Hamming Distance Between Two Strings of Equal Length Is the Number of PosiOns at Which the Corresponding Symbols Are Different

Total Page:16

File Type:pdf, Size:1020Kb

Hamming Distance Between Two Strings of Equal Length Is the Number of Posi�Ons at Which the Corresponding Symbols Are Different Basics on bioinforma-cs Lecture 4 Nunzio D’Agostino [email protected]; [email protected] Why compare sequences Sequence comparison is a way of arranging the sequences of DNA, RNA or protein to iden;fy regions of similarity that may be a consequence of funconal, structural or evoluonary relaonships between the sequences. The best way to compare two sequences (protein or nucleic acid) is to align them. This is a basic problem in bioinformacs that recurs in different forms, in many cases. 2 Conserved residues Perfect Match ATGCGTGTGTGCATGCAATGCGTGA ************ TGTGCATGCAAT Sequence variations Mismatch ATGCGTGTGTGCATGCAATGCGTGA ************ TGTGCATGCAAT ATGCGTGTGTGCATGCAATGCGTGA *** **** *** TGTCCATGTAAT Sequence variations Deletion ATGCGTGTGTGCATGCAATGCGTGA ****** *! TGTGCAGCAAT Sequence variations Deletion ATGCGTGTGTGCATGCAATGCGTGA ****** *! TGTGCAGCAAT ATGCGTGTGTGCATGCAATGCGTGA ****** ///// TGTGCAGCAAT Sequence variations Gap ATGCGTGTGTGCATGCAATGCGTGA ****** ///// TGTGCAGCAAT ATGCGTGTGTGCATGCAATGCGTGA ****** ***** TGTGCA-GCAAT Complexity of pairwise alignment • simple approach: compute & score all possible alignments • but there are possible global alignments for 2 sequences of length n • e.g. two sequences of length 100 have about 1077 possible alignments Dot plot Dot plot is a graphical method that allows the comparison of two biosequences and iden<fy regions of close similarity between them. The dotplot is a table or matrix. In the simplest form of dotplot, when the residues are different the corresponding posi<ons are leH blank, while are filled when the residues correspond. The dotplot capture in a single image the overall similarity between two sequences as well as the complete set of the different possible alignments. The biggest asset of dot matrix analysis is it allows you to visualize the en<re comparison at once, not concentrang on any one ‘op<mal’ region, but rather giving you the ‘Gestalt’ of the whole thing. 9 Dot-plot ATGCGTGTGTGCATGCAATGCGTGA T * * * * * * * G * * * * * * * * * T G C A G C A A T Dot-plot ATGCGTGTGTGCATGCAATGCGTGA T * * * * * * * G * * * * * * * * * T * * * * * * * G * * * * * * * * * C * * * * A* * ** * G * * * * * * * * * C * * * * A* * ** * A* * ** * T * * * * * * * Dot-plot ATGCGTGTGTGCATGCAATGCGTGA T * * * * * * * The dot plots of G * * * * * * * * * very closely T * * * * * * * related sequences G * * * * * * * * * will appear as a single line along C * * * * the matrix's A* * ** * G * * * * * * * * * C * * * * A* * ** * A* * ** * T * * * * * * * Word length=1 Interpretation of dot plot A problem with dot matrices for long sequences is that they can be very noisy due to lots of insignificant matches. Solu<on use a window and a threshold o compare character by character within a window (have to choose window size) o require certain frac<on of matches within window in order to display it with a “dot” 13 Dot-plot ATGCGTGTGTGCATGCAATGCGTGA T * * * * * * * Noise reducon G * * * * can be obtained T * * * * * * * increasing the G * * * * word size C * * A G * * * * C * * A * A* * * T Word length=2 Dot-plot ATGCGTGTGTGCATGCAATGCGTGA T * * Over a certain G * * * * word size may be T * * * * reduced also the G * * diagonal length C A G * * C * A * A T Word length=3 Dot-plot ATGCGTGTGTGCATGCAATGCGTGA T * * * * * G * * * * * T * * * * G * * C A * G * * C * A A T Word length=4 Dot plot - one path Dot plot - one path A--CTGACTG-TCGACTGCCTG! * ** *** ** ****! ATGCTG-CTGCTCCACTG! Dot plot - one path Dot plot - one path ACTGACTG-T-C-GACTGC-CTG! * ** * * * ** * ***! A-TGCTGCTG-CTCCACTG! Dot plot - more paths Dottup W=1 W=2 W=3 W=5 W=6 Dot plot - gap Dot plot - duplication Dot plot - duplication 1 2 Penalties ü The scoring scheme consists of character subs<tu<on scores (i.e. score for each possible character replacement) plus penal<es for gaps. ü The alignment score is the sum of subs<tu<on scores and gap penal<es. The alignment score reflects goodness of alignment. Dot plot – example 1 Match 1! Mismatch 0! Gap 0! Dot plot – example 1 A--CTGACTG-TCGACTGCCTG! Match 1! 100110011101101111! Mismatch 0! ATGCTG-CTGCTCCACTG! Gap 0! Dot plot – example 1 Match 1! Mismatch 0! Gap 0! 6! 4! 13! 12! Dot plot – example 2 Match 1! Mismatch 0! Gap -1! Dot plot – example 2 Match 1! Mismatch 0! Gap -1! 4! 4! 10! 6! Dot plot – example 3 Match 1! Mismatch -1! Gap -1! Dot plot – example 3 Match 1! Mismatch -1! Gap -1! 4! 4! 9! 5! Scoring scheme match mismatch gap A B C D 1 0 0 4 13 12 6 1 0 -1 4 10 6 4 1 -1 -1 4 9 5 4 1 -1 -2 4 6 -1 2 2 0 0 2 26 24 12 Linear vs affine gap penalties oLinear gap penalty: same penalty subtracted from each space in the gap oAffine gap penalty: first space in the gap has a larger score than subsequent spaces in the gap; i.e., easier to lose/gain more subunits from a gap than to start a new gap/inser<on (this makes sense evolu<onarily) Match = +1, mismatch = -1, gap = -2; CCTGGGCTATGC Score = 1 CC-GG-TT-TGC Same as above but with affine penalty = -1 CCTGGGCTATGC Score = 2 CC--GGTT-TGC 35 Distance between two sequences Since we are dealing with biological sequences, the problem can be approached using two different points of view, which lead to the same result. It must be searched: 1. the minimum distance between the two sequences 2. the maximum similarity between the two sequences 36 Distance between two sequences In the first case we refer to the evolu<onary process, for which we say that if two orthologous sequences, for example, a mouse and a frog, have had separate evolu<ons from a certain point in <me onwards, it is expected that the differences between the two sequences will give us an indicaon of their divergence. In the second case, reference is made most directly to the search of similar substring, to be able to derive the structural and func<onal relaonships. In the scien<fic literature are oHen used interchangeably the minimum distance or maximum similarity between two sequences. 37 Similarity vs homology Homologous sequences are descended from a common ancestral sequence. Homology is either true or false. It can never be par;al! Saying two sequences are 45% homologous is a misuse of the term. Sequence iden<ty and similarity can be described as a percentage and are used as evidence of homology 38 Distance between two strings In informaon theory, the Hamming distance between two strings of equal length is the number of posi<ons at which the corresponding symbols are different. TONEd and ROSES HD= 3. The Levenshtein distance between two sequences is the minimum number of single-character edits (inser<on, dele<on, subs<tu<on) required to change one sequences into the other. KITTEN and SITTING Ld = 3 kieen → sien (subs<tu<on of "s" for "k") sien → siin (subs<tu<on of "i" for "e") sin → sing (inser<on of "g" at the end). 39 Edit distance The phrase edit distance is oHen used to refer specifically to Levenshtein distance. Edit Distance is a standard dynamic Programming problem. Given two strings s1 and s2, the edit distance between s1 and s2 is the minimum number of opera-ons required to convert string s1 to s2. The following operaons are typically used: Replacing one character of string by another character. dele<ng a character from string Adding a character to string 40 Edit distance Assess the Hamming distance between DECLENSION and RECREATION DECLENSION 4 RECREATION Evaluate the Levenshtein distance between BIOINFORMATICS and CONFORMATION BIOINFORMATICS 5 -CO-NFORMATION 41 Edit distance calculation Transform S1=“winter” in S2=“writers” w r i t e r s Edits: 0 1 2 3 4 5 6 7 iàr sobs<tu<on w 1 0 1 2 3 4 5 6 nài sobs<tu<on i 2 1 1 1 2 3 4 5 s inseron n 3 2 2 2 2 3 4 5 t 4 3 3 3 2 3 4 5 e 5 4 4 4 3 2 3 4 r 6 5 4 5 4 3 2 3 42 .
Recommended publications
  • The One-Way Communication Complexity of Hamming Distance
    THEORY OF COMPUTING, Volume 4 (2008), pp. 129–135 http://theoryofcomputing.org The One-Way Communication Complexity of Hamming Distance T. S. Jayram Ravi Kumar∗ D. Sivakumar∗ Received: January 23, 2008; revised: September 12, 2008; published: October 11, 2008. Abstract: Consider the following version of the Hamming distance problem for ±1 vec- n √ n √ tors of length n: the promise is that the distance is either at least 2 + n or at most 2 − n, and the goal is to find out which of these two cases occurs. Woodruff (Proc. ACM-SIAM Symposium on Discrete Algorithms, 2004) gave a linear lower bound for the randomized one-way communication complexity of this problem. In this note we give a simple proof of this result. Our proof uses a simple reduction from the indexing problem and avoids the VC-dimension arguments used in the previous paper. As shown by Woodruff (loc. cit.), this implies an Ω(1/ε2)-space lower bound for approximating frequency moments within a factor 1 + ε in the data stream model. ACM Classification: F.2.2 AMS Classification: 68Q25 Key words and phrases: One-way communication complexity, indexing, Hamming distance 1 Introduction The Hamming distance H(x,y) between two vectors x and y is defined to be the number of positions i such that xi 6= yi. Let GapHD denote the following promise problem: the input consists of ±1 vectors n √ n √ x and y of length n, together with the promise that either H(x,y) ≤ 2 − n or H(x,y) ≥ 2 + n, and the goal is to find out which of these two cases occurs.
    [Show full text]
  • Fault Tolerant Computing CS 530 Information Redundancy: Coding Theory
    Fault Tolerant Computing CS 530 Information redundancy: Coding theory Yashwant K. Malaiya Colorado State University April 3, 2018 1 Information redundancy: Outline • Using a parity bit • Codes & code words • Hamming distance . Error detection capability . Error correction capability • Parity check codes and ECC systems • Cyclic codes . Polynomial division and LFSRs 4/3/2018 Fault Tolerant Computing ©YKM 2 Redundancy at the Bit level • Errors can bits to be flipped during transmission or storage. • An extra parity bit can detect if a bit in the word has flipped. • Some errors an be corrected if there is enough redundancy such that the correct word can be guessed. • Tukey: “bit” 1948 • Hamming codes: 1950s • Teletype, ASCII: 1960: 7+1 Parity bit • Codes are widely used. 304,805 letters in the Torah Redundancy at the Bit level Even/odd parity (1) • Errors can bits to be flipped during transmission/storage. • Even/odd parity: . is basic method for detecting if one bit (or an odd number of bits) has been switched by accident. • Odd parity: . The number of 1-bit must add up to an odd number • Even parity: . The number of 1-bit must add up to an even number Even/odd parity (2) • The it is known which parity it is being used. • If it uses an even parity: . If the number of of 1-bit add up to an odd number then it knows there was an error: • If it uses an odd: . If the number of of 1-bit add up to an even number then it knows there was an error: • However, If an even number of 1-bit is flipped the parity will still be the same.
    [Show full text]
  • Sequence Distance Embeddings
    Sequence Distance Embeddings by Graham Cormode Thesis Submitted to the University of Warwick for the degree of Doctor of Philosophy Computer Science January 2003 Contents List of Figures vi Acknowledgments viii Declarations ix Abstract xi Abbreviations xii Chapter 1 Starting 1 1.1 Sequence Distances . ....................................... 2 1.1.1 Metrics ............................................ 3 1.1.2 Editing Distances ...................................... 3 1.1.3 Embeddings . ....................................... 3 1.2 Sets and Vectors ........................................... 4 1.2.1 Set Difference and Set Union . .............................. 4 1.2.2 Symmetric Difference . .................................. 5 1.2.3 Intersection Size ...................................... 5 1.2.4 Vector Norms . ....................................... 5 1.3 Permutations ............................................ 6 1.3.1 Reversal Distance ...................................... 7 1.3.2 Transposition Distance . .................................. 7 1.3.3 Swap Distance ....................................... 8 1.3.4 Permutation Edit Distance . .............................. 8 1.3.5 Reversals, Indels, Transpositions, Edits (RITE) . .................... 9 1.4 Strings ................................................ 9 1.4.1 Hamming Distance . .................................. 10 1.4.2 Edit Distance . ....................................... 10 1.4.3 Block Edit Distances . .................................. 11 1.5 Sequence Distance Problems . .................................
    [Show full text]
  • Dictionary Look-Up Within Small Edit Distance
    Dictionary Lo okUp Within Small Edit Distance Ab dullah N Arslan and Omer Egeciog lu Department of Computer Science University of California Santa Barbara Santa Barbara CA USA farslanomergcsucsbedu Abstract Let W b e a dictionary consisting of n binary strings of length m each represented as a trie The usual dquery asks if there exists a string in W within Hamming distance d of a given binary query string q We present an algorithm to determine if there is a memb er in W within edit distance d of a given query string q of length m The metho d d+1 takes time O dm in the RAM mo del indep endent of n and requires O dm additional space Intro duction Let W b e a dictionary consisting of n binary strings of length m each A dquery asks if there exists a string in W within Hamming distance d of a given binary query string q Algorithms for answering dqueries eciently has b een a topic of interest for some time and have also b een studied as the approximate query and the approximate query retrieval problems in the literature The problem was originally p osed by Minsky and Pap ert in in which they asked if there is a data structure that supp orts fast dqueries The cases of small d and large d for this problem seem to require dierent techniques for their solutions The case when d is small was studied by Yao and Yao Dolev et al and Greene et al have made some progress when d is relatively large There are ecient algorithms only when d prop osed by Bro dal and Venkadesh Yao and Yao and Bro dal and Gasieniec The small d case has applications
    [Show full text]
  • Searching All Seeds of Strings with Hamming Distance Using Finite Automata
    Proceedings of the International MultiConference of Engineers and Computer Scientists 2009 Vol I IMECS 2009, March 18 - 20, 2009, Hong Kong Searching All Seeds of Strings with Hamming Distance using Finite Automata Ondřej Guth, Bořivoj Melichar ∗ Abstract—Seed is a type of a regularity of strings. Finite automata provide common formalism for many al- A restricted approximate seed w of string T is a fac- gorithms in the area of text processing (stringology), in- tor of T such that w covers a superstring of T under volving forward exact and approximate pattern match- some distance rule. In this paper, the problem of all ing and searching for borders, periods, and repetitions restricted seeds with the smallest Hamming distance [7], backward pattern matching [8], pattern matching in is studied and a polynomial time and space algorithm a compressed text [9], the longest common subsequence for solving the problem is presented. It searches for [10], exact and approximate 2D pattern matching [11], all restricted approximate seeds of a string with given limited approximation using Hamming distance and and already mentioned computing approximate covers it computes the smallest distance for each found seed. [5, 6] and exact covers [12] and seeds [2] in generalized The solution is based on a finite (suffix) automata ap- strings. Therefore, we would like to further extend the set proach that provides a straightforward way to design of problems solved using finite automata. Such a problem algorithms to many problems in stringology. There- is studied in this paper. fore, it is shown that the set of problems solvable using finite automata includes the one studied in this Finite automaton as a data structure may be easily imple- paper.
    [Show full text]
  • B-Bit Sketch Trie: Scalable Similarity Search on Integer Sketches
    b-Bit Sketch Trie: Scalable Similarity Search on Integer Sketches Shunsuke Kanda Yasuo Tabei RIKEN Center for Advanced Intelligence Project RIKEN Center for Advanced Intelligence Project Tokyo, Japan Tokyo, Japan [email protected] [email protected] Abstract—Recently, randomly mapping vectorial data to algorithms intending to build sketches of non-negative inte- strings of discrete symbols (i.e., sketches) for fast and space- gers (i.e., b-bit sketches) have been proposed for efficiently efficient similarity searches has become popular. Such random approximating various similarity measures. Examples are b-bit mapping is called similarity-preserving hashing and approximates a similarity metric by using the Hamming distance. Although minwise hashing (minhash) [12]–[14] for Jaccard similarity, many efficient similarity searches have been proposed, most of 0-bit consistent weighted sampling (CWS) for min-max ker- them are designed for binary sketches. Similarity searches on nel [15], and 0-bit CWS for generalized min-max kernel [16]. integer sketches are in their infancy. In this paper, we present Thus, developing scalable similarity search methods for b-bit a novel space-efficient trie named b-bit sketch trie on integer sketches is a key issue in large-scale applications of similarity sketches for scalable similarity searches by leveraging the idea behind succinct data structures (i.e., space-efficient data structures search. while supporting various data operations in the compressed Similarity searches on binary sketches are classified
    [Show full text]
  • Large Scale Hamming Distance Query Processing
    Large Scale Hamming Distance Query Processing Alex X. Liu, Ke Shen, Eric Torng Department of Computer Science and Engineering Michigan State University East Lansing, MI 48824, U.S.A. {alexliu, shenke, torng}@cse.msu.edu Abstract—Hamming distance has been widely used in many a new solution to the Hamming distance range query problem. application domains, such as near-duplicate detection and pattern The basic idea is to hash each document into a 64-bit binary recognition. We study Hamming distance range query problems, string, called a fingerprint or a sketch, using the simhash where the goal is to find all strings in a database that are within a Hamming distance bound k from a query string. If k is fixed, algorithm in [11]. Simhash has the following property: if two we have a static Hamming distance range query problem. If k is documents are near-duplicates in terms of content, then the part of the input, we have a dynamic Hamming distance range Hamming distance between their fingerprints will be small. query problem. For the static problem, the prior art uses lots of Similarly, Miller et al. proposed a scheme for finding a song memory due to its aggressive replication of the database. For the that includes a given audio clip [20], [21]. They proposed dynamic range query problem, as far as we know, there is no space and time efficient solution for arbitrary databases. In this converting the audio clip to a binary string (and doing the paper, we first propose a static Hamming distance range query same for all the songs in the given database) and then finding algorithm called HEngines, which addresses the space issue in the nearest neighbors to the given binary string in the database prior art by dynamically expanding the query on the fly.
    [Show full text]
  • Parity Check Code Repetition Code 10010011 11100001
    Lecture Notes Charles Cusack Communication Errors Introduction Implementations of memory, storage, and communication are not perfect. Therefore, it is possible that when I store a number on a hard drive or send it over a network, a slightly different number is actually stored/received. There are techniques to deal with this. Definition An error detection (correction) code is a method of encoding data in so that if a certain number of errors has occurred during transmission, it can be detected (corrected). Definition The hamming distance between two bit strings is the number of bits where they differ. Example The hamming distance between 10010011 and 11100001 is 4 since 1001 00 11 these bit patterns differ in bits 2, 3, 4, and 7. 1110 00 01 Parity Check Code The simplest method of detecting errors is by using a parity bit . To use a parity bit, one simply appends one additional bit (to the beginning or end—it doesn’t matter which as long as you are consistent) to a bit string so that the number of 1s in the string is odd (or even). To detect an error you add the number of ‘1’ bits. If it is not odd (even) you know an error has occurred. Example The bit string 10010011 is encoded as 100100111 using an odd parity check code, and the bit string 11110001 is encoded as 111100010 using an odd parity check code. Question • How many errors can this method detect? What happens if more errors occur? • How many errors can this method correct? Repetition Code A repetition code encodes a bit string by appending k copies of the bit string.
    [Show full text]
  • Bit-Parallel Approximate String Matching Under Hamming Distance
    Aalto University School of Science Degree Programme in Computer Science and Engineering Tommi Hirvola Bit-parallel approximate string matching under Hamming distance Master's Thesis Espoo, July 21, 2016 Supervisors: Professor Jorma Tarhio Advisor: Professor Jorma Tarhio Aalto University School of Science ABSTRACT OF Degree Programme in Computer Science and Engineering MASTER'S THESIS Author: Tommi Hirvola Title: Bit-parallel approximate string matching under Hamming distance Date: July 21, 2016 Pages: 87 Major: Software engineering Code: T-106 Supervisors: Professor Jorma Tarhio Advisor: Professor Jorma Tarhio In many situations, an exact search of a pattern in a text does not find all in- teresting parts of the text. For example, exact matching can be rendered useless by spelling mistakes or other errors in the text or pattern. Approximate string matching addresses the problem by allowing a certain amount of error in occur- rences of the pattern in the text. This thesis considers the approximate matching problem known as string matching with k mismatches, in which k characters are allowed to mismatch. The main contribution of the thesis consists of new algorithms for approximate string matching with k mismatches based on the bit-parallelism technique. Ex- periments show that the proposed algorithms are competitive with the state-of- the-art algorithms in practice. A significant advantage of the novel algorithms is algorithmic simplicity and flexibility, which is demonstrated by deriving efficient algorithms to several problems involving approximate string matching under the k-mismatches model. A bit-parallel algorithm is presented for online approximate matching of circular strings with k mismatches, which is the first average-optimal solution that is not based on filtering.
    [Show full text]
  • Calculating Hamming Distance with the IBM Q Experience José Manuel Bravo [email protected] Prof
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 12 April 2018 doi:10.20944/preprints201804.0164.v1 Calculating Hamming distance with the IBM Q Experience José Manuel Bravo [email protected] Prof. Computer Science and Technology, High School, Málaga, Spain Abstract In this brief paper a quantum algorithm to calculate the Hamming distance of two binary strings of equal length (or messages in theory information) is presented. The algorithm calculates the Hamming weight of two binary strings in one query of an oracle. To calculate the hamming distance of these two strings we only have to calculate the Hamming weight of the xor operation of both strings. To test the algorithms the quantum computer prototype that IBM has given open access to on the cloud has been used to test the results. Keywords: quantum algorithm, Hamming weight, Hamming distance Introduction This quantum algorithms uses quantum parallelism as the fundamental feature to evaluate The advantage of the quantum computation a function implemented in a quantum oracle for to solve more efficiently than classical many different values of x at the same time computation some algorithms is one of the most because it exploits the ability of a quantum important key for scientists to continue researching computer to be in superposition of different states. and developing news quantum algorithms. Moreover it uses a property of quantum Grover´s searching quantum algorithm is able to mechanics known as interference. In a quantum select one entry between 2 with output 1 in only computer it is possible for the two alternatives to O(log(n)) queries to an oracle.
    [Show full text]
  • Low Distortion Embedding from Edit to Hamming Distance Using Coupling
    Electronic Colloquium on Computational Complexity, Report No. 111 (2015) Low Distortion Embedding from Edit to Hamming Distance using Coupling Diptarka Chakraborty∗ Elazar Goldenbergy Michal Koucký z July 8, 2015 Abstract The Hamming and the edit metrics are two common notions of measuring distances between pairs of strings x; y lying in the Boolean hypercube. The edit distance between x and y is dened as the minimum number of character insertion, deletion, and bit ips needed for converting x into y. Whereas, the Hamming distance between x and y is the number of bit ips needed for converting x to y. In this paper we study a randomized injective embedding of the edit distance into the Ham- ming distance with a small distortion. This question was studied by Jowhari (ESA 2012) and is mainly motivated by two questions in communication complexity: the document exchange problem and deciding edit distance using a sketching protocol. We show a randomized embedding with quadratic distortion. Namely, for any x; y satisfying that their edit distance equals k, the Hamming distance between the embedding of x and y is O(k2) with high probability. This improves over the distortion ratio of O(log n log∗ n) obtained by Jowhari for small values of k. Moreover, the embedding output size is linear in the input size and the embedding can be computed using a single pass over the input. ∗Department of Computer Science & Engineering, Indian Institute of Technology Kanpur, Kanpur, India, dip- [email protected]. Work done while visiting Charles University in Prague. y Charles University in Prague, Computer Science Institute of Charles University, Malostranské námesti 25, 118 00 Praha 1, Czech Republic, [email protected].
    [Show full text]
  • Chapter 10 Error Detection and Correction
    Chapter 10 Error Detection and Correction 10.1 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Note Data can be corrupted during transmission. Some applications require that errors be detected and corrected. 10.2 10-110-1 INTRODUCTIONINTRODUCTION LetLet usus firstfirst discussdiscuss somesome issuesissues related,related, directlydirectly oror indirectly,indirectly, toto errorerror detectiondetection andand correction.correction. TopicsTopics discusseddiscussed inin thisthis section:section: Types of Errors Redundancy Detection Versus Correction Forward Error Correction Versus Retransmission Coding Modular Arithmetic 10.3 Note In a single-bit error, only 1 bit in the data unit has changed. 10.4 Figure 10.1 Single-bit error 10.5 Note A burst error means that 2 or more bits in the data unit have changed. 10.6 Figure 10.2 Burst error of length 8 10.7 Note To detect or correct errors, we need to send extra (redundant) bits with data. 10.8 Figure 10.3 The structure of encoder and decoder 10.9 Note In this book, we concentrate on block codes; we leave convolution codes to advanced texts. 10.10 Note In modulo-N arithmetic, we use only the integers in the range 0 to N −1, inclusive. 10.11 Figure 10.4 XORing of two single bits or two words 10.12 10-210-2 BLOCKBLOCK CODINGCODING InIn blockblock coding,coding, wewe dividedivide ourour messagemessage intointo blocks,blocks, eacheach ofof kk bits,bits, calledcalled datawordsdatawords.. WeWe addadd rr redundantredundant bitsbits toto eacheach blockblock toto makemake thethe lengthlength nn == kk ++ r.r. TheThe resultingresulting n-bitn-bit blocksblocks areare calledcalled codewordscodewords.
    [Show full text]