Knockdown of PAK4 Or PAK1 Inhibits the Proliferation of Mutant KRAS Colon Cancer Cells Independently of RAF/MEK/ERK and PI3K/AKT Signaling

Published OnlineFirst December 10, 2012; DOI: 10.1158/1541-7786.MCR-12-0466

Molecular Cancer Cell Cycle and Senescence Research

Knockdown of PAK4 or PAK1 Inhibits the Proliferation of Mutant KRAS Colon Cancer Cells Independently of RAF/MEK/ERK and PI3K/AKT Signaling

Hana Tabusa, Teresa Brooks, and Andrew J. Massey

Abstract The p21-activated kinase (PAK) serine/threonine kinases are important effectors of the small GTPases Rac and Cdc42, and play signiﬁcant roles in controlling cell growth, motility, and transformation. Knockdown of PAK4 or PAK1 inhibited the proliferation of mutant KRAS or BRAF colon cancer cells in vitro. Dependence on PAK4 or PAK1 protein for colon cancer cell proliferation was independent of PAK4 or PAK1 protein expression levels. Mutant KRAS HCT116 colorectal cells were the most sensitive to PAK4 or PAK1 knockdown resulting in the potent inhibition of anchorage-dependent and -independent proliferation as well as the formation and proliferation of HCT116 colon cancer spheroids. This inhibition of proliferation did not correlate with inhibition of RAF/MEK/ ERK or PI3K/AKT signaling. In HCT116 cells, knockdown of PAK4 or PAK1 caused changes to the actin cytoskeleton resulting in reduced basal spread and cell elongation and increased cell rounding. These cytoskeletal rearrangements seemed to be independent of LIMK/coﬁlin/paxillin phosphorylation. PAK4 or PAK1 knockdown initially induced growth arrest in HCT116 cells followed by cell death at later time points. Inhibition of the

antiapoptotic proteins Bcl-2 and Bcl-XL with the pharmacologic inhibitor ABT-737 increased effector caspase activation and apoptosis, and reduced cell survival with PAK4 or PAK1 knockdown. These results support a role for the PAKs in the proliferation of mutant KRAS-driven colorectal carcinoma cells via pathways not involving RAF/MEK/ERK and PI3K/AKT signaling. Mol Cancer Res; 11(2); 109–21. 2012 AACR.

Introduction adhesion (7), and promotion of cell migration (8–10) and The p21-activated kinases (PAK) are members of the anchorage-independent growth (11, 12). Changes to PAK1 STE20 family of serine/threonine kinases. In mammalian mRNA, protein and activity have been reported in variety of cells, 6 PAK isoforms have been identified and subclassified human malignancies including bladder (13), breast (14), into 2 families: group I (PAK1-3) and group II (PAK4-6) colorectal (15), and ovarian carcinoma (16). Overexpression based on their sequence homology but also on the presence of a kinase-activated mutant form of PAK1 induced the of an inhibitory region present in group I but not group II anchorage-independent growth of breast cell lines in vitro PAKs (1, 2). The PAKs function as major downstream and breast carcinomas when transgenically expressed in the mouse mammary gland albeit with a long latency (17). effectors of the Rho family of small GTPases such as Rac fi fi and Cdc42 (3, 4), and therefore play a major role in PAK1 genomic ampli cation has been identi ed as prevalent in luminal breast cancer, whereas strong nuclear and cyto- modulating changes to the actin cytoskeleton organization – and dynamics, thereby controlling cell shape and motility in plasmic PAK1 expression was prevalent in squamous non response to extracellular stimuli. PAK1 and PAK4 have been small cell lung carcinomas (NSCLCs; ref. 14). Selective implicated in a number of cellular processes critical for targeting of PAK1 with short hairpin RNA (shRNA) inhibited breast and NSCLC cell proliferation in vitro and in vivo. oncogenic transformation including protection from apo- – ptosis and programmed cell death (5, 6), inhibition of cell Pharmacologic inhibition of X chromosome linked inhibitor of apoptosis (XIAP) increased effector capsase activation and apoptosis in NSCLC cells following PAK1 knockdown (14). Authors' Affiliation: Department of Oncology, Vernalis R&D Ltd., Granta fi Park, Cambridge, United Kingdom PAK4 upregulation has been identi ed in a variety of human cancer cell lines and amplification of the chromo- Note: Supplementary data for this article are available at Molecular Cancer Research Online (http://mcr.aacrjournals.org/). some region containing PAK4 has been frequently observed in pancreatic (18), colorectal (19), and ovarian cancer (20). Corresponding Author: Andrew J. Massey, Department of Oncology, Vernalis R&D Ltd., Granta Park, Cambridge, CB21 6GB, United Kingdom. Overexpression of a kinase-activated mutant form of PAK4 Phone: 44-1223-895555; Fax: 44-1223-895556; E-mail: transforms NIH-3T3 cells facilitating anchorage-indepen- [email protected] dent growth and tumor formation in nude mice (7, 11). doi: 10.1158/1541-7786.MCR-12-0466 PAK4 knockdown has an opposing effect on cell transfor- 2012 American Association for Cancer Research. mation. Oncogenic Ras-dependent transformation was

www.aacrjournals.org 109

Tabusa et al.

severely attenuated in PAK4 / mouse embryonic fibroblast than 6 months after resuscitation. HCT116 cells were cells, which were also resistant to tumor formation by an routinely cultured in Dulbecco's modified Eagle's medium oncogenic variant of the upstream activator Cdc42 (DMEM) containing 10% fetal calf serum (FCS) and fi (Cdc42V12; refs. 19, 21). Nuclear and cytoplasmic PAK4 penicillin/streptomycin at 37 C in a 5% CO2-humidi ed and pPAK4 overexpression were observed in ovarian cancer atmosphere. cell lines both in vitro and in vivo. Targeted shRNA-mediated knockdown of PAK4 inhibited the migration, invasion, Compounds and proliferation of these ovarian cell lines and their tumor- ABT-737 was purchased from Selleck Chem and dis- igenesis in nude mice (20). solved in dimethyl sulfoxide (DMSO) as a 20-mmol/L stock. Mutation of KRAS is a common, early event in the adenoma to carcinoma transition in colorectal cancer. KRAS Immunoblotting mutations have been identified in around 40% of human Anti-PAK1, PAK2, PAK4, glyceraldehyde-3-phosphate primary cancers (22) and 53% of colorectal cancer cell lines. dehydrogenase (GAPDH), pMEK1 (S298), pMEK1 (S217/ KRAS mutation, and the resulting activation, activates both 221), pERK (T202/Y204), cyclin D, pRAF-1 (S338), pCo- mitogen-activated protein kinase (MAPK) and phosphoi- filin (S3), pLIMK (T508), pPaxillin (T118), Actin, PARP, nositide 3-kinase (PI3K) signaling pathways. In colorectal pAKT (S473), pGSK3b (S9), and caspase-3 antibodies were carcinoma, overexpression of both PAK1 and PAK4 has purchased from Cell Signaling Technologies. been identified in primary human cancers and cancer cell Cells were washed once with PBS and lysed in radio- lines (15, 19). PAK1 overexpression was found to correlate immunoprecipitation assay (RIPA) buffer containing protease with lower survival rates in patients with colorectal cancer and phosphatase inhibitor cocktails (Roche). Protein concen- (23). PAK1 and PAK4 have been shown to phosphorylate tration was determined using BCA Kit (Pierce). Equal RAF-1 and mitogen-activated protein/extracellular signal– amounts of lysate were separated by SDS-PAGE and Western regulated kinase (MEK), and facilitate signaling through the blot analysis conducted using the antibodies indicated earlier. Ras/RAF/MAPK signaling pathways (3, 24, 25) and the dependence on PAK4 versus PAK1 for malignant transfor- RNAi and transfection mation and cell proliferation may be cell type or context RNA interference (RNAi) specific to PAK4 (Hs_PAK4_5 dependent. In mutant KRAS-driven HCT116 cells, over- UACAUCUCCACCACAUUCUCG, Hs_PAK4_6 UUC- expression of a kinase dead mutant form of PAK4 severely CUCUUCCCAAACAUGGTG, Hs_PAK4_11 UUCUU- abrogated the anchorage-independent growth of this cell line GACGGCCACCAGCUTG and Hs_PAK4_12 UUGUG- (11). A small-molecule inhibitor of PAK4, PF-3758309, CAGGUUCUUCAGUCGG) and PAK1 (Hs_PAK1_6 G- potently inhibited the proliferation of a range of human UAAUUCACAAUGUUUGGGTT, Hs_PAK1_7 UCUC- cancer cell lines including multiple colon cancer cell lines UGGCCGCUCUUUCUCTT, Hs_PAK1_8 UUAGGU and modulated numerous known PAK4-dependent signal- GCAGCAAUCAGUGGA and Hs_PAK1_9 UUCA- ing nodes (26). Knockdown of PAK1 in DLD1 cells with a GUUGCAGUUCUCUUCAA) were purchased from Qia- specific shRNA inhibited cell migration, invasion, and gen as were AllStars negative control RNAi and AllStars Hs proliferation in vitro via extracellular signal–regulated kinase cell death control RNAi. A total of 1.5 105 HCT116 cells (ERK)- and AKT-dependent pathways (27). Likewise, per well of a 6-well plate were transfected using Lipofecta- knockdown of PAK1 in HCT116 colon carcinoma cells mine RNAiMAX (Inivtrogen) in OptiMEM (Invitrogen) inhibited b-catenin expression and transcriptional activity, according to the manufacturer's protocol. and inhibited colon cancer growth in vivo (28). We used the KRAS mutant colon carcinoma cell line Cell proliferation and survival assays HCT116 as a model to investigate and define the role of HCT116 cells were seeded in 96-well plates at a density of PAK4 and PAK1 in the proliferation and survival of mutant 1 104 cells per well in DMEM containing 10% FCS for 72 KRAS colon carcinoma cells and investigate the downstream or 96 hours posttransfection. Cell viability was determined pathways through which PAK4 and PAK1 exert their onco- using a CellTiter-Glo Luminescent Cell Viability Assay genic effects. The interplay between PAK1 and PAK4, and (Promega). For colony formation assays, HCT116 cells were the subsequent reliance on these 2 kinases for cellular growth trypsinized 24 hours after transfection and plated in 6-well and survival, was further investigated. Combination studies plates at 200 to 2,000 cells per well. Colonies were allowed to fi fi identi ed small-molecule antagonists of Bcl-2/Bcl-XL as form for 10 days at 37 C in a 5% CO2 humidi ed atmo- potentiators of cell death following PAK inhibition. In this sphere, fixed, and stained with crystal violet in formaldehyde study, we show the importance of PAK4 and PAK1 in colon and counted. Viable colonies were determined as those cancer proliferation through pathways that are apparently containing 50 cells or more. For anchorage-independent independent of RAF/MEK/ERK and PI3K/AKT signaling. growth assays, HCT116 cells were trypsinized 24 hours after transfection and plated in 24-well plates at 200 to 2,000 Materials and Methods cells per well in 0.4% low melting point agarose on a layer of Cell lines and cell culture 0.6% agarose in media containing 10% FCS. The agarose All cell lines were purchased from the American Type layers were subsequently overlayed with 1 mL of DMEM Culture Collection and passaged in our laboratory for less containing 10% FCS and incubated at 37Cina5%

110 Mol Cancer Res; 11(2) February 2013 Molecular Cancer Research

PAK4 and PAK1 Knockdown Inhibits Colon Cancer Cell Proliferation

fi CO2-humidi ed atmosphere for 14 days. Colonies were mutant (HCT116, SW620, DLD1, and SW480) or BRAF stained using MTT reagent (Sigma) and counted. mutant (HT29, Colo205, and RKO) colon carcinoma cell lines. Knockdown of PAK4 resulted in a 43% to 89% Spheroid growth assays reduction (P < 0.001) in cell proliferation in 6 of 7 cell Multicellular tumor spheroid assays were conducted lines (Fig. 1A). Conversely, knockdown of PAK1 reduced essentially as described previously (29). A total of 1 cell proliferation by 45% to 50% (P < 0.001) in 2 of 7 cell 103 HCT116 cells per well in DMEM containing 10% lines. Simultaneous knockdown of PAK4 and PAK1 did not FCS were seeded in 96-well round-bottomed ultra-low decrease the cell proliferation beyond that seen with knock- attachment microplates (Corning Costar), centrifuged at down of PAK4 alone in all 7 colon cancer cell lines (data not 1,000 g for 3 minutes and allowed to form into spheroids shown). Mutant KRAS HCT116 cells exhibited the greatest at 37 C in a 5% CO2 incubator for 72 hours. Spheroid cell sensitivity to either PAK4 or PAK1 knockdown, and so the viability was determined using a CellTiter-Glo Luminescent effect of PAK4 or PAK1 knockdown using specificRNAi Cell Viability Assay (Promega) and imaged using a Zeiss oligonucleotides on the proliferation of this cell line was Axiovert 200 microscope and 10 or 20 objective. Colo- investigated in more detail under anchorage-dependant nospheres were cultured essentially as described earlier (30). growth conditions. Knockdown of PAK4 inhibited the HCT116 cells were cultured in DMEM containing B27 proliferation of HCT116 cells up to 95% (P < 0.001), supplement (Invitrogen) plus EGF and fibroblast growth whereas knockdown of PAK1 inhibited proliferation up to factor (FGF; Invitrogen). 80% (P < 0.001) after 96 hours transfection (Fig. 1B). Transient knockdown of PAK4 but not PAK1 for 72 hours Immunofluorescence microscopy produced a small but significant (P < 0.05 compared with A total of 1 104 HCT116 cells/chamber were seeded in nontargeting RNAi) reduction in cell proliferation (Fig. 1C). 8-chamber glass slides. Following fixation with formalde- Increasing the transient knockdown to 96 hours significantly hyde and permeabilization, F-actin was selectively labeled increased the inhibition of cell proliferation by both PAK4- with an Alexa Fluor 488–labeled phalloidin (Invitrogen). and PAK1-targeting RNAi (P < 0.001). RNAi-mediated Cells were subsequently imaged using a Zeiss Axiovert 200 knockdown of PAK4 with Hs_PAK4_6 reduced cell pro- microscope and 40 objective. liferation by 46% at 72 hours to 97% after 96 hours and PAK1 knockdown with Hs_PAK1_7 by 14% at 72 hours to 7-Aminoactinomycin D (7-AAD) cell viability assay 85% at 96 hours. RNAi-transfected cells were harvested by trypsinization, Assessment of the ability of PAK4 or PAK1 RNAi to washed once with PBS, and stained with 7-AAD for 10 inhibit the colony forming ability of HCT116 cells was minutes at room temperature in the dark. Viable (7-AAD- also assessed. Knockdown of PAK4 reduced HCT116 negative) and dead (7-AAD-positive) cell populations were colony forming ability by 97%, whereas PAK1 knock- quantitated by flow cytometry using a FACSArray flow down reduced it by 74% (P < 0.001, Fig. 1D). The cytometer. reduction of PAK4 or PAK1 protein resulted in the initial inhibition of cell proliferation as evidenced by the small Flow cytometry increase in 7-AAD-positive cells after 72-hour incubation RNAi-transfected HCT116 cells were harvested by tryp- with specific RNAi (Fig. 1E). Increasing the incubation sinization, washed, and fixed in ice-cold 70% ethanol before time from 72 to 96 hours resulted in increased cell death. being stained with propidium iodide (PI) containing RNase For example, with the PAK4-specific RNAi PAK4_6, the A. Cell-cycle profiles were collected on a FACSArray flow fraction of 7-AAD-positive cells increased from 23.5% at cytometer and analyzed with FACSDiva software (Becton 72 hours to 52.6% at 96 hours. Simultaneous knockdown Dickinson). of PAK4 and PAK1 did not dramatically decrease the proliferation of HCT116 cells beyond that induced by Growth in 3-dimensional culture conditions PAK4 knockdown alone (Fig. 1C, D, and F). To deter- HCT116, HT29, and DLD1 cells were grown in DMEM mine the effect of PAK4 or PAK1 protein depletion on the containing 10% FCS in 12-well Alvetex plates (Reinnervate) cell cycle, the cell-cycle profile of HCT116 cells was or 6-well AlgiMatrix plates (Invitrogen) according to the determined 72 or 96 hours after transfection with specific manufacturer's recommended protocol. RNAi. Knockdown of PAK4 or PAK1 reduced the fraction of cells in G1 and increased the fraction of cells with Statistical analysis sub-G1 DNA content (Fig. 1G and Supplementary Fig. Results were analyzed using a Student t test tool within the S1). The effect of PAK protein knockdown on the fraction data analysis package provided by Microsoft Excel. of sub-G1 cells was time dependent. The percentage of sub-G1 cells increased following a 96-hour incubation Results with specific RNAi as compared with 72-hour incubation. PAK4 is required for the proliferation of colon carcinoma DespiteknockingPAK4orPAK1proteinlevelsdowntoa cells in vitro in anchorage-dependant culture similar extent as the other 3 targeted RNAis, 1 RNAi The role of PAK4 and PAK1 in the proliferation of colon targeting PAK4 (PAK4_5) and 1 targeting PAK1 carcinoma cells in vitro was evaluated in a panel of KRAS (PAK1_6) exhibited a reduced effect on HCT116 cell

www.aacrjournals.org Mol Cancer Res; 11(2) February 2013 111

Tabusa et al.

Figure 1. Knockdown of PAK4 reduces the proliferation of mutant KRAS or BRAF colon carcinoma cells in vitro. A, proliferation of a panel of colon cancer cell lines following transfection with speciﬁc RNAi oligonucleotides to PAK4 (PAK4_6) or PAK1 (PAK1_7) was determined using CellTiter-Glo 96 hours after transfection. Values are normalized against the scrambled RNAi-negative control. , P < 0.01. B, proliferation of HCT116 colon carcinoma cells transfected with speciﬁc RNAi oligonucleotides to PAK4 or PAK1 was determined by CellTiter-Glo 96 hours after transfection. C, the time dependence of PAK inhibition on

112 Mol Cancer Res; 11(2) February 2013 Molecular Cancer Research

PAK4 and PAK1 Knockdown Inhibits Colon Cancer Cell Proliferation

Figure 2. Expression levels of PAK1 or PAK4 do not correlate with growth inhibition sensitivity to knockdown. Protein expression levels of various PAK isoforms in human cancer cell lines were determined by immunoblot analysis. Colon carcinoma cell lines are indicated with an arrow.

proliferation in the Cell Titer Glo assay compared with the Inhibition of proliferation of HCT116 colon carcinoma other RNAis (Fig. 1B and C). Hs_PAK4_5 RNAi, how- cells by PAK4 or PAK1 RNAi is independent of RAF/ ever, was able to reduce the colony forming ability of MEK/ERK signaling HCT116 cells by 84% (Fig. 1D). The reason for the Previous studies have shown an association between the reducedactivityofthese2RNAiswasnotapparentand PAKs and the RAF/MEK/ERK and PI3K/AKT signaling was not investigated further. pathways. To assess the mechanism by which PAK4 or PAK1 contribute to HCT116 colon carcinoma cell prolif- Expression levels of PAK1 or PAK4 do not correlate with eration, we examined the effect of transient RNAi-mediated growth inhibition sensitivity to knockdown knockdown of PAK4 or PAK1 on RAF/MEK/ERK and PAK1andPAK4amplification has been identified in a PI3K/AKT signaling. The 4 RNAi-targeting PAK4 efficient- range of human cancer types namely breast, colon, ly reduced PAK4 protein levels with minimal effect on PAK1 ovarian, and NSCLC for PAK1 and pancreatic, colon, protein levels. Likewise, the 4 RNAi-targeting PAK1 effi- and ovarian cancer for PAK4. The protein expression ciently reduced PAK1 protein levels with minimal effect on levels of PAK1, 2 or PAK4 in whole-cell lysates from a PAK4 protein levels (Fig. 3A and Supplementary Fig. S2). range of solid human cancer cell lines was assessed by The effects of PAK1 or PAK4 knockdown on RAF, MEK, immunoblotting (Fig. 2). The expression levels of the 3 ERK, and AKT phosphorylation were not consistent across PAK isoforms varied across the panel of 14 solid cancer the 4 RNAi oligonulceotides used and did not result in cell lines studied. In the 5 colon cancer cell lines in the consistent changes to cyclin D levels. Reduction in PAK4 panel (Colo205, DLD1, HCT116, HT29, and SW620), protein levels resulted in a reduction in cyclin D protein no consistent expression profile was evident. All of the levels with 1 RNAi, an increase with another RNAi and no colon cancer cell lines had detectable levels of PAK1 and change with 2 additional RNAis (Fig. 3A). Following PAK4 though the levels of PAK4 were low in the knockdown of PAK1, cyclin D levels were reduced with Colo205 and DLD1 cell lines. With the exception of 3 oligonucleotides and induced by a fourth. These changes in the A549 and MDA-MB-453 tumor lysates, the expres- cyclin D protein levels did not correlate with suppression of sion levels of PAK2 seemed relatively consistent across the cell proliferation. In HCT116 cells, the cellular phenotype panel of cell lines. MDA-MB-453 had noticeably higher associated with knockdown of PAK4 seemed to predominate expression levels of PAK2 but had virtually no detectable over PAK1 (Fig. 3B). Suppression of PAK4 protein expres- levels of PAK1 or PAK4. No correlation between inhi- sion following transfection of HCT116 cells with the specific bition of proliferation by PAK4- or PAK1-specificRNAi RNAi PAK4_6 was observed to at least 120 hours post- and expression levels of PAK4 or PAK1 protein was transfection. Likewise, transfection of HCT116 cells with evident. the PAK1-specific RNAi PAK1_7 suppressed PAK1 protein

HCT116 cell proliferation (as measured using CellTiter-Glo) was determined 72 or 96 hours after transfection. D, proliferation and survival of HCT116 cells following knockdown of PAK4 or PAK1 was measured using colony formation 10 days after transfection. E, the number of viable HCT116 cells following PAK4 or PAK1 knockdown was determined by 7-AAD staining of unfixed cells 72 or 96 hours after transfection. F, proliferation and survival of HCT116 cells following combinatorial knockdown of PAK4 or PAK1 was measured using CellTiter-Glo 96 hours after transfection. The values are the mean of at least 6 determinations SD. G, cell-cycle changes associated with knockdown of PAK4 or PAK1. HCT116 cells were transfected with specific olignucloetides to PAK4 or PAK1 for 72 hours. The cell-cycle profile was determined by PI staining and flow cytometry. ve, AllStars negative control RNAi; þve, AllStars Hs cell death control RNAi. , P < 0.001.

www.aacrjournals.org Mol Cancer Res; 11(2) February 2013 113

Tabusa et al.

expression for at least 120 hours posttransfection (Fig. 3C). subsequent cell migration, proliferation, and invasion. In summary, the effect of PAK4 and PAK1 on HCT116 cell Knockdown of either PAK4 or PAK1 with specificRNAi proliferation seems to not be mediated via the RAF-1/MEK oligonucleotides induced a reduction in the basal spread area dependent control of cyclin D protein levels. PAK4 and of cells and a concomitant increase in cell rounding (Fig. 4A). PAK1 seem to drive cell proliferation via additional, as yet Furthermore, PAK4 or PAK1 reduced the amount of unidentified, mechanisms that are independent of the RAF/ HCT116 cell elongation compared with those treated with MEK/ERK and PI3K/AKT signaling pathways. a control RNAi. The LIMK/cofilin/paxillin pathway plays a key role in controlling actin dynamics and subsequent PAK4 or PAK1 knockdown modulates actin cytoskeletal cytoskeletal rearrangements. Modulation of actin dynamics rearrangements but not via the LIMK and paxillin through PAK4-dependent cofilin phosphorylation has been signaling pathways. shown to affect cell migration and polarization and thereby The PAKs have been associated with the regulation of the cell proliferation in a variety of human cancer cell types actin cytoskeleton in normal and cancer cells (21). PAKs are (8, 20). In HCT116 cells, the observed F-actin rearrange- the major effectors of the small Rho GTPases Rac1 and ments (as determined by phalloidin staining) induced by Cdc42, which play critical roles in cell morphology, and knockdown of PAK4 or PAK1 did not correlate with

Figure 3. Inhibition of proliferation of HCT116 colon carcinoma cells by PAK4 or PAK1 RNAi is independent of RAF/MEK/ERK signaling. HCT116 cells were transfected with speciﬁc RNAi oligonucleotides to PAK4 or PAK1 (A), or combinations of PAK4 plus PAK1 (B), and changes to signaling pathways determined by immunoblot analysis 48 hours after transfection. C, the duration of PAK4 or PAK1 knockdown was evaluated in HCT116 cells transfected with the speciﬁc RNAi oligonucleotides PAK4_6 or PAK1_7 for up to 5 days.

114 Mol Cancer Res; 11(2) February 2013 Molecular Cancer Research

PAK4 and PAK1 Knockdown Inhibits Colon Cancer Cell Proliferation

Figure 4. PAK4 or PAK1 knockdown alters actin cytoskeletal arrangements in HCT116 colon cancer cells. A, HCT116 cells were transfected with specific RNAi oligonucleotides to PAK4 (PAK4_6) or PAK1 (PAK1_7) for 48 hours. Fixed cells were stained with fluorescent phalloidin to detect F-actin andimagedusinga40 objective. Enlarged sections of the image (as defined by the white box) are shown later. Changes to the phosphorylation levels of components of the LIMK signaling pathway were determined by immunoblotting 48 hours after transfection with oligonucleotides specificto PAK4 or PAK1 (B) or in combination (C).

www.aacrjournals.org Mol Cancer Res; 11(2) February 2013 115

Tabusa et al.

decreased cofilin phosphorylation on serine 9 or paxillin on (AlgiMatrix). Anchorage-independent growth-modulated tyrosine 118 (Fig. 4B). Combinatorial knockdown of PAK4 MEK/ERK and LIMK signaling compared with anchor- and PAK1 resulted in the same changes to cofilin and paxillin age-dependent growth that was cell line and culture system phosphorylation as the single gene knockdowns (Fig. 4C). dependent (Fig. 6). For HCT116 cells, growth as spheroids, In HCT116 colon carcinoma cells, control of the actin colonospheres, or in AlgiMatrix resulted in a reduction in cytoskeleton by PAK4 and PAK1 does not seem to proceed MEK1 S298 phosphorylation, but only under the AlgiMa- via the LIM kinase (LIMK) and paxillin signaling pathways. trix and spheroid growth conditions did this result in a decrease in cyclin D levels (Fig. 6). Conversely, growth in PAK4 and PAK1 are essential for HCT116 colon cancer AlgiMatrix but none of the other anchorage-independent cell proliferation in anchorage-independent culture systems dramatically induced phospho-cofilin in HCT116 The PAKs have been shown to have a clear role in cells. Growth on the Alvetex scaffold reduced protein cytoskeletal remodeling, cell motility and invasion, and the expression levels of both PAK4 and PAK1 in HCT116 and promotion of anchorage-independent growth. Given the DLD1 cells. This reduction in PAK protein levels, however, increased cell–cell interactions in 3-dimensional culture had little effect on MEK1 S298 and ERK T202/Y204 (anchorage-independent culture), we postulated that cancer phosphorylation and cyclin D levels. Despite differences in cells may be more PAK dependent under these growth MEK and cofilin phosphorylation, and cyclin D levels, conditions. To examine the role of PAK4 and PAK1 on HCT116 cells remained sensitive under 3-dimensional anchorage-independent survival, mutant KRAS HCT116 culture conditions to growth inhibition following PAK4 or cells were transiently transfected with RNAi oligonucleo- PAK1 knockdown. This provides additional evidence to tides specific to either PAK4 or PAK1 before being plated in suggest that PAK4 and PAK1 drive colon cancer cell pro- low melting point agarose. Knockdown of PAK4 or PAK1 liferation through additional pathways independently of inhibited the anchorage-independent proliferation and sur- RAF/MEK/ERK. vival of HCT116 colon cancer cells growing in low melting point agarose (Fig. 5A). PAK4 knockdown reduced Bcl-2/Bcl-XL inhibition potentiates cell killing following HCT116 cell survival by 88.3%, whereas knockdown of PAK inhibition PAK1 was less effective reducing cell survival by 65.4% (P < ABT-737 is a small-molecular antagonist of the prosurvi- 0.001%) compared with the negative control, scrambled val Bcl-2, Bcl-XL, and Bcl-w but not Mcl-1 proteins. It RNAi. Dual knockdown of PAK4 plus PAK1 did not mimics the proapoptotic BH3 proteins through binding to dramatically reduce cell survival compared with PAK4 the proapoptotic Bcl-2 homology domain (BH3) groove on knockdown alone. the Bcl-2 family proteins thereby inhibiting their prosurvival Multicellular tumor spheroids more closely resemble the activity. As a single agent, ABT-737 induces apoptosis in a avascular regions of human tumors with respect to their limited number of tumor types (31, 32). However, ABT- morphologic and histopathologic features than the same cell 737 (and the closely related analog ABT-263) has been line grown anchorage dependently. Tumor cells from such shown to enhance the apoptotic potential of a range of novel- spheroids assemble an appropriate extracellular matrix along targeted therapeutics and cytotoxic chemotherapeutics. with complex cell–cell and cell–matrix interactions as well as Knockdown of PAK4 or PAK1 with RNAi induced a oxygen and pH gradients in larger spheroids (29). Knock- small increase in apoptotic HCT116 cells as measured by an down of PAK4 or PAK1 did not inhibit the formation of increase in cleaved caspase-3 and -7 (Fig. 7A and C), cleaved HCT116 colon cancer spheroids. However, spheroids PARP (Fig. 7C), and PI staining tumor spheroid cells (Fig. formed from HCT116 cells lacking either PAK4 or PAK1, 7E) compared with cells transfected with scrambled RNAi. and especially those lacking both PAK4 and PAK1, appeared Addition of ABT-737 to HCT116 cells transfected with less compacted and the extracellular matrix supporting the PAK4 or PAK1 RNAi increased (P < 0.001) the levels of spheroid less well organized (Fig. 5B). Knockdown of PAK4 activated caspase-3 and -7 (Fig. 7A). This increased activa- reduced spheroid cell growth, as evidenced by the reduction tion of caspase-dependent apoptosis by ABT-737 resulted in in total ATP content of the spheroid, by 79% and PAK1 by a decrease in HCT116 survival. Following the knockdown 52% (Fig. 5C; P < 0.001 compared with control RNAi). The of PAK4, HCT116 cell survival was reduced from 54% to effect on spheroid cell proliferation following PAK knock- 20% (P < 0.001) in the presence of ABT-737 (Fig. 7B). down seemed independent of FCS concentration. Likewise, ABT-737 in combination with the knockdown of We evaluated further the effect of growing colon cancer PAK1 resulted in a reduction in HCT116 cell survival from cells in a variety of 3-dimensional culture systems on 90% to 42% (P < 0.001). The decreased cell viability signaling pathways postulated to be PAK dependent. A induced by the combination of either PAK4 or PAK1 RNAi comparison of MEK/ERK and cofilin signaling was made with ABT-737 resulted in an induction of apoptosis as between (i) normal anchorage-dependent growth on cell measured by an increase in PARP and caspase-3 cleavage culture plastic plates; (ii) anchorage-independent growth as by immunoblotting (Fig. 7C). multicellular colon tumor spheroids [MCTS in media pos- In multicellular tumor spheroids deficient in either PAK4 tulated to increase the stem cell such as properties of the cells or PAK1, treatment with ABT-737 resulted in a small but (colonospheres)], on a highly porous polystyrene scaffold significant decrease (P < 0.001) in the fraction of viable cells (Alvetex); and (iii) embedded in a porous alginate gel within the tumor spheroid (Fig. 7D). ABT-737 treatment

116 Mol Cancer Res; 11(2) February 2013 Molecular Cancer Research

PAK4 and PAK1 Knockdown Inhibits Colon Cancer Cell Proliferation

Figure 5. PAK4 and PAK1 are essential for HCT116 colon cancer cell proliferation in anchorage-independent culture. A, HCT116 cells were transfected with RNAi oligonucleotides speciﬁc to PAK4 (PAK4_6) or PAK1 (PAK1_7) for 24 hours before being replated in low melting point agarose. Colonies were allowed to form for 14 days before being stained with MTT and counted. Values are the mean of 3 determinations SD. , P < 0.001 compared with ve control RNAi. B, HCT116 colon cancer cells were transfected with speciﬁc RNAi oligonucleotides to PAK4 or PAK1 for 24 hours before being transferred to round-bottomed, low-adherence 96-well plates containing 1% or 10% FCS. Spheroids were allowed to form for a further 72 hours before being imaged under a Zeiss Axiovert microscope. C, cell viability was determined using CellTiter-Glo and normalized to the untreated (UT) control 72 hours after transfection. The values are the mean of 8 determinations SD. , P < 0.001. Scale bar, 100 mm.

www.aacrjournals.org Mol Cancer Res; 11(2) February 2013 117

Tabusa et al.

Figure 6. Growth in 3-dimensional culture conditions modulates PAK signaling pathways in colon cancer cell lines. HCT116, HT29, or DLD1 colon cancer cells were grown in 2-dimensional culture attached to cell culture plastic plates or in a variety of 3-dimensional culture systems—multicellular colon tumor spheroids, colon cancer stem cell-like spheroids (colonospheres), attached to Alvetex scaffold, or embedded in AlgiMatrix. Protein expression changes from whole-cell extracts were determined by immunoblot analysis.

reduced the fraction of viable cells from 26% to 17% low melting point agarose of HCT116 colon cancer cells as following PAK4 knockdown and from 75% to 40% fol- well as the growth and formation of multicellular colon lowing PAK1 knockdown. Cell death following combina- cancer spheroids. Under all growth conditions studied, torial knockdown of PAK4 with PAK1 was not increased knockdown of PAK4 had a greater inhibitory effect on cell beyond that of the single gene knockdowns. This increased proliferation than knockdown of PAK1. Inhibition of pro- cell death following ABT-737 of PAK4 or PAK1 RNAi- liferation occurred at an earlier time point following PAK4 treated spheroids was confirmed by PI staining of the treated RNAi treatment compared with PAK1 RNAi despite similar spheroids. The fraction of the cells staining positive for PI kinetics of protein downregulation. As was seen with the within PAK4 or PAK1 RNAi knockdown spheroids was other cell lines, combinatorial knockdown of PAK4 and increased following treatment with ABT-737 (Fig. 7E). PAK1 was not significantly more antiproliferative than knockdown of either PAK4 or PAK1 alone under any of Discussion the different growth conditions tested. Despite reducing The PAK family of kinases have been shown to modulate protein levels of PAK4 or PAK1 to a similar extent as the cell signaling pathways critical for cancer cell proliferation, other RNAi, PAK4_5 and PAK1_6 did not inhibit cellular transformation, migration, and invasion (3, 25), and there- proliferation to the same extent. The reasons for this are fore suggest themselves as potentially important targets for unclear but potential explanations include differences in therapeutic intervention. In this study, we evaluated the role either the kinetics or duration of mRNA and subsequent of PAK4 and PAK1 in the proliferation and survival of a protein reduction, or knockdown of an off target protein that range of colon carcinoma cell lines harboring mutations in renders the cells insensitive to PAK knockdown. either KRAS or BRAF. Knockdown of PAK4 inhibited the These observations are in keeping with previous studies proliferation of 3 of 4 of the KRAS-mutant and 3 of 3 of the showing a crucial role for PAK4 or PAK1 in cancer cell BRAF-mutant colon cancer cell lines. Combinatorial knock- proliferation and survival. Knockdown of PAK4 reduced the down of PAK4 and PAK1 was not significantly more proliferation and survival of ovarian cancer cells (20), pan- antiproliferative than knockdown of either PAK4 or PAK1 creatic cancer 8988T cells (18), JEG3, and JAR choriocar- alone. The mutant KRAS HCT116 cell line showed the cinoma cells (33) and increased the levels of apoptotic greatest sensitivity to PAK4 or PAK1 knockdown. Knock- proteins in gastric cancer cell lines (34). In comparison, down of PAK4 or PAK1 inhibited the anchorage-dependent knockdown of PAK1 inhibited the anchorage-dependent growth on plastic and the anchorage-independent growth in (14) and -independent (35) growth of breast cancer cells, the

118 Mol Cancer Res; 11(2) February 2013 Molecular Cancer Research

PAK4 and PAK1 Knockdown Inhibits Colon Cancer Cell Proliferation

Figure 7. Inhibition of Bcl-2/Bcl-XL increases the antitumor activity of PAK inhibition in anchorage- dependent in vitro culture and human colon cancer spheroids. A, HCT116 cells were transfected with RNAi oligonucleotides specifictoPAK4 (PAK4_6) or PAK1 (PAK1_7) for 48 hours in the presence or absence of 5 mmol/L ABT-737. Caspase-3/7 activation was measured using a homogenous caspase activation kit. The values were normalized to the untreated control and are the mean of 3 determinations SD. , P < 0.001. B, HCT116 cells transfected with RNAi oligonucleotides specific to PAK4 or PAK1 were treated with 0 or 5 mmol/L ABT-737 for 72 hours. Cell viability was determined using CellTiter-Glo. Values were normalized to the untreated control and are the mean of 4 determinations SD. , P < 0.05; , P < 0.01. C, protein extracts from HCT116 cells transfected with RNAi oligonucleotides treated 5 mmol/L ABT-737 for 48 hours were analyzed for changes to apoptosis proteins by immunoblotting. For PARP, both full- length 116 kDa (FL) and the 89 kDa cleavage product (CL) were detected. D, HCT116 colon cancer cells were transfected with specific RNAi oligonucleotides to PAK4 or PAK1 for 24 hours before being transferred to round-bottomed, low- adherence 96-well plates containing 10% FCS. Spheroids were allowed to form for a further 72 hours in the presence of 0 or 5 mmol/L ABT-737. Cell viability was determined using CellTiter-Glo and normalized to the untreated (UT) control. The values are the mean of 8 determinations SD. , P < 0.001. E, spheroids formed as in (D) earlier were labeled with PI for 30 minutes and imaged using phase contrast and fluorescence on a Zeiss Axiovert microscope. Scale bar, 100 mm.

proliferation of NSCLC cancers in vitro and in vivo (14), increased expression of either PAK4 or PAK1 protein. colon cancer in vitro (27) and in vivo (28), and the growth of Compensation for PAK1 loss by PAK2 did not seem to be gastric cancer cells anchorage-dependently and -indepen- responsible for the variable effect of PAK1 RNAi on cell dently as well as tumor xenografts (36). In previous studies, proliferation in the colon cancer cell lines studied. A recent gene ampliﬁcation or increased protein expression of PAK4 study by Baskaran and colleagues (37) suggests that PAK4 or PAK1 has been suggested to correlate with dependence on (unlike PAK1) is constitutively phosphorylated on serine this pathway for tumor progression and tumor cell prolif- 474 and held inactive by an N-terminal auto-inhibitory eration. In this study, the dependence of colon cancer cells domain. Binding of Cdc42 relieves this auto-inhibition on PAK4 or PAK1 for proliferation did not correlate with resulting in the full activation of PAK4. Reliance on gene

www.aacrjournals.org Mol Cancer Res; 11(2) February 2013 119

Tabusa et al.

amplification or protein overexpression to select patient actincytoskeletoninHCT116cellsresultinginincreased populations that might be sensitive to PAK-directed cell rounding and reduced basal spread and cell elongation small-molecule therapeutics could result in potentially sen- but did not modulate downstream targets of the LIMK sitive patient populations being overlooked. Further work is pathway. In colon cancer cells, PAK4 and PAK1 promote needed to identify additional cellular biomarkers of PAK tumor cell proliferation independently of the RAF/MEK/ activation status to aid this patient selection. ERK pathway and actin cytoskeleton arrangements inde- Downregulation of PAK4, PAK1, or PAK4 plus PAK1 pendently of LIMK. The necessity of the interaction with in HCT116 colon cancer cells induced a predominantly Cdc42 for PAK4 activity and its involvement in cell cytostatic effect on cell proliferation that converted to cell adhesion dynamics suggests that PAK4 has the potential deathonprolongedproteinknockdown.Inhibitionof to control cancer cell proliferation via modulation of cell– Bcl-2/Bcl-XL with ABT-737 increased caspase-dependent cell interactions. apoptosis and cell death in HCT116 cells following RNAi Despite the ability of PAK4 and PAK1 to phosphorylate knockdown of PAK4 or PAK1. Previous studies in identical protein substrates albeit often in different cancer NSCLC cells have shown that antagonism of the anti- cell lines, and are activated by the same small G-proteins, apoptotic inhibitor of apoptosis (IAP) proteins with a PAK4 and PAK1 do not show functional redundancy. In all pharmacologic inhibitor in combination with PAK1 abla- the colon cell lines studied, including HCT116s, PAK1 did tion increased the number of cells undergoing apoptosis not compensate for the loss of PAK4 and vice versa. It is also (14). This differed substantially from the antiproliferative unclear as to whether PAK5 and PAK6 can functionally effect observed after single-agent inhibition of PAK1 in substitute for PAK4. This was further reinforced by the these cells. PAK4 and PAK1 have both been shown to observation that PAK1 RNAi does not increase the anti- protect against apoptotic cell death by direct phosphor- proliferative activity of PAK4 RNAi and vice versa. Knock- ylation of Bad on serine 136 (6, 38). Targeting PAK4 or down of PAK4 or PAK1 did not result in consistent changes PAK1 may be a mechanism to prime tumor populations to MEK1, RAF-1, paxillin, or cofilin phosphorylation in resistant to small-molecule inhibitors of antiapoptosis HCT116 cells and, following knockdown of PAK4 and proteins,suchasBcl-2,Bcl-XL, or XIAP to apoptosis PAK1, the cellular phenotype associated with knockdown of induction by these small molecules. Inhibitors of both PAK4 seemed to predominate over PAK1. Bcl-2/Bcl-XL and XIAP are currently in early-stage clinical Overall our studies suggest that PAK4 and PAK1 are trials and the combination of PAK inhibitors with inhi- crucial for the anchorage-dependent and -independent pro- bitors of apoptosis may be a useful therapeutic regimen for liferation but not the survival of colon cancer cells in vitro via a variety of human cancers. pathways independent of RAF/MEK/ERK and that protein To further understand the mechanism by which PAK4 overexpression was not a determinant of PAK signaling andPAK1regulatecellproliferationinmutantKRAS dependence. Further work is needed to identify biomarkers HCT116 colon cancer cells, we examined the effect of of the activation status of PAK1 and PAK4 in human cancer PAK4andPAK1knockdownonpathwayspreviously cells, and further elucidate the mechanisms by which group I shown to be modulated by the PAKs. PAK4 and PAK1 and group II PAK substrate specificity is determined in a have been found to phosphorylate common substrates in cancer cell context, and the signaling pathways modulated by cells and modulate the same signaling pathways namely the PAKs. the RAF/MEK, LIMK/Cofilin, HGF/MET, Rho GTPase exchange factors, PI3K/AKT, and apoptotic regulatory Disclosure of Potential Conflicts of Interest (BAD) pathways (2–4, 24, 25, 39). In the case of the RAF/ No potential conflicts of interest were disclosed. MEK pathway, PAK4 and PAK1 have both been shown to phosphorylate MEK on serine 298 (40, 41) and RAF on Authors' Contributions serine 338 (42, 43). In HCT116 colon cancer cells, Conception and design: A.J. Massey inhibition of cell proliferation induced by knockdown of Development of methodology: T. Brooks, A.J. Massey Acquisition of data (provided animals, acquired and managed patients, provided PAK4 or PAK1 did not correlate with consistent reduction facilities, etc.): H. Tabusa, A.J. Massey in phosphorylation of RAF-1, MEK, or ERK and subse- Analysis and interpretation of data (e.g., statistical analysis, biostatistics, compu- tational analysis): A.J. Massey quent decrease in cyclin D protein levels. The relationship Writing, review, and/or revision of the manuscript: A.J. Massey between PAK4 and MEK/cyclin D activation was inde- Administrative, technical, or material support (i.e., reporting or organizing data, pendent of cell culture conditions. In anchorage-indepen- constructing databases): T. Brooks dent culture, the phosphorylation of MEK1 on serine 298 Study supervision: A.J. Massey and the protein levels of cyclin D were reduced compared with cells growing attached to plastic. However, HCT116 Acknowledgments The authors thank Mike Wood for critically reading and commenting on the cells growing under these conditions were still sensitive to article. growth inhibition induced by PAK4 knockdown. Like- The costs of publication of this article were defrayed in part by the payment of page wise, PAK4 and PAK1 have been shown to modulate cell charges. This article must therefore be hereby marked advertisement in accordance with migration and invasion (9) through modulation of actin 18 U.S.C. Section 1734 solely to indicate this fact. dynamics via downstream targets of LIMK (8, 44, 45). Received August 1, 2012; revised October 26, 2012; accepted November 20, 2012; Knockdown of PAK4 and PAK1 dramatically altered the published OnlineFirst December 10, 2012.

120 Mol Cancer Res; 11(2) February 2013 Molecular Cancer Research

PAK4 and PAK1 Knockdown Inhibits Colon Cancer Cell Proliferation

References 1. Arias-Romero LE, Chernoff J. A tale of two Paks. Biol Cell 2008;100: 23. Li LH, Zheng MH, Luo Q, Ye Q, Feng B, Lu AG, et al. P21-activated 97–108. protein kinase 1 induces colorectal cancer metastasis involving ERK 2. Eswaran J, Soundararajan M, Kumar R, Knapp S. UnPAKing the class activation and phosphorylation of FAK at Ser-910. Int J Oncol differences among p21-activated kinases. Trends Biochem Sci 2010;37:951–62. 2008;33:394–403. 24. Ong CC, Jubb AM, Zhou W, Haverty PM, Harris AL, Belvin M, et al. p21- 3. Wells CM, Jones GE. The emerging importance of group II PAKs. activated kinase 1: PAK'ed with potential. Oncotarget 2011;2:491–6. Biochem J 2010;425:465–73. 25. Kichina JV, Goc A, Al Husein B, Somanath PR, Kandel ES. PAK1 as a 4. Eswaran J, Soundararajan M, Knapp S. Targeting group II PAKs in therapeutic target. Expert Opin Ther Targets 2010;14:703–25. cancer and metastasis. Cancer Metastasis Rev 2009;28:209–17. 26. Murray BW, Guo C, Piraino J, Westwick JK, Zhang C, Lamerdin J, et al. 5. Li X, Minden A. PAK4 functions in tumor necrosis factor (TNF) alpha- Small-molecule p21-activated kinase inhibitor PF-3758309 is a potent induced survival pathways by facilitating TRADD binding to the TNF inhibitor of oncogenic signaling and tumor growth. Proc Natl Acad Sci receptor. J Biol Chem 2005;280:41192–200. U S A 2010;107:9446–51. 6. Schurmann€ A, Mooney AF, Sanders LC, Sells MA, Wang HG, Reed JC, 27. Huynh N, Liu KH, Baldwin GS, He H. P21-activated kinase 1 stimulates et al. p21-activated kinase 1 phosphorylates the death agonist bad and colon cancer cell growth and migration/invasion via ERK- and AKT- protects cells from apoptosis. Mol Cell Biol 2000;20:453–61. dependent pathways. Biochim Biophys Acta 2010;1803:1106–13. 7. Qu J, Cammarano MS, Shi Q, Ha KC, De Lanerolle P, Minden A. 28. He H, Huynh N, Liu KH, Malcontenti-Wilson C, Zhu J, Christophi C, Activated PAK4 regulates cell adhesion and anchorage-independent et al. P-21 activated kinase 1 knockdown inhibits beta-catenin signal- growth. Mol Cell Biol 2001;21:3523–33. ling and blocks colorectal cancer growth. Cancer Lett 2012;317:65–71. 8. Ahmed T, Shea K, Masters JR, Jones GE, Wells CM. A PAK4-LIMK1 29. Friedrich J, Seidel C, Ebner R, Kunz-Schughart LA. Spheroid-based pathway drives prostate cancer cell migration downstream of HGF. drug screen: considerations and practical approach. Nat Protoc Cell Signal 2008;20:1320–8. 2009;4:309–24. 9. Whale A, Hashim FN, Fram S, Jones GE, Wells CM. Signalling to 30. Kanwar SS, Yu Y, Nautiyal J, Patel BB, Majumdar AP. The Wnt/beta- cancer cell invasion through PAK family kinases. Front Biosci 2011;16: catenin pathway regulates growth and maintenance of colonospheres. 849–64. Mol Cancer 2010;9:212. 10. Coniglio SJ, Zavarella S, Symons MH. Pak1 and Pak2 mediate tumor 31. Oltersdorf T, Elmore SW, Shoemaker AR, Armstrong RC, Augeri DJ, cell invasion through distinct signaling mechanisms. Mol Cell Biol Belli BA, et al. An inhibitor of Bcl-2 family proteins induces regression of 2008;28:4162–72. solid tumours. Nature 2005;435:677–81. 11. Callow MG, Clairvoyant F, Zhu S, Schryver B, Whyte DB, Bischoff JR, 32. Kang MH, Reynolds CP. Bcl-2 inhibitors: targeting mitochondrial et al. Requirement for PAK4 in the anchorage-independent growth of apoptotic pathways in cancer therapy. Clin Cancer Res 2009;15: human cancer cell lines. J Biol Chem 2002;277:550–8. 1126–32. 12. Vadlamudi RK, Adam L, Wang RA, Mandal M, Nguyen D, Sahin A, et al. 33. Zhang HJ, Siu MK, Yeung MC, Jiang LL, Mak VC, Ngan HY, et al. Regulatableexpressionofp21-activated kinase-1promotes anchorage- Overexpressed PAK4 promotes proliferation, migration and invasion independent growth and abnormal organization of mitotic spindles in of choriocarcinoma. Carcinogenesis 2011;32:765–71. human epithelial breast cancer cells. J Biol Chem 2000;275:36238–44. 34. Ahn HK, Jang J, Lee J, Se Hoon P, Park JO, Park YS, et al. P21- 13. Ito M, Nishiyama H, Kawanishi H, Matsui S, Guilford P, Reeve A, et al. activated kinase 4 overexpression in metastatic gastric cancer P21-activated kinase 1: a new molecular marker for intravesical recur- patients. Transl Oncol 2011;4:345–9. rence after transurethral resection of bladder cancer. J Urol 2007;178: 35. Shrestha Y, Schafer EJ, Boehm JS, Thomas SR, He F, Du J, et al. PAK1 1073–9. is a breast cancer oncogene that coordinately activates MAPK and 14. Ong CC, Jubb AM, Haverty PM, Zhou W, Tran V, Truong T, et al. MET signaling. Oncogene 2012;31:3397–408. Targeting p21-activated kinase 1 (PAK1) to induce apoptosis of tumor 36. Liu F, Li X, Wang C, Cai X, Du Z, Xu H, et al. Downregulation of p21- cells. Proc Natl Acad Sci U S A 2011;108:7177–82. activated kinase-1 inhibits the growth of gastric cancer cells involving 15. Carter JH, Douglass LE, Deddens JA, Colligan BM, Bhatt TR, Pemberton cyclin B1. Int J Cancer 2009;125:2511–9. JO, et al. Pak-1 expression increases with progression of colorectal 37. Baskaran Y, Ng YW, Selamat W, Ling FT, Manser E. Group I and II carcinomas to metastasis. Clin Cancer Res 2004;10:3448–56. mammalian PAKs have different modes of activation by Cdc42. EMBO 16. Brown LA, Kalloger SE, Miller MA, Shih IeM, McKinney SE, Santos JL, Rep 2012;13:653–9. et al. Amplification of 11q13 in ovarian carcinoma. Genes Chromo- 38. Gnesutta N, Qu J, Minden A. The serine/threonine kinase PAK4 somes Cancer 2008;47:481–9. prevents caspase activation and protects cells from apoptosis. J Biol 17. Wang RA, Zhang H, Balasenthil S, Medina D, Kumar R. PAK1 hyper- Chem 2001;276:14414–9. activation is sufficient for mammary gland tumor formation. Oncogene 39. Kumar R, Gururaj AE, Barnes CJ. p21-activated kinases in cancer. Nat 2006;25:2931–6. Rev Cancer 2006;6:459–71. 18. Kimmelman AC, Hezel AF, Aguirre AJ, Zheng H, Paik JH, Ying H, et al. 40. Park ER, Eblen ST, Catling AD. MEK1 activation by PAK: a novel Genomic alterations link Rho family of GTPases to the highly invasive mechanism. Cell Signal 2007;19:1488–96. phenotype of pancreas cancer. Proc Natl Acad Sci U S A 2008;105: 41. Zhang J, Wang J, Guo Q, Wang Y, Zhou Y, Peng H, et al. LCH-7749944, 19372–7. a novel and potent p21-activated kinase 4 inhibitor, suppresses 19. Liu Y, Xiao H, Tian Y, Nekrasova T, Hao X, Lee HJ, et al. The pak4 proliferation and invasion in human gastric cancer cells. Cancer Lett protein kinase plays a key role in cell survival and tumorigenesis in 2011;317:24–32. athymic mice. Mol Cancer Res 2008;6:1215–24. 42. Zang M, Hayne C, Luo Z. Interaction between active Pak1 and Raf-1 is 20. Siu MK, Chan HY, Kong DS, Wong ES, Wong OG, Ngan HY, et al. p21- necessary for phosphorylation and activation of Raf-1. J Biol Chem activated kinase 4 regulates ovarian cancer cell proliferation, migra- 2002;277:4395–405. tion, and invasion and contributes to poor prognosis in patients. Proc 43. Koh W, Sachidanandam K, Stratman AN, Sacharidou A, Mayo AM, Natl Acad Sci U S A 2010;107:18622–7. Murphy EA, et al. Formation of endothelial lumensrequires a coordinated 21. Abo A, Qu J, Cammarano MS, Dan C, Fritsch A, Baud V, et al. PAK4, a PKCepsilon-, Src-, Pak- and Raf-kinase-dependent signaling cascade novel effector for Cdc42Hs, is implicated in the reorganization of the downstream of Cdc42 activation. J Cell Sci 2009;122:1812–22. actin cytoskeleton and in the formation of filopodia. EMBO J 1998;17: 44. Dan C, Kelly A, Bernard O, Minden A. Cytoskeletal changes regulated 6527–40. by the PAK4 serine/threonine kinase are mediated by LIM kinase 1 and 22. Baldus SE, Schaefer KL, Engers R, Hartleb D, Stoecklein NH, Gabbert cofilin. J Biol Chem 2001;276:32115–21. HE. Prevalence and heterogeneity of KRAS, BRAF, and PIK3CA 45. Edwards DC, Sanders LC, Bokoch GM, Gill GN. Activation of LIM- mutations in primary colorectal adenocarcinomas and their corre- kinase by Pak1 couples Rac/Cdc42 GTPase signalling to actin cyto- sponding metastases. Clin Cancer Res 2010;16:790–9. skeletal dynamics. Nat Cell Biol 1999;1:253–9.

www.aacrjournals.org Mol Cancer Res; 11(2) February 2013 121

Knockdown of PAK4 or PAK1 Inhibits the Proliferation of Mutant KRAS Colon Cancer Cells Independently of RAF/MEK/ERK and PI3K/AKT Signaling

Hana Tabusa, Teresa Brooks and Andrew J. Massey

Mol Cancer Res 2013;11:109-121. Published OnlineFirst December 10, 2012.

Updated version Access the most recent version of this article at: doi:10.1158/1541-7786.MCR-12-0466

Supplementary Access the most recent supplemental material at: Material http://mcr.aacrjournals.org/content/suppl/2012/12/10/1541-7786.MCR-12-0466.DC1

Cited articles This article cites 45 articles, 20 of which you can access for free at: http://mcr.aacrjournals.org/content/11/2/109.full#ref-list-1

Citing articles This article has been cited by 11 HighWire-hosted articles. Access the articles at: http://mcr.aacrjournals.org/content/11/2/109.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mcr.aacrjournals.org/content/11/2/109. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.