr-Virus- 1008 Induced One-Carbon Metabolism Drives B Cell Transformation. Cell Metab 1009 30:539-555.e11. 1010 36. Wang C, Li D, Zhang L, Jiang S, Liang J, Narita Y, Hou I, Zhong Q, Zheng 1011 Z, Xiao H, Gewurz BE, Teng M, Zhao B. 2019. RNA Sequencing Analyses of 1012 Gene Expression during Epstein-Barr Virus Infection of Primary B 1013 Lymphocytes. Journal of Virology 93:e00226-19. 1014 37. Price AM, Luftig MA. 2015. To Be or Not IIb: A Multi-Step Process for 1015 Epstein-Barr Virus Latency Establishment and Consequences for B Cell 1016 Tumorigenesis. PLOS Pathogens 11:e1004656. 1017 38. Zhao B, Barrera LA, Ersing I, Willox B, Schmidt SC, Greenfeld H, Zhou H, 1018 Mollo SB, Shi TT, Takasaki K, Jiang S, Cahir-McFarland E, Kellis M, 1019 Bulyk ML, Kieff E, Gewurz BE. 2014. The NF-kappaB genomic landscape in 1020 lymphoblastoid B cells. Cell Rep 8:1595-606. 1021 39. Schmidt SC, Jiang S, Zhou H, Willox B, Holthaus AM, Kharchenko PV, 1022 Johannsen EC, Kieff E, Zhao B. 2015. Epstein-Barr virus nuclear antigen 1023 3A partially coincides with EBNA3C genome-wide and is tethered to DNA 1024 through BATF complexes. Proc Natl Acad Sci U S A 112:554-9. 1025 40. Jiang S, Willox B, Zhou H, Holthaus AM, Wang A, Shi TT, Maruo S, 1026 Kharchenko PV, Johannsen EC, Kieff E, Zhao B. 2014. Epstein-Barr virus 1027 nuclear antigen 3C binds to BATF/IRF4 or SPI1/IRF4 composite sites and 1028 recruits Sin3A to repress CDKN2A. Proc Natl Acad Sci U S A 111:421-6. 1029 41. Portal D, Zhou H, Zhao B, Kharchenko PV, Lowry E, Wong L, Quackenbush J, 1030 Holloway D, Jiang S, Lu Y, Kieff E. 2013. Epstein-Barr virus nuclear 1031 antigen leader protein localizes to promoters and enhancers with cell 1032 transcription factors and EBNA2. Proc Natl Acad Sci U S A 110:18537-42. bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

1033 42. Lin CY, Loven J, Rahl PB, Paranal RM, Burge CB, Bradner JE, Lee TI, 1034 Young RA. 2012. Transcriptional amplification in tumor cells with 1035 elevated c-Myc. Cell 151:56-67. 1036 43. Shimizu N, Tanabe-Tochikura A, Kuroiwa Y, Takada K. 1994. Isolation of 1037 Epstein-Barr virus (EBV)-negative cell clones from the EBV-positive 1038 Burkitt's lymphoma (BL) line Akata: malignant phenotypes of BL cells are 1039 dependent on EBV. J Virol 68:6069-73. 1040 44. Hughes DJ, Dickerson CA, Shaner MS, Sample CE, Sample JT. 2011. 1041 <em>trans</em>-Repression of Protein Expression Dependent on 1042 the Epstein-Barr Virus Promoter Wp during Latency. Journal of Virology 1043 85:11435. 1044 45. Kanda T, Miyata M, Kano M, Kondo S, Yoshizaki T, Iizasa H. 2015. 1045 Clustered microRNAs of the Epstein-Barr virus cooperatively downregulate 1046 an epithelial cell-specific metastasis suppressor. J Virol 89:2684-97. 1047 46. Loppin B, Bonnefoy E, Anselme C, Laurencon A, Karr TL, Couble P. 2005. 1048 The histone H3.3 chaperone HIRA is essential for chromatin assembly in 1049 the male pronucleus. Nature 437:1386-90. 1050 47. McFarlane S, Orr A, Roberts APE, Conn KL, Iliev V, Loney C, da Silva 1051 Filipe A, Smollett K, Gu Q, Robertson N, Adams PD, Rai TS, Boutell C. 1052 2019. The histone chaperone HIRA promotes the induction of host innate 1053 immune defences in response to HSV-1 infection. PLoS Pathog 15:e1007667. 1054 48. Rai TS, Glass M, Cole JJ, Rather MI, Marsden M, Neilson M, Brock C, 1055 Humphreys IR, Everett RD, Adams PD. 2017. Histone chaperone HIRA 1056 deposits histone H3.3 onto foreign viral DNA and contributes to anti- 1057 viral intrinsic immunity. Nucleic Acids Res 45:11673-11683. 1058 49. Placek BJ, Huang J, Kent JR, Dorsey J, Rice L, Fraser NW, Berger SL. 1059 2009. The histone variant H3.3 regulates gene expression during lytic 1060 infection with herpes simplex virus type 1. J Virol 83:1416-21. 1061 50. Albright ER, Kalejta RF. 2016. Canonical and Variant Forms of Histone 1062 H3 Are Deposited onto the Human Cytomegalovirus Genome during Lytic and 1063 Latent Infections. J Virol 90:10309-10320. 1064 51. Gallastegui E, Millan-Zambrano G, Terme JM, Chavez S, Jordan A. 2011. 1065 Chromatin reassembly factors are involved in transcriptional 1066 interference promoting HIV latency. J Virol 85:3187-202. 1067 52. Hammerschmidt W, Sugden B. 2013. Replication of Epstein-Barr viral DNA. 1068 Cold Spring Harb Perspect Biol 5:a013029. 1069 53. Djavadian R, Chiu YF, Johannsen E. 2016. An Epstein-Barr Virus-Encoded 1070 Protein Complex Requires an Origin of Lytic Replication In Cis to 1071 Mediate Late Gene Transcription. PLoS Pathog 12:e1005718. bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

1072 54. Hammerschmidt W, Sugden B. 1988. Identification and characterization of 1073 oriLyt, a lytic origin of DNA replication of Epstein-Barr virus. Cell 1074 55:427-33. 1075 55. Bergbauer M, Kalla M, Schmeinck A, Gobel C, Rothbauer U, Eck S, Benet- 1076 Pages A, Strom TM, Hammerschmidt W. 2010. CpG-methylation regulates a 1077 class of Epstein-Barr virus promoters. PLoS Pathog 6:e1001114. 1078 56. Huang H, Deng Z, Vladimirova O, Wiedmer A, Lu F, Lieberman PM, Patel DJ. 1079 2016. Structural basis underlying viral hijacking of a histone chaperone 1080 complex. Nat Commun 7:12707. 1081 57. Shannon-Lowe C, Baldwin G, Feederle R, Bell A, Rickinson A, Delecluse 1082 HJ. 2005. Epstein-Barr virus-induced B-cell transformation: 1083 quantitating events from virus binding to cell outgrowth. J Gen Virol 1084 86:3009-3019. 1085 58. Houlard M, Berlivet S, Probst AV, Quivy JP, Hery P, Almouzni G, Gerard 1086 M. 2006. CAF-1 is essential for heterochromatin organization in 1087 pluripotent embryonic cells. PLoS Genet 2:e181. 1088 59. Hatanaka Y, Inoue K, Oikawa M, Kamimura S, Ogonuki N, Kodama EN, Ohkawa 1089 Y, Tsukada Y, Ogura A. 2015. Histone chaperone CAF-1 mediates 1090 repressive histone modifications to protect preimplantation mouse 1091 embryos from endogenous retrotransposons. Proc Natl Acad Sci U S A 1092 112:14641-6. 1093 60. Cheng L, Zhang X, Wang Y, Gan H, Xu X, Lv X, Hua X, Que J, Ordog T, 1094 Zhang Z. 2019. Chromatin Assembly Factor 1 (CAF-1) facilitates the 1095 establishment of facultative heterochromatin during pluripotency exit. 1096 Nucleic Acids Res 47:11114-11131. 1097 61. Tempera I, Wiedmer A, Dheekollu J, Lieberman PM. 2010. CTCF prevents 1098 the epigenetic drift of EBV latency promoter Qp. PLoS Pathog 6:e1001048. 1099 62. Murata T, Kondo Y, Sugimoto A, Kawashima D, Saito S, Isomura H, Kanda T, 1100 Tsurumi T. 2012. Epigenetic histone modification of Epstein-Barr virus 1101 BZLF1 promoter during latency and reactivation in Raji cells. J Virol 1102 86:4752-61. 1103 63. Ramasubramanyan S, Osborn K, Flower K, Sinclair AJ. 2012. Dynamic 1104 chromatin environment of key lytic cycle regulatory regions of the 1105 Epstein-Barr virus genome. J Virol 86:1809-19. 1106 64. Chau CM, Lieberman PM. 2004. Dynamic chromatin boundaries delineate a 1107 latency control region of Epstein-Barr virus. J Virol 78:12308-19. 1108 65. Countryman JK, Gradoville L, Miller G. 2008. Histone hyperacetylation 1109 occurs on promoters of lytic cycle regulatory genes in Epstein-Barr 1110 virus-infected cell lines which are refractory to disruption of latency 1111 by histone deacetylase inhibitors. J Virol 82:4706-19. bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

1112 66. Ichikawa T, Okuno Y, Sato Y, Goshima F, Yoshiyama H, Kanda T, Kimura H, 1113 Murata T. 2018. Regulation of Epstein-Barr Virus Life Cycle and Cell 1114 Proliferation by Histone H3K27 Methyltransferase EZH2 in Akata Cells. 1115 mSphere 3. 1116 67. Mrozek-Gorska P, Buschle A, Pich D, Schwarzmayr T, Fechtner R, Scialdone 1117 A, Hammerschmidt W. 2019. Epstein-Barr virus reprograms human B 1118 lymphocytes immediately in the prelatent phase of infection. Proc Natl 1119 Acad Sci U S A 116:16046-16055. 1120 68. Price AM, Tourigny JP, Forte E, Salinas RE, Dave SS, Luftig MA. 2012. 1121 Analysis of Epstein-Barr virus-regulated host gene expression changes 1122 through primary B-cell outgrowth reveals delayed kinetics of latent 1123 membrane protein 1-mediated NF-kappaB activation. J Virol 86:11096-106. 1124 69. Conn KL, Hendzel MJ, Schang LM. 2013. The differential mobilization of 1125 histones H3.1 and H3.3 by herpes simplex virus 1 relates histone 1126 dynamics to the assembly of viral chromatin. PLoS Pathog 9:e1003695. 1127 70. Cabral JM, Oh HS, Knipe DM. 2018. ATRX promotes maintenance of herpes 1128 simplex virus heterochromatin during chromatin stress. Elife 7. 1129 71. English CM, Maluf NK, Tripet B, Churchill ME, Tyler JK. 2005. ASF1 1130 binds to a heterodimer of histones H3 and H4: a two-step mechanism for 1131 the assembly of the H3-H4 heterotetramer on DNA. Biochemistry 44:13673- 1132 82. 1133 72. Hammond CM, Stromme CB, Huang H, Patel DJ, Groth A. 2017. Histone 1134 chaperone networks shaping chromatin function. Nat Rev Mol Cell Biol 1135 18:141-158. 1136 73. Guo R, Zhang Y, Teng M, Jiang C, Schineller M, Zhao B, Doench J, 1137 O’Reilly R, Cesarman E, Guilino-Roth L, Gewurz B. 2020. DNA 1138 Methylation Enzymes and PRC1 Restrict B-cell Epstein-Barr Virus 1139 Oncoprotein Expression. Nature Microbiology In Press. 1140 74. Jha HC, A JM, Saha A, Banerjee S, Lu J, Robertson ES. 2014. Epstein- 1141 Barr virus essential antigen EBNA3C attenuates H2AX expression. J Virol 1142 88:3776-88. 1143 75. Gradoville L, Kwa D, El-Guindy A, Miller G. 2002. Protein kinase C- 1144 independent activation of the Epstein-Barr virus lytic cycle. J Virol 1145 76:5612-26. 1146 76. Belotserkovskaya R, Oh S, Bondarenko VA, Orphanides G, Studitsky VM, 1147 Reinberg D. 2003. FACT facilitates transcription-dependent nucleosome 1148 alteration. Science 301:1090-3. 1149 77. Saunders A, Werner J, Andrulis ED, Nakayama T, Hirose S, Reinberg D, Lis 1150 JT. 2003. Tracking FACT and the RNA polymerase II elongation complex 1151 through chromatin in vivo. Science 301:1094-6. bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

1152 78. Carter DR, Murray J, Cheung BB, Gamble L, Koach J, Tsang J, Sutton S, 1153 Kalla H, Syed S, Gifford AJ, Issaeva N, Biktasova A, Atmadibrata B, Sun 1154 Y, Sokolowski N, Ling D, Kim PY, Webber H, Clark A, Ruhle M, Liu B, 1155 Oberthuer A, Fischer M, Byrne J, Saletta F, Thwe le M, Purmal A, 1156 Haderski G, Burkhart C, Speleman F, De Preter K, Beckers A, Ziegler DS, 1157 Liu T, Gurova KV, Gudkov AV, Norris MD, Haber M, Marshall GM. 2015. 1158 Therapeutic targeting of the MYC signal by inhibition of histone 1159 chaperone FACT in neuroblastoma. Sci Transl Med 7:312ra176. 1160 79. Johannsen E, Luftig M, Chase MR, Weicksel S, Cahir-McFarland E, Illanes 1161 D, Sarracino D, Kieff E. 2004. Proteins of purified Epstein-Barr virus. 1162 Proc Natl Acad Sci U S A 101:16286-91. 1163 80. Arvey A, Tempera I, Lieberman PM. 2013. Interpreting the Epstein-Barr 1164 Virus (EBV) epigenome using high-throughput data. Viruses 5:1042-54. 1165 81. Lieberman PM. 2015. Chromatin Structure of Epstein-Barr Virus Latent 1166 Episomes. Curr Top Microbiol Immunol 390:71-102. 1167 82. Carter KL, Cahir-McFarland E, Kieff E. 2002. Epstein-barr virus-induced 1168 changes in B-lymphocyte gene expression. Journal of virology 76:10427- 1169 10436. 1170 83. Cliffe AR, Wilson AC. 2017. Restarting Lytic Gene Transcription at the 1171 Onset of Herpes Simplex Virus Reactivation. J Virol 91. 1172 84. Conn KL, Schang LM. 2013. Chromatin dynamics during lytic infection 1173 with herpes simplex virus 1. Viruses 5:1758-86. 1174 85. Placek BJ, Berger SL. 2010. Chromatin dynamics during herpes simplex 1175 virus-1 lytic infection. Biochim Biophys Acta 1799:223-7. 1176 86. Bloom DC, Giordani NV, Kwiatkowski DL. 2010. Epigenetic regulation of 1177 latent HSV-1 gene expression. Biochim Biophys Acta 1799:246-56. 1178 87. Hadinoto V, Shapiro M, Sun CC, Thorley-Lawson DA. 2009. The dynamics of 1179 EBV shedding implicate a central role for epithelial cells in amplifying 1180 viral output. PLoS Pathog 5:e1000496. 1181 88. Perrine SP, Hermine O, Small T, Suarez F, O'Reilly R, Boulad F, 1182 Fingeroth J, Askin M, Levy A, Mentzer SJ, Di Nicola M, Gianni AM, Klein 1183 C, Horwitz S, Faller DV. 2007. A phase 1/2 trial of arginine butyrate 1184 and ganciclovir in patients with Epstein-Barr virus-associated lymphoid 1185 malignancies. Blood 109:2571-8. 1186 89. Meng Q, Hagemeier SR, Fingeroth JD, Gershburg E, Pagano JS, Kenney SC. 1187 2010. The Epstein-Barr virus (EBV)-encoded protein kinase, EBV-PK, but 1188 not the thymidine kinase (EBV-TK), is required for ganciclovir and 1189 acyclovir inhibition of lytic viral production. J Virol 84:4534-42. 1190 90. Greenfeld H, Takasaki K, Walsh MJ, Ersing I, Bernhardt K, Ma Y, Fu B, 1191 Ashbaugh CW, Cabo J, Mollo SB, Zhou H, Li S, Gewurz BE. 2015. TRAF1 1192 Coordinates Polyubiquitin Signaling to Enhance Epstein-Barr Virus LMP1- bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license.

1193 Mediated Growth and Survival Pathway Activation. PLoS Pathog 1194 11:e1004890. 1195 91. Ma Y, Walsh MJ, Bernhardt K, Ashbaugh CW, Trudeau SJ, Ashbaugh IY, Jiang 1196 S, Jiang C, Zhao B, Root DE, Doench JG, Gewurz BE. 2017. CRISPR/Cas9 1197 Screens Reveal Epstein-Barr Virus-Transformed B Cell Host Dependency 1198 Factors. Cell Host Microbe 21:580-591.e7. 1199 92. Neuhierl B, Feederle R, Hammerschmidt W, Delecluse HJ. 2002. 1200 Glycoprotein gp110 of Epstein-Barr virus determines viral tropism and 1201 efficiency of infection. Proc Natl Acad Sci U S A 99:15036-41. 1202 93. Patro R, Duggal G, Love MI, Irizarry RA, Kingsford C. 2017. Salmon 1203 provides fast and bias-aware quantification of transcript expression. 1204 Nature methods 14:417-419. 1205 94. Love MI, Huber W, Anders S. 2014. Moderated estimation of fold change 1206 and dispersion for RNA-seq data with DESeq2. Genome biology 15:550-550. 1207 95. Chen EY, Tan CM, Kou Y, Duan Q, Wang Z, Meirelles GV, Clark NR, Ma'ayan 1208 A. 2013. Enrichr: interactive and collaborative HTML5 gene list 1209 enrichment analysis tool. BMC Bioinformatics 14:128. 1210 bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Figure 1 A 8 B C CHAF1B RBBP4 sgRNA sgRNA 6 value) - 4 Log2 (fold change sgRNA) Log2 (fold change sgRNA)

Log10 (p Log10 CHAF1B Day 6 Day 6 - 2 RBBP4 Day 9 Day 9 0 -3 -2 -1 0 1 2 3 depleted enriched depleted enriched Log2 (gp350+ vs input sgRNA fold change)

D E CHAF1B CHAF1B CHAF1B C sg1 sg2 C sg1 sg2 C sg1 sg2

BZLF1

BMRF1

CHAF1B

GAPDH

P3HR-1 Akata MUTU I

F Akata G Akata H cDNA: GFP CHAF1BR 8 400 **** **** sgRNA: sgControl 6 CHAF1B Control 300 Control sgChaf1b #1 CHAF1B sgChaf1b #2 BZLF1 200 4 Counts

gp350 MFI gp350 BMRF1 100 2 CHAF1B 0 0 2 3 4 #2 1 10 10 10 10 #1 GAPDH gp350 Abundance sgCHAF1B V5- sgControl CHAF1B Akata I J 15 sgCHAF1B ** ns CHAF1BR sgControl 10

sgCHAF1B

gp350 MFI gp350 5 GFP sgControl 0 1 10 102 103 CHAF1BR - - + + gp350 level sgCHAF1B - + - + bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.Figure It is made2 A availableB under aCC-BY-NC 4.0 International licenseAkata. 40 400 Akata EBV lytic Intracellular * 15 Extracellular Host 300 30 10 **** value) - 200 20 ****

FoldChange 5 Log10 (p Log10

- 100 10 ** *

0 00 0 #2 -10 -5 0 5 10 #1 #1 #2 IgG α Log2 (fold change mRNA sgCHAF1B sgCHAF1B sgCHAF1B vs sgControl) sgControl sgControl

C sgControl sgCHAF1b D Akata EBV+ aIgG E - IgG + IgG 20 **** **** sgControl **** **** Day 7 +IgG 15 sgCHAF1B 10

sgCHAF1B MFI gp350 5 -IgG Day 21 sgControl 0 0 10 102 103 104 IgG - - - + + + #1 #1 #2 gp350 Abundance #2

Control CHAF1B CHAF1B Control

F G downregulated upregulated 400 IFN stimulated Type I IFN-mediated signaling pathway Histone related Type I IFN-mediated signaling pathway 300 IFNγ-mediated signaling pathway value) - Cellular response to IFNγ 200 Cytokine-mediated signaling pathway

Log10 (p Log10 Nucleosome organization - 100 Nucleosome assembly Chromatin assembly 0 Protein-DNA complex assembly

-5 0 5 10 10 0 10 Log2 (fold change mRNA -Log10(p-value) sgCHAF1B vs sgControl)

H CHAF1B CHAF1B sg1 sg2 Control

sgRNA Control

IRF7 IRF7

CHAF1B IFIT1

GAPDH GAPDH

Akata P3HR-1 bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Figure 3 A RBBP4 B C 8 **** sgRNA: C sg1 sg2 200 sgControl **** BZLF1 sgRBBP4 #1 6 150 sgRBBP4 #2 BMRF1 4 100 Counts RBBP4 MFI gp350 50 2 GAPDH 0 0 0 10 102 3 104

10 #1 #2 gp350 Abundance sgRBBP4 sgControl

D E F **** CHAF1A 5 **** sgRNA:C sg1 sg2 250 sgControl 4 BZLF1 200 sgChaf1a #1 sgChaf1a #2 3 BMRF1 150

Counts 2

100 MFI gp350 CHAF1A 50 1 GAPDH 0 0 2 3 4 #1 0 10 10 10 10 #2 gp350 Abundance sgCHAF1A sgControl

G Intracellular Extracellular H Intracellular Extracellular 6 **** 4 **** 5 8 *** **** **** **** 4 **** 3 **** 6 4 3 2 4 2 2 FoldChange FoldChange 2 1 1

0 0 0 0 #1 #1 #2 #2 #1 #2 #1 #2 sgRBBP4 sgRBBP4 sgCHAF1A sgCHAF1A sgControl sgControl sgControl sgControl bioRxiv preprinttimepoints? doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Figure 4 A **** B Primary Human B-cells **** **** 1.00 *** **** ** ** ** * * * DPI: 0 2 4 7 10 14 RBBP4 ns 0. 75 CHAF1B CHAF1B **** **** CHAF1A 0. 50 **** **** CHAF1A **** **** **** **** **** **** 0.25 **** RBBP4 **** Relative Protein Abundance Protein Relative

0 DDX1 DPI: 0 2 4 7 10 14 18 21 28 Primary Human B-cells 10 kb C EBNA2 EBNA-LP EBNA3A EBNA3C RelA RelB cRel p50 p52 c-MYC CHAF1B

EBV- Akata + EBV- Akata + 293-EBV D E EBV- Akata Only 293-EBV Lytic Lytic+ ACY Acyclovir 104 0% 3.02% 0.47% 3.06% 0.14% 103

102 sgControl 10

0 4 GFP 10 0% 4.64% 1.63% 5.75% 0.34% 103

102

F sgCHAF1B 10 2.0 **** **** 0 1.5 0 10 102 103 0 10 102 103 0 10 102 103 1.0 gp350

0.5 % GFP+/gp350+% 0.0 EBV: - + + - + + ACV: - - + - - + sgRNA: Control CHAF1B

CHAF1B

BZLF1

GAPDH bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Figure 5 A HIRA HIRA HIRA B C

C #1 #2 C #1 #2 C #1 #2 3 **** 200 **** BZLF1 sgControl 150 2 BMRF1 sgHIRA #1 100 sgHIRA #2 Counts HIRA MFI gp350 1 50 GAPDH 0 0 P3HR-1 Akata MUTU I 0 10 102 103 104 #1 sgRNA: #2 gp350 Abundance HIRA Control

D Intracellular extracellular E sgControl sgHIRA **** 8 3 *** **** *** 6 Day 7 2

4

FoldChange 1 2 Day 10 0 0 0 #2 #1 #2 #1

sgHIRA sgHIRA sgControl sgControl

F G EBV- Akata + EBV- Akata + 293-EBV ns ns ns ns ns 1.00 ns ns ns ns EBV- Akata Only 293-EBV Lytic Lytic+ ACY Acyclovir 104 0% 3.02% 0.47% 3.06% 0.14% 0.75 HIRA 103 0.05 102

0.25 sgControl 10 0

Relative protein abundanceRelativeprotein DPI: 0 2 4 7 10 14 18 21 28 0

H GFP 104 ** 1.0 **** 0% 3.45% 0.83% 5.29% 0.18% 103 0.8 102

0.6 sgHIRA 10 0.4 0 0.2 2 3 0 10 10 10 0 10 102 103 0 10 102 103 % Double positive cellsDoublepositive% 0.0 gp350 EBV: - + + - + + ACV: - - + - - + sgRNA: Control HIRA bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Figure 6

sgControl sgCHAF1B A BZLF1 BLLF1 OriLyt L OriLyt R 0.10 0.15 0.08 0.08 **** 0.08 **** **** **** 0.06 0.06 0.10 0.06 **** **** **** **** 0.04 %input 0.04 0.04 0.05 0.02 0.02 0.02

0.00 0.00 0.00 0.00 ChIP: IgG H3.1 H3.3 IgG H3.1 H3.3 IgG H3.1 H3.3 IgG H3.1 H3.3

B C sgControl sgCHAF1B 0.6 BZLF1 0.8 BLLF1 BZLF1 ** ** 0.6 * BMRF1 * 0.4 CHAF1B 0.4

H3.1 %input 0.2 H3.3 0.2 GAPDH 0.0 0.0 Akata EBV+ ChIP:

D 0.6 0.10 0.8 oriLyt R OriLyt L *** **** * H3.1 0.08 0.6 * H3.3 0.4 **** 0.06 **** ** ** 0.4 %input 0.04 %input ** 0.2 * 0.2 0.02 IgG 0.00 0.0 0.0 DPI: 2 4 7 ChIP: bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Figure 7 sgControl sgCHAF1B A oriLyt L BZLF1 BLLF1 oriLyt R 0.10 0.15 0.10 0.08 * * * *** 0.08 0.08 0.06 0.10 0.06 0.06 0.04

%input 0.04 0.04 0.05 0.02 0.02 0.02

0.00 0.00 0.00 0.00 ChIP:

B sgControl sgCHAF1B BZLF1 BLLF1 oriLyt L oriLyt R 1.0 *** * 0.8 0.8 * 0.8 0.81.0 0.6 * 0.6 0.6 0.6 0.4 0.4 %input 0.4 0.4 0.2 0.2 0.2 0.2

0.0 0.0 0.0 0.0 ChIP: bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Figure 8 bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Figure S1 A P3HR-1 B Akata CHAF1A sgControl sgRNA 20 sgCHAF1B 15 **** **** 10 Log2 (fold change sgRNA) **** **** **** **** Foldchange Day 6 5 ****

Day 9 0 0

depleted enriched

C MUTU I D MUTU I

500 20 **** sgControl 400 sgCHAF1B #1 **** sgCHAF1B #2 15 300 10

gp350 MFI gp350 200 5 100

0 0 2 3 4 #1 1 10 10 10 #2 10 sgRNA CHAF1B gp350 MFI Control

E cDNA: GFP CHAF1BR

sgRNA: Control CHAF1B Control CHAF1B

BZLF1

BMRF1

CHAF1B

GAPDH

V5- CHAF1B

MUTU I bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Figure S2 A Intracellular Extracellular B Intracellular Extracellular **** **** **** 10 6 5 3 **** **** **** **** **** 8 4 4 2 6 3

2

4 Foldchange Foldchange 2 1 2 1

0 0 0 0 #2 #2 #1 #1 #2 #2 sgRNA: #1 sgRNA: #1 CHAF1B CHAF1B CHAF1B CHAF1B Control Control Control Control

MUTU I P3HR-1

C Intracellular Extracellular D Intracellular Extracellular **** **** ns ns **** **** 5 6 40 18 **** * **** **** **** * 4 30 12 4 3 20 Foldchange old changeold Foldchange

2 F 6 2 10

1 0 0 aIgG - - + + aIgG - - + + 0 0 sgControl + - + - + - + - CHAF1BR - - + + cDNA - - + + sgRNA - + - + sgCHAF1B - + - + - + - + sgCHAF1B - + - + Akata Akata Akata

F Intracellular Extracellular E MUTU I **** **** **** 7.5 **** 7 **** **** 6 sgControl 5 5.0 +aIgM 4

sgCHAF1B 3

Foldchange 2.5 Foldchange 2

sgCHAF1B 1 0 0 -aIgM - - + + - - + + sgControl aIgM aIgM sgControl + - + - + - + - sgCHAF1B - + - + - + - + 0 10 102 103 104 gp350 Abundance MUTU I bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Figure S3 A sgControl sgCHAF1B B sgControl sgCHAF1B C sgControl sgCHAF1B Rep: 1 2 3 1 2 3 Rep: 1 2 3 1 2 3 Rep: 1 2 3 1 2 3

Row Min Row Max

Row Min Row Max

Row Min Row Max bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Figure S4 A sgControl B 15 sgRBBP4 15 sgControl **** **** sgCHAF1A **** **** 10 **** 10 **** **** **** **** **** 5 **** **** **** Foldchange 5 Foldchange ****

0 0

Akata Akata

C D RBBP4 RBBP4 CHAF1A CHAF1A sgRNA: sg1 sg2 sg1 sg2 sgRNA: Control Control Control

Control sg1 sg2 sg1 sg2

BZLF1 BZLF1

BMRF1 BMRF1

RBBP4 CHAF1A

GAPDH GAPDH

MUTU I P3HR-1 MUTU I P3HR-1

E F Intracellular Extracellular Intracellular Extracellular 6 6 12.5 **** 6 **** **** **** 10 **** **** **** **** **** 4 4 4 **** 7.5 **** ******** **** **** **** 5 Foldchange Foldchange 2 2 2 2.5

0 0 0 0 #1 #1 #2 #2 #2 #1 #1 #1 #2 #1 #1 #1 #2 #2 #2 #2

Control CHAF1A

Control RBBP4 CHAF1A RBBP4 Control CHAF1A RBBP4 Control CHAF1A RBBP4

MUTU I P3HR-I bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Figure S5 A RNAseq: CHAF1B RNAseq: CHAF1A 2000 1000 **** **** **** 800 1500 **** 600 **** **** *** 1000 **** *** *** *** 400 ** 500 Normalized ReadsNormalized Normalized ReadsNormalized 200

0 0 DPI: 0 2 4 7 14 21 28 DPI: 0 2 4 7 14 21 28

RNAseq: RBBP4 5000 **** **** **** **** **** 4000 ****

3000

2000

Normalized ReadsNormalized 1000

0 DPI: 0 2 4 7 14 21 28

B

C

RBBP4 bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Figure S6

A B 25 sgControl 2000 RNAseq: HIRA sgHIRA **** 20 1500 * ns **** ns 15 ns ns ns 1000 10 **** **** **** **** **** Foldchange 500

5 ReadsNormalized

0 0 DPI: 0 2 4 7 14 21 28 bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Figure S7 A B ATRX ATRX ATRX DAXX DAXX DAXX sgRNA: sg1 sg2 Control Control sg1 sg2 Control Control sg1 sg2 sg1 sg2 sg1 sg2 sg1 sg2 Control Control

BZLF1 BZLF1

BMRF1 BMRF1

ATRX DAXX

GAPDH GAPDH Akata+ MUTU I P3HR-1 Akata+ MUTU I P3HR-1

C D 500 2.5 ** control control 400 2.0 ** * ATRX sg1 DAXX sg1 * ATRX sg2 DAXX sg2 1.5 300 Counts

200 MFI gp350 1.0

100 0.5

0 0 0 1 2 3 0 1 2 #1 #1 #2 10 10 10 10 #2 10 10 10 sgRNA: ATRX DAXX

PM gp350 abundance Control

E sgControl sgControl F 10 sgATRX 10 sgDAXX **** **** **** 8 **** 8 **** **** **** **** **** **** **** **** **** **** 6 6

4 4 Foldchange Foldchange 2 2

0 0

G H 3 Intracellular EBV Copy Number **** 1 **** ns ns * ** **** **** * ** **** ** **** **** *** 2 **** 0.75 **** **** ns ns DAXX

Foldchange 1 0.50 ATRX

0.25 0 abundanceRelativeprotein #1 #2 #1 #2

DAXX 0 Control ATRX DPI: 0 2 4 7 10 14 18 21 28 Akata bioRxiv preprint doi: https://doi.org/10.1101/2020.04.28.067371; this version posted April 30, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made sgControl availablesgCHAF1B under aCC-BY-NC 4.0 International license. Figure S8

0.15 BZLF1 0.15 BLLF1

0.10 0.10 %input

0.05 0.05 **** ****

0.00 0.00 IgG H3.1 IgG H3.1

+Acyclovir

0.08 OriLyt L 0.08 OriLyt R

0.06 0.06

%input 0.04 0.04 ** **** 0.02 0.02

0.00 0.00 IgG H3.1 IgG H3.1