Radiation Hybrid Mapping of Genes in the Lithium- Sensitive Wnt Signaling Pathway AR Rhoads1, JD Karkera2 and SD Detera-Wadleigh2

ORIGINAL RESEARCH ARTICLE Radiation hybrid mapping of genes in the lithium- sensitive Wnt signaling pathway AR Rhoads1, JD Karkera2 and SD Detera-Wadleigh2

1Department of Biochemistry and Molecular Biology, Howard University, Washington, DC 20059; 2Unit on Gene Mapping and Expression, National Institute of Mental Health, National Institutes of Health, Bethesda, MD 20892, USA

Lithium, an effective drug in the treatment of bipolar disorder, has been proposed to disrupt the Wnt signaling pathway. To facilitate analysis of the possible involvement of elements of the Wnt pathway in human bipolar disorder, a high resolution radiation hybrid mapping (RHM) of these genes was performed. A fine physical location has been obtained for Wnt 7A, frizzled 3, 4 and 5, dishevelled 1, 2 and 3, GSK3␤, axin, ␣-catenin, the Armadillo repeat-containing genes (␦-catenin and ARVCF), and a frizzled-like protein (frpHE) using the Stanford Human Genome Center (SHGC) G3 panel. Most of these genes were previously mapped by fluor- escence in situ hybridization (FISH). Frizzled 4, axin and frpHE did not have a previous chromosomal assignment and were linked by RHM to chromosome markers, SHGC-35131 at 11q22.1, NIB1488 at 16p13.3 and D7S2919 at 7p15.2, respectively. Interestingly, some of these genes were found to map within potential regions underlying susceptibility to bipolar disorder and schizophrenia as well as disorders of neurodevelopmental origin. This alternative approach of establishing the precise location of selected genetic components of a candidate pathway and determining if they map within previously defined susceptibility loci should help to identify plausible candidate genes that warrant further analysis through association and mutational scanning. Keywords: radiation hybrid mapping; Wnt pathway; lithium; bipolar disorder; susceptibility loci; chromosome localization

Introduction mals, and some Wnt genes (Wnt 1 and Wnt 3) have been found to function as oncogenes during virus- Klein and Melton1 proposed that the activity of lithium induced tumorigenesis.6 A large family of transmem- in bipolar disorder may be due to inhibition of glyco- brane G-protein receptors or frizzled proteins appear to gen synthase kinase 3␤ (GSK3␤), an enzyme that anta- function as Wnt receptors.7 Another signaling protein, gonizes the Wingless or Wnt pathway signaling. They dishevelled, is recruited to the plasma membrane in suggested further that lithium action via Wnt signaling response to overexpression of frizzled and appears to may be more significant than its action on the inositol function downstream of Wnt and frizzled8 in the path- 1,4,5-trisphosphate pathway that is the focus of the way. In addition to secreted Wnt proteins, a family of inositol depletion hypothesis.2 The Wnt pathway has secreted frizzled-like proteins with homology to the been elaborated largely through studies on epidermal cysteine-rich ligand-binding domain of the frizzled development in Drosophila and consists of secreted receptor family, but lacking the seven-transmembrane Wnt ligands which bind to a family of frizzled recep- domains has also been identified.9 Members of this tors that alter the activity of downstream targets: dis- family of frizzled-like proteins can have opposite hevelled, zeste-white 3/shaggy or GSK3␤ and Arma- effects on the apoptopic pathway and can modulate ␤- dillo or ␤-catenin.3 This highly conserved Wnt catenin levels by interfering with Wnt-frizzled sig- signaling pathway plays a major role during develop- naling.10 ment and growth in multicellular organisms4 and is Interaction of Wnt family members with the cognate essential to the development of the central nervous sys- frizzled receptor causes inhibition of GSK3␤ via dis- tem.5 The Wnt genes encode cysteine-rich extacellular hevelled promoting the stabilization of cytoplasmic ␤- signaling proteins of approximately 350–400 amino catenin by preventing its phosphorylation by GSK3␤.11 acids. Fifteen or more of the Wnt genes exist in mam- The phosphorylated form of ␤-catenin is degraded more rapidly via the interaction with a cytoplasmic adenomatosis polyposis coli (APC) protein.12 In this Correspondence: Dr AR Rhoads, Department of Biochemistry and manner GSK3␤ antagonizes Wnt signaling by decreas- Molecular Biology, Howard University, Washington, DC 20059, ␤ USA ing steady-state levels of -catenin that can form bipar- Received 20 November 1998; revised and accepted 29 January tite transcriptional complexes with T cell factor (TCF) 1999 and lymphoid enhancer factor (LEF) leading to the acti- Radiation hybrid mapping of Wnt pathway genes AR Rhoads et al 438 vation of genes associated with cell growth and pro- breakage frequency and its significance expressed as a liferation.13 Axin, an inhibitor of dorsoventral axis likelihood estimate or LOD score.20,21 For genes with- determination, binds directly to GSK3␤, catenin and out any prior mapping information, a LOD score of 6 APC,14 and its binding correlates with inhibition of or greater was required for reporting. For genes with a axial development.15 Disturbances in development known chromosomal assignment, a threshold LOD observed with lithium exposure appear to be due to score of 3 or greater was necessary. The cytogenetic lithium interaction with GSK3␤.1 band location of the linked marker was obtained from We have fine mapped genes of the Wnt pathway as the Location Database (LDB) at the Wessex Human an approach to identify new candidate genes for Genetic Institute, UK (http: //cedar.genetics.soton. bipolar disorder. Identification of predisposing genes ac.uk/public html/). in complex diseases is difficult because of a number of reasons, among them are: (a) weak to moderate suscep- Results tibility genes may not be detectable by means of linkage analysis,16 particularly when using inadequate Most of the genes in this study have only been approxi- sample size;17 and (b) susceptibility regions are gener- mately mapped by somatic cell hybrid or FISH. Fine ally broad and recombinants may not be useful for nar- mapping with a more precise localization was perfor- rowing down the region.18 An alternative strategy med on human Wnt 7A, frizzled 3, 4 and 5, a frizzled- involves association testing utilizing candidate genes like protein (frpHE), dishevelled 1, 2 and 3, GSK3␤, because this has greater power to detect small effect axin, ␣ and ␦-catenin and ARVCF. In some cases no genes, ‘even if one needs to test every gene in the gen- previous chromosome assignment (frizzled 4, axin, ome’.16 In this study, we have used RHM to fine map frpHE) was made. In most instances, primers used for potential candidate genes of the Wnt pathway to deter- the amplification were derived from the 3Ј-UTR of the mine whether they map to previously proposed sus- mRNA sequence. Primers for frizzled 4 (Accession ceptibility regions for bipolar disorder and to facilitate AA902950) were derived from the 5Ј-flanking sequence future analysis of their possible association with the of the cDNA clone (residues 148–280) adjacent to a disease. conserved frizzled region. The forward and reverse primers used for PCR amplification of these genes and the accession number of the corresponding mRNA Materials and methods sequences are indicated in Table 1. The SHGC radiation hybrid whole genome G3 panel RHM and Wnt 7A indicated that the marker that best was purchased from Research Genetics (Huntsville, linked to this gene was SHGC-31086 located on chro- AL, USA) and pipetted into a standard 96-well plate. mosome 3p25.3 between loci D3S3610 and D3S1585 or RHM was performed as described.19 Primers (18–24 41 cR from D3S1585 (Table 2). Wnt 7A was previously mers) were synthesized by Gene Probe Technology mapped to the 3p25 region by FISH.22 For the frizzled

(Gaithersburg, MD, USA). The Tm of primers ranged receptors, frizzled 3 was linked to locus D7S2101E, on from 60 to 63°C, and the amplicons were 93–185 bp in 7q11.21, frizzled 4 to marker SHGC-35131 at 11q22.1 length. PCR was performed in 1 × PCR buffer (10 mM and frizzled 5 to locus D2S325, at 2q34. Using an inter-

Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2 and specific backcross mouse mapping panel and based on 0.001% gelatin (Sigma Chemical Co, St Louis, MO, synteny, Wang et al7 predicted that frizzled 5 and also USA), 110 ␮M dNTP, 0.5 ␮M primers, 10% sucrose, frizzled 7 would map to 2q33–34, supporting the RHM 0.2 ␮M cresol red, 0.25 unit of Taq DNA polymerase assignment. The secreted, frizzled-related gene, frpHE, and hamster-human hybrid DNA template in a total that is modulated during the endometrial cycle and volume of 10 ␮l. Hamster and human total genomic malignant transformation and was previously DNA were used as negative and positive controls, unmapped,23 was linked to locus D7S2919 which was respectively. The PCR amplification was performed in located at 7p15.2. a Gene-Amp System 9700 (Perkin-Elmer Corp, Nor- Axin, an inhibitor of the Wnt pathway, was linked walk, CT, USA) with an initial denaturation at 94°C for by RHM to the EST, NIB1488, at the telomeric end of 5 min followed by 35–40 cycles of denaturation at 94°C the p-arm at 16p13.3. Only one other marker, D16S521, for 30 s, annealing at 55° or 60°C for 30 s and extension was located more proximal to the tip of the short arm at 72°C for 1 min. A final extension was at 72°C for of chromosome 16. NIB1488 was flanked by locus 5 min. Electrophoresis was performed on 3% agarose D16S3327, toward the centromere. Blast analysis of the containing a 3:1 mixture of NuSieve GTG:SeaKem GTG cDNA of human axin revealed that it shared complete (FMC BioProducts, Rockland, ME, USA) in 40 mM identity to cosmid clones 333B10 (Z81450) and to Tris-HCl, 20 mM sodium acetate and 1 mM EDTA, pH RT220 (AC004652) from the tip of the short arm of 7.8 and 0.0001% ethidium bromide. RHM for each of chromosome 16 in support of this assignment. the genes was performed in duplicate or triplicate. Dishevelled 1 was linked to D1S2565 located 29 cR The data were submitted to the SHGC server from the telomeric end of the p-arm of chromosome (http://www.shgc. stanford.edu), and a two-point 1p36.33, within the previously assigned region of 1p36 maximum likelihood analysis was obtained. Linkage to by FISH analysis.24 Dishevelled 2 was previously markers of the map framework ordered on the basis of linked to chromosome 17 by analysis of somatic cell X-ray breakage of chromosomes was determined by hybrid panels and distal to Wnt3A and vestigial tail Radiation hybrid mapping of Wnt pathway genes AR Rhoads et al 439 Table 1 PCR primers for radiation hybrid mapping

Gene name/accession Forward primer (5Ј→3Ј) Reverse primer (5Ј→3Ј) Product size (bp)

Wnt 7A U53476 GCAGGATGCTGAGCTTGTCT AGGGACTTGGGCTGTGTCT 155 Frizzled 3 U82169 CTGCATCCCCTAGAGACAGC ACTAGGACCCTGTGGGGACT 168 Frizzled 4 AA902950 AGTGTTGTGCAAAGAGGGCT GCGCCTGATAATCCATCACT 133 Frizzled 5 U43318 TGCCAAGGTCACTTCCGT ACCTGGGACAGGTTCTTCCT 103 Frizzled-like frpHE AF026692 GCAGCACCAGAAACAGTGAG GGTGGATGTCCTGGGAAGTA 127 Axin AF009674 CCTGTGGTCTACCCGTGTCT TATGAGGAGTGGTCCAGGCT 101 Dishevelled 1 AF006011 GACCCTGTCATCTGTCCCAC AGGATGTCCAGCCCTCTCTC 127 Dishevelled 2 AF006012 TACCAGCTGCTGCCATACAG AGGTCCCTTGTCTACCCCTG 95 Dishevelled 3 U75651 GTAGTCGCCTCCAATAGCCA GCAGGGGTAGAGCAGAGATG 121 GSK-3␤ (AF098789) GTAAGCTACTGTCCCTCTCCCTG TTAGGCTGATATTGCAAAAGGAAT 93 ␣-Catenin D14705 SHGC-36193 GATTCCACAGGGAAATGGG AGGCTCCTGCATTCTAAAAGC 100 ␦-Catenin (U96136) GTGGTTGATGGGAGGAGAGA GCTGTACAGAGGAACCCCAA 177 ARVCF U51269 CTTCTAAAGGCGGAGGGTCT AGGCTCTCTACTGCACAGGG 185

Table 2 Radiation hybrid mapping of genes of the human Wnt signaling pathway

Gene RHM linked Chromosome 2-Point linkage Previous Reference marker localization LOD score chromosome assignment

Wnt 7A SHGC-31086 3p25.3 4.45 3p25 22 Frizzled 3 D7S2101E 7q11.21 1000 7q11.23 30 Frizzled 4 SHGC-35131 11q22.1 11.05 None – Frizzled 5 D2S325 2q34 6.46 2q33–34 7 Frizzled-like frpHE D7S2919 7p15.2 12.93 None – Axin NIB1488 16p13.3 1000 Nonea – Dishevelled 1 D1S2565 1p36.33 7.06 1p36 24 Dishevelled 2 SHGC-35547 17p13.1 1000 17 25 Dishevelled 3 SHGC-30693 3q21.3 5.17 3q27 24,26 GSK-3␤ D3S3620 3q21.1 1000 3q13.3–q21 27 ␣-Catenin D5S500 5q31.1 1000 5q31 40 ␦-Catenin D5S478 5p15.2 1000 D5S630–D5S478 WICGRb ARVCF D22S1138 22q11.2–12.1 9.46 22q11 46 aCosmid clone RT220 from human chromosome 16 shares complete identity with cloned cDNA sequence of axin. bWhitehead Institute Center for Genome Research.

(vt) on mouse chromosome 11.25 By RHM, dishevelled marker D5S478 at 5p15.2 located in the cri-du-chat 2 was linked to the STS, SHGC-35547 on 17p13.1 region of 5p. The catenin-like gene, ARVCF, was linked between markers D17S938 and D17S786. The third to SHGC-2421 (locus D22S1138) at 22q11–12. gene, dishevelled 3, that is widely expressed in human tissues including brain was mapped earlier to 3q27.24,26 Discussion Dishevelled 3 was mapped by RHM to 3q21.3 between markers D3S1765 and D3S4136. Successful treatment in bipolar disorder with lithium Since primers derived from the 3Ј-UTR of the mRNA and abnormalities in neurodevelopment induced by for GSK3␤ were not selective for hamster genomic lithium may occur through perturbations in Wnt path- DNA, it was necessary to identify one of the intron- way signaling. Thus, establishing the fine location of exon boundaries and obtain the partial sequence of the genes encoding proteins of the Wnt pathway and intron for the design of selective primers. Using intron- determining if these genes map to chromosomal derived primers, GSK3␤ was linked by RHM to locus regions linked to bipolar susceptibility is an important D3S3620 at 3q21.1. GSK3␤ was previously mapped to aim. A precise assignment of the chromosomal position region 3q13.3–q21 by FISH.27 Alpha-catenin was of these genes will facilitate further genetic analysis mapped to marker D5S500, at 5q31.1, and ␦-catenin to involving association testing to investigate the relation- Radiation hybrid mapping of Wnt pathway genes AR Rhoads et al 440 ship between their polymorphism and disease as well determined by Nollet et al40 using FISH analysis. A as mutation scanning for disease-related variants. possible susceptibility locus for schizophrenia has also Wnt 7A is closely linked to an STS located on 3p25. been suggested for the 5q31 chromosomal region.41,42 Edenberg et al28 have found a modest increase in allele Inhibition of GSK3␤ by lithium may be the mech- sharing in the 3p region of affected sib-pairs with anism by which lithium interferes with development bipolar disorder from 97 families of the NIMH Genetics in many organisms, and suppresses the overt symp- Initiative. Thus Wnt 7A may be an interesting candi- toms of bipolar disorder.1,43 GSK3␤ was mapped to date gene for association. Wnt 7A is expressed in adult 3q21.1 about 200 cR away from the dishevelled 3 gene and fetal brain and in many other tissues.22 Involve- in a region that has yet to be linked to mental disorders. ment of Wnt 7A in axonal remodeling and in increases Interestingly, both lithium and insulin-like growth in synapsin I levels in cerebellar neurons suggest that factor-1 have recently been shown to reduce the pro- this protein may control synaptic remodeling which duction of hyperphosphorylated tau protein by GSK3␤ could result in changes in brain function such as in cultured neurons.44,45 Hyperphosphorylated tau is a mood disorders.29 primary component of paired helical filaments associa- Frizzled 3 which is expressed in highest levels in ted with Alzheimer’s disease and may contribute to adult brain7 was previously shown to be located within neuronal degeneration. the 2-Mb deletion region of chromosome band 7q11.23 ARVCF was previously mapped to 22q11 by FISH that was associated with the developmental disorder, and physical mapping.46 RHM links ARVCF to locus Williams syndrome (WS).30 The deleted sequence D22S1138 between 22q11 and 22q12. Anomalies in within chromosome band, 7q11.23, encodes frizzled 3 Armadillo repeat-containing genes during develop- that may contribute to the WS phenotype.30 RHM indi- ment may lead to dysmorphism and psychiatric illness. cated that frizzled 3 was most closely linked to a ARVCF is deleted in velo-cardio-facial syndrome marker D7S2101E, at 7q11.21. This linked marker was (VCFS)46 and a possible locus near the VCFS deletion located 40 cR from locus D7S672 that was more proxi- on chromosome 22 has been suggested for both bipolar mal to the telomeric end of chromosome 7q. Genes disorder47 and schizophrenia.48,49 The Armadillo- commonly deleted in Williams syndrome patients such repeat containing genes, ␤- and ␦-catenin, also show as elastin and LIM kinase are found near D7S672.31,32 altered regional distribution in schizophrenia.50 Axin Interestingly, a potential susceptibility locus at 7q11 which maps to 16p13.3 is within a region that showed has recently been reported for schizophrenia.33 This weak linkage signals with bipolar disorder under a relates to an emerging phenomenon indicating a poss- recessive model of inheritance51 and increased allele ible overlap of susceptibility regions for bipolar dis- sharing in another pedigree series.28 order and schizophrenia.33–37 Although not a comprehensive study of the genes Pizzuti et al24 mapped both dishevelled 1 and 3 to associated with the Wnt pathway that includes numer- loci 1p36 and 3q27, respectively. RHM results agreed ous isoforms of Wnt and frizzled genes, the mapped with the previous assignment of dishevelled 1, but dis- genes are representative of the different components of hevelled 3 was linked closer to the centromeric region the Wnt pathway. This approach of selecting candidate of chromosome 3q21.3. This difference may be due to genes that may have relevance to bipolar disorder resolution, errors in map construction or possibly involves analysis of genes in pathways known to be detection of homologous markers at different locations. perturbed by lithium. The Wnt signaling pathway may Further mapping with other sequence tags may support be more consequential than the inositol pathway in its the RHM assignment. Currently, there are no published response to lithium,1 and to our knowledge, the genetic reports implicating these regions in either bipolar dis- components of the Wnt pathway have not yet been order or schizophrenia. Both dishevelled genes are investigated in bipolar disorder. Our initial focus lies expressed in fetal and adult tissues that include brain, in determining the fine physical map of selected genes heart, skeletal muscle, kidney and lung. Charcot-Marie- through the use of a radiation hybrid panel.21 High res- Tooth types 2A and 2B map to chromosome 1p35–p36 olution mapping should provide vital information on and 3q13–q22, respectively, and both dishevelled 1 whether the gene maps to a chromosomal region and 3 map within these respective regions as noted involved in susceptibility to bipolar disorder. If so, previously.24 such a gene would be a priority candidate for associ- Mapping of ␦-catenin by RHM agreed with the pre- ation or mutational analysis. vious assignment by WICGR with the linked marker, D5S478 at 5p15.2, being flanked by loci D5S2571 at a distance of 4 cR and D5S2586 at 16 cR. Kelsoe et al38 References reported that the region, 5p15.3 near the dopamine 1 Klein PS, Melton DA. A molecular mechanism for the effect of lith- transporter may be a possible locus for bipolar dis- ium on development. Proc Natl Acad Sci USA 1996; 93: 8455– order. The ␦-catenin gene is located within the cri-du- 8459. chat region of chromosome 5. Clinical features of the 2 Berridge MJ, Downes CP, Hanley MR. Neural and developmental cri-du-chat syndrome have been localized to 5p15.2 actions of lithium: a unifying hypothesis. Cell 1989; 59: 411–419. and 5p15.339 suggesting ␦-catenin as a candidate gene 3 Klingensmith J, Nusse R. Signaling by wingless in Drosphila. Dev ␣ Biol 1994; 166: 396–414. associated with this syndrome. In the case of -catenin, 4 Nusse R, Varmus HE. Wnt genes. Cell 1992; 69: 1073–1087. RHM localized the gene to 5q31.1 within region 5q31 5 McMahon AP, Bradley A. The Wnt-1 (int-1) proto-oncogene is Radiation hybrid mapping of Wnt pathway genes AR Rhoads et al 441 required for development of a large region of the mouse brain. Cell the coding region of the glycogen synthase kinase-3␣ and ␤ iso- 1990; 62: 1073–1085. forms in patients with NIDDM. Diabetologia 1997; 40: 940–946. 6 Nusse R, Varmus HE. Many tumors induced by the mouse mam- 28 Edenberg HJ, Foroud T, Conneally PM, Sorbel JJ, Carr K, Crose C mary tumor viruses contain a provirus integrated in the same et al. Initial genomic scan of the NIMH genetics initiative bipolar region of the host genome. Cell 1982; 31: 99–109. pedigrees: chromosomes 3, 5, 15, 16, 17, and 22. Am J Med Genet 7 Wang Y, Macke JP, Abella BS, Andreasson K, Worley P, Gilbert DJ 1997; 74: 238–246. et al. A large family of putative transmembrane receptors homolo- 29 Lucas FR, Salinas PC. WNT-7a induces axonal remodeling and gous to the product of the Drosophila tissue polarity gene frizzled. increases synapsin I levels in cerebellar neurons. Dev Biol 1997; J Biol Chem 1996; 271: 4468–4776. 192: 31–44. 8 Yang-Synder J, Miller JR, Brown JD, Lai CJ, Moon RT. A frizzled 30 Wang YK, Samos CH, Peoples R, Perez-Jurado LA, Nusse R, homolog functions in a vertebrate Wnt signaling pathway. Curr Biol Francke U. A novel human homologue of the Drosphila frizzled 1996; 6: 1302–1306. Wnt receptor gene binds wingless protein and is in the Williams 9 Rattner A, Hsieh J-C, Smallwood PM, Gilbert DJ, Copeland NG, Jen- syndrome deletion at 7q11.23. Hum Mol Genet 1997; 6: 465–472. kins NA et al. Family of secreted proteins contains homology to 31 Wu YQ, Sutton VR, Nickerson E, Lupski JR, Potocki L, Korenberg the cysteine-rich ligand-binding domain of frizzled receptors. Proc JR et al. Delineation of the common critical region in Williams syn- Natl Acad Sci USA 1997; 94: 2859–2863. drome and clinical correlation of growth, heart defects, ethnicity, 10 Melkonyan HS, Chang WC, Shapiro JP, Mahadevappa M, Fitzpa- and parental origin. Am J Med Genet 1998; 78: 82–89. trick PA, Kiefer MC et al. SARPS: a family of secreted apoposis- 32 Robinson WP, Waslynka J, Bernasconi F, Wang M, Clark S, Kotzot related proteins. Proc Natl Acad Sci 1997; 94: 13636–13641. D et al. Delineation of 7q11.2 deletions associated with Williams- 11 Pai LM, Oursulic S, Bejsovec A, Peifer MK. Negative regulation of Beuren Syndrome and mapping of a repetitive sequence to within Armadillo, a wingless effector in Drosophila. Development 1997; and to either side of the common deletion. Genomics 1996; 34: 17–23. 124: 2255–2266. 33 Blouin J-L, Dombroski BA, Nath SK, Lasseter VK, Wolyniec PS, 12 Korinek V, Barker N, Morin PJ, van Wichen D, de Weger R, Kinzler Nestadt G et al. Schizophrenia susceptibility loci on chromosomes KW et al. Constitutive transcriptional activation by ␤-catenin-tcf 13q32 and 8p21. Nature 1998; 20: 70–73. complex in APC-/- colon carcinomas. Science 1997; 275: 1784– 34 Wildenauer DB, Hallmayer J, Schwab SG, Albus M, Eckstein GN, 1787. Zill P et al. Searching for susceptibility genes in schizophrenia by 13 Rubinfeld B, Robbins P, El-Gamil M, Albert I, Porfiri E, Polakis P. genetic linkage analysis. Cold Spring Harb Symp Quant Biol 1996; Stabilization of ␤-catenin by genetic defects in melanoma cell lines. 61: 845–850. Science 1997; 275: 1790–1792. 35 Rice JP, Goate A, Williams JT, Bierut L, Door D, Wu W et al. Initial 14 Kishida S, Yamamoto H, Ikeda S, Kishida M, Sakamoto I, Koyama genome scan of the NIMH genetics initiative bipolar pedigrees: S et al. Axin, a negative regulator of the Wnt signaling pathway, chromosomes 1,6,8,10 and 12. Am J Med Genet 1997; 74: 247–253. directly interacts with adenomatous polyposis coli and regulates 36 Faraone SV, Matise T, Svrakic D, Pepple J, Malaspina D, Suarez B the stabilization of ␤-catenin. J Biol Chem 1998; 273: 10823–10826. et al. Genome scan of European-American schizophrenia pedigrees: 15 Itoh K, Krupnik VE, Sokol SY. Axis determination in Xenopus results of the NIMH genetics initiative and millennium consortium. involves biochemical interactions of axin, glycogen synthase kinase Am J Med Genet 1998; 81: 290–295. 3 and beta-catenin. Curr Biol 1998; 8: 591–594. 37 Detera-Wadleigh SD, Badner JA, Berrettini WH, Yoshikawa T, Gol- 16 Risch N, Merikangas K. The future of genetic studies of complex din LR, Turner G et al. A high density genome scan detects evi- human diseases. Science 1996; 273: 1516–1517. dence for a bipolar disorder susceptibility locus on 13q32, and 17 Hauser ER, Boehnke M, Guo S-W, Risch N. Affected-sib-pair inter- other potential loci on 1q32 and 18p11.2. Proc Natl Acad Sci USA val mapping and exclusion for complex genetic traits: sampling 1999; (in press). considerations. Genetic Epidemiol 1996; 13: 117–137. 38 Kelsoe JR, Sadovnick AD, Kristbjarnarson H, Bergesch P, 18 Lander ES, Schork NJ. Genetic dissection of complex traits. Science Mroczkowski-Parder Z, Drennan M et al. Possible locus for bipolar 1994; 265: 2037–2048. disorder near the dopamine transporter on chromosome 5. Am J 19 Esterling LE, Cox Matise T, Sanders AR, Yoshikawa T, Overhauser Med Genet 1996; 67: 533–540. J, Gershon ES et al. An integrated physical map of 18p11.2: a sus- 39 Simmons AD, Goodart SA, Gallardo TD, Overhauser J, Lovett M. ceptibility region for bipolar disorder. Mol Psychiatry 1997; 2: Five novel genes from the Cri-Du-Chat critical region isolated by 501–504. direct selection. Hum Mol Genet 1995; 4: 295–302. 20 Boehnke M, Lange K, Cox DR. Statistical methods for multipoint 40 Nollet F, van Hengel J, Berx G, Molemans F, van Roy F. Isolation radiation hybrid mapping. Am J Hum Genet 1991; 49: 1174–1188. and characterization of a human pseudogene (CTNNAP1) and 21 Cox DR, Burmeister M, Price ER, Kim S, Myers RM. Radiation alpha E-catenin (CTNNA1): assignment of the pseudogene to 5q22 hybrid mapping: a somatic cell genetic method for constructing and the alpha E-catenin gene to 5q31. Genomics 1995; 26: 410–413. high resolution maps for mammalian chromosomes. Science 1990; 41 Schwab SG, Eckstein GN, Hallmayer J, Lerer B, Albus M, Borrmann 250: 245–250. M et al. Evidence suggestive of a locus on chromosome 5q31 con- 22 Ikegawa S, Kumano Y, Okui K, Fujiwara T, Takahashi E, Nakamura tributing to susceptibility for schizophrenia in German and Israeli Y. Isolation, characterization and chromosomal assignment of the families by multipoint affected sib-pair linkage analysis. Mol Psy- human WNT7A gene. Cytogenet Cell Genet 1996; 74: 149–152. chiatry 1997; 2: 156–160. 23 Abu-Jawdeh G, Comella N, Tomita Y, Brown L, Tognazzi K, Kocher 42 Straub RE, MacLean CJ, O’Neill FA, Walsh D, Kendler KS. Support O. Identification and characterization of fprHE, a novel stromal pro- for a possible schizophrenia vulnerability locus in region 5q22–31 tein of the frizzled gene family modulated during the endometrial in Irish families. Mol Psychiatry 1997; 2: 148–155. cycle and malignant transformation. FASEB J 1998; 12: 944. 43 Hedgepeth CM, Conrad LJ, Zhang J, Huang H-C, Lee VMY, Klein 24 Pizzuti A, Amati F, Calabrese G, Mari A, Colosimo A, Silani V et al. PS. Activation of the Wnt signaling pathway: a molecular mech- cDNA characterization and chromosomal mapping of two human anism for lithium action. Dev Biol 1997; 185: 82–91. homologues of the Drosphila dishevelled polarity gene. Hum Mol 44 Hong M, Lee VM. Insulin and insulin-like growth factor-1 regulate Genet 1996; 5: 953–958. tau phosphorylation in cultured human neurons. J Biol Chem 1997; 25 Greco TL, Sussman DJ, Camper SA. Dishevelled-2 maps to human 272: 19547–19553. chromosome 17 and distal to Wnt3A and vestigial tail(vt) on mouse 45 Munoz-Montano FR, Moreno FJ, Avila J, Diaz-Nido J. Lithium chromosome 11. Mammalian Genome 1996; 7: 475–476. inhibits Alzheimer’s disease-like tau protein phosphorylation in 26 Bui TD, Beirer DR, Jonssen M, Smith K, Dorrington SM, Kakla- neurons. FEBS Lett 1997; 411: 183–188. manis L et al. cDNA cloning of a human dishevelled DVL-3 gene, 46 Sirotkin H, O’Donnell H, DasGupta R, Halford S, Jore BS, Puech A mapping to 3q27, and expression in human breast and colon carci- et al. Identification of a new human catenin gene family member nomas. Biochem Biophys Res Commun 1997; 239: 510–516. (ARVCF) from the region deleted in velo-cardio-facial syndrome. 27 Hansen L, Arden KC, Rasmussen SB, Viars CS, Vestergaard H, Genomics 1997; 41: 75–83. Hansen T et al. Chromosomal mapping and mutational analysis of 47 Lachman HM, Kelsoe JR, Remick RA, Sadovnick AD, Rapaport MH, Radiation hybrid mapping of Wnt pathway genes AR Rhoads et al 442 Lin M et al. Linkage studies suggest a possible locus for bipolar 22q12. Schizophrenia Collaborative Linkage Group (Chromosome disorder near the velo-cardio-facial syndrome region on chromo- 22). Am J Med Genet 1996; 67: 40–45. some 22. Am J Med Genet 1997; 74: 121–128. 50 Cotter D, Kerwin R, al-Sarraji S, Brion JP, Chadwich A, Lovestone 48 Bassett AS, Hodgkinson K, Chow EWC, Correia S, Scutt LE, S et al. Abnormalities of Wnt signalling in schizophrenia—evi- Weksberg R. 22q11 Deletion syndrome in adults with schizo- dence for neurodevelopmental abnormality. Neuroreport 1998; 9: phrenia. Am J Med Genet 1998; 81: 328–337. 1379–1383. 49 Gill M, Vallada H, Collier D, Sham P, Holmans P, Murray R et al.A 51 Ewald H, Mors O, Flint T, Koed K, Eiberg H, Kruse TA. A possible combined analysis of D22S278 marker alleles in affected sib-pairs: locus for manic depressive illness on chromosome 16p13. Psychiatr support for a susceptibility locus for schizophrenia at chromosome Genet 1995; 5: 71–81.