Sustained Activation of Wnt/B-Catenin Signaling Drives AKI to CKD Progression

BASIC RESEARCH www.jasn.org

Sustained Activation of Wnt/b-Catenin Signaling Drives AKI to CKD Progression

† † ‡ † Liangxiang Xiao,* Dong Zhou, Roderick J. Tan, Haiyan Fu, Lili Zhou,* Fan Fan Hou,* and † Youhua Liu*

*State Key Laboratory of Organ Failure Research, National Clinical Research Center of Kidney Disease, Nanfang Hospital, Southern Medical University, Guangzhou, China; and Departments of †Pathology and ‡Medicine, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania

ABSTRACT AKI is increasingly recognized as a major risk factor for progression to CKD. However, the factors governing AKI to CKD progression are poorly understood. In this study, we investigated this issue using moderate (20 minutes) and severe (30 minutes) ischemia/reperfusion injury (IRI) in mice. Moderate IRI led to acute kidney failure and transient Wnt/b-catenin activation, which was followed by the restoration of kidney morphology and function. However, severe IRI resulted in sustained and exaggerated Wnt/ b-catenin activation, which was accompanied by development of renal fibrotic lesions characterized by interstitial myofibroblast activation and excessive extracellular matrix deposition. To assess the role of sustained Wnt/b-catenin signaling in mediating AKI to CKD progression, we manipulated this signaling by overexpression of Wnt ligand or pharmacologic inhibition of b-catenin. In vivo, overexpression of Wnt1 at 5 days after IRI induced b-catenin activation and accelerated AKI to CKD progression. Conversely, blockade of Wnt/b-catenin by small molecule inhibitor ICG-001 at this point hindered AKI to CKD progression. In vitro, Wnt ligands induced renal interstitial fibroblast activation and promoted fibronectin expression. However, activated fibroblasts readily reverted to a quiescent phenotype after Wnt ligands were removed, suggesting that fibroblast activation requires persistent Wnt signaling. These results indicate that sustained, but not transient, activation of Wnt/b-catenin signaling has a decisive role in driving AKI to CKD progression.

J Am Soc Nephrol 27: 1727–1740, 2016. doi: 10.1681/ASN.2015040449

AKIisresponsiblefor about 2million deaths eachyear pathophysiology of AKI-CKD progression but also worldwide, and its incidence is rising.1–3 AKI is in- is instrumental in designing rational strategies for creasingly common in critically ill patients, and those therapeutic intervention. patients with severe AKI requiring dialysis have a Wnt/b-catenin is a developmental signaling mortality rate of .50%. In contrast to the traditional pathway that plays an essential role in regulating belief that survivors of AKI tend to fully recover renal function, there is growing evidence that patients who survive an episode of AKI will have a signiﬁcant risk Received April 27, 2015. Accepted August 22, 2015. 1,2,4 of developing progressive CKD and even ESRD. Published online ahead of print. Publication date available at Evidence is also mounting that the severity and fre- www.jasn.org. quency of AKI seem to be closely correlated with Correspondence: Dr. Fan Fan Hou, Division of Nephrology, poor patient long–term outcome,5,6 suggesting that Nanfang Hospital, Southern Medical University, 1838 North AKI may be a predictive and causative factor for sub- Guangzhou Avenue, Guangzhou, China 510515, or Dr. Youhua Liu, Department of Pathology, University of Pittsburgh School of sequent development of CKD. In this context, delin- Medicine, S-405 Biomedical Science Tower, 200 Lothrop Street, eation of the underlying mechanisms governing the Pittsburgh, PA 15261. Email: [email protected] or liuy@ different courses of long-term outcome after AKI will upmc.edu not only shed new light on understanding the Copyright © 2016 by the American Society of Nephrology

J Am Soc Nephrol 27: 1727–1740, 2016 ISSN : 1046-6673/2706-1727 1727 BASIC RESEARCH www.jasn.org nephron formation during embryogenesis, injury repair, and kidney failure. Even at 10 days after 30-minute IRI, serum pathogenesis of kidney diseases.7,8 Wnt proteins transmit their creatinine level remained significantly higher than the base- signal through interaction with the Frizzled family of receptors line (Figure 1B). Consistent with these functional data, kidney and their coreceptors, members of the LDL receptor–related morphology was restored at 10 days after 20-minute IRI, protein-5 and -6. On binding to their receptors, Wnts trigger a whereas morphologic lesions were evident in the kidneys at cascade of downstream events, resulting in dephosphorylation 10 days after 30-minute IRI (Figure 1C). These results suggest of b-catenin. This leads to the stabilization of b-catenin and that the severity of the injury is a key determinant dictating renders its translocation into the nucleus, where it binds to the divergent outcomes of AKI, because 20-minute IRI leads T cell factor/lymphoid enhancer–binding factor to stimulate to recovery, whereas 30-minute IRI triggers progression to its target genes.9,10 Although Wnt/b-catenin is relatively silent CKD. in normal adult kidneys, this signaling is robustly reactivated To delineate the mechanism governing the different out- after a wide variety of kidney injuries.11–16 comes of AKI, we investigated the expression of Wnt/b-catenin Previous studies from our laboratory show that tubule- in the kidneys after IRI. As shown in Figure 1D, numerous specificablationofb-catenin in mice aggravates AKI after Wnt ligands, such as Wnt1, Wnt2 Wnt3, Wnt3a, Wnt7a, either ischemic or nephrotoxic insults, suggesting that Wnt/ Wnt8a, and Wnt8b, were significantly induced at 1 day after b-catenin activation is renoprotective, at least in the initial IRI. Compared with moderate AKI induced by 20-minute IRI, stage after insults.17 Along this line, an earlier study has also severe AKI by 30-minute IRI exhibited an exaggerated induc- shown the beneficial effect of macrophage-derived Wnt7b in tion of many Wnt ligands, including Wnt1, Wnt3, Wnt7a, promoting tubular repair and kidney regeneration after Wnt8a, and Wnt8b (Figure 1D). Similarly, renal b-catenin AKI.18,19 However, chronic activation of this signaling seems protein abundance was dramatically increased at 3 days after to be detrimental, leading to development and progression of IRI, and the degree of b-catenin induction was closely corre- CKD. This notion is consistent with copious reports that Wnt/ lated with the severity of AKI (Figure 1, E and F). Collectively, b-catenin controls a battery of fibrogenic genes, such as these results indicate that Wnt/b-catenin is activated in both Snail1,15 plasminogen activator inhibitor-1 (PAI-1),20 matrix moderate and severe AKI, but severe AKI is associated with an metalloproteinase-7 (MMP-7),21 fibroblast-specificprotein exaggerated activation of this signaling. 1 (Fsp1),22 and multiple components of the renin-angiotensin system.23,24 On the basis of these observations, it is conceiv- Wnt/b-Catenin Activation Is Transient in Moderate AKI able to speculate that an early and transient activation of Wnt/ with Recovery b-catenin after AKI may be renoprotective by facilitating tu- We further examined the dynamics of Wnt/b-catenin activa- bular repair and regeneration, whereas sustained activation of tion in AKI at different time points after IRI. To that end, the same signaling could promote AKI to CKD progression. expression of Wnt ligands was assessed in moderate AKI in- To test this hypothesis, we have studied the pattern and duced by 20-minute IRI, in which kidney function and struc- dynamics of Wnt/b-catenin expression in both moderate and ture promptly recovered (Figure 1). As shown in Figure 2A, severe AKI models induced by ischemia/reperfusion injury RT-PCR analyses displayed a transient activation of the ma- (IRI). We further manipulated this signaling in vivo by either jority of Wnt ligands at 1 day after 20-minute IRI followed by a overexpressing Wnt1 or inhibiting b-catenin–mediated gene return to the baseline level at 3 and 10 days after injury. On the transcription. Our results indicate that sustained but not tran- basis of the characteristic features of Wnts regulation, we clas- sient activation of Wnt/b-catenin is a key determinant for sified four dynamic patterns of Wnt expression, although driving AKI-CKD progression. the magnitude of induction for each individual Wnt after 20-minute IRI was different. As shown in Figure 2B, the majority of Wnt ligands, such as Wnt1, Wnt2, Wnt3, Wnt3a, RESULTS Wnt7a, Wnt8a, Wnt8b, and Wnt16, displayed a similar expression pattern with a transient induction peaking at 1 day, Level of Wnt/b-Catenin Activation Correlates with AKI but their mRNA levels quickly returned to the baseline at 3 Severity and 10 days after IRI injury. A few Wnts exhibited different We first examined the effect of different severity of AKI expression patterns, whereas the expression of Wnt5b and induced by IRI on the long-term outcomes of kidney function Wnt11 was not changed throughout the course of the experi- in mice. As shown in Figure 1A, ischemia/reperfusion after ments (Figure 2B). Notably, the induction of b-catenin pro- bilaterally clamping renal pedicles for 20 minutes triggered tein predominantly took place at 3 days after 20-minute IRI, a moderate AKI. Serum creatinine level was significantly ele- time point lagging behind Wnt induction (Figure 2, C and D). vated at 1 day after 20-minute IRI but returned to the baseline However, b-catenin protein also returned to the baseline at at 3 and 10 days (Figure 1A). However, 30-minute IRI caused 10 days after injury. Taken together, these results suggest that more severe AKI, with a higher level of serum creatinine at moderate AKI after 20-minute IRI, which is characterized by 1 day. More importantly, serum creatinine did not decrease at transient kidney failure and recovery (Figure 1A), is associated 3 days after 30-minute IRI (Figure 1B), suggesting a persistent with a transient Wnt/b-catenin activation.

1728 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 1727–1740, 2016 www.jasn.org BASIC RESEARCH

Figure 1. Wnt/b-catenin is activated in both moderate and severe AKI induced by ischemia/reperfusion. (A) Twenty-minute IRI induced moderate AKI followed by rapid restoration of kidney function. Serum creatinine (Scr) levels were assayed at different time points after 20-minute IRI as indicated. Data are expressed as means6SEMs. Ctrl, control; D, day. *P,0.05 versus sham controls (n=5). (B) Thirty- minute IRI caused severe AKI with sustained kidney dysfunction. Scr levels were elevated at different time points after injury. *P,0.05 versus sham controls (n=4). (C) Representative micrographs show the kidney morphology at 10 days after 20- or 30-minute IRI. Kidney sections were subjected to Periodic acid–Schiff staining. Boxed areas are enlarged. Arrows indicate renal tubules. Scale bar, 50 mm. (D) Representative RT-PCR analysis reveals different magnitudes of Wnt induction after 20- and 30-minute IRI. The expression of most Wnt genes was substantially increased in the kidneys at 1 day after 30-minute IRI compared with sham or 20-minute IRI groups. (E and F) Western blot shows that b-catenin protein level was dramatically increased at 3 days after severe AKI induced by 30-minute IRI compared with sham or 20-minute IRI groups. Numbers (1–3) indicate each individual animal in a given group. *P,0.05 versus sham † controls; P,0.05 versus 20-minute IRI (n=4).

Sustained Activation of Wnt/b-Catenin Is Associated alterations in the kidneys after 30-minute IRI (Figure 3B). Cor- with AKI-CKD Progression respondingly, Western blotting also revealed that renal b-catenin We next investigated the expression pattern and dynamics of protein was induced at 1, 3, and 10 days after 30-minute IRI, Wnt/b-catenin in severe AKI induced by 30-minute IRI, which with a peak at 3 days (Figure 3, C and D). Therefore, in contrast are characterized by developing progressive CKD (Figure 1B).25 to moderate AKI after 20-minute IRI, severe AKI after 30-minute As shown in Figure 3A, the expression of the majority of Wnt IRI, characterized by progressing to CKD, is associated with a genes was induced at 1 day after 30-minute IRI and then, slightly sustained activation of Wnt/b-catenin signaling. reduced at 3 days but increased again at 10 days after injury. According to the dynamics of Wnts induction, four distinct pat- In Vivo Expression of Wnt Accelerates AKI to CKD ternsofWntsexpressioncouldbeidentiﬁed. As shown in Figure Progression 3B, most Wnt ligands, such as Wnt1, Wnt5b, Wnt7a, Wnt7b, To establish a role of sustained Wnt/b-catenin activation in Wnt9b, Wnt10a, and Wnt10b, were induced at 1 day and some- AKI-CKD progression, we sought to upregulate Wnt signaling what decreased at 3 days but increased again at 10 days after in the kidneys in vivo after AKI. To this end, we investigated 30-minute IRI. Other patterns of Wnt induction were also ob- whether in vivo expression of Wnt1 gene in mice accelerates served, but they only represented the minority of the Wnt AKI to CKD progression. Wnt1 was chosen, because it is the

J Am Soc Nephrol 27: 1727–1740, 2016 Wnt and AKI-CKD Progression 1729 BASIC RESEARCH www.jasn.org

Western blot analyses of whole-kidney lysates (Figure 4C). Notably, this increase in Wnt1 protein was primarily because of the transgene expression of exogenous Wnt1 as shown by Western blotting using anti-HA antibody (Figure 4C). Consistently, immunohistochemical staining revealed that Wnt1 and its downstream b-catenin protein were predominantly induced in kidney tubular epithelium after pHA-Wnt1 plasmid injection (Figure 4D). Of note, endogenous Wnt1 was also mainly expressed in renal tubular epithelium (Figure 4D, IRI +pcDNA3). Collectively, these data indicate that the hydrodynamic–based gene delivery of pHA-Wnt1 plasmid resulted in overex- pressionofWnt1inthesamesitesas endogenous gene in vivo.Wefoundthat overexpression of Wnt1 in vivo exacerbated kidney dysfunction and increased serum creatinine and BUN levels at 11 days after UIRI (6 days after plasmid injection) (Fig- ure 4, E and F), suggesting that sustained activation of Wnt/b-catenin accelerates AKI to CKD progression.

In Vivo Expression of Wnt Augments Renal Fibrosis after AKI We next examined the effect of sustained expressionofWnt1 onrenalfibrosis, thefinal common outcome of progressive CKD.28–30 As shown in Figure 5, in vivo expression of Figure 2. Wnt/b-catenin activation is transient in moderate AKI after 20-minute IRI. (A) Wnt1 induced its downstream mediator and Representative RT-PCR analysis of renal Wnt gene expression at different time points after 20-minute IRI. The majority of Wnt genes was transiently induced at 1 day but target genes in the kidneys after ischemic returned to baselines at 3 and 10 days after injury. Numbers (1–3) indicate each in- AKI. Western blot analyses illustrated that dividual animal in a given group. (B) Graphic presentation shows the dynamic pattern delivery of the Wnt1-expressing vector up- of Wnt expression in the kidneys after 20-minute IRI. Different Wnts with similar ex- regulated renal expression of b-catenin and pression patterns after IRI were grouped. D, day. (C and D) Representative Western PAI-1 protein after IRI compared with blot reveals that the b-catenin protein level was induced with a peak at 3 days after IRI pcDNA3 controls (Figure 5, A–C). Similarly, compared with controls. Numbers (1 and 2) indicate each individual animal in a given exogenous Wnt1 induced renal mRNA ex- group. Data are presented as fold induction over sham controls. Ctrl, control. *P,0.05 pression of MMP-7 and Fsp1 as determined versus sham controls (n=5). by quantitative real–time RT-PCR (qRT- PCR) analyses (Figure 5, D and E). Immu- nohistochemical staining also revealed that prototype of Wnt that transmits its signal by canonical overexpression of Wnt1 promoted the expression of b-catenin pathway and because its expression was upregulated in AKI target genes, such as MMP-7 and renin (Figure 5F). Notably, (Figures 1–3). As shown in Figure 4A, hemagglutinin (HA)– weak renin staining was only observed in the juxtaglomerular tagged Wnt1 expression vector (pHA-Wnt1) or empty vector apparatus of normal kidneys (Figure 5F, open arrow), whereas (pcDNA3) was administered intravenously at 5 days after renin was predominantly induced in renal tubular epithelial cells unilateral ischemia/reperfusion injury (UIRI) by a hydrodynamic– after kidney injury (Figure 5F, solid arrows), consistent with based gene transfer technique, an approach that results in sig- previous observations.31–33 nificant renal expression of the transgenes.26,27 As shown in We further investigated the effects of exogenous Wnt1 on Figure 4B, Wnt1 mRNA was induced in the kidneys at 6 days matrix gene expression and renal fibrotic lesions after AKI. As after a single injection of Wnt1-expressing plasmid (11 days shown in Figure 6, A–D, in vivo expression of exogenous Wnt1 after UIRI). Wnt1 protein was also induced as shown by significantly induced the mRNA expression of a-smooth muscle

1730 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 1727–1740, 2016 www.jasn.org BASIC RESEARCH

Blockade of Wnt/b-Catenin Signaling Hinders AKI-CKD Progression To further confirm a role of the sustained Wnt/b-catenin signaling in driving AKI- CKD progression, we examined whether blockade of Wnt/b-catenin signaling can protect kidneys against developing CKD after AKI. To this end, we assessed the effect of ICG-001, a small molecule inhibitor that blocks b-catenin–mediated gene transcription,34–36 in an established IRI–induced kidney injury. As shown in Figure 7A, ICG-001 was administered through daily intraperitoneal injections starting at 5 days after UIRI. We found that inhibition of Wnt/b-catenin signaling by ICG-001 ameliorated both serum creatinine and BUN levels at 11 days after IRI compared with vehicle controls (Fig- ure 7, B and C). Similarly, qRT-PCR analyses showed that ICG-001 reduced the mRNA expression of fibronectin, types I and III collagens, and a-SMA in the kidneys (Figure 7, D–G). MTS also revealed that ICG-001 ameliorated renal collagen deposition and fibrotic lesions at 11 days after IRI (Figure 7H). Quanti- tative data on renal fibrotic lesions as determined by using computer–aided morphometric analyses are presented in Figure 7I. These results indicate that blockade of Wnt/b-catenin by ICG-001 Figure 3. Severe AKI after 30-minute IRI is associated with sustained activation of Wnt/ starting at 5 days after UIRI efficiently b-catenin. (A) Representative RT-PCR analysis reveals that most Wnt genes were induced at 1 day after severe AKI induced by 30-minute IRI compared with sham protects the kidneys against developing controls and that Wnt induction was sustained at 3 and 10 days. Numbers (1–3) in- CKD after AKI. dicate each individual animal in a given group. (B) Graphic presentation shows the distinct pattern of Wnt expression in severe AKI after 30-minute IRI. Different Wnts ICG-001 Represses Wnt/b-Catenin with similar dynamic pattern were grouped. D, day. (C) Representative Western blot Downstream Target Genes and (D) graphic presentation show that b-catenin protein was induced at 1, 3, and We then investigated the effect of blocking 10 days after 30-minute IRI, with a peak expression at 3 days. Data are presented as Wnt/b-catenin by ICG-001 by examining , fold induction over sham controls. *P 0.05 versus sham controls (n=4). GAPDH, the expression of its target genes. As shown glyceraldehyde-3-phosphate dehydrogenase. in Figure 8, A–E, Western blot analyses showed that b-catenin, fibronectin, actin (a-SMA), fibronectin, and types I and III collagens in the a-SMA, and PAI-1 proteins were dramatically induced in kidneys after IRI as shown by qRT-PCR analyses. Accordingly, the kidneys at 11 days after UIRI compared with sham con- Western blot analyses of whole-kidney lysates also revealed that trols, indicating an active AKI-CKD progression in this model. exogenous Wnt1 promoted renal expression of a-SMA and However, administration of ICG-001 starting at 5 days after fibronectin proteins (Figure 6, E–G). Similar results were ob- initial injury almost completely abolished the expressions tained when kidney sections were immunostained with antibod- of b-catenin (Figure 8B), fibronectin (Figure 8C), a-SMA ies against a-SMA and fibronectin (Figure 6H). Furthermore, (Figure 8D), and PAI-1 protein (Figure 8E). Immunohisto- Masson Trichrome staining (MTS) also showed that exogenous chemical staining also showed that b-catenin, fibronectin, and Wnt1 in vivo aggravates renal fibrotic lesions after IRI (Figure 6, a-SMA proteins were markedly induced after UIRI, whereas I and J). These data indicate that sustained activation of Wnt/ ICG-001 largely abolished the induction of these proteins b-catenin after severe AKI is a major driver promoting kidney (Figure 8F). Consistently, qRT-PCR results also revealed that function decline and fibrogenesis. ICG-001 repressed the mRNA expression of MMP-7 and

J Am Soc Nephrol 27: 1727–1740, 2016 Wnt and AKI-CKD Progression 1731 BASIC RESEARCH www.jasn.org

Figure 4. In vivo expression of Wnt1 accelerates AKI-CKD progression after IRI. (A) Diagram shows the experimental design. Arrows indicate the time point of UIRI and unilateral nephrectomy (UNx). The green arrowhead indicates the time point when pcDNA3 or pHA- Wnt 1 was injected. (B) Representative RT-PCR shows Wnt1 mRNA expression in the kidneys at 6 days after single plasmid injection. Ctrl, control. (C) Representative Western blot shows renal Wnt1 and HA protein expression at 6 days after plasmid injection; kidney lysates were immunoblotted with antibodies against Wnt1 and HA, respectively. (D) Representative micrographs show renal Wnt1 and b-catenin protein expression and localization at 6 days after plasmid injection; kidney sections were stained with speciﬁc antibodies against Wnt1 and b-catenin, respectively. Arrows indicate positive staining. Scale bar, 50 mm. (E and F) Graphic presentation shows the † levels of serum creatinine (Scr) and BUN in different groups. *P,0.05 versus sham controls; P,0.05 versus pcDNA3 alone (n=5).

Snail1 (Figure 8, G and H), two direct downstream targets of incubation with a low level of Wnt-CM (10%) for 24 hours Wnt/b-catenin signaling.15,21 was sufficient to induce fibroblast activation as assessed by fibronectin expression. However, after Wnt-CM was re- Fibroblast Activation Requires Persistent Wnt/ moved, fibronectin induction in fibroblasts was eradicated, b-Catenin Signaling In Vitro indicating its reversion to a quiescent phenotype. These data To elucidate the mechanism underlying sustained Wnt/b-catenin suggest that fibroblast activation in vitro requires persistent activation driving AKI to CKD progression, we studied fibro- Wnt/b-catenin activation. blast activation, a key event in renal fibrogenesis,28,30 by using Consistent with this notion, we found that continuous an in vitro model system. To this end, conditioned media were incubation of NRK-49F cells with Wnt-CM for 48 hours resulted collected from human kidney proximal tubular epithelial cell in massive expression of fibronectin (Figure 9B). Notably, the (HKC-8) transfected with various Wnt expression vectors, fibrogenic effect of Wnt-CM was abolished by ICG-001 (Figure including Wnt1, Wnt2, Wnt3a, Wnt4, and Wnt16. This 9, C and D), indicating an indispensable role for Wnt/b-catenin Wnt–rich conditioned medium (Wnt-CM) contained a cock- signaling in mediating fibroblast activation. Analyses of the tail of the Wnts that were induced after IRI. As shown in mRNA expression by qRT-PCR also revealed that persistent Figure 9A, normal rat kidney interstitial fibroblast (NRK- Wnt signaling was obligatory for induction of fibronectin, col- 49F) cells were treated with Wnt-CM using different proto- lagens I and III, and Fsp1 in cultured fibroblasts (Figure 9, E–H). cols that imitate in vivo conditions. Protocol c in Figure 9A Similarly, prolonged incubation with a high level of Wnts resul- mimicked moderate AKI after 20-minute IRI, with a low– ted in maximal induction of fibronectin, collagen III, and vi- level, transient Wnt exposure, whereas protocol d modeled mentin proteins in NRK-49F cells. These results indicate that severe AKI after 30-minute IRI, with high–level, persistent persistent but not transient Wnt signaling is required for sus- Wntexposure(Figure9A).AsshowninFigure9B,transient taining fibroblast activation and matrix production in vitro.

1732 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 1727–1740, 2016 www.jasn.org BASIC RESEARCH

Figure 5. In vivo expression of exogenous Wnt1 promotes the expression of b-catenin target genes. (A–C) Western blot analyses show the expression of b-catenin and PAI-1 in different groups. Numbers (1–3) indicate each individual animal in a given group. (A) Rep- resentative Western blot and quantitative data for (B) b-catenin and (C) PAI-1 are shown. Data are presented as fold induction over † sham controls. Ctrl, control. *P,0.05 versus sham controls; P,0.05 versus pcDNA3 alone (n=5). (D and E) qRT-PCR analyses show that † expression of Wnt1 in vivo promoted renal expression of (D) MMP-7 and (E) Fsp1 after IRI. *P,0.05 versus sham controls; P,0.05 versus pcDNA3 alone (n=5). (F) Representative micrographs show renal induction of MMP-7 and renin at 6 days after plasmid injection. Arrows indicate positive staining. Open arrow shows renin expression in the juxtaglomerular apparatus. Scale bar, 50 mm.

DISCUSSION that requires persistent Wnt signaling. Collectively, these findings establish a crucial role for a sustained and exagger- After AKI, the kidney sometimes fully recovers its structure ated Wnt signaling in driving AKI to CKD progression. Our andfunctionbyanadaptiverepairandregenerationor studies also provide novel insights into the mechanisms that undergoes maladaptive responses in other circumstances, control the different long–term outcomes of AKIs of varying leading to the development of progressive and fibrotic CKD.37 severity. Exactly what factors dictate such divergent outcomes of AKI, It is widely recognized that the long-term outcome of however, remain a mystery. In this study, we have investigated patientswhosurviveanepisode of AKIis divergent.Although the molecular mechanisms underlying the distinct fates of some patients with AKI may have better prognosis with full the kidneys after AKI. Our results show that sustained acti- recovery of kidney function, others unfortunately will vation of Wnt/b-catenin signaling plays a decisive role in progress to CKD with declining renal function. Although driving CKD progression after AKI. This conclusion is numerous host factors, such as preexisting conditions and supported by several lines of evidence, which include (1) geneticmakeup,playarole,theseverityofAKIseemstobethe sustained but not transient activation of Wnt/b-catenin is most important and robust predictor of poorer outcome.3,6 associated with developing CKD after AKI, (2)prolonged For instance, in patients who underwent cardiac surgery, the activation of Wnt/b-catenin through in vivo expression of magnitude of serum creatinine concentration during the Wnt1 after AKI accelerates CKD progression, (3)blockade postoperative hospital course is found to be directly linked of Wnt/b-catenin after AKI with small molecule inhibitor to CKD progression and mortality.38,39 Consistent with prevents AKI-CKD progression and ameliorates renal fibro- these data, we found that, in mice with identical age, sex, sis, and (4) fibroblast activation in vitro is a reversible process and genetic backgrounds, the severity of ischemia, per se,is

J Am Soc Nephrol 27: 1727–1740, 2016 Wnt and AKI-CKD Progression 1733 BASIC RESEARCH www.jasn.org

Figure 6. Exogenous Wnt1 in vivo drives CKD progression after AKI. (A–D) qRT-PCR shows the relative mRNA levels of (A) a-SMA, (B) fibronectin, (C) collagen I, and (D) collagen III in different groups. Relative mRNA levels were determined after normalization with † b-actin and expressed as fold induction over controls. Ctrl, control. *P,0.05 versus sham controls; P,0.05 versus pcDNA3 (n=5). (E) Western blot analyses of renal expression of fibronectin and a-SMA. Kidney lysates were immunoblotted with specific antibodies against fibronectin (FN), a-SMA, and b-actin. Numbers (1–3) indicate each individual animal in a given group. (F and G) Graphic † presentation of renal protein levels of fibronectin and a-SMA. *P,0.05 versus sham controls; P,0.05 versus pcDNA3 (n=5). (H) Im- munofluorescence and immunohistochemical staining show fibronectin and a-SMA expression in the kidneys at 6 days after Wnt1 plasmid injection. Kidney sections were stained with specific antifibronectin and a-SMA antibody. Scale bar, 50 mm. (I) Kidney sections were stained with MTS. Representative micrographs from different groups as indicated are shown. Scale bar, 50 mm. (J) Quantitative † determination of renal fibrotic lesions in different groups. *P,0.05 versus sham controls; P,0.05 versus pcDNA3 alone (n=5).

the single most crucial factor for determining the ultimate Wnt/b-catenin is associated with moderate AKI after outcome of AKI, with 20-minute IRI triggering transient 20-minute IRI (Figure 2). Given the fact that Wnt signaling AKI followed by recovery of renal function and 30-minute promotes tubular cell survival by inhibiting apoptosis and IRI causing severe AKI followed by progression to CKD (Fig- augmenting cell proliferation,40–42 such a transient activa- ure 1). Therefore, by merely altering the duration of ische- tion of Wnt/b-catenin in the early stage of AKI seems ben- mia, one can establish both models of moderate AKI with eficial by minimizing the injury and promoting repair and full recovery and severe AKI destined to progressive CKD in regeneration. Consistent with this view, genetic knockout of the same setting (Figure 1). Such IRI models with different the b-catenin gene in tubule-specificfashionisshownto outcomes provide an unparalleled system to interrogate the aggravate kidney injury after both ischemic and nephrotoxic mechanisms dictating the different long–term outcomes insults.17 It should be pointed out that the biologic action of AKI. elicited by transient Wnt/b-catenin signaling, such as fibro- One novel finding in this study is that severe AKI is blast activation and matrix production, is controllable and coupled to a sustained Wnt/b-catenin activation. Although reversible (Figure 9). Therefore, transient Wnt/b-catenin reactivation of Wnt/b-catenin is a common event in both activation after moderate AKI would lead to predominantly moderate and severe AKI, the duration and magnitude adaptive repair, with complete resolution of the injury of activation are quite different between these two IRI and full recovery of kidney function. Taken together, it is models with divergent outcomes. Transient activation of reasonable to conclude that the differences in duration of

1734 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 1727–1740, 2016 www.jasn.org BASIC RESEARCH

Figure 7. Blockade of Wnt/b-catenin signaling by small molecule inhibitor ICG-001 hinders AKI-CKD progression. (A) Diagram shows the experimental design. Arrows indicate the time point of UIRI and unilateral nephrectomy (UNx). The green arrowhead indicates the time point when ICG-001 or vehicle was injected. (B and C) Graphic presentation shows that ICG-001 reduced the levels of serum † creatinine (Scr) and BUN at 11 days after UIRI compared with vehicle controls. Ctrl, control. *P,0.05 versus sham controls; P,0.05 versus vehicle alone (n=6). (D–G) qRT-PCR shows that ICG-001 reduced the mRNA expression of (D) ﬁbronectin, (E) collagen I, (F) † collagen III, and (G) a-SMA in the kidneys after IRI compared with vehicle controls. *P,0.05 versus sham controls; P,0.05 versus vehicle alone (n=6). (H) Kidney sections were stained with MTS. Representative micrographs from different groups as indicated are shown. The arrow indicates positive staining. Scale bar, 50 mm. (I) Quantitative determination of renal ﬁbrotic lesions in different † groups. *P,0.05 versus sham controls; P,0.05 versus vehicle alone (n=6).

Wnt/b-catenin activation after AKI determine the divergent genes (Figures 5 and 6), all of which are relevant to the pro- paths to adaptive repair or maladaptive responses, thereby gression of CKD.15,20,21,23 The importance of sustained Wnt leading to disparate outcomes. signaling in driving AKI to CKD progression is also substan- There are several reasons that could account for why a tiated by in vivo expression of Wnt1, the prototype of Wnt sustained activation of Wnt/b-catenin leads to CKD. As ligands that is highly induced after IRI (Figures 2 and 3), or illustrated in vitro (Figure 9), persistent Wnt signaling, a sce- inhibiting Wnt/b-catenin signaling by using a small molecule nario similar to severe AKI, leads to sustained fibroblast ac- inhibitor ICG-001.34,43,44 Notably, we selected to manipulate tivation and matrix production, whereas activated fibroblasts Wnt/b-catenin at 5 days after IRI (Figures 4 and 7), a time easily revert back to quiescent phenotype when Wnt signal- point that extends beyond the initial injury and early repair/ ing is transient, a condition closely resembling moderate regeneration phases after AKI, to assess the potential role AKI. As such, sustained activation of Wnt/b-catenin would of Wnt signaling in modulating AKI to CKD progression. result in irreversible fibroblast activation, which contributes These data clearly suggest that a sustained activation of to the development of fibrotic lesions. Furthermore, sus- Wnt/b-catenin beyond the injury and repair phases after tained activation of Wnt/b-catenin in severe AKI will cause AKI would result in maladaptive responses characterized by an exaggerated induction of several key target genes, such as persistent fibroblast activation, excessive matrix accumula- Snail1,PAI-1,MMP-7,Fsp1,andrenin-angiotensinsystem tion, and renal fibrosis.

J Am Soc Nephrol 27: 1727–1740, 2016 Wnt and AKI-CKD Progression 1735 BASIC RESEARCH www.jasn.org

Figure 8. ICG-001 represses Wnt/b-catenin target genes and reduces fibrotic lesions. (A) Western blot analyses show that ICG-001 inhibited renal expression of b-catenin, fibronectin, a-SMA, and PAI-1 after IRI. Numbers (1–3) indicate each individual animal. Ctrl, control. (B–E) Quantitative data for (B) b-catenin, (C) fibronectin, (D) a-SMA, and (E) PAI-1 are shown in different groups. *P,0.05 versus † sham controls; P,0.05 versus vehicle alone (n=6). (F) Immunostaining shows that ICG-001 reduced the expression of b-catenin, fibronectin, and a-SMA after IRI; kidney sections from different groups were stained with specificantibodiesagainstb-catenin, fibronectin, and a-SMA, respectively. Scale bar, 50 mm. (G and H) qRT-PCR analyses show that ICG-001 inhibited MMP-7 and Snail1 mRNA † expression in vivo.*P,0.05 versus sham controls; P,0.05 versus vehicle (n=6). GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Given the significant therapeutic potential of blocking and adriamycin nephropathy,23,34 it is reasonable to specu- AKI to CKD progression, it is important to determine late that later interventions (starting at 10 or 14 days) will whether a later intervention (such as 10 days after AKI) by also be beneficial. Additional studies are warranted to test targeting Wnt/b-catenin is still therapeutically effective for this hypothesis. longer follow-up periods. Our experiments were terminated Emerging evidence suggests that AKI and CKD should be at 11 days after severe IRI, because kidney function decline viewed as an intertwined clinical entity rather than two and renal fibrosis already developed at that time point disparate diseases as previously perceived.3 In this study, we (Figure 7). We envision that the kidney at 5 days after severe propose that the differences in the dynamics and duration of IRI or beyond is destined to CKD. Because late administra- renal Wnt/b-catenin activation play a decisive role in dictating tion of ICG-001 has been shown to reduce kidney injury in whether kidneys recover or progress to CKD after acute injury. other CKD models, such as unilateral ureteral obstruction Although more studies are needed, this study provides the

1736 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 1727–1740, 2016 www.jasn.org BASIC RESEARCH

CONCISE METHODS

Mouse Ischemic AKI Models Male C57BL/6 miceweighing approximately 22– 25 g were purchased from Harlan Sprague– Dawley (Indianapolis, IN). Mice were subjected to bilateral renal IRI by an established protocol as described previously.17 For studying moderate and severe AKI induced by IRI, two different protocols with 20- or 30-minute ischemia time were used.25 Briefly, under general anesthesia induced by intraperitoneal injection of a mixture of ketamine hydrochloride (100 mg/kg body wt) and xylazine hydrochloride (10 mg/kg), a midline abdominal incision was made, and bilateral renal pedicles were clipped for 20 or 30 minutes using microaneurysm clamps (item no. 18051–35; Fine Science Tools, Cambridge, UK) for moderate or severe AKI, respectively. After removal of the clamps, reperfusion of the kidneys was visually confirmed. The incision was then closed in two layers. During the ischemic period, body temperature was maintained between approximately 37°C and 38°C using a temperature–controlled heating system. Ani- mals were then administered intraperitoneally with buprenorphine at 0.05 mg/kg body wt. Mice were euthanized at 1, 3, and 10 days post- IRI, respectively. Serum and kidney tissues were collected for various analyses. It should be noted that the severity of ischemic AKI in murine fl Figure 9. Myofibroblast activation requires sustained Wnt/b-catenin signaling in vitro. models is in uenced by several factors as recently (A) Diagram shows the experimental design: a and b show that NRK-49F cells were reviewed.45 In addition to the duration of treated without or with 10% Wnt-CM for 24 hours; c indicates that NRK-49F cells were ischemia, experimental conditions, including treated with 10% Wnt-CM for 24 hours, washed, and incubated without Wnt-CM for an temperature control, animal strain, sex, and additional 24 hours, and d shows that NRK-49F cells were incubated with 40% age, are important variables. In this study, sur- Wnt-CM continuously for 48 hours. (B–D) Western blot analyses and quantitative data gery was performed by the same individual fi b show that myo broblast activation was dependent on sustained Wnt/ -catenin sig- (D.Z.), and all other experimental conditions naling in vitro. Wnt-CM was collected from HKC-8 cells after transfection with a group were identical between groups except the ische- of Wnt expression vectors, including Wnt1, Wnt2, Wnt3a, Wnt4, and Wnt16. Some mia time. All animal experiments were approved samples were pretreated with ICG-001 (10 mM) for 1 hour. The experimental con- by the Laboratory Animal Committee at the ditions (a–d) are presented at the bottom of each panel. Fn, fibronectin. *P,0.05 † versus controls (n=3); P,0.05 versus Wnt-CM alone (n=3). (E–H) Blockade of Wnt/ Southern Medical University and the Institu- b-catenin signaling by ICG-001 abolished the Wnt-CM–induced mRNA expression of tional Animal Care and Use Committee at the fibronectin, collagen I, collagen III, and Fsp1 in NRK-49F cells. NRK-49F cells were University of Pittsburgh. treated as indicated, and the mRNA expression was assessed by qRT-PCR. *P,0.05 † versus controls (n=3); P,0.05 versus Wnt-CM alone (n=3). (I) Immunofluorescence Manipulation of Wnt/b-Catenin fi staining shows that Wnt-CM induced bronectin, collagen III, and vimentin expression Signaling In Vivo in NRK-49F cells and that ICG-001 inhibited their expression; NRK-49F cells cultured To manipulate Wnt/b-catenin signaling dur- fi fi on coverslips were stained with speci c antibodies against bronectin, collage III, and ing AKI-CKD progression in vivo,aUIRI vimentin, respectively. Arrows indicate positive staining. model was used.45,46 This model avoids animal loss after severe AKI induced by bilateral IRI, because one kidney is intact at the time of in- proof of principle that strategies to manipulate this signaling jury.TheUIRImodeliswellestablished and particularly suited to may be effective approaches to prevent AKI to CKD progres- study AKI-CKD progression, because kidney function can be as- sion in the afflicted patients. sessed after removing the intact kidney by nephrectomy.45,46 The

J Am Soc Nephrol 27: 1727–1740, 2016 Wnt and AKI-CKD Progression 1737 BASIC RESEARCH www.jasn.org details of UIRI protocol are described in Figure 4A. Briefly, 10- using routine protocol. Antibodies used were as following: rabbit week-old male C57BL/6 mice were subjected to UIRI by a similar polyclonal anti–Wnt1 (ab15251; Abcam, Inc., Cambridge, MA), protocol to bilateral IRI, except that only one renal pedicle was rabbit polyclonal anti–b-catenin (ab15180; Abcam, Inc.), mouse clipped for 30 minutes. Briefly, under general anesthesia, a midline monoclonal anti–a-SMA (ab5694; Abcam, Inc.), mouse monoclonal abdominal incision was made, and the left renal pedicle was clipped anti–MMP-7 (GTX17854; GeneTex, Inc.), and goat polyclonal anti- using microaneurysm clamps. After removal of the clamps, reper- renin (sc-27320; Santa Cruz Biotechnology, Santa Cruz, CA). fusion of the kidneys was visually confirmed, and the incision was then closed. During the ischemic period and recovery, body tem- Immunofluorescence Staining perature was maintained between approximately 37°C and 38°C Kidney cryosections or cells cultured on coverslips were fixed with using a temperature–controlled heating system. Animals were 3.7% paraformalin for 15 minutes at room temperature. After then administered intraperitoneally with buprenorphine at 0.05 blocking with 10% donkey serum for 30 minutes, the slides were mg/kgbodywt.At5daysafterUIRI,miceweresubjectedtoasingle immunostained with primary antibodies against fibronectin (F3648; intravenous injection of Wnt1 expression plasmid (pHA-Wnt1; Sigma-Aldrich, St. Louis, MO), collagen III (234189; EMD Millipore), Upstate Biotechnology) at 1 mg/kg body wt (Figure 4A) using the and vimentin (V5255; Sigma-Aldrich). To visualize the primary hydrodynamic–based gene transfer technique as reported previ- antibodies, slides were stained with cyanine Cyanine dye-2– or Cya- ously.27 For inhibition of Wnt/b-catenin signaling, at 5 days after nine dye-3–conjugated secondary antibodies (Jackson Immuno- UIRI, mice were subjected to daily intraperitoneal injections of Research Laboratories, West Grove, PA). Slides were viewed ICG-001 (Chembest, Shanghai, China) at 5 mg/kg body wt for under a Nikon Eclipse E600 Microscope equipped with a digital 6 days (Figure 7A). At 10 days after UIRI, mice were subjected to camera. unilateral nephrectomy to remove the intact contralateral kidney. Mice were euthanized at 11 days after UIRI. Serum and kidney Western Blot Analysis tissues were collected for various analyses. Protein expression was analyzed by Western blot analysis as described previously.48 The primary antibodies used were as follow: rabbit Cell Culture and Wnt-CM polyclonal antifibronectin (F3648; Sigma-Aldrich), mouse monoclo- HKC-8 cells and their culture conditions were described previously.34 nal anti–b-catenin antibody (610154; BD Transduction Laboratories, NRK-49F cells were obtained from the American Type Culture San Jose, CA), mouse monoclonal anti–a-SMA antibody (A2547; Collection (Manassas, VA). Cells were maintained as described pre- Sigma-Aldrich), mouse anti–PAI-1 antibody (Sc-5297; Santa Cruz viously.47 HKC-8 cells were transfected with a mixture of Wnt ex- Biotechnology), rabbit polyclonal anti–Wnt1 (ab15251; Abcam, pression vectors using Lipofectamine 2000 according to the protocol Inc.), mouse anti–a-tubulin (T9026; Sigma-Aldrich), mouse specified by the manufacturer (Invitrogen, Grand Island, NY). The antiactin (MAB1501; Chemicon, Billerica, MA), and rabbit anti- Wnt expression vectors used were the pHA-Wnt1, V5-tagged Wnt2 glyceraldehyde-3-phosphate dehydrogenase (2118s; Cell Signaling expression vector (pV5-Wnt2), pV5-Wnt3a, pHA-Wnt4, and pV5- Technology, Danvers, MA). Wnt16. At 16 hours after transfection, cells were incubated in serum- free medium, and the supernatant of the transfected HKC-8 cells was RT-PCR and Real-Time RT-PCR harvested after an additional 48 hours of incubation as Wnt-CM. Total RNA isolation was carried out using the TRIzol RNA Isola- Serum–starved NRK-49F cells were then treated with different con- tion System (Life Technologies, Grand Island, NY) according to the centrations of Wnt-CM for various periods of time as indicated in manufacturer’s instruction. The first–strand cDNA synthesis was car- Figure 9A. In some experiments, NRK-49F cells were pretreated with ried out by using a Reverse Transcription System Kit (Promega, ICG-001 at 10 mM for 0.5 hours before incubation with Wnt-CM. Madison, WI). qRT-PCR was performed on an ABI PRISM 7000 After various treatments, NRK-49F cells were collected and subjected Sequence Detection System (Applied Biosystems, Foster City, CA) to various analyses. as described previously.23,48 The PCR reaction mixture in a 25-ml volume contained 12.5 ml23 SYBR Green PCR Master Mix (Applied Serum Creatinine and BUN Assay Biosystems), 5 ml diluted reverse transcription product (1:10), and Serum creatinine levels were measured using the QuantiChrom 0.5 mM sense and antisense primer sets. The sequences of the primer Creatinine Assay Kit (DICT-500; Bioassay Systems, Hayward, CA) as pairs used in RT-PCR or qRT-PCR are given in Supplemental Table 1. described previously.17 The level of serum creatinine was expressed as Expression of various genes was determined by the comparative CT 2DD milligrams per 100 ml. BUN levels were determined by using the method (2 CT). The mRNA levels of various genes were calculated QuantiChrom Urea Assay Kit according to the manufacturer’s pro- after normalizing with b-actin. tocol (DIUR-500; Bioassay Systems). Statistical Analyses Histology and Immunohistochemical Staining All data examined are expressed as means6SEMs. Statistical analyses Paraffin–embedded mouse kidney sections (4-mm thickness) were of the data were performed using SigmaStat software (Jandel Scien- prepared by a routine procedure. Kidney sections were subjected to tific, San Rafael, CA). Comparison between groups was made using MTS for assessing collagen deposition and fibrotic lesions as de- one-way ANOVA followed by Newman–Kuels test. P,0.05 was con- scribed previously.48 Immunohistochemical staining was performed sidered statistically significant.

1738 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 1727–1740, 2016 www.jasn.org BASIC RESEARCH

ACKNOWLEDGMENTS Macrophage Wnt7b is critical for kidney repair and regeneration. Proc Natl Acad Sci U S A 107: 4194–4199, 2010 fi ThisworkwassupportedbyNational973ProgramGrant2012CB517700, 19. Kawakami T, Ren S, Duf eld JS: Wnt signalling in kidney diseases: Dual roles in renal injury and repair. J Pathol 229: 221–231, 2013 National Science Foundation of China Grants 81130011 and 81521003, 20. He W, Tan R, Dai C, Li Y, Wang D, Hao S, Kahn M, Liu Y: Plasminogen and National Institutes of Health Grants DK064005, DK091239, and activator inhibitor-1 is a transcriptional target of the canonical pathway DK106049, and Guangdong Natural Science Funds for Innovative Team of Wnt/b-catenin signaling. J Biol Chem 285: 24665–24675, 2010 grant 2014A030312014. R.J.T was supported by American Heart Asso- 21.HeW,TanRJ,LiY,WangD,NieJ,HouFF,LiuY:Matrix ciation Fellow-to-Faculty Transition Grant 13FTF16990086. metalloproteinase-7 as a surrogate marker predicts renal Wnt/ b-catenin activity in CKD. J Am Soc Nephrol 23: 294–304, 2012 22. Stein U, Arlt F, Walther W, Smith J, Waldman T, Harris ED, Mertins SD, Heizmann CW, Allard D, Birchmeier W, Schlag PM, Shoemaker RH: DISCLOSURES The metastasis-associated gene S100A4 is a novel target of beta- None. catenin/T-cell factor signaling in colon cancer. Gastroenterology 131: 1486–1500, 2006 23. Zhou L, Li Y, Hao S, Zhou D, Tan RJ, Nie J, Hou FF, Kahn M, Liu Y: Multiple genes of the renin-angiotensin system are novel targets of REFERENCES Wnt/b-catenin signaling. JAmSocNephrol26: 107–120, 2015 24. Zhou L, Liu Y: Wnt/b-catenin signalling and podocyte dysfunction in 1. Belayev LY, Palevsky PM: The link between acute kidney injury and proteinuric kidney disease. Nat Rev Nephrol 11: 535–545, 2015 chronic kidney disease. Curr Opin Nephrol Hypertens 23: 149–154, 2014 25. Yang L, Besschetnova TY, Brooks CR, Shah JV, Bonventre JV: Epithelial 2. Leung KC, Tonelli M, James MT: Chronic kidney disease following cell cycle arrest in G2/M mediates kidney fibrosis after injury. Nat Med acute kidney injury-risk and outcomes. Nat Rev Nephrol 9: 77–85, 2013 16: 535–543, 2010 3. Chawla LS, Kimmel PL: Acute kidney injury and chronic kidney disease: 26. Zhou L, Li Y, Zhou D, Tan RJ, Liu Y: Loss of Klotho contributes to kidney An integrated clinical syndrome. Kidney Int 82: 516–524, 2012 injury by derepression of Wnt/b-catenin signaling. J Am Soc Nephrol 4. Bonventre JV, Basile D, Liu KD, McKay D, Molitoris BA, Nath KA, 24: 771–785, 2013 Nickolas TL, Okusa MD, Palevsky PM, Schnellmann R, Rys-Sikora K, 27. Dai C, Saleem MA, Holzman LB, Mathieson P, Liu Y: Hepatocyte growth Kimmel PL, Star RA; Kidney Research National Dialogue (KRND): AKI: A factor signaling ameliorates podocyte injury and proteinuria. Kidney Int path forward. Clin J Am Soc Nephrol 8: 1606–1608, 2013 77: 962–973, 2010 5. Coca SG, Singanamala S, Parikh CR: Chronic kidney disease after acute 28. Boor P, Ostendorf T, Floege J: Renal fibrosis: Novel insights into kidney injury: A systematic review and meta-analysis. Kidney Int 81: mechanisms and therapeutic targets. Nat Rev Nephrol 6: 643–656, 442–448, 2012 2010 6. Chawla LS, Amdur RL, Amodeo S, Kimmel PL, Palant CE: The severity of 29. Zeisberg M, Neilson EG: Mechanisms of tubulointerstitial fibrosis. JAm acute kidney injury predicts progression to chronic kidney disease. Soc Nephrol 21: 1819–1834, 2010 Kidney Int 79: 1361–1369, 2011 30. Liu Y: Cellular and molecular mechanisms of renal fibrosis. Nat Rev 7. Huang H, He X: Wnt/beta-catenin signaling: New (and old) players and Nephrol 7: 684–696, 2011 new insights. Curr Opin Cell Biol 20: 119–125, 2008 31. Tan X, He W, Liu Y: Combination therapy with paricalcitol and tran- 8. Fodde R, Brabletz T: Wnt/beta-catenin signaling in cancer stemness dolapril reduces renal fibrosis in obstructive nephropathy. Kidney Int and malignant behavior. Curr Opin Cell Biol 19: 150–158, 2007 76: 1248–1257, 2009 9. Semenov MV, Habas R, Macdonald BT, He X: SnapShot: Noncanonical 32. Gilbert RE, Wu LL, Kelly DJ, Cox A, Wilkinson-Berka JL, Johnston CI, Wnt signaling pathways. Cell 131: 1378, 2007 Cooper ME: Pathological expression of renin and angiotensin II in the 10. Wang Y: Wnt/Planar cell polarity signaling: A new paradigm for cancer renal tubule after subtotal nephrectomy. Implications for the patho- therapy. Mol Cancer Ther 8: 2103–2109, 2009 genesis of tubulointerstitial fibrosis. Am J Pathol 155: 429–440, 1999 11. Tan RJ, Zhou D, Zhou L, Liu Y: Wnt/b-catenin signaling and kidney fi- 33. Ramkumar N, Stuart D, Rees S, Hoek AV, Sigmund CD, Kohan DE: brosis. Kidney Int Suppl (2011) 4: 84–90, 2014 Collecting duct-specific knockout of renin attenuates angiotensin 12. Ren S, Johnson BG, Kida Y, Ip C, Davidson KC, Lin SL, Kobayashi A, II-induced hypertension. Am J Physiol Renal Physiol 307: F931–F938, Lang RA, Hadjantonakis AK, Moon RT, Duffield JS: LRP-6 is a 2014 coreceptor for multiple fibrogenic signaling pathways in pericytes 34. Hao S, He W, Li Y, Ding H, Hou Y, Nie J, Hou FF, Kahn M, Liu Y: Targeted and myofibroblasts that are inhibited by DKK-1. Proc Natl Acad Sci inhibition of b-catenin/CBP signaling ameliorates renal interstitial fi- USA110: 1440–1445, 2013 brosis. J Am Soc Nephrol 22: 1642–1653, 2011 13. Peng J, Dong Z: Role changes of b-catenin in kidney injury and repair. 35. Henderson WR Jr., Chi EY, Ye X, Nguyen C, Tien YT, Zhou B, Borok Z, Kidney Int 82: 509–511, 2012 Knight DA, Kahn M: Inhibition of Wnt/b-catenin/CREB binding protein 14. He W, Dai C, Li Y, Zeng G, Monga SP, Liu Y: Wnt/b-catenin signaling (CBP) signaling reverses pulmonary fibrosis. Proc Natl Acad Sci U S A promotes renal interstitial fibrosis. J Am Soc Nephrol 20: 765–776, 2009 107: 14309–14314, 2010 15. Dai C, Stolz DB, Kiss LP, Monga SP, Holzman LB, Liu Y: Wnt/b-catenin 36. Emami KH, Nguyen C, Ma H, Kim DH, Jeong KW, Eguchi M, Moon RT, signaling promotes podocyte dysfunction and albuminuria. JAmSoc Teo JL, Kim HY, Moon SH, Ha JR, Kahn M: A small molecule inhibitor of Nephrol 20: 1997–2008, 2009 b-catenin/CREB-binding protein transcription [corrected]. Proc Natl 16. DiRocco DP, Kobayashi A, Taketo MM, McMahon AP, Humphreys BD: Acad Sci U S A 101: 12682–12687, 2004 Wnt4/b-catenin signaling in medullary kidney myofibroblasts. JAm 37. Ferenbach DA, Bonventre JV: Mechanisms of maladaptive repair after Soc Nephrol 24: 1399–1412, 2013 AKI leading to accelerated kidney ageing and CKD. Nat Rev Nephrol 17. Zhou D, Li Y, Lin L, Zhou L, Igarashi P, Liu Y: Tubule-specific ablation of 11: 264–276, 2015 endogenous b-catenin aggravates acute kidney injury in mice. Kidney 38. James MT, Ghali WA, Knudtson ML, Ravani P, Tonelli M, Faris P, Pannu Int 82: 537–547, 2012 N, Manns BJ, Klarenbach SW, Hemmelgarn BR; Alberta Provin- 18. Lin SL, Li B, Rao S, Yeo EJ, Hudson TE, Nowlin BT, Pei H, Chen L, Zheng cial Project for Outcome Assessment in Coronary Heart Disease JJ, Carroll TJ, Pollard JW, McMahon AP, Lang RA, Duffield JS: (APPROACH) Investigators: Associations between acute kidney injury

J Am Soc Nephrol 27: 1727–1740, 2016 Wnt and AKI-CKD Progression 1739 BASIC RESEARCH www.jasn.org

and cardiovascular and renal outcomes after coronary angiography. 44. Floege J: Antagonism of canonical Wnt/b-catenin signaling: Taking Circulation 123: 409–416, 2011 RAS blockade to the next level? JAmSocNephrol26: 3–5, 2015 39. Ishani A, Nelson D, Clothier B, Schult T, Nugent S, Greer N, Slinin Y, 45. Wei Q, Dong Z: Mouse model of ischemic acute kidney injury: Technical Ensrud KE: The magnitude of acute serum creatinine increase after notes and tricks. Am J Physiol Renal Physiol 303: F1487–F1494, 2012 cardiac surgery and the risk of chronic kidney disease, progression of 46. Skrypnyk NI, Harris RC, de Caestecker MP: Ischemia-reperfusion model kidney disease, and death. Arch Intern Med 171: 226–233, 2011 of acute kidney injury and post injury fibrosis in mice [published online 40. Wang Z, Havasi A, Gall JM, Mao H, Schwartz JH, Borkan SC: Beta- ahead of print August 9, 2013]. J Vis Exp 10.3791/50495 catenin promotes survival of renal epithelial cells by inhibiting Bax. 47. Hu K, Wu C, Mars WM, Liu Y: Tissue-type plasminogen activator promotes JAmSocNephrol20: 1919–1928, 2009 murine myofibroblast activation through LDL receptor-related protein 41. Schmidt-Ott KM, Barasch J: WNT/beta-catenin signaling in nephron 1-mediated integrin signaling. J Clin Invest 117: 3821–3832, 2007 progenitors and their epithelial progeny. Kidney Int 74: 1004–1008, 48. Zhou D, Li Y, Zhou L, Tan RJ, Xiao L, Liang M, Hou FF, Liu Y: Sonic 2008 hedgehog is a novel tubule-derived growth factor for interstitial fibro- 42. Terada Y, Tanaka H, Okado T, Shimamura H, Inoshita S, Kuwahara M, blasts after kidney injury. JAmSocNephrol25: 2187–2200, 2014 Sasaki S: Expression and function of the developmental gene Wnt-4 during experimental acute renal failure in rats. JAmSocNephrol14: 1223–1233, 2003 43. Kahn M: Can we safely target the WNT pathway? Nat Rev Drug Discov This article contains supplemental material online at http://jasn.asnjournals. 13: 513–532, 2014 org/lookup/suppl/doi:10.1681/ASN.2015040449/-/DCSupplemental.

1740 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 1727–1740, 2016

Supplementary Table 1. Nucleotide sequences of the primers used for RT-PCR in this study

Primer Sequence 5’ to 3’ Product Mouse gene Forward Reverse Size (bp) Wnt1 GCCCTAGCTGCCAACAGTAGT GAAGATGAACGCTGTTTCTCG 312 Wnt2 AGAGTGCCAACACCAGTTCC TACAGGAGCCACTCACACCA 425 Wnt2b TTGTGTCAACGCTACCCAGA ACCACTCCTGCTGACGAGAT 200 Wnt3 GGGGCGTATTCAAGTAGCTG GTAGGGACCTCCCATTGGAT 107 Wnt3a TTCTTACTTGAGGGCGGAGA CTGTCGGGTCAAGAGAGGAG 227 Wnt4 CGAGGAGTGCCAATACCAGT GTCACAGCCACACTTCTCCA 193 Wnt5a CCCAGTCCGGACTACTGTGT TTTGACATAGCAGCACCAGTG 189 Wnt5b TCTCCGCCTCACAAAAGTCT CACAGACACTCTCAAGCCCA 242 Wnt6 TTCGGGGATGAGAAGTCAAG CGGCACAGACAGTTCTCCTC 497 Wnt7a GACAAATACAACGAGGCCGT GGCTGTCTTATTGCAGGCTC 207 Wnt7b ACAGGAGGGTGGGGATAGA GAAACAGCCCAGGAAACCGT 253 Wnt8a CTGACTACTGCAACCGCAAC TGACAGTGCAACACCACTGA 201 Wnt8b CCAGAGTTCCGGGAGGTAG GAGATGGAGCGGAAGGTGT 131 Wnt9a CCCCTGACTATCCTCCCTCT GATGGCGTAGAGGAAAGCAG 273 Wnt9b GGGTGTGTGTGGTGACAATC TCCAACAGGTACGAACAGCA 200 Wnt10a GCGCTCCTGTTCTTCCTACT ATGCCCTGGATAGCAGAGG 197 Wnt10b TCAGTCGGGCTCTAAGCAAT TGGTGCTGACACTCGTGAAC 190 Wnt11 TGCTTGACCTGGAGAGAGGT AGCCCGTAGCTGAGGTTGT 193 Wnt16 CCCTCTTTGGCTATGAGCTG TACTGGACATCATCCGAGCA 202 β-actin CAGCTGAGAGGGAAATCGTG CGTTGCCAATAGTGATGACC 150 α-SMA GAGGCACCACTGAACCCTAA CATCTCCAGAGTCCAGCACA 154 Fibronectin CGAGGTGACAGAGACCACAA CTGGAGTCAAGCCAGACACA 149 Collagen I ATCTCCTGGTGCTGATGGAC ACCTTGTTTGCCAGGTTCAC 154 Collagen III AGGCAACAGTGGTTCTCCTG GACCTCGTGCTCCAGTTAGC 149 Snail 1 ATTCTCCTGCTCCCACTGC GACTCTTGGTGCTTGTGGAG 150 MMP-7 TAGGCGGAGATGCTCACTTT TTCTGAATGCCTGCAATGTC 150 FSP1 AGCTACTGACCAGGGAGCTG TCATTGCCCTGTTGCTGTC 100