Understanding the Function and Mechanisms of Intestinal Cell

Understanding the function and mechanisms of

Intestinal Cell Kinase in the growth and survival of prostate cancer cells

Alice Wilce

Bachelor of Science

Submitted in fulfilment of the requirements for the degree of

Master of Applied Science (Research)

School of Biomedical Sciences

Faculty of Health

Queensland University of Technology

2015

Keywords

Apoptosis

Epidermal growth factor receptor

Intestinal cell kinase p21 p53

Prostate cancer

Abstract

Prostate cancer (PCa) is the most commonly diagnosed cancer in Australian men. Unfortunately, treatment options are limited once the disease progresses to advanced stages. To develop an effective treatment, it is necessary to better understand the molecular mechanisms underlying the development of PCa. The aim of the current study was to investigate the role of intestinal cell kinase (ICK), a protein recently found to be upregulated in prostate tumours. Initially the levels of ICK mRNA were examined in two non-tumorigenic human prostate epithelial cell lines and six human PCa cell lines with qRT-PCR. Consistent with the results reported previously, ICK mRNA was upregulated in the PCa cell lines when compared to the non-tumorigenic prostate epithelial cells. Increased ICK expression in PCa was confirmed by Western blot analyses. ICK protein was located within the cytoplasm and nuclei by immunofluorescence. siRNA-mediated gene knockdown suppressed endogenous expression of ICK mRNA and protein. Western blot analysis of expression of a group of proteins known to regulate cancer cell growth revealed that the level of many of these proteins was not changed following manipulation of ICK expression but knockdown of ICK resulted in downregulation of epidermal growth factor receptor (EGFR) mRNA and protein levels in C4-2B cells. Overexpression of ICK mRNA and protein following transfection of an expression vector was confirmed by qRT-PCR and Western blot analyses. ICK overexpression resulted in increased levels of EGFR mRNA and protein expression. Transfection of C4-2B cells with a construct of a luciferase reporter gene driven by the EGFR promoter and measurement of luciferase activity indicated that ICK upregulated EGFR promoter activity. Similarly, overexpression of ICK in a non-tumorigenic prostate epithelial cell line, HPr-1, was found to induce EGFR expression, and was associated with an increase in the number of mitotic cells, suggesting that ICK may regulate the growth of prostate cells through upregulation of the EGFR signalling pathway. Interestingly, in PCa cells, knockdown of ICK expression was found to induce cellular apoptosis, as evidenced by the increase in annexin V positive cells and the induction of cleavage of poly-ADP-ribose polymerase-1 (PARP-1). Examination of pro- apoptotic proteins confirmed that ICK knockdown induces the protein expression of p53 and its downstream target, p21. These findings provide strong evidence that ICK regulates PCa cell survival through modulation of the p53/p21 pathway.

Taken together, the current study not only identified two novel ICK-downstream targets in PCa cells, but also demonstrated, for the first time, the important role of ICK in PCa cell survival. Thus, these findings will provide a basis for further investigation of ICK as a potential therapeutic target for the treatment of PCa.

Table of contents

Keywords ...... i Abstract ...... ii List of figures ...... iv List of tables ...... vi Statement of authorship ...... vii Acknowledgements ...... viii List of abbreviations ...... ix Chapter 1.0 General introduction ...... 1 Chapter 2.0 Literature review ...... 3 2.1 Prostate cancer risk factors ...... 3 2.2 Pathology ...... 9 2.3 Biomarkers for detection and prognosis ...... 12 2.4 Therapeutic options ...... 16 2.5 Targeted therapy ...... 21 2.6 Introduction to intestinal cell kinase family and cancer ...... 23 2.7 Aims and objectives ...... 24 Chapter 3.0 Materials and methods ...... 25 Chapter 4.0 ICK regulates EGFR expression in prostate cancer cells ...... 33 4.1 Introduction ...... 33 4.2.1 ICK expression in PCa cell lines...... 35 4.2.2 Identification of EGFR as a novel downstream target of ICK ...... 41 4.3 Discussion ...... 49 Chapter 5.0 ICK regulates prostate cancer cell survival ...... 51 5.1 Introduction ...... 51 5.2.1 Loss of ICK induces apoptosis...... 51 5.2.2 Identification of p53 as a novel downstream target of ICK ...... 57 5.3 Discussion ...... 61

Chapter 6.0 General discussion ...... 63 6.1 Conclusion and future directions ...... 66 References ...... 69

iii

List of figures Figure 2.1. Left: general anatomy of the prostate in median sagittal view. Right: Zone anatomy of the prostate in transverse view Figure 2.2. Gleason grading system Figure 2.3. The metastatic cascade Figure 3.1. Map of pCMV6-ICK-GFP plasmid Figure 4.1. The activation and downstream targets of ICK Figure 4.2. qRT-PCR analysis of ICK mRNA expression in different cell lines. Figure 4.3. Western blotting of endogenous ICK protein in PCa cells using various anti-ICK antibodies Figure 4.4. Western blot analysis of ICK protein expression in different prostate cell lines Figure 4.5. Immunofluorescence staining of C4-2B cell with DAPI and ICK antibody Figure 4.6. qRT-PCR analysis of ICK mRNA following knockdown with RNA-1, -2 and -3 in PC-3 cells and RNA-1 in C4-2B cells Figure 4.7. Western blot analysis of ICK following knockdown with RNA-1 in PC-3 and C4-2B cells Figure 4.8. Western blot analysis of cell proliferation-related proteins in C4-2B cells following ICK knockdown Figure 4.9. qRT-PCR analysis of EGFR mRNA expression in C4-2B cells following ICK knockdown Figure 4.10. qRT-PCR and Western blot analysis of ICK mRNA and protein expression following transfection of C4-2B cells with ICK overexpression vector Figure 4.11. qRT-PCR analysis of EGFR mRNA following ICK overexpression in C4-2B cells Figure 4.12. Western blot analysis of EGFR following ICK overexpression in C4-2B cells Figure 4.13. Luciferase reporter activity in control and ICK overexpressed C4-2B cells Figure 4.14. Western blot analysis of EGFR in ICK overexpressing HPr-1 cells Figure 4.15. Cell cycle analysis of empty vector and in ICK overexpressing HPr-1 cell lines using FACS Figure 5.1. Phase contrast images of C4-2B cells transfected with scramble or ICK RNA-1 Figure 5.2. Annexin V staining of C4-2B cells 96 hr post ICK knockdown Figure 5.3. Annexin V staining of C4-2B 120 hr post ICK knockdown Figure 5.4. Western blot analysis of Cl-PARP 72, 96 and 120 hr following ICK knockdown in C4-2B cells Figure 5.5. Western blot analysis of cell survival proteins in C4-2B cells following ICK knockdown Figure 5.6. Western blot analysis of p53 and p21 following ICK knockdown and overexpression in C4- 2B cells Figure 5.7. qRT-PCR analysis of p53 mRNA following ICK knockdown and overexpression in C4-2B cells

Figure 6.1. Summary of EGFR –MAPK signalling cascade Figure 6.2. Summary of p53/p21 signalling Figure 6.3. Summary of the novel ICK downstream targets identified in this study

List of tables Table 2.1. Summary of prostate cancer tumour staging system used in Australia Table 3.1. Short interfering RNA sequences for ICK knockdown Table 3.2. Primer sequences and manufacturers Table 3.3 Primary and secondary antibodies used in study

Table 4.1. Summary of the cell lines used in this study

Table 4.2. Summary of cell proliferation proteins and their functions Table 5.1. Summary of cell survival–associated proteins examined in this study

Statement of original authorship

The work contained in this thesis has not been previously submitted to meet requirements for an award at this or any other higher education institution. To the best of my knowledge and belief, the thesis contains no material previously published or written by another person except where due reference is made.

QUT Verified Signature Signature:

Alice Wilce

Date: 21 May 2015

vii

Acknowledgments

My sincerest thanks to my supervisor Patrick Ling for his ongoing mentoring and guidance throughout all aspects of my project. I extend my gratitude to my associate supervisor, Judith Clements and the rest of the team at the Australian Prostate Cancer Research Centre for allowing me the opportunity to undertake my degree. My sincerest thanks to Kai Dun Tang and Ji Liu for all their help and assistance and I would particularly like to acknowledge Ji Liu for providing me with some of the materials necessary to acquire my results.

I would like to thank Carol Wilce, Emma Wilce and Kristopher Rogers for their unwavering support over the last few years. Finally, I extend my deepest appreciation to Peter Wilce for his assistance during the final stages of my writing.

viii

List of abbreviations

ADT Androgen deprivation therapy

Akt Protein kinase B

AMACR Alpha-methyl CoA racemase

AR Androgen receptor

AS Active surveillance

BCR Biochemical reoccurrence

CRPC Castration-resistant prostate cancer

CTC Circulating tumour cells

DAPI 4’,6-diamidino-2-phenylindole

DRE Digital rectal exam

EBRT External beam radiation therapy

EGF Epidermal growth factor

EGFR Epidermal growth factor receptor

GFP Green fluorescent protein

ICK Intestinal cell kinase

IGF1 Insulin-like growth factor 1

IGF1R Insulin-like growth factor 1 receptor

MAPK Mitogen activated protein kinase

OS Overall survival

PB Prostate brachytherapy

PCa Prostate cancer

PCA3 Prostate cancer antigen 3 phi Prostate health index

PI3K Phosphoinositide 3-kinase

PSA Prostate specific antigen

PTEN Phosphatase and tensin homolog

RP Radical prostatectomy

ix qRT-PCR Quantitative real- time polymerase chain reaction siRNA Small interfering RNA WW Watchful waiting

Chapter 1.0 General introduction and aims of project

Although the prostate was first described by the Venetian anatomist Niccolò Massa in 1536, and illustrated by Flemish anatomist Andreas Vesalius in 1538, prostate cancer (PCa) was not identified until 1853. Globally, it is the second most common cause of cancer and the fifth leading cause of cancer-related death in men. In 2012 it occurred in 1.1 million men and caused 307,000 deaths. It was the most common cancer in males in 84 countries (Baade PD, 2013). Although mortality rates in Western societies are relatively low compared to incidence, the mortality can be as high as 50% within 10 years of first symptoms in countries without sophisticated medicine (Baade PD, 2013).

Much of the increased understanding of the pathobiology of PCa has been made possible by the development of a simple blood test to detect prostate-specific antigen (PSA). The efficacy of various PCa treatments have been defined by PSA studies in large numbers of patients. Localised prostate cancer is treated with surgery and salvage radiotherapy. Metastatic PCa is treated with anti- androgen therapy that is only effective for about 2 years, after which time the cancer becomes castration resistant prostate cancer (CRPC). In the final stages of cancer development, chemotherapy is the preferred treatment but is only effective for approximately 9 months (De Marzo et al., 2004).

The absence of reliable treatment options for advanced disease has led to research into the mechanisms behind PCa development and progression. A number of protein kinase family members have been implicated in PCa (Normanno et al., 2006). In addition, the epidermal growth factor receptor (EGFR) has been shown to promote PCa cell proliferation and survival. In PCa, expression of EGFR has been shown to correlate with Gleason score and can be upregulated in low androgen environments (Traish and Morgentaler, 2009). Protein kinases downstream of EGFR signal transduction, such as Raf and mitogen activated protein kinase kinase (MAPKK) have been shown to be overexpressed in PCa (Mukherjee et al., 2011) further suggesting that protein kinase signalling cascades are aberrantly activated in PCa.

Recently, we and other laboratories (Whitworth et al., 2012) have empolyed small inteference RNA (siRNA)-based high-throughput genetic screening to identify novel protein kinases that play key roles in the development and progression of PCa. Similar to Whitworth et al. (2012) our lab identified the Intestinal Cell Kinase (ICK) as one of the key protein kinases essential for the growth of PCa cells (unpublished data). ICK is a ubiquitously expressed serine/threonine protein kinase which, when expression is reduced, has shown to reduce cell proliferation in intestinal epithelial cells. In both

1 studies, ICK was found to be upregulated in PCa. However the underlying mechanism of action of ICK in PCa cells is largely unknown. Thus, the overall aim of the current study was to investigate the downstream mechanisms underlying the functions of ICK in PCa cells with the future intention of applying any new knowledge to the development of new PCa therapies.

Chapter 2.0 Literature review

2.1 Prostate Cancer Risk factors

2.1.1 Incidence

Prostate cancer (PCa) is the most commonly diagnosed cancer in Australian men. In 2008, 15% of the estimated 900,000 cases worldwide were diagnosed in Australia (Baade PD, 2013). According to the Australian Institute of Health and Welfare, 21,808 new cases were diagnosed in 2009 and in 2011 approximately 3,000 men died from the disease (Ellis et al., 2013). By 2020 the number of new cases is expected to reach 25,000 per annum. From 1982-2009, the age-standardised incidence increased from 79 to 194 cases per 100,000 males. This rise has been attributed to more comprehensive screening processes (Threlfall et al., 1998) and a 23% increase in health-care expenditure from 2005 to 2008 (Ellis et al., 2013). However, over this period there was a decline in mortality from PCa in Australia from 34 deaths per 100,000 in 1982 to 31 per 100,000 in 2011 (Ellis et al., 2013). The decrease was more pronounced in urban compared to rural areas. Notably, between 1998 and 2002 there were 110 extra deaths in rural areas compared to capital cities (Coory and Baade, 2005). Furthermore, indigenous Australians are less likely to be diagnosed and more likely to die from PCa (Ellis et al., 2013).

From 2006-2010, there was a 92% survival rate 5 years following diagnosis, an increase from 59% in 1986. In comparison, the 5 year survival rate of men following diagnosis of other cancers is 65% (Ellis et al., 2013). In 2008 the mortality-to-incidence ratio in Australia (0.1) was lower than the world (0.8) but similar to that in New Zealand and North America (Ellis et al., 2013). The lower mortality rate from PCa compared to other cancers reflects the multifaceted nature of the disease. The fact that different ethnic groups are more at risk of presenting with advance disease (for example, indigenous Australians) may reflect differences in screening rates between socioeconomic groups and/or an inheritability component of PCa.

2.1.2 Family history

There are currently only a few reliable risk factors for PCa namely; family history, race and age. Men with a father or brother with PCa have double the risk of developing the disease compared to men without an affected first degree relative. The risk increases further in men with several affected relatives particularly if these relatives are under 60 years of age (Brawley, 2012). The highest hazard ratio (23) has been observed in men with three affected brothers who were diagnosed before the age of 60 (Hemminki, 2012). Hemminki (2012) found a significantly higher hazard ratio in offspring

3 of parents with fatal disease. Similarly, Jansson et al. (2012) found a higher standardised incidence ratio (4.0) in men with brothers diagnosed with high grade tumours compared to men with brothers affected by low grade tumours. A Swedish cohort study found a higher standardised incidence ratio among men between the ages of 45 to 49 compared to those aged over 80 years of age (Damber et al., 1998). Moreover, several studies have observed an increased risk in men with a first degree female relative with breast cancer (Bostwick et al., 2004). Rodriguez et al. (1998) found a higher incidence rate ratio (1.16) of fatal PCa among men with a family history of breast cancer. The incidence rate ratio increased to 1.65 among men younger than 65 years of age with a female relative diagnosed with breast cancer before the age of 50. The highest rate ratio was among Jewish men (1.73) with a family history of breast cancer (Rodriguez et al., 1998). It is important to note that the higher incidence among families may be partly influenced by detection bias, for instance men with relatives with cancer may be more likely to undergo screening processes. However, the high incidence among families could also suggest a genetic component to the disease.

2.1.3 Ethnicity and inheritability

African-Americans have the highest incidence of PCa. Between 1988 and 1992, race-specific incidence rates in the United States were 135 per 100,000 for Caucasian Americans and 181 for African-Americans (Bostwick et al., 2004). Additionally, African-Americans present with cancers at a relatively advanced stage and have a higher stage-specific mortality (Bostwick et al., 2004, Hoffman et al., 2001). African-American and Hispanic men are diagnosed younger than Caucasian men (Cotter et al., 2002). Although these differences may reflect a different genetic background, it may be that African-American men have a higher risk of developing the disease because of lifestyle factors, such as diet. This suggestion is supported by Cunningham et al. (2003) who compared the incidence of PCa in first degree family members of African-Americans with that in Caucasian men and showed a similar familial aggregation.

Despite an obvious inheritable component of the disease in some individuals and the varying incidence between races, no genetic variation has been identified as a direct causal link with development of PCa. However, a number of genes have been identified where mutations are associated with an increased susceptibility. Carriers of mutations in the breast cancer susceptibility genes BRCA1 or BRCA2 have an increased risk of developing early-onset PCa. For instance, a population-based study of 596 PCa patients in Iceland found that the 30 individuals identified as carriers of BRCA2 mutations had a lower mean age of diagnosis, more advance tumours, higher tumour grade and shorter median survival time (Tryggvadottir et al., 2007). Similarly, mutation in BRCA1 is associated with a moderate increase in PCa risk (Thompson et al. 2002). Furthermore, PCa

4 tissue from men with either BRCA1 or 2 mutations has significantly higher Gleason scores compared to appropriately matched controls (Mitra et al., 2008).

Other candidate genetic markers/susceptibility genes include variants on chromosome locus 8q24 in men of European decent (Yeager et al., 2007) and several single nucleotide polymorphisms (SNP) present in both African-American and European men including, seven SNPs at locus 8q24 and three at the kallikrein-related peptidase 3 (KLK3) locus (Bensen et al., 2013). Three missense mutations in the tumour suppressor gene, interferon-induced ribonuclease (RNASEL) have been implicated in familial cancers among Finnish, American Caucasians and Japanese men (Alvarez-Cubero et al., 2013). In an extensive study, men with PCa were significantly more likely to carry germline mutations in the homeobox 13 (HOXB13) gene, which encodes a transcription factor involved in urogenital development. Meanwhile, the highest rates of HOXB13 mutations were among men with a positive family history of PCa. This suggests that HOXB13 mutation is conserved within families (Ewing et al., 2012).

2.1.4 Additional inheritability factors

Two major approaches have been used to identify PCa-related genes and potential modifications of structure and function associated with PCa. Somatic alterations have been identified by comparative genomic hybridization as gains or losses of a number of chromosomal regions (Taylor et al., 2010). These include NKX3.1 at 8p21, MYC at 8q24, and PTEN at 10q23.

A second approach has attempted to identify genetic susceptibility loci for PCa, traditionally by analysis of susceptible families and more recently by genome-wide association studies (GWAS). Familial studies identified the RNASEL (HPC1) locus which encodes an endoribonuclease for ssRNA and is associated with defence against viral infection and ELAC (HPC2), a gene of uncertain function (Carpten et al., 2002).

Genome-wide association studies have identified numerous single-nucleotide polymorphisms (SNPs) that are associated with cancer risk (Kader et al., 2009). These studies identified sequence polymorphisms associated with increased cancer risk at the NKX3.1 locus and a major locus proximal to MYC (Gelmann et al., 2002) emphasizing the potential importance of these genes initially identified by somatic studies.

In mouse models, loss of function of the homeobox gene, NKX3.1, leads to deregulated expression of oxidative damage response genes, increased levels of DNA adducts and tumourigenesis (Ouyang et al., 2005). Conversely gain of function is protective against DNA damage in PCa cell lines (Bowen and

Gelmann, 2010). Since NKX3.1 is frequently down-regulated in human PCa, its inactivation may allow accumulation of DNA damage associated with cancer initiation (Bowen et al., 2000). NKX3.1 has been shown to be a critical regulator of prostate epithelial differentiation and appears to protect against DNA damage in the adult (Ouyang et al., 2005, Bowen and Gelmann, 2010). The gene may act as a tumour suppressor gene that acts as a “gatekeeper” gene for PCa initiation (Magee et al., 2003).

Amplification of the chromosomal region encompassing the MYC oncogene is common in advanced prostate tumours (Sato et al., 1999) and nuclear MYC protein is up-regulated in many carcinomas (Gurel et al., 2008). Functionally, over expression of MYC immortalizes non-tumourigenenic human prostate epithelial cells (Gil et al., 2005) and induces an expression signature characterized by downregulation of NKX3.1 (Ellwood-Yen et al., 2003).

A second abnormally expressed transcription factors is created by the TMPRSS2-ERG fusion gene. The fusion protein is an N-terminally truncated ERG protein, a member of the ETS family of transcription factors under the control of the androgen-responsive promoter of TMPRSS2 an androgen-regulated transmembrane serine protease (Tomlins et al., 2005). Both genes are located on chromosome 21. TMPRSS2-ERG fusions occur in ∼50% in localized PCa (Albadine et al., 2009). Gene fusion may be a result of androgen receptor binding which brings the two genes closer together and fusion follows DNA damage (Lin et al., 2009). Although prevalent the functional significance in PCa of the TMPRSS2-ERG fusion and other ETS rearrangements (not discussed here) is not understood but may be a disruption in differentiation programs or cooperative interactions with other transforming elements.

2.1.5 Age

Age is one of the strongest factors contributing to PCa incidence. The prevalence of PCa at autopsy in men over 80 is close to 80% across most ethnic groups (Bostwick et al., 2004). In Australia, incidence rates rise sharply after the age of 50 (Baade PD, 2013). The high incidence of cancer among elderly men is most likely related to accumulated damage to the prostate cells caused by oxidative stress (Bostwick et al., 2004). Such damage may result in alteration in the pattern of gene expression and initiation of tumourigenesis. Supporting evidence linking oxidative stress and PCa initiation include an inverse correlation in the level of major antioxidant enzymes and levels oxidized DNA adducts (Bostwick et al., 2000). Interestingly polymorphisms in the APE gene encoding the APE/Ref1 enzyme, which functions in excision repair, are associated with increased PCa risk (Kelley et al., 2001).

An important event associated with DNA damage is shortening of the telomere which may lead to chromosomal instability and possibly PCa (Meeker et al., 2002). Although there is limited information on the cause and effects of telomere shortening, various strategies to regulate telomere length are being investigated as potential therapeutic agents (Asai et al., 2003).

The build-up of free radicals in the gland over time results in the accumulation of DNA-adducts and increases the frequency of DNA breakages and subsequent mutations. For example, DNA hypermethylation in the promoter region of genes encoding Ras association domain-containing protein 1 (RASSF1) and retinoic receptor-beta (RAR-beta) has been associated with aging of the prostate tissue and is estimated to be involved in 56% of cancers (Damaschke et al., 2013).

2.1.6 Hormones

There is weak evidence supporting a role of testosterone in PCa. Serum testosterone levels of PCa patients were found to be equal to or lower than control patients (Bostwick et al., 2004). Alternately, a higher level of the biologically active androgen, 5-αdihydroxytestosterone (5αDHT) has been implicated in benign prostatic hyperplasia and PCa. Inhibition of the enzyme 5-α dihydroxytestosterone reductase that converts testosterone to 5-αdihydroxytestosterone in androgen-dependent tissues has been shown to decrease PCa risk. For instance, ~18,000 men with low levels of the prostatic biomarker, prostate specific antigen (PSA) were randomized to receive a 5 mg dose of a 5-α dihydroxytestosterone reductase inhibitor (finasteride) or placebo. A 25% reduction in PCa incidence was observed in the finasteride arm relative to the control arm (Thompson et al., 2001). There was, however, an increase in the rate of high-grade tumours among the inhibitor arm. It was suggested that finasteride treatment may either increase the incidence of high-grade tumours or improve the accuracy of the PSA test (Violette and Saad, 2012).

2.1.7 Diet and lifestyle

Multiple studies have found a positive correlation between dietary fat intake and PCa, however, the studies differ in their selection of controls, the definition of fat, such as meat and dairy, and whether the studies adjusted for energy intake (Bostwick et al., 2004). Strom et al. (2008) found a positive association with saturated fats, predominantly from animal products, and biochemical recurrence. Biochemical recurrence is defined as a level of prostate specific antigen (PSA) > 0.2 ng/mL following prostatectomy (Thompson et al., 2013). Although the study controlled for obesity and other lifestyle factors, men who consumed more saturated fat also consumed significantly more calories. Punnen et al. (2011) performed a case control study of the meat consumption of 470 men with aggressive PCa and 512 controls. The group found a positive association between consumption of ground beef

7 and aggressive PCa. The control group was matched to age, ethnicity and medical institution. All controls were screened for PCa by PSA testing. In addition, a case control study of 79 men with PCa and 187 controls found unsaturated fat consumption to be an important risk factor (Williams C et al. (2011). The group found diets with high omega-6: omega-3 ratios were associated with an increased risk of high grade tumours only. These studies are not intervention studies and rely on information collected from the patients via questionnaires, which are highly subjective.

It is suggested that the antioxidant function of vitamins could be important in inhibiting PCa progression (Lawson et al., 2007). However, there is little evidence to support this. A large study of ~290,000 men in America investigated the relationship between multivitamin supplements and PCa risk. The results demonstrated an increase in advanced PCa in those men who reported excessive multivitamin use (Lawson et al. 2007). Low levels of vitamin A, C or carotenes do not appear to be risk factors for development of PCa. Furthermore, diet supplements of vitamin E and selenium, singularly or in combination, were not effective in PCa prevention (Klein et al., 2011). Despite the role of vitamin D in inducing immune cell differentiation (Masko et al., 2013), a meta-analysis performed by Gilbert et al. (2011) found no significant evidence that vitamin D plays a role in preventing PCa development or progression. Similarly, Shui et al. (2012) performed a case-control study and found no significant correlation between plasma vitamin D levels and overall PCa incidence, however they did observe that higher plasma concentrations of vitamin D were associated with a 57% reduction in the risk of lethal PCa.

Finally, obesity has been weakly correlated to PCa incidence. A meta-analysis of 17 studies performed by Bergström et al. (2001) found overweight men had a 6% increase in risk of developing PCa and obese men had an increase of 12%. Moreover, a meta-analysis of 31 cohort studies found obesity to be a weak risk factor for PCa, more so for advanced disease (MacInnis and English, 2006). This was supported by a meta-analysis by Cao and Ma (2011) which associated a 21% increase in risk of biochemical recurrence and a 15% higher risk of dying from PCa with body mass index (BMI) increases of 5 kg/m2. Likewise, a population cohort study of over 200,000 men in America found higher BMI increases the risk of PCa-specific mortality. It is important to note that the individual studies included in these meta-analyses varied greatly in size, geographical region and there were a number of studies that found obesity to be protective against PCa (Allott et al., 2013).

2.2 Pathology

2.2.1 Anatomy

The tissue of the prostate gland is divided into three glandular zones; the peripheral, central and transition and one non-glandular region, the anterior fibromuscular stroma (McNeal, 1981). The zones are surrounded by a fibromuscular capsule (McNeal, 1981) (Figure 2.1).

Figure 2.1. Left: general anatomy of the prostate in median sagittal view (Howe et al., 2010); Right: zone anatomy of the prostate in transverse view (Kutikov et al., 2009).

The peripheral zone is the major glandular component (65%) and extends posterolaterally and anteriorly from the urethra (Fine and Reuter, 2012). The central zone comprises 30% of the glandular tissue and has ducts branching from the mid-prostate to the base. Finally, the transition zone has 5% of the glandular tissue and ducts extending laterally from the urethral wall (Fine and Reuter, 2012). Around 60-70% of tumours occur in the peripheral zone, 24% in transition zone and ~8% in the central zone (Cohen et al., 2008). Due to their more anterior location, tumours derived from the transition zone are more difficult to detect by digital rectal exam (DRE) than those in the peripheral zone (Fine and Reuter, 2012). Moreover, transition zone tumours are larger in volume than peripheral zone tumours, have lower Gleason scores (section 2.2.2) and are more often organ confined (Akin et al., 2006). Central zone tumours have been shown to have more aggressive pathological features then either peripheral or transition zone tumours. Cohen et al. (2008) found central zone tumours were more likely to invade into the seminal vesicles and have positive surgical margins.

2.2.2 Gleason Score

In Australia, patients with elevated PSA levels (section 2.3.1) and a suspicious DRE are sent for needle biopsy and the tumours are graded with a Gleason score. In the Gleason tumour grading system, a pathologist assesses the extent of loss of glandular differentiation and the carcinoma cell

9 growth pattern in stained prostate tissue (Figure 2.2, (Humphrey, 2004). Five basic grades are used and assigned to the primary (most ubiquitous cell type) and secondary grade patterns to produce an overall score between 2 and 10 (Humphrey, 2004). Tumours with a grade in the range 2-4 are considered low risk, 5-6 moderate risk, 7 intermediate risk and 8 or above are considered aggressive (Australia, 2014).

Figure 2.2. Gleason grading system (Wikipedia, 2006).

In addition to Gleason grading, tumours are staged depending on size of the tumour and the extent to which the tumour has migrated beyond the prostate gland (Table 2.1, (Australia, 2014).

Tumour stage Histopathology

1 Tumour is small and confined within the prostate capsule

2 Tumour is larger, in 2 nodes but is still within the capsule

3 Tumour cells are present in lymph node or seminal vesicles

4 Tumour cells are present in bone or organs outside prostate

Table 2.1. Summary of prostate cancer tumour staging system used in Australia (Australia, 2014).

2.2.3 Metastasis

The PCa metastatic cascade (Figure 2.3) is a multi-step process which is facilitated by altered expression of different proteins involved in angiogenesis, apoptosis and cell motility.

Figure 2.3. The metastatic cascade (Msaouel et al., 2008).

During stage 1 the tumour cells grow rapidly by upregulating growth factor receptors, such as epidermal growth factor receptor (EGFR) and resisting apoptosis. Initially tumour cells receive nutrients via diffusion but once the tumour is >1 mm in diameter it requires neoangiogenisis (Arya et al., 2006). Tumour cells stimulate this by upregulating proangiogenic proteins such as vascular growth factor or fibroblast growth factor (Arya et al., 2006). In stage 3, the cells escape from prostate by intravasation into the periprostatic fat, the neurovascular bundle or to the outer edge of the gland (Kench et al., 2011). Cancer cells may spread into the seminal vesicle via the ejaculatory duct, through the prostatic capsule into the soft tissue and subsequently into the seminal vesicle (Ohori et al., 1993). To decrease cell adhesion, PCa cells downregulate epithelial cadherin, a calcium-dependent cell-cell adhesion molecule. They also alter the expression of integrins, proteins that facilitate the interaction between cells and the extracellular matrix (Arya et al., 2006). Once in the general circulation (stage 4) cancer cells must evade the immune system by either downregulating the major histocompatibility complex or by travelling as a fibrin clot (Arya et al., 2006). PCa cells frequently metastasise to bone, for example lumbar spine, ribs, pelvis or femur (Msaouel et al., 2008). The cells attach to bone via low affinity binding to bone marrow epithelium- specific lectins and induce firmer adhesion via bone marrow epithelium-specific integrins (Arya et al., 2006). Extravasation by PCa cells is aided by osteoclasts, the bone cells that reabsorb bone tissue. PCa cells activate bone resorption by osteoclasts which results in seeding by the cancer cells and the release of growth factors by the surrounding bone tissue (Msaouel et al., 2008). These processes allow for a more stable growth environment for the cancer cells.

At every stage of the cascade PCa cells must evade apoptotic signalling. This requires, for example, diminished function of the tumour suppressor gene, the phosphatase and tensin homolog (PTEN) and subsequent hyperactivation of antiapoptotic proteins such as protein kinase B (Akt) and B-cell lymphoma 2 (Bcl-2) as well as, resistance to signalling from proapoptotic proteins such as the apoptosis antigen 1 (FasR) and its ligand, FasL. PTEN functions to dephosphorylate lipid-signalling intermediates and deactivate phosphoinositide 3-kinase (PI3K) signalling, which leads to cell proliferation, differentiation and survival. PI3K signalling activates Akt which leads to inhibition of apoptosis (DeMarzo et al., 2003). Homologous deletion of PTEN occurs in approximately 40% of primary PCa (Barbieri et al., 2013).

The FasR-induced apoptotic pathway is used by cytotoxic T cells as part of the natural immune response (Msaouel et al., 2008). FasR is a member of the tumour necrosis factor family of proteins, and when activated leads to Caspase mediated apoptosis and the inhibition of anti-apoptotic proteins, Bcl-2 and B-cell lymphoma extra-large (Bcl-xl) (Park et al., 2010). Soluble FasR, mutation of cell-surface FasR or Bcl-2 and Bcl-xl overexpression can lead to suppression of FasR-induced apoptosis in PCa (Park et al., 2010).

2.3 Biomarkers for detection and prognosis

2.3.1 Prostate Specific Antigen

PCa has no specific symptoms until the tumour becomes large enough to impede normal functioning of the urethra. In Australia, early detection is usually made by DRE and/or measurement of levels of serum PSA by immunoassay. The preliminary diagnosis is followed by a needle biopsy and ultrasound (Ellis et al., 2013). PSA is a 30 kDa glycoprotein secreted into the seminal plasma in large concentrations (~0.35 mg/mL) by the prostatic epithelial cells (Lippi et al., 2009). Its major purpose is to cause liquefication of the seminal clot following ejaculation (Hoffman et al., 2001). PSA is encoded by the KLK3 gene, a member of the kallikrein gene family which is regulated through the steroid hormone-receptor system (Lilja et al., 2008). Low concentrations of PSA (0.6 ng/mL) are found in the serum of normal males (Lippi et al., 2009). In PCa, there is disruption of the basement membrane resulting in leakage of PSA into the bloodstream (Lilja et al., 2008). PSA levels are directly correlated with age and prostate volume. For healthy individuals, the levels increase from a median concentration of 0.7 ng/mL at 40- 49 years of age to 0.9 ng/ml between 50- 59 (Lippi et al., 2009). Patients with benign prostatic hyperplasia (BPH) will also show elevated PSA and, as a result, PSA levels cannot be used in isolation for PCa diagnoses. For example, a multicentre trial of the PSA and

12 prostate volume values of 4,627 patients with BPH and 179 controls found that men with BPH had higher serum PSA (mean 2.6 ng/mL) than the control arm (mean 0.7 ng/mL). The men in the control arm, however, were younger (mean 31 years) than those in the BPH arm (64 years) (Roehrborn et al., 1999).

A PSA concentration of 4 ng/mL or above is commonly used as a threshold for biopsy. This level has a positive predictive value of about 30% in men aged > 50 years of age and a negative predicative value of ~85% in men of between 65 and 70 years of age (Hayes and Barry, 2014). Unfortunately, there are no reliable means of distinguishing aggressive and non-aggressive tumours by PSA measurement. In order to improve the predictive capacity of PSA in men with serum PSA concentrations between 4-10 ng/mL, the ratio of free PSA (fPSA) versus bound PSA has been trialled. Pepe and Aragona (2010) showed a 28.8% PCa detection rate in men with PSA < 10 ng/mL. Furthermore, the prostate health index (phi) is a formula that uses a combination of total PSA, fPSA and a subform of fPSA, the pro-PSA molecule (p2PSA) (Loeb and Catalona, 2014). Loeb et al. (2013) found men with a high phi were significantly correlated with negative biopsies. Similarly, a European study of ~600 men found that phi was a significantly better predictor of biopsy outcome compared to tPSA and fPSA (Lazzeri et al., 2013).

From 1994 to 2006 there was a decline in PCa mortality in both the USA and the UK (Strope and Andriole, 2010). In a randomised trial to determine the efficacy of biochemical screening in reducing mortality in men aged between 55 and 74 years of age, a higher incidence of cancer was detected in the PSA screened patients than the control group (7.4% vs 6.2%), but there was no difference in cancer-specific mortality (Grubb et al., 2008). One of the major limitations of this study was that only 50% of the control patients had their PSA levels measured. Moreover, the European randomized study of screening for PCa, which involved 182,000 men between the ages of 50 and 74 across seven countries, found that individuals from the screening group were more likely to be diagnosed with cancer and less likely to die than those from the control group (Schroeder et al., 2009). In Australia almost 800,000 PSA tests and 17,000 biopsies were performed in 2012, the highest number in the 65-74 year age group (Ellis et al., 2013). Although these studies confirm that PSA screening reduces mortality, there is still a risk of over diagnoses and PSA screening should be left to the discretion of the individual. There is also a clear need for improvements in the screening processes.

2.3.2 Circulating tumour cells

Circulating tumour cells (CTC) are potential biomarkers for advanced stage PCa. In order to metastasise, both primary and metastatic tumours must shed cells into the bloodstream and into

13 the lymphatic circulation. These CTC can be isolated from peripheral blood or the bone marrow and quantitated to assess disease progression (Doyen et al., 2012). First a CTC enriched fraction is isolated then the CTCs are detected using DNA, RNA or protein markers. CTC are captured from peripheral blood using antibodies to epithelial proteins, such as epithelial cell adhesion molecule (Saad and Pantel, 2012). They are distinguished from white blood cells by the antibody capture of cell-specific proteins, such as cytokeratins for CTC and the glycoprotein, CD45 for white blood cells (Saad and Pantel, 2012).

CTC typically express PSA, alpha-methyl CoA racemase (AMACR) and exhibit gene-specific genomic abnormalities, such as gene copy amplifications (Danila et al., 2011). A pilot study by Moreno et al. (2005) showed that the presence of CTCs in patients with metastatic PCa was associated with short survival (<1 year). Similarly, de Bono et al. (2008) found that monitoring the number of CTCs was a better prognostic determinant than measurements of PSA levels post chemotherapy. A cohort study at the Memorial Sloan-Kettering Cancer Centre found that baseline CTC levels in patients 4, 8 and 12 weeks post-treatment were more strongly correlated to risk of mortality than PSA (Danila et al., 2007). Davis et al. (2008) performed a comparison study of PSA and CTC levels on 97 men with localised PCa. The group found no correlation between CTC levels and tumour volume, pathological stage or Gleason score. More recently, a study on the CTC populations in control and patients with different stages of PCa found CTC counts were significantly increased in metastatic PCa compared to localised cancer but localised cancer CTC counts were at control levels (Friedlander et al., 2014). The relevance of CTC in patients with low grade tumours is still under investigation.

2.3.3 Histological biomarker, alpha-methylacyl CoA racemase (AMACR)

With the increase in PSA testing there has been an increase in the number of needle biopsies. As a result, diagnosis of PCa is often left to the discretion of a pathologist. The difficulty in distinguishing minimal adenocarcinomas from BPH (Evans, 2003) prompted the development of specific immunohistochemical staining for cancer cells in biopsied specimens. AMACR is a 382 amino acid protein with a primary function related to the β oxidation of branched chain fatty acids, bile acid intermediates and trihydroxycholestanoic acid (Evans, 2003). Microarray and northern blot analysis demonstrated unregulated AMACR expression in PCa tissue, whereas expression in normal prostate tissue was undetectable (Xu et al., 2000). The increased levels of AMACR mRNA distinguished benign from cancer tissue (Al-Maghrebi et al., 2012) and positive staining of AMACR was significantly correlated with PCa in an extensive population study (Jiang et al. (2013). Conversely, Gumulec et al. (2012) found no significant difference in serum concentration of AMACR in PCa patients compared to controls. When AMACR expression is compared among disease states, it is

14 higher in localised cancer tissue than in metastatic cancer (Rubin et al., 2005). For instance, in a cohort study of 920 men with PCa, weaker AMACR staining was associated with higher PSA and more advanced clinical stage at diagnosis (Barry et al., 2012). These results indicate AMACR has utility in distinguishing cancer tissue from enlarged prostatic tissue during biopsy.

2.3.4 New potential biomarkers

In the search for more reliable biomarkers, a genetic variant, the TMPRSS2:ERG fusion gene has been identified. Prostate cancer antigen 3 (PCA3) and the prostate health index (phi) have also been considered. Fusions between the androgen-regulated transmembrane protease serine gene (TMPRSS2) and E twenty-six (ETS) family of transcription factors were discovered in PCa in 2005 (Tomlins et al., 2005). This fusion results in the aberrant expression of the ETS related gene (ERG) transcription factor. The ETS family are involved in many cellular functions, including cell proliferation, apoptosis and migration (Tomlins et al., 2009). The TMPRSS2:ERG is the commonest subtype of ETS fusion (~85% of ETS fusion samples) and present in ~50% of tumours (Tomlins et al., 2009). They are reasonably rare in BPH. Population studies suggest that men with TMPRSS2:ERG fusion could have more aggressive phenotype, although more evidence is required (Tomlins et al., 2009). Leyten et al. (2014) detected urinary TMPRSS2:ERG transcript by real- time polymerase chain reaction (RT-PCR) and a showed a 90% specificity and a 94% positive predictive value for PCa detection.

Another emergent biomarker is the transcript of PCA3. PCA3 is a noncoding RNA that is specific to the prostate (Salagierski and Schalken, 2012). Hessels et al. (2003) found a ~66 fold upregulation of the PCA3 transcript in 95% of tumour tissues when compared to BPH. PCA3 transcripts are detectable in urine by RT-PCR and are expressed as a score (PCA3 mRNA/ PSA mRNA x 1000) (Salagierski and Schalken, 2012). The usefulness of PCA3 score as a prognosticator for tumour stage is controversial. Hessels et al. (2010) found no correlation with urine PCA3 score and Gleason score or tumour evasion. Conversely, Nakanishi et al. (2008) observed a lower average PCA3 score for low volume tumours following prostatectomy. These results were supported by Auprich et al. (2011) who found lower PCA3 scores with lower grade tumours. However, there is evidence that PCA3 is a good predictor of a requirement for repeat biopsy. For instance, in a study of 463 patients there was a 44% decrease in repeat biopsy when a PCA3 cut off of 20 was used. Unfortunately, 9% of clinically significant cancers were missed (Haese et al., 2008).

In order to improve the accuracy of PCa diagnosis, a combination of one or more biomarkers could be the best prognosticator. For example, PCA3 score has been used in combination with phi to

15 predict PCa diagnosis and to stratify patients (Ferro et al., 2012). Combining biomarkers could in turn minimise the risk of over diagnosis and unnecessary medical interventions.

2.4 Therapeutic Options

2.4.1 Localised disease

Treatment options for PCa depend greatly on the severity of the tumour. Patients with early stage and localised disease are treated with watchful waiting (WW), active surveillance (AS), radical prostatectomy (RP), prostate brachytherapy (PB) or external beam radiation therapy (EBRT) (Keyes et al., 2013). AS is used as a treatment option for patients with tumours that have a Gleason score of <6, a tumour stage of <2 and a PSA value of <10 ng/mL (Dall'Era et al., 2012). Patients are biopsied 6-12 months after the initial diagnosis and routinely monitored with PSA testing and follow- up biopsies (Keyes et al., 2013). Cancer specific mortality is between 0-1% with AS and about 30% of patients will receive further intervention after 2.5 years, usually as a result of changes in cancer pathology or an increase in PSA doubling time (Dall'Era et al., 2012). Older men with <10 years life expectancy due to their age or other comorbidities may be recommended for WW independent of the tumour aggressiveness. WW requires DRE and PSA testing every 6-12 months (Freedland, 2011).

RP is the only surgical option for PCa and is recommended for younger men (<70 years of age) with Gleason scores between 6 and 7 and PSA levels >10 ng/mL (Heidenreich et al., 2014a). Han et al. (2003) found that of ~2,000 men that underwent RP, 84% had no biochemical reoccurrence (BCR) after 5 years, 72% after 10 years and 61% of men had no BCR after 15 years. A PSA level of >0.2 ng/mL several years post prostatectomy is classified as a BCR. A number of studies have assessed whether RP offers a survival advantage over WW. Bill-Axelson et al. (2011) assigned 347 men to a RP group and 348 to WW. After 15 years, 55 men (cumulative death incidence 14.4%) in the RP group had died from PCa and 81 men in the WW group (cumulative death incidence 20.7%). The significant survival benefit for the RP arm was mostly in men under the age of 65. Similar results were found after > 20 years of follow-up (Bill-Axelson et al., 2014). Wilt et al. (2012) found that only patients with a pre-treatment PSA of >10 ng/mL or high-risk PCa had a significant survival benefit following RP; although they were less likely to develop metastases. Urinary incontinence occurs in a significant number of patients (~42%) and may persist for 24 months or longer post RP. Erectile dysfunction may occur in some patients for up to 24 months (Keyes et al., 2013). These quality of life issues should be considered when deciding on treatment options for organ-confined tumours, particularly when the patient is 65 years or older. Conversely, the concept of living with untreated cancer may cause anxiety in some patients. It is therefore important that patients are fully aware of

16 both the risks and benefits of treatment and are encouraged to make an independent decision about treatment.

PB is administered in either low (LDB) or high doses (HDB). LDB involves permanently implanting radioactive seeds into the prostate unlike HDB, in which radioactive sources are administered via catheters over a ten minute period (Keyes et al., 2013). EBRT is a procedure in which X-ray beams are aimed at the prostate for a few minutes daily (Australia, 2014). LDB is recommended as a first- line treatment in patients that are not eligible for surgery and with a tumour grade < 2, a Gleason score < 7 and a PSA level of < 10 ng/mL (Heidenreich et al., 2014a). The disease-free survival of men with low to medium-risk tumours following LDB has been reported to be as high as 97% after 5 years and 94% after 10 years (Morris et al., 2013). EBRT is recommended for patient with high-risk, organ- confined tumours (Heidenreich et al., 2014a). Radiation toxicity occurs in <5% but erectile dysfunction occurs in ~40% of patients. A recent multicenter study by Grimm et al. (2012) compared the treatment outcomes of patients with low, medium and high risk tumours following RP, EBRT and PB. Interestingly, for low risk patients PB produced the best biochemical free progression, EBRT and/or PB for intermediate risk patients and for high risk patients a combination of EBRT and PB with or without androgen deprivation therapy compared to any individual treatment.

2.4.2 Metastatic Stage

Despite good prognosis for patients treated for localised PCa, about 35% of men will experience an increase in PSA 10 years post treatment (Freedland, 2011). A PSA of >0.2 ng/ml indicates recurrent cancer post RP and after PB or EBRT a level of 2 ng/mL above the lowest detected post-therapy PSA indicates BCR (Heidenreich et al., 2014b). BCR in the bed of prostate following RP may be predicted in 80% of patients with a PSA increase of >3 years, a PSA doubling time of >15 months and a Gleason score of <7 (Heidenreich et al., 2014b). Systemic failure is most likely in men with a PSA increase after a year, coupled with a doubling time of 4-6 months and Gleason scores > 8 (Heidenreich et al., 2014b). Moreover, this aggressive phenotype with two or more affected lymph nodes has been associated with cancer specific mortality (Abdollah et al., 2013).

BCR in the prostate bed is usually treated with salvage radiotherapy with or without androgen deprivation therapy (ADT) before PSA reaches 0.5 ng/mL (Heidenreich et al., 2014b). Salvage radiotherapy has been shown to increase PCa survival by as much as three fold compared to observation in men with a PSA doubling time <6 months when treatment was initiated within 2 years of BCR (Trock et al., 2008). Similarly, a study of over 2,500 men, 32% of which received salvage radiotherapy following BCR, found radiation provided a reduction in disease progression but not in overall survival (OS) (Boorjian et al., 2009). ADT in conjunction with salvage radiotherapy has been

17 shown to increase PSA progression-free rate and decrease cumulative incidence of metastatic PCa (Punnen et al., 2013).

Once the tumour has metastasised men are treated with anti-androgen therapy. The androgen receptor (AR) belongs to the steroid family of receptors. In the absence of a ligand, the AR is contained in the cytoplasm bound to heat shock proteins (Green et al., 2012) but steroid binding activates its function as a ligand-dependent transcription factor responsible for the regulation of expression of androgen-related genes, such as KLK3 (Knudsen and Penning, 2010). In PCa it is believed to play an important role in cell cycle progression, survival and growth (Green et al., 2012). ADT is effective through multiple mechanisms. Luteinising hormone-releasing hormone (LHRH) agonists such as goserelin or leuprolide, are the first line of treatment in ADT (Heidenreich et al., 2014b). These agents result in an initial increase in luteinising hormone and testosterone and ultimately tumour growth termed the “flare response” (Massard and Fizazi, 2011). After approximately a week, the high testosterone levels negatively feedback on the production of LH and consequently testosterone drops to ~5-10% of normal levels. Recently, LHRH antagonists have been explored in order to circumvent the flare response with promising results. For instance, a study of 610 men found a LHRH antagonist achieved more rapid testosterone suppression compared to leuprolide without a flare response (Klotz et al., 2008).

Direct androgen antagonists including, bicalutamide, flutamide and nilutamide (Massard and Fizazi, 2011) work by the recruitment of AR co-repressors (Knudsen and Penning, 2010). These agents are not recommended as a standard monotherapy in the treatment of metastatic disease due to the lack of positive clinical outcomes (Heidenreich et al., 2014b). Drug efficacy is monitored by measurement of PSA levels, tumour volume and relief of symptoms. Side effects of ADT include disruption of sexual function, particularly loss of libido and gynecomastia (Violette and Saad, 2012). Intermittent ADT therapy is a treatment regime which involves cycling hormone treatment, usually a LHRH analogue or antagonist plus a direct androgen antagonist, with periods of no treatment (Boccon-Gibod et al., 2007). It has been shown to improve patient quality of life by reducing the severity of the unwanted side effects and is becoming a standard treatment for metastatic PCa (Heidenreich et al., 2014b).

Unfortunately, this line of treatment is only effective for a finite period of time, usually 18-24 months after which the cancer becomes castration-resistant prostate cancer (CRPC) (Petrylak et al., 2004). Subsequently, a rise in PSA level, tumour regrowth and metastatic spread occurs (Knudsen and Scher, 2009). At this stage of tumour progression, the median survival is 10-12 months (Petrylak et al., 2004). It is important to distinguish CRPC from hormone refractory prostate cancer (HRPC) as

CRPC is still responsive to secondary hormone treatments whereas HRPC is completely resistant (Heidenreich et al., 2014b). A number of mechanisms for androgen resistance have been identified. Firstly, AR amplification occurs in approximately one third of men with CRPC and may be via amplification of the gene locus, increased transcription or protein/mRNA stabilisation (Green et al., 2012). Mutations in different regions of the AR protein may result in activation of the AR by other steroids, AR antagonists or cause increased sensitivity of the AR to DHT (Green et al., 2012). This situation is infrequent among cancer patients (8-25%) (Debes and Tindall, 2004). Splice variants in the ligand binding domain of the AR have also been identified and result in the AR becoming constitutively active (Hornberg et al., 2011). Interestingly, splice variants have not been identified in normal prostate tissue (Sun et al., 2010). Finally, resistance to ADT can be the result of hyperactivation due to activation by kinases or cofactors (Massard and Fizazi, 2011). Signal transduction by the Ras-Raf-MAP pathway activated by ligands such as, epidermal growth factor (EGF) and insulin growth factor (IGF) have been implicated in AR activation in low androgen environments (Green et al., 2012). These pathways have been shown to be upregulated in more aggressive cancers (Yuan and Balk, 2009).

2.4.3. Castration resistant prostate cancer

Secondary hormonal therapies, such as abiraterone acetate and MDV3100 and cytotoxic agents, are used when primary ADT has failed. MDV3100 is a competitive AR antagonist which binds with a much greater affinity than other antagonists, such as bicalutamide, and inhibits AR translocation to the nucleus (Green et al., 2012). In a small phase I/II study of men with CRPC, MDV3100 led to a PSA decrease of >50% in 62% chemotherapy-naive patients and 51% of docetaxel-treated patients (Scher et al., 2010). Phase III trials are still to be published for this treatment option. Abiraterone acetate is a permanent inhibitor of androgen production and can be used before and after chemotherapy has failed. Abiraterone is an inhibitor of cytochrome P450-17 (CYP17) and 17α-hydroxylase. CYP17 is expressed in adrenal and tumour tissue and catalyses the production of progesterone and androstenedione which are precursors of testosterone (Barrie et al., 1994). Attard et al. (2008) performed phase I clinical trials on abiraterone and observed a decrease in PSA concentration in 66% of patients. Phase III trials by de Bono et al. (2010) with 1,200 men that failed chemotherapy treatment compared the OS of patients on abiraterone and prednisone with those treated with prednisone alone. The group reported an average OS of 450 days for the patients on abiraterone compared to 332 days for the control patients. In 2011 the Food and Drug Administration in the United States approved this drug for treatment in PCa (Massard and Fizazi, 2011).

Chemotherapeutic agents, such as docetaxel, estramustrine, mitoxantrone or cabazitaxel are usually used in combination with steroids or AR antagonists (Attard and de Bono, 2011). Estramustrine, mitoxantrone and docetaxel are antineoplastic agents. Docetaxel binds to β-tubulin thereby inhibiting microtubule depolymerisation. Consequently, cell cycle progression stalls, ultimately leading to Bcl-2 inactivation and apoptosis via the Caspase pathway (Ting et al., 2007, Debes and Tindall, 2004). Impaired tubular function also impedes AR translocation through the cell into the nucleus thereby reducing transcription of AR regulated genes (Madan, 2011). This has been demonstrated in vitro as docetaxel reduced both AR and PSA expression in PCa cells (Kuroda et al., 2009).

One phase III trial of docetaxel and estramustrine by Petrylak et al. (2004) compared tumour progression of two treatment groups. 338 patients were treated with docetaxel and estramustrine and 336 received steroid treatment (prednisone) and mitoxantrone. The median OS was higher for the docetaxel and estramustrine group (17.5 months) compared to the mitoxantrone and prednisone (15.6 months). Similarly, the progression time was 6.3 months for the docetaxel group and 3.2 months for the mitoxantrone group, however, neutropenic fevers, nausea and cardiovascular events were more common in the docetaxel group. In addition, Tannock et al. (2004) published a randomised phase III trial with 1,006 men across 24 countries. All men received 5 mg of prednisone and were randomly assigned to receive 12 mg of mitoxantrone or 75 mg of docetaxel every 3 weeks or 30 mg for 5 of every 6 weeks. The median survival was 16.5 months in the mitoxantrone group, 18.9 months in the docetaxel every 3 weeks group and 17.4 months for the group with docetaxel administered weekly. More men in both docetaxel groups had reductions in pain and improvements in quality of life but also experienced more adverse side effects than the other groups. Conversely, phase II trials of docetaxel and doxercalciferol (1α-hydroxyvitamin D2) combination therapy showed no improvement in OS or toxicity when compared with docetaxel therapy alone (Attia et al., 2008). Whereas, a double blind study performed by Beer et al. (2007), which assigned 250 patients on docetaxel treatment regimens to 45 µg of 1,25-dihydroxyvitamin D3 or placebo, reported a 50% reduction in PSA in 58% of patients on the combination therapies compared to 49% in the placebo arm. The adverse effects of docetaxel include, peripheral neuropathy, myelosuppresion, arthralgias, myalgias, and skin reactions (Cella et al., 2003). Unfortunately, approximately 40% to 50% of CRPC patients have only a 6-9 month response to chemotherapy (as assessed by PSA levels) (Mathew and DiPaola, 2007). In these cases salvage chemotherapy is a treatment option. In a phase II trial of 755 patients with CRPC that had cancer progression during or after docetaxel treatment, patients were assigned to receive cabazitaxel plus prednisone or mitoxantrone plus prednisone. The patients in the cabazitaxel arm demonstrated a

20 significant increase in OS, however side effects occurred more frequently (Heidenreich et al., 2014b). At this stage of disease progression, palliative care is imperative and new trials of targeted therapies should be made known to the patients as they become available.

2.5 Targeted therapy

2.5.1 Insulin-like growth factor pathway

Insulin-like growth factor 1 (IGF1) and its receptor, insulin-like growth factor receptor (IGF1R) mediate downstream signal transduction pathways, for example, the mitogen activated protein kinase (MAPK) and phosphoinositide 3-kinase/protein kinase B (PI3K/Akt). Activation of these kinase pathways results in a suppression of apoptosis, and an increase in cell proliferation, invasion and survival (King and Wong, 2012). The binding of IGF1 to IGF1R results in autophosphorylation in the kinase domain of IGF1R and the recruitment of insulin receptor substrate proteins and the subsequent phosphorylation of PI3K or MAPK (King and Wong, 2012). The association between high serum IGF-1 concentrations and an increased risk of PCa is controversial (Kojima et al., 2009). A number of studies have reported a positive correlation while others have reported an inverse relationship. Roddam et al. (2008) performed a meta-analysis of 12 studies and found a marginal correlation between IGF-1 and PCa. Immunohistochemical staining of normal, localised and metastatic cancer tissue has demonstrated an upregulation of IGF1R in the stroma of prostate tissue (Ryan et al., 2007). Furthermore, IGF-1 has been linked to the AR as IGF-1 promotes AR signalling by increasing the expression of AR cofactors, transcriptional mediator 2 protein and insulin degrading enzyme (Saraon et al., 2011). Alternatively, PCa cell lines treated with antiandrogens are unable to activate the AR.

The human monoclonal antibodies figitumumab and cixutummunab, which target the extracellular domain of the IGF1R, have been trialled as potential therapies for PCa. Preoperative treatment with figitumumab decreased IGF1R and AR expression as measured by immunohistochemical staining in prostatectomy specimens (Chi et al., 2012). Cixutummunab phase II trials have shown some promise. Disease stabilisation was observed in about a third of men with CRPC receiving regular doses, although adverse hyperglycaemia was also reported in some men (Aggarwal et al., 2013).

2.5.2 Epidermal growth factor receptor The epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases contain an extracellular ligand binding, a transmembrane and an intracellular tyrosine kinase domain (Wang and Hung, 2012). The family contains four members, EGFR/ErbB-1/HER-1, ErbB-2/HER-2/neu, ErbB-

3/HER-3 and ErbB-4/HER-4. Ligands of EGFR include, EGF, transforming growth factor α (TGF-α) and ampiregulin. Following ligand binding, EGFR dimerises and activates several downstream kinases, such as PI3K, MAPK and phospholipase leading to cellular adhesion, differentiation and proliferation (Wang and Hung, 2012). EGFR is downregulated by androgens in normal prostate tissue and castration of mature animals causes a dose-dependent upregulation of EGFR (Traish and Morgentaler, 2009). In PCa, EGF promotes tumour cell motility, adhesion and invasion and is antiapoptotic in cell lines overexpressing EGFR (Traish and Morgentaler, 2009). It has been reported to induce the cyclin-dependent kinase (cyclin D1), which is involved in progression though the GI phase of the cell cycle (Herbst and Shin, 2002). EGFR is expressed in primary and secondary tumours and expression increases with disease severity. Di Lorenzo et al. (2002) found 40% of prostatectomy biopsy specimens stained for EGFR, that increased to 70% of tissues following treatment with hormone therapy and prostatectomy and, finally 100% of tissues from CRPC were EGFR positive. Furthermore, EGFR expression was significantly correlated with high Gleason score and higher levels of PSA.

In terms of therapies, direct antagonists of EGFR have been developed as well as inhibitors of the downstream kinases. The chimeric anti-EGFR, monoclonal antibody, Cetuximab binds to the extracellular domain of EGFR and inhibits EGF from binding (Fu et al., 2012). It has been shown to reduce cell proliferation in the PCa cell line DU145 but not in the more aggressive cell type, PC-3 (Dhupkar et al., 2010). One in vivo study of the use of Cetuximab plus doxorubicin in patients with CRPC showed no significant decline in PSA levels compared to the control group but an increase in OS (Slovin et al., 2009). In addition, a randomised phase II trial of patients treated with Cetuximab plus mitoxantrone or Cetuximab plus mitoxantrone plus prednisone showed no significant improvement in OS or time to disease progression with the addition of Cetuximab (Fleming et al., 2012). Gefitinib inhibits EGFR tyrosine kinase by binding to the adenosine triphosphate (ATP)- binding site of the enzyme thereby inhibiting the anti-apoptotic Ras signal transduction cascade (Bonaccorsi et al., 2004). It has been shown in vitro to reduce invasion and proliferation of PC-3 and DU145 cells. In phase II trials, however there was no improvement in disease load as measured by PSA levels (Small et al., 2007, Canil et al., 2005). There is limited evidence for EGFR inhibitors as monotherapies. This may be related to changes in expression of downstream kinases resulting in indirect drug resistance. It is clear that growth factors play an important role in PCa progression but their efficacy as therapeutic targets for PCa is still to be fully elucidated.

2.6 Introduction to the intestinal cell kinase family and cancer

Due to the lack of an effective therapeutic target for PCa, a number of high-throughput RNA- interference based screens have been performed recently. These studies identified novel proteins actively involved in the regulation of cell proliferation and survival of PCa cells. One of these proteins was ICK. It was identified by ours (unpublished observations) and other laboratories (Whitworth et al., 2012) to be a key protein essential for the growth of PCa cells.

Intestinal cell kinase (ICK) (also known as MRK, MAK-related kinase), named after being cloned from the intestine, is a serine/threonine protein kinase ubiquitously expressed in most mouse, rat and human tissues (Fu, 2012). Other members of the family include male germ cell-associated kinase (MAK) and MOK (MAPK/MAK/MRK-overlapping kinase). Despite significant similarities in their N- terminal catalytic domains, the family members diverge markedly in the sequence and structural organization of their C-terminal non-catalytic domains, which may confer distinct regulatory mechanisms and functional specificity. A loss-of-function point mutation of ICK is the causative mutation in a neonatal lethal multiplex human syndrome endocrinecerebro-osteodysplasia, implicating a key role for ICK in the development of multiple organ systems (Lahiry et al., 2009). Furthermore, suppression of ICK expression in intestinal epithelial cells markedly impairs cell proliferation and G1 cell cycle progression (Fu et al., 2009). There is a significant increase in the protein level of ICK in human primary colon cancer and ICK protein level is upregulated whereas MOK protein level is downregulated in mouse intestinal adenomas as compared with their adjacent normal intestinal mucosa (Chen et al., 2013).

A second family member has been implicated in cancer development. Male germ cell-associated kinase (MAK) was identified as an androgen-inducible co-activator of the androgen receptor in PCa cells (Ma et al., 2006). Similar to the role of ICK in intestinal epithelial cells, MAK is also required for prostate epithelial cell replication (Ma et al., 2006). MAK is over-expressed in PCa cells and in cultured cells. Viral-mediated MAK overexpression results in mitotic defects such as centrosome amplification and lagging chromosomes via an androgen receptor -independent mechanism (Wang and Kung, 2012). In vitro studies indicate that some protein components of the mitotic regulatory mechanism may be substrates for MAK and may thus play a role in PCa development.

2.7 Aims and objectives

Prostate cancer is the most commonly diagnosed cancer in Australian men. The overall objective of the laboratory program is to better understand the molecular mechanisms underlying the development of prostate cancer particularly the progression of the disease to advanced stages. The overall aim of the current study was to focus on functions of intestinal cell kinase (ICK), as the protein was recently found to be upregulated in prostate tumours.

The underlying hypothesis is that ICK has a central role in regulating prostate epithelial cell growth and that manipulation of ICK activity may influence growth and progression of prostate carcinoma cells.

The specific aims of the project were:

 to develop cellular tools for study of ICK mRNA and protein levels in tumour and non-tumour prostate cell lines  to determine the effect of manipulation of ICK expression on mRNA and protein levels of a potential downstream target(s) of ICK selected from a panel of candidates genes with functions associated with cancer cell growth  to conduct similar experiments with candidate genes with functions associated with cancer cell survival.

Chapter 3.0 Materials and methods

3.1 Cell culture conditions

The human PCa cell lines, PC-3, DU145, LNCaP, were obtained from the American Type Culture Collection (Manassa, USA). C4-2 and C4-2B cells were kindly provided by Professor Leland Chung (Cedars-Sinai Medical Center, USA). The immortalised non-tumorigenic prostate epithelial cell line, NPTX, was kindly provided by Professor Suzanne Topalian (National Cancer Institute, NIH, USA). The prostate epithelial cells HPr-1 was established as described previously (Choo et al., 1999). PC-3, DU145, LNCaP were maintained in RPMI 1640 growth medium (Life Technologies; catalogue v number: 12633-012) supplemented with 5% ( /v) foetal bovine serum (FBS) (Life Technologies; w catalogue number: 10099-141) and 2% ( /v) penicillin/streptomycin (P/S), (Life Technologies, v catalogue number: 15070-063). 22Rv1 were grown in RPMI 1640 growth medium with 10% ( /v) FBS v and 2% ( /v) P/S. C4-2 and C4-2B cells were sustained in T-medium (Life Technologies; catalogue v w number: 0020056DJ) with 5% ( /v) FBS and 2% P/S ( /v). The non-tumorigenic prostate epithelial cell lines NPTX and HPr-1 were maintained in Keratinocyte-SFM (Life Technologies; catalogue number: 17005-042) supplemented with human recombinant epidermal growth factor and bovine pituitary

w extract (Life Technologies; catalogue number: 3700-015) and 1% ( /v) P/S. All cells were incubated o v at 37 C and 5% ( /v) CO2.

3.2 Transfection

3.2.1 Small interfering RNA

To knockdown ICK expression in PCa cells, small interfering RNA (siRNA) specific for the ICK RNA were obtained from three different commercial companies (table 3.1). The corresponding scrambled RNA oligo from each manufacturer was used as a negative control.

Sequence Catalogue Manufacturer Sense sequence Anti-sense sequence No. No.

siRNA-1 Ambion S22514 GGACUCGCUUUAUUCACAtt UGUGAAUAAAUGCGAGUCCtt

siRNA-2 Dharmacon L-004811-00- SMARTpool:ON-TARGET plus siRNA

005 Pool of four sequences

siRNA-3 Invitrogen 10620318 GGCACUUCGAUAUCCUUACUUCCAA UUGGAAGUAAGGAUAUCHAAHUHCC

Table 3.1. Short interfering RNA sequences for ICK knockdown.

A total of 240,000 cells were seeded on a 6 well plate 24 hr before transfection. Cells were transfected with siRNA using Lipofectamine RNAiMAX (Life Technologies; catalogue number: 13778- 075). Five microlitres of RNAiMAX was mixed with 250 µL Opti-MEM® reduced serum medium (Life Technologies; catalogue number: 31985062) and left for 5 min at room temperature. Meanwhile, 5 l of 20 M of siRNA was diluted with 250 l Opti-MEM® and left for 5 min. The two mixtures were combined and incubated for a further 20 min at room temperature. Finally, the mixture was added dropwise into the cells and incubated for 6-12 hr. Cells were collected 72, 96 or 120 hr post transfection.

3.2.1 ICK expression plasmid

To overexpress ICK in PCa cells, a plasmid which encoded the full length human ICK protein tagged with green fluorescent protein (GFP) at the C-terminus region (pCMV6-ICK-GFP) was obtained from Origene (catalogue number: RG216454) (figure 3.1).

Figure 3.1. Map of pCMV6-ICK-GFP plasmid from Origene.

The plasmid was propagated in Escherichia coli as per the protocol outlined by PROMEGA (2014). Bacterial colonies were subsequently grown in ampicillin-resistant agar overnight at 37°C. Colonies were transferred to a 40 mL tube containing Luria broth and ampicillin (100 µg/mL) and incubated v for 18 hr at 37°C. Five hundred microlitres of the culture was stored in 50% ( /v) glycerol stock at - 80°C. The plasmid was purified using Spin MiniPrep Kit as per the manufacturer’s instructions (QIAGEN; catalogue number: 27104) and was then transfected into the C4-2B cells using X- tremeGENE HP DNA transfection reagent (Roche; catalogue number: 06 366 236 001). Eight microlitres of X-tremeGENE HP was mixed with 200 l of Opti-MEM® reduced serum medium, 2.5 g of plasmid and incubated for 15 min at room temperature. The mixture was added dropwise into the well and incubated for at least 6 hr. Cells were collected 72, 96 or 120 hr post transfection.

3.3 Quantitative real-time polymerase chain reaction

A cell pellet was collected following trypsinisation and the total RNA in each sample was purified using a QIAGEN RNeasy Mini Kit as per the manufacturer’s instructions (catalogue number: 74104). The total RNA concentration was measured using a spectrophotometer at 260 nm and 280 nm (Nanodrop, Thermoscientific). The RNA purity was calculated using the 260:280 nm ratio and a ratio of ~2 was considered acceptable. Between 0.5 and 2 µg of RNA was used to synthesize cDNA using the reagents and protocol provided by Life Technologies (catalogue number: 18080400). Quantitative PCR was performed by adding 5 µL of Syber Green (Life Technologies; catalogue number: 4472908), 0.1 µL of each reverse and forward primer specific for the genes of interest and internal control (60S ribosomal protein L32 table 3.2), 3.8 µL of RNAse free water and 1 µL of cDNA to a 384 well plate. Each sample was repeated in triplicate and 3 non-template controls were run with each primer. The fluorescence signal in each sample was measured using a Life Technologies ViiA 7 system as per manufacturer’s instructions (Life Technologies).

Primer Manufacturer Forward sequence Reverse sequence

ICK Sigma Aldrich TTGCTTTTATGCCCTCTGAC GACCCTTCCCCTGGTTATTCC

EGFR Sigma Aldrich CCGTCCAGTATTGATCGGGAG CCACCTCACAGTTATTGAACATCC

p53 Sigma Aldrich GCGAATTCCAGTCTGAGTCAGG AAGGATCCAAGAGGAGCCGCAGT

Rpl-32 Sigma Aldrich CCCCTTGTGAAGCCCAAGA GACTGGTGCCGGATGAACTT

Table 3.2. Primer sequences (5’ to 3’) and manufacturers.

The fold change in mRNA was determined from the average threshold cycle number (Ct) for each set of samples. The Ct number is the number of cycles at which the fluorescence signal in the samples exceeds the background signal. The fold change in each gene was calculated using the Pfaffl equation: (Pfaffl, 2001).

3.5 Western blotting

3.5.1 Protein lysate preparation

Following trypsinisation, the insoluble protein pellet was collected and washed once with 1X phosphate buffered saline (PBS). The insoluble protein pellet was incubated with 30- 60 µL 1X cell w lysis buffer (CLB) containing 150 mM NaCl, 1.0% ( /v) Triton X-100, 50 mM Tris pH 8.0 and 1 mM phenylmethanesulfonylfluoride on ice for 20 min. The insoluble protein was pelleted by microcentrifugation at 4°C for 20 min and the supernatant was recovered.

3.5.2 Measurement of total protein concentration

A standard curve was created by diluting a 2 mg/mL solution of bovine serum albumin (Thermoscientific; catalogue number: 23209) to 9 concentrations (2000, 1500, 1000, 750, 500, 250, 125, 25, 0 µg/mL) with CLB. The total protein concentration was calculated using a Bicinchoninic acid (BCA) protein assay kit supplied by Thermoscientific (catalogue number: 23227). The BCA reagent was prepared as per the manufacturer’s instructions and 2 μl of protein sample was added to 200 µL of reagent. The solution was incubated at 37°C for 30 min and the light intensity at 562 nm was measured with the FLUOstar Omega microplate reader (Isogen Life Science B.V). The total protein in each sample was determined based on the standard curve.

3.5.3 SDS-PAGE gel electrophoresis and protein transfer

All samples were adjusted to the same concentration, typically between 10 and 30 µg. Each sample was diluted to the same total volume (9 µL). Two microliters of 6X sample buffer containing 350 mM

v v w v Tris-HCL (pH 6.8), 30% ( /v) glycerol, 21.4% ( /v) mercaptoethanol, 10% ( /v) SDS and 0.01% ( /v) bromophenol blue was added to each sample and the mixture was incubated at 100oC for 8 min.

w Equal concentrations of sample were loaded onto the SDS-PAGE gel with either 10% ( /v) or 12.5% w ( /v) acrylamide. Five microliters of the Rainbow molecular weight marker (GE Healthcare; catalogue number: RPN 800E) was also loaded. The gel was run at 100 V for 60 min in running buffer

w containing 25 mM Tris-HCl, 192 mM glycine and 0.1% ( /v) SDS. Following gel electrophoresis, the proteins on the gel were transferred to a PVDF membrane at 100 V for 75 min in transfer buffer

v containing 25 mM Tris-HCl, 192 mM glycine and 20% ( /v) methanol.

3.5.4 Blocking and blotting of the membrane.

w The membrane was blocked with 5% ( /v) non-fat milk in Tris-buffered saline-Tween 20 (TBST, 20 w mM Tris-HCl, 137 mM NaCl, 0.1% ( /v) Tween 20) for 60 min. The membrane was washed three w times for 5 min each and was incubated with the primary antibody (table 3.3) in 5% ( /v) non-fat milk overnight at 4°C. The membrane was washed for 5 min three times with TBST and incubated with w the appropriate horseradish peroxidase (HRP)-conjugated secondary antibody (table 3.3) in 5% ( /v) non-fat milk for 60 min at room temperature. The membrane was washed 3 times for 5 min.

Catalogue Estimated size Antibody Species Dilution Manufacturer number (kDa)

ICK Rabbit 1:250 H00022858-D01P Abnova Corporation 72

ICK Goat 1:250 sc-48020 Santa Cruz biotechnology 72

ICK Mouse 1:250 sc-365244 Santa Cruz biotechnology 72

ICK Rabbit 1:250 PA001113 Sigma-Aldrich 72

Actin Goat 1:1000 sc-1616 Santa Cruz biotechnology 44

Phospho- Rabbit 1:1000 4511S Cell Signalling 38 p38

Phospho- Rabbit 1:1000 3281S Cell Signalling 125 FAK

PRK2 Rabbit 1:1000 2612S Cell Signalling 140

Phospho- Rabbit 1:1000 3771S Cell Signalling 125 Jak-2

ID1 Rabbit 1:500 Sc-488 Santa Cruz biotechnology 16

phospho- Rabbit 1:1000 9461S Cell Signalling 82 Fox01

Cyclin-B1 Mouse 1:500 Sc-7393 Santa Cruz biotechnology 55

phospho-c- Rabbit 1:1000 3270 Cell signalling 48 jun

p16 Mouse 1:1000 5A8A4 Thermoscientific 16

ARK-1 Rabbit 1:500 sc-25425 Santa Cruz biotechnology 45

EGFR Rabbit 1:500 Sc-03 Santa Cruz biotechnology 170

p53 Mouse 1:1000 M7001 Dako 53

p21 Mouse 1:500 M7202 Dako 21

Cleaved Rabbit 1:1000 9541 Cell signalling 89 PARP

Ƴ-tubulin Rabbit 1:1000 T5192 Sigma-Aldrich 48

IgG HRP Rabbit 1:5000 NA934V GE Healthcare conjugated

IgG HRP Mouse 1:10000 NA931V GE Healthcare conjugated

IgG HRP Goat 1:5000 Sc-2020 Santa Cruz biotechnology conjugated

Table 3.3. Primary and secondary antibodies used in study.

3.5.4 Signal detection

Positive signal was visualised by enhanced chemiluminescence (ECL) using a HRP substrate from Merck-Millipore (catalogue number: WBKLS0500). The signal intensity was measured on a ChemiDoc MP system from Biorad using ImageLab 4.0.1 data analysis software (Biorad).

3.6 Immunofluorescence staining

5.0 x104 cells were seeded on a sterile coverslip inside a 24 well plate. Cells were transfected with scrambled control or siRNA-1. Forty eight hours post transfection, the cells were washed twice with v PBS, fixed with 4% ( /v) formaldehyde in PBS for 10 min and washed another three times with PBS. v The cells were permeabilized with 0.25% ( /v) Triton X-100 in PBS for 15 min and blocked for 60 min w in 2% ( /v) BSA. The cells were incubated with the Sigma ICK antibody (1:250) for 120 min at room temperature. The cells were washed three times with PBS for 10 min and incubated with Alexa Fluor® 488 secondary antibody (Abcam; catalogue number: ab150077) for 30 min prior to washing with PBS. Counterstaining of the nuclei was performed with 4’,6-diamidino-2-phenylindole (DAPI) (Life Technologies; catalogue number: D3571) and the cells were washed with PBS. The coverslip was mounted on a slide with mounting medium and left to dry overnight before being visualised with a Nikon E600 fluorescence microscope (Rhodes) at wavelength 488 nm for ICK and for 358 nm for DAPI.

3.7 Luciferase reporter assay

Luciferase reporter assay was performed with the pER-1 plasmid (luciferase reporter containing the EGF-R promoter, kindly donated by Dr A. Johnson, NCI, MD, USA) and pRL-TK-Luc (internal control). 0.25 µg of these two plasmids were co-transfected with either the 0.25 µg of pCMV6-GFP or pCMV6- ICK-GFP plasmid. The DNA was mixed with 1 µL of Lipofectamine™ 2000 reagent (Life Technologies; catalogue number: 11668-027) in 50 µL of Opti-MEM® reduced serum medium as per the manufacturer’s instructions. Luciferase activity was determined with the Dual Luciferase reporter assay kit (Promega; catalogue number: TM040). Luminescent signal was quantitated with the FLUOstar Omega microplate reader (Isogen Life Science B.V) and was normalized with the internal control (Renilla).

3.8 Flow cytometry

3.8.1 Annexin V staining

Apoptotic cells were examined by the Annexin V staining kit (BD Pharmingen; catalogue number: 550474) as per the protocol provided by the manufacturer. After staining, cells were analysed with a BD LSR II flow cytometer (San Jose, USA) based on the intensity of fluoresescein isothiocynate and propidium iodide staining. Data was analysed using FlowJo data analysis software (Oregon, USA).

3.8.2 Cell cycle analysis

v o Cells were fixed with 1 mL of cold 70% ( /v) ethanol and stored at 4 C for 24 hr. After fixation, cell pellets were collected by centrifugation, resuspended in 500 μl of PBS and incubated at 4oC for 24 hr prior to performing flow cytometry analysis. The cells were stained with 15 µL of propidium iodide (1 mg/ml) and 25 µL of RNase (1 mg/ml) for 30 min. Cell cycle analysis was performed with a BD LSR II flow cytometer (BD Biosciences) and analyzed using FlowJo data analysis software.

3.9 Statistical analysis

Statistical analysis was performed using Microsoft Excel software. For most of the qRT-PCR experiments and the luciferase reporter assay, the experiment was repeated at least three times with samples collected from separate experiments. The fold change was determined for each sample, for each experiment and the mean and standard deviation was calculated from the three replicate experiments. For Western blot analysis, the relative protein expression was normalized with that of the control sample using the ImageLab software and the mean and standard deviation was calculated from three replicate experiments. A Students T-test was used to determine significance and a P value of <0.05 was considered significant.

Chapter 4.0 Intestinal cell kinase regulates epidermal growth factor receptor expression in prostate cancer cells

4.1 Introduction

As described earlier, the search for novel therapeutic targets for prostate cancer has identified the protein, intestinal cell kinase (ICK) as potential regulator of growth in prostate cancer cells (Haggarth et al., 2011). The function of ICK is still largely unclear. Activation of ICK has been shown to occur by phosphorylation of a threonine-aspartate-tyrosine motif in the activation loop. In contrast to the mitogen activated protein kinases (MAPKs), which are activated by growth factors, the upstream activating kinase for ICK is cell cycle related kinase (CCRK). Deactivation is via protein phosphatase 5 (PP5) and thus with CCRK, the pair of proteins act as yin-yang regulators of ICK activity (Fu et al., 2006) (figure 4.1). Recently, CCRK was shown to be downstream of mammalian Sonic hedgehog signal transduction (Ko et al., 2010) and may thus play important roles in many cellular functions. CCRK is a suppressor of apoptosis (MacKeigan et al., 2005) and is known to be important for cell growth (Wohlbold et al., 2006). It is a novel candidate oncogene in hepatocellular carcinoma (Feng et al., 2011). PP5 plays an important role in the cellular response to DNA damage and in control of cell division (Golden et al., 2008) by regulating cell cycle progression at the p53-dependent G1 checkpoint (Zuo et al., 1998). Identification of ICK as a downstream target of CCRK and/or PP5 supports a role of ICK in the regulation of proliferation and/or apoptosis and in modulating some branch of checkpoint signalling in response to stress and DNA damage.

Figure 4.1. The activation and downstream targets of ICK. Activators are shown in green and deactivators in red.

Recently, proteins such as Scythe and Raptor have been identified as direct ICK substrates. Phosphorylation of Scythe has been shown to regulate cell survival in bone tumour cells (Yong and Wang, 2012). On the other hand, phosphorylation of Raptor is essential in activation of the mammalian target of rapamycin (mTOR), which is involved in the regulation of normal and cancer cell growth (Laplante and Sabatini, 2009). mTORC1 stimulates cell growth and proliferation by phosphorylation of two key regulators of mRNA translation and ribosome biogenesis, ribosomal protein S6 kinase 1 and eukaryotic initiation factor 4E-binding protein 1 (Ma and Blenis, 2009). In addition cyclin D1 and c-Myc are specific downstream targets of activated mTORC1 (Fu et al., 2009). Nevertheless, it is still unclear whether ICK regulates cell proliferation and cell cycle progression through activation of the mTORC1 signalling pathway (Wu et al., 2012).

To better understand how ICK regulates PCa cell proliferation, in this study ICK was either reduced or overexpressed in PCa cells. Examination of a series of proteins associated with cell proliferation revealed that ICK regulates EGFR, a growth factor receptor that regulates cell proliferation and cell cycle progression. In PCa cells, knockdown of ICK resulted in downregulation of EGFR protein, while overexpression of ICK induced EGFR protein expression. Both EGFR promoter activities and mRNA expression were upregulated by ICK, suggesting that ICK regulates EGFR expression through

34 induction of gene transcription. Consistent with these findings, overexpression of ICK in a non- tumorigenic prostate epithelial cell line not only induced cell cycle progression, but also upregulated EGFR protein. These data confirm that EGFR functions as a novel ICK downstream target in PCa cells.

4.2 Results

4.2.1 ICK expression in prostate cancer cell lines

4.2.1.1 Examination of ICK mRNA level by quantitative real time- polymerase chain reaction (qRT-PCR)

To understand the function of ICK in PCa cells, the levels of ICK mRNA were examined in a panel of prostate cell lines (table 4.1) with qRT-PCR. Two non-tumorigenic human prostate epithelial cell lines, NPTX and HPr-1 and six human PCa cell lines, PC-3, DU145, LNCaP, C4-2, C4-2B and 22Rv1 were grown in their corresponding growth media before being lysed for RNA extraction (table 4.1). Examination of ICK mRNA level with a pair of ICK specific primers revealed that ICK mRNA was highly upregulated in all of the PCa cell lines when compared to the non-tumorigenic prostate epithelial cells (figure 4.2). However, the level of ICK did not appear to correlate with the aggressiveness of the cancer cell lines, since its level in the most aggressive cell line (i.e. PC-3) was indeed lower than the less aggressive cell line 22Rv1.

Cell Line Description

NPTX  Immortalized normal prostate epithelial Non-tumorigenic HPr-1  Immortalized normal prostate epithelial  High tumorigenicity PC-3  Bone derived  Androgen unresponsive  Moderate tumorigenicity DU145  Brain derived  Androgen unresponsive  Very low tumorigenicity LNCaP  Lymph node derived Tumorigenic  Androgen responsive  Moderate tumorigenicity C4-2  Derived from LNCap cells  Androgen resistant  High tumorigenicity C4-2B  Derived from C42 cells  Androgen resistant  Moderate tumorigenicity 22RV1  Human carcinoma xenograft derived  Mildly androgen dependent Table 4.1. Summary of the cell lines used in this study.

Fold change in ICK mRNA across prostate cell lines

7 C4-2B

5 DU145 22Rv1 4 C4-2

3 PC-3 LNCaP 2 NPTX 1 HPr-1

mRNA level (relative NPTX) to (relative level mRNA 0 Cell Line

Figure 4.2. qRT-PCR of ICK expression in different cell lines. mRNA isolated from the different cell lines was examined by qRT-PCR with the ICK primers and the results are presented as fold change (mean ± SD) relative to the value of NPTX cells for triplicate samples from a single experiment.

4.2.1.2 Detection of endogenous ICK by Western blot analysis

Next, ICK protein level in PCa cells was determined using Western blot analysis. To optimize the conditions for Western blot analysis, four commercially available antibodies were tested against protein lysates of DU145 and PC-3 cells.

As shown in Figure 4.3, the antibodies from Abnova and Santa Cruz failed to generate a specific signal corresponding to the ICK protein in both DU145 and PC-3 cells. Other researchers noted that the intensity of the band detected by the Santa Cruz monoclonal antibody varied between experiments unrelated to those reported here. Consequently, it was deduced that the antibody was not detecting endogenous ICK but was binding another protein with a similar size. On the other hand, the antibody from Sigma produced a band in DU145 and PC-3 cell lysates with size similar to that of ICK. This antibody was therefore chosen for subsequent analysis of ICK expression in all the cell lines.

Figure 4.3. Western blot analysis of endogenous ICK protein in PCa cells using various anti-ICK antibodies. 20 micograms of total cell lysate from DU145 and PC-3 cells was examined with Western blotting using four different anti- ICK antibodies and actin (loading control). The same membrane was stripped of antibody and probed with the Adnova and Santa Cruz antibodies and the same actin image was used as a loading control for each antibody. A separate set of cell lysates was used for the Sigma antibody. This image was spliced together to remove empty lanes.

Next, the levels of ICK protein were determined in the same panel of prostate cell lines described earlier (figure 4.4). Although ICK protein could be detected in all cell lines, the level was higher in the PCa cell lines when compared to the non-tumorigenic prostate epithelial cells. This appeared to correlate with the result from the qRT-PCR analysis (figure 4.2). ƴ-tubulin was used as a loading control, as endogenous expression remains relatively consistent across different cell lines.

Figure 4.4. Western blot analysis of ICK protein expression in different PCa cell lines. Fifteen micorgrams of total cell lysate from all cell lines was examined with Western blot analysis against ICK and ƴ-tubulin (loading control) antibodies. The image was spliced together to remove empty lanes.

4.2.1.3 Subcellular localisation of ICK in prostate cancer cells.

To investigate the localisation of ICK protein within the PCa cells, immunofluorescence staining was performed with the ICK antibody. Although high levels of ICK were detected in the cytoplasm, ICK was also found in the cell nuclei as indicated by the colocalization of the signal with the DAPI staining (figure 4.5). These observations concur with previously published data by Fu et al. (2005), which showed GFP-conjugated ICK to be expressed in both the cytoplasm and nucleus of human embryonic kidney cells.

Figure 4.5. Immunofluorescence staining of C4-2B cells with DAPI and ICK antibody (40x magnification) C4-2B cells were prepared as per the protocol outlined in chapter 3.6. Following incubation with primary and secondary antibodies cells were counterstained with DAPI. (A) DAPI staining in blue. (B) ICK staining is shown in red. (C) Overlay staining in purple. Open arrow indicates nucleus, closed arrow indicates cytoplasm (Scale bar = 100 µm).

4.2.1.4 Knockdown of ICK expression in prostate cancer cells by ICK specific siRNA.

To determine the function and the downstream targets of ICK in PCa cells, siRNA-mediated gene knockdown was performed to suppress the endogenous expression of ICK. Three different ICK- specific siRNAs (siRNA 1-3) that target different sequences of the ICK mRNA were trialled in PC-3 cells. Transfection of each of the three siRNAs resulted in a marked downregulation of the level of ICK mRNA when compared to cells transfected with the scrambled control 72 (figure 4.6). siRNA-1 was chosen for further validation with C4-2B cells and for subsequent experiments involving knockdown of ICK (figure 4.6).

To confirm that the knockdown of ICK mRNA by siRNA transfection led to suppression of ICK protein, total cellular protein was collected from PC-3 cells transfected with either the scrambled control or siRNA-1 and analysed with Western blots against ICK antibody. Knockdown of ICK with siRNA-1 resulted in almost complete reduction of the ICK protein in PC-3 cells (figure 4.7). Similarly,

39 transfection of C4-2B with the same siRNA also resulted in a reduction of ICK protein, suggesting that the siRNA approach can effectively suppress endogenous ICK expression in PCa cells (figure 4.7).

Figure 4.6. qRT-PCR analysis of ICK mRNA following knockdown with siRNA-1, -2 and -3 in PC-3 cells and siRNA-1 in C4-2B cells. (A-C) Changes in ICK mRNA level in PC-3 cells 72 hours following ICK knockdown with siRNA-1, 2 and 3 in PC-3 cells. Data represents mean + SD or triplicate samples from a single experiment. (D) Further validation of the effect of siRNA-1 on ICK expression in C4-2B cells 72 hours post transfection. (D) data represents mean + SD from three replicates.

Figure 4.7. Western blot analysis of ICK following knockdown with siRNA-1 in PC-3 and C4-2B cells. Cells transfected with either scrambled control or siRNA-1 were lysed 72 hours post transfection. Twenty microlitres of total cell lysate was examined with Western blot analysis against ICK and actin (loading control) antibodies.

4.2.2 Identification of EGFR as a novel downstream target of ICK.

Since ICK is known to regulate cell cycle progression, in order to delineate its downstream signalling pathway, the effect of ICK knockdown on the expression of a selection of proteins involved in the regulation of cell cycle progression and cell proliferation of cancer cells was first investigated using Western blotting (table 4.2). As the 22Rv1 cell line expressed the highest level of ICK protein (figure 4.4), it was used initially for the knockdown experiments. Unfortunately, all experiments with 22Rv1 cell line were discontinued when the cells were found to be contaminated with xenotropic murine leukaemia virus-related virus. The C4-2B cell line, which also expressed high levels of ICK, was thus chosen as it attached easily to plates/flasks and has a high proliferation rate.

CELL PROLIFERATION-RELATED PROTEINS

Protein Characteristics

 p16 inhibits the activity of cyclin-dependent kinase complexes necessary for

p16 transition through the G1 phase of the cell cycle (Plath et al., 2000)  Loss of p16 expression common in metastatic cancers (Jarrard et al., 2002)

Phosphorylated-  tyrosine kinase  involved in cell proliferation (Frenzel et al., 2006) Janus kinase-2  involved in the autocrine signal transduction of the growth factor, prolactin (Jak-2) in metastatic and CRPC (Dagvadorj et al., 2007)

 transcription factor that induces DNA synthesis (Maw et al., 2009) Inhibitor of DNA-  Increased expression associated with increasing PCa tumour grade (Sharma binding 1 (ID1) et al., 2012)

 transcription factor  important in balancing cell growth and cell cycle arrest in response to stimuli phosphorylated  phosphorylated protein translocates from the nucleus to the cytoplasm Forkhead box O1 where it is degraded (Glauser and Schlegel, 2007) (FOXO1)  deregulated expression promotes the development of CRPC (Zhao et al., 2014)

 key initiator of mitosis (Jackman et al., 2003) Cyclin B1  expression of the cyclin B family of proteins increase throughout cancer progression (Maddison et al., 2004)

 kinase critical for cell cycle control (Fu et al., 2007) Aurora related kinase-  overexpression can result in errors in spindle formation, chromosome 1 (ARK-1) segregation errors and errors in cytokinesis

 a cell surface receptor  activated by extracellular ligands such as EGF Epidermal growth  initiates MAPK signalling cascade and PI3K pathway (Dhillon et al., 2007) factor receptor (EGFR)  EGFR-MAPK signalling pathway is involved in cell proliferation  aberrant activation present in many cancers  EGFR overexpression in ~50% of cancers (Roberts and Der, 2007)

Table 4.2. Summary of cell proliferation proteins and their functions.

Examination of each protein in the above table using Western blotting revealed that expression of most of the proteins (Jak-2, ID1, cyclin B1 and ARK-1) remained unchanged following ICK knockdown in C4-2B cells (figure 4.8A). A slight change in the level of p16 and FOXO1 expression was observed. Most importantly, the protein expression of EGFR, a key regulator of cell proliferation which is frequently overexpressed in PCa, was found to be downregulated significantly following ICK

42 knockdown, suggesting that EGFR may function as the main downstream target of ICK in PCa cells (figure 4.8 B).

(A) (B)

1.2

0.8

0.6 *

0.4

0.2

Band intensity (relative to control) to (relative intensity Band 0 Scramble siRNA-1

Figure 4.8. Western blot analysis of cell proliferation-related proteins in C4-2B cells following ICK knockdown. (A) C4-2B cells were transfected with either scrambled control or siRNA-1 then lysed 72 hr later. Twenty microlitres of total cell lysate was analysed with Western blotting using antibodies against ICK, phospho-Jak-2, ID1, phospho-Fox01, cyclin-B1, EGFR and actin (loading control). (B) Graph represents mean + SD from 3 replicate measurements of EGFR protein following ICK knockdown. *P<0.05 Student’s t-test.

4.2.2.1 ICK regulates EGFR mRNA expression.

To investigate if the decrease in EGFR protein level after ICK knockdown is mediated through regulation of EGFR mRNA levels, C4-2B cells were transfected with either scrambled control or siRNA-1. Changes in EGFR mRNA expression were then determined using qRT-PCR. Knockdown of ICK resulted in downregulation of EGFR mRNA level in C4-2B cells (figure 4.10). Similar results were observed in C4-2B cells that were transfected with a second ICK siRNA targeting another mRNA sequence (data not displayed), further supporting the conclusion that ICK regulates EGFR protein expression through modulation of the EGFR mRNA level.

1.8

1.6

1.4

1.2

0.8 * 0.6

mRNA level (relative to to control) level (relative mRNA 0.4

0.2

0 Scramble siRNA-1

Figure 4.9. qRT-PCR analysis of EGFR mRNA expression in C4-2B cells following ICK knockdown. Changes in EGFR mRNA level in C4-2B cells 72 hr following transfection with scramble or siRNA-1. Data represents mean + SD from 3 replicate experiments. *P<0.05 Student’s t-test.

4.2.2.2 Overexpression of ICK in PCa cells induces EGFR expression.

In order to confirm the above findings, C4-2B cells were transfected with a construct that expresses a GFP-tagged ICK protein. Ectopic expression of ICK mRNA and protein expression was then confirmed with both qRT-PCR and Western blot analyses (figure 4.10). Examination of the EGFR mRNA with qRT-PCR indicated that ICK overexpression resulted in increased levels of EGFR mRNA (figure 4.11). Consistent with the changes in mRNA, there was also a significant induction in EGFR protein expression (figure 4.12) in ICK overexpressing cells. These findings provide solid support that ICK regulates EGFR protein level through modulation of EGFR mRNA expression.

(A) (B)

3.6

2.4

1.8

1.2

0.6

0 mRNA level control) level (relative to mRNA pCMV6-GFP pCMV6-ICK-GFP

Figure 4.10. qRT-PCR and Western blot analysis of ICK mRNA and protein expression following transfection of C4-2B cells with an ICK overexpression vector. (A) Changes in ICK mRNA level in C4-2B cells 72 hr following transfection with pCMV6-GFP or pCMV6-ICK-GFP. Data represents mean + SD from 3 replicate experiments. (B) Protein level was analysed with Western blot analysis against ICK and actin (loading control) in 20 µL of total cell lysate.

4.2

3.6 *

2.4

1.8

1.2

mRNA level (relative to to control) (relative level mRNA 0.6

0 pCMV6-GFP pCMV6-ICK-GFP

Figure 4.11. qRT-PCR analysis of EGFR mRNA following ICK overexpression in C4-2B cells. Changes in EGFR mRNA level in C4-2B cells 72 hr following transfection with pCMV6-GFP or pCMV6-ICK-GFP. Data represents mean + SD from 3 replicate experiments. *P<0.05 Student’s t-test.

3.2

2.8 * 2.4 2 1.6 1.2 0.8 0.4

Band intensity (relative to control) to (relative intensity Band 0 pCMV6-GFP pCMV6-ICK-GFP

Figure 4.12. Western blot analysis of EGFR following ICK overexpression in C4-2B cells. C4-2B cells were transfected with either pCMV6-GFP or pCMV6-ICK-GFP, lysed 72 hr later. Twenty microlitres of total cell lysate was analysed with Western blotting against ICK, EGFR and actin (loading control). Graph represents mean + SD from 3 replicate experiments. *P<0.05 Student’s t-test.

To investigate whether ICK induced EGFR mRNA through upregulation of EGFR gene transcription, a luciferase reporter assay was performed. This was done by transfecting C4-2B cells with an ICK expression construct and a construct that expresses the luciferase reporter gene driven by the EGFR promoter. The effect of ICK on the EGFR-promoter activities was then determined by measuring the luciferase activity with a luminometer. In cells overexpressing ICK, a higher level of luciferase activity was observed, indicating that ICK upregulates EGFR gene transcription through induction of the EGFR-promoter (figure 4.13).

2.8

2.4 *

1.6

1.2

0.8

0.4 Promoter activity (relative to to activity control) (relative Promoter

0 pCMV6-GFP pCMV6-ICK-GFP

Figure 4.13. Luciferase reporter activity in control and ICK overexpressed C4-2B cells. C4-2B cells were co-transfected with a bioluminescent reporter gene driven by the promoter region of EGFR and either pCMV6-GFP or pCMV6-ICK-GFP. The cells were collected 48 hr post transfection. The total protein was collected and the absorbance measured using a luminometer. Each sample was adjusted for an internal standard. Data represents mean absorbance + SD from 3 replicate experiments. *P<0.05 Student’s t-test.

In order to confirm that ICK also regulated EGFR in non-tumorigenic prostate epithelial cells, Western blot analysis was performed to examine EGFR protein level in HPr-1 cells stably transfected with either empty vector control or vector expressing ICK. As shown in figure 4.14, a significant induction of EGFR was observed in the ICK overexpressing cells.

To further investigate whether the induction of EGFR by ICK in non-tumorigenic cells was associated with an increase in cell proliferation, cell cycle analysis was performed on the control and ICK overexpressed stable HPr-1 cell lines (figure 4.15). Consistent with an increase in cell cycle progression, a lower percentage of cells in G1 phase was observed in the ICK overexpressing cells when compared to the control cells. Moreover, the percentage of cells in G2M phase was higher in the ICK overexpressed cells relative to the control.

1.8

1.6

1.4 *

1.2

0.8

0.6

0.4

Band inetnsity (relative control) to (relative inetnsity Band 0.2

0 Empty vector ICK overexpressing cells

Figure 4.14. Western blot analysis of EGFR following in ICK overexpressing HPr-1 cells. Cells were transfected with either control or over expression vector. Fifteen microlitres of total cell lysate was analysed with Western blot analysis against ICK, EGFR and actin (loading control). Graph represents mean + SD from 3 replicate experiments. *P<0.05 Student’s t-test.

Figure 4.15. Cell cycle analysis of HPr-1 cells overexpressing ICK. Empty vector and ICK overexpressed cell lines were seeded and collected after 48 hours. Cells were prepared for analysis as outlined in chapter 2 and measured using LSR II flow cytometer. This experiment was repeated in duplicate.

4.3 Discussion

Although ICK is known to regulate cell proliferation in normal and cancer cells, the underlying mechanism is still largely unknown. In this study, EGFR was identified and validated as a novel downstream target regulated by ICK in PCa cells.

ICK mRNA has previously been shown to be upregulated in breast, colon and lung cancer cell lines (Sturgill et al., 2010). In this study, ICK mRNA and protein levels were also found to be higher in cancer cells relative to non-tumorigenic cells. Interestingly, ICK mRNA levels in the LNCaP cells were lower than the castration resistant PCa cell lines (C4-2 and C4-2B cells). In a previous study, ICK transcription was found to be activated by FOXA1, a transcription factor which promotes aberrant androgen receptor activation in castration resistant PCa cells (Sturgill et al., 2010). This may indeed explain the increase in ICK mRNA in the castration resistant line. Surprisingly, however, the protein level of ICK was found to be higher in LNCaP cells among the three cell lines. Therefore, it remains to be elucidated whether ICK may play any role in the development of the castration resistant phenotype of the PCa cells.

While the exact function of ICK in cancer is not clear, ICK appears to play an essential role in the normal development of multiple tissues, as evidenced by the developmental disorder, endocrinecerebro-osteodysplasia, associated with a mutation in the ICK gene (Chen et al., 2013). Examination of the gene expression profile of the skin fibroblasts from the affected patients revealed that the main signalling pathway associated with the condition is the JAK-STAT cascade (Dutta and Li, 2001). JAK-STAT signalling has been shown to regulate both cell proliferation and invasion (Dutta and Li, 2001) Aberrant activation of JAK-STAT has been reported in a number of cancers (Tam et al., 2007). However, in PCa cells, the phosphorylation level of JAK2, which regulates its activation, was not affected by knockdown of ICK. Consistently, knockdown of ICK also failed to affect expression of ID1, a protein known to be regulated by JAK2 (Tam et al., 2008). Thus, it is possible that the association between ICK and JAK-STAT activities could be tissue specific, although further examination is needed to confirm this hypothesis.

Considering the reported role of ICK in the regulation of cell cycle progression, it is somewhat surprising that the level of many of the cell cycle regulators such as cyclin B1 and ARK-1 remain unchanged after ICK knockdown. However, a significant decrease in EGFR mRNA and protein levels was observed in cells with knockdown of ICK. In both non-tumorigenic prostate epithelial cells and PCa cells, ectopic ICK expression has been shown to upregulate EGFR expression. Although we were unable to show the effect of ICK knockdown on EGFR promoter activities due to the fact that there

49 was an increase in apoptosis (as discussed in chapter 5), overexpression of ICK was found to significantly induce EGFR promoter activation. Therefore, ICK appears to induce EGFR expression through regulation of its promoter activities, although the exact mechanism is unclear. Since ICK has not been shown to bind to DNA, it is likely to act through an indirect mechanism rather than directly regulating the EGFR promoter.

Due to its pivotal role in maintaining cell growth and survival of both normal and cancer cells, EGFR has long been established as a key anti-cancer target. EGFR activates a long list of signalling pathways, which include the mTOR cascade. Interestingly, one of the proteins known to be phosphorylated by ICK is Raptor. Raptor is known to activate the mTOR signalling pathway, leading to subsequent induction of downstream targets essential for cell growth and survival (Davis et al., 2014). Our finding that ICK significantly upregulated EGFR mRNA and protein levels suggests that ICK may regulate mTOR activation through both direct and indirect mechanisms, and that inactivation of ICK may have dual inhibitory effect on mTOR activation.

Taken together, these findings suggest that ICK plays a key role in regulating the mRNA and protein level of EGFR in both non-tumorigenic prostate epithelial cells and PCa cells, possibly through regulation of the EGFR promoter activity.

Chapter 5.0 ICK regulates prostate cancer cell survival

5.1 Introduction

Apoptosis, also known as programmed cell death, is a process essential for eliminating tumour cells within the normal organs. Chemotherapeutic compounds, such as cabazitaxel and docetaxel, work by inducing cellular apoptosis either through induction of mitotic arrest or by inhibiting antiapoptotic proteins (Fitzpatrick and de Wit, 2014). Similar to other cancers, PCa cells are capable of evading apoptosis by modulating the expression of pro-apoptotic factors (Fernald and Kurokawa, 2013), leading to treatment failure and disease progression. The p53 and p38 signalling cascades are among the most studied pro-apoptotic pathways, are frequently inactivated in cancer, and may be involved in treatment sensitivity of PCa cells (Barbieri et al., 2013).

Although ICK has been found to regulate proteins (for example, Scythe and c-Myc) known to be important in cellular apoptosis, it has not been reported to regulate cell survival. In this study, it was determined that ICK expression is crucial for the survival of PCa cells. Knockdown of ICK in PCa cells not only increased Annexin V positive population, but also induced the cleavage of PARP, suggesting that ICK is involved in suppressing cellular apoptosis. Moreover, ICK knockdown was found to upregulate both p53 and p21 protein expression, while ectopic ICK expression was found to suppress both proteins. Therefore, the findings revealed for the first time that ICK regulates PCa cell survival, possibly through suppression of the p53/p21 signalling pathway.

5.2 Results

5.2.1 Loss of ICK induces apoptosis

To determine if ICK regulates PCa cell survival, C4-2B cells were transfected with either the scrambled control or siRNA-1. Examination of cell morphology under phase contrast microscope revealed that there was an increase in detached cells 72 hr after transfection with the siRNA-1 (figure 5.1). To determine if the increase in detached cells was the result of induction of cellular apoptosis, Annexin V staining was performed to quantify the apoptotic population in C4-2B cells after knockdown of ICK. While approximately 60% of the C4-2B cells transfected with scrambled control were viable 96 hr after transfection, a significant increase in early (quadrant 4) and late apoptosis (quadrant 2) was evident in cells transfected with siRNA-1 (figure 5.2). Similarly, an increase in apoptosis was also observed at 120 hr after transfection with siRNA-1 (figure 5.3). To further confirm the results, the level of PARP cleavage (Cl-PARP), a commonly used marker for

51 assaying cellular apoptosis, was determined in cells collected at 72, 96 and 120 hr post transfection. An increase in Cl-PARP was observed in the ICK knockdown cells at each time point relative to the control. The level of Cl-PARP appeared to be higher at 120 hr than 72 hr (figure 5.4).

Figure 5.1. Phase contrast images of C4-2B cells transfected with scramble or siRNA-1 (10x magnification). C4-2B cells were photographed at 72, 96 and 120 hr post transfection with a phase contrast microscope. (A) Scrambled control cells at 72 hr. (B) siRNA-1 cells at 72 hr. (C) Scrambled control cells at 96 hr. (D) siRNA-1 cells at 96 hr. (E) Scrambled control cells at 120 hr. (F) siRNA-1 cells at 120 hr. Arrow indicates detached cells. Scale bar = 100µm

(A)

(B)

10 9 8 7 6 Scramble 5 * siRNA-1

% Cells % 4 3 2 * 1 0 Early apoptosis Late apoptosis

Figure 5.2. Annexin V staining of C4-2B cells 96 hr post ICK knockdown. C4-2B cells were stained with Annexin V 96 hr post transfection with scrambled control or siRNA-1. (A) Representative FACS analysis of the Annexin V positive population at 96 hr. (B) Graph represents mean + SD from 3 replicate experiments for viable cells. *P<0.05 Student’s t-test.

(A)

(B)

10 9 8 * 7 Scramble 6 5 siRNA-1

% Cells % 4 3 2 1 0 * Early apoptosis Late apoptosis

Figure 5.3. Annexin V staining of C4-2B cells 120 hr post ICK knockdown. C4-2B cells were stained with Annexin V 120 hr post transfection with scrambled control or siRNA-1. (A) Representative FACS analysis of the Annexin V positive population at 96 hr. (B) Graph represents mean + SD from 3 replicate experiments for viable cells. *P<0.05 Student’s t-test.

Figure 5.4. Western blot analysis of Cl-PARP 72, 96 and 120 hr following ICK knockdown in C4-2B cells. Cells were transfected with either scrambled control or siRNA-1 and analysed with Western blotting against ICK, Cl-PARP and actin (loading control) 72, 96 and 120 post transfection.

5.2.2 Identification of p53 as a novel downstream target of ICK.

To understand how ICK regulated the survival of PCa cells, expression of a series of pro- and antiapoptotic proteins was explored using Western blot analysis following ICK knockdown. The important characteristics of the selected proteins are summarised in table 5.1.

CELL SURVIVAL-RELATED PROTEINS

Protein Characteristics

Focal adhesion  regulator of cell migration (Schaller, 2010) kinase (FAK)  expression increased in high-grade and metastatic PCa

Protein kinase-C  protein kinase involved in cell-cell interaction (Mukai, 2003) related protein kinase-2 (PRK2)

 tumour suppressor protein  acts as a transcription factor regulating the expression of many genes in response to cellular stressors such as, radiation, hypoxia, growth factor p53 withdrawal and cytotoxic drugs (Meek, 2004)  deletions at the p53 gene locus reported in 25-40% of PCa  lesions in the germ-line in 5-40% of PCa patients (Barbieri et al., 2013)

 cyclin-dependent kinase inhibitor  downstream target of p53  DNA damage-induced p53-activated p21 inhibits cyclin-dependent p21 kinases (cdks) during the G1 phase of the cell cycle and results in cell cycle arrest (Slee et al., 2004), (Weinberg and Denning, 2002)  mutations in p21 rarely cause tumours (Weinberg and Denning, 2002)

 MAP kinase  activated by extracellular stimuli including growth factors  involved in inflammation, cell growth, differentiation, cell cycle, cell p38 death (Ono and Han, 2000)  expressed in basal and epithelial prostate cells  upregulated in poorly differentiated tumours (Koul et al., 2013)

 MAP kinase  implicated in cell survival signalling. c-Jun  reduced c-Jun expression associated with development of CRPC in mice (Hubner et al., 2012)

Table 5.1. Summary of cell survival–associated proteins examined in this study.

Apart from a slight decrease in the level of phosphorylated p38 and c-jun, the majority of the proteins remained unchanged after knockdown of ICK (figure 5.5). However, the level of p53 protein, which represents the most important regulator of cell survival in both normal and cancer cells, was found to be significantly induced by ICK knockdown.

(B) (A)

2.4

1.8 * 1.2

0.6

Band intensity (relative to control) to (relative intensity Band 0 Scramble siRNA-1

Figure 5.5. Western blot analysis of cell survival proteins in C4-2B cells following ICK knockdown. (A) C4-2B cells were transfected with either scrambled control or siRNA-1, lysed 72 hr later. Twenty microlitres of total cell lysate was analysed with Western blotting against ICK, phospho- FAK, PRK2, phospho-c-Jun, phospho-p38, p53 and actin (loading control). (B) Graph represents mean + SD from 3 replicate measurements of p53 protein following ICK knockdown. *P<0.05 Student’s t-test.

5.2.2.1 ICK regulates expression of p53 and p21 in prostate cancer cells

Since p53 induces cellular apoptosis through induction of p21 protein, Western blotting was performed to investigate if ICK also regulates the level of p21 protein in PCa cells. Similar to p53, in C4-2B cells, knockdown of ICK was also found to induce p21 level, suggesting that ICK functions as a suppressor of the p53/p21 signalling pathway (figure 5.6A and B). Furthermore, a consistent and statistically significant reduction in p53 and p21 protein expression was also observed in C4-2B cells overexpressing the ICK protein (figure 5.6C-E). These findings provide strong evidence that ICK regulates PCa cell survival through modulation of the p53/p21 pathway.

(A)

(A) (B)

2.4

1.6

1.2

0.8

0.4 Band intensity (relative to control) to (relative intensity Band

0 Scramble siRNA-1

(C)

(D) (E)

2.4 2.4

1.8 1.8

1.2 1.2 * * 0.6 0.6

0 control) to (relative intensity Band 0 Band intensity (relative to control) to (relative intensity Band pCMV6-GFP pCMV6-ICK-GFP pCMV6-GFP pCMV6-ICK-GFP

Figure 5.6. Western blot analysis of p53 and p21 following ICK knockdown and overexpression in C4-2B cells. (A) Cells were transfected with either scrambled control or RNA-1, lysed 72 hr later and 20 µL of total cell lysate was analysed with Western blotting against ICK, p53, p21 and actin (loading control). (B) Graph represents mean + SD from 3 replicate measurements of p21 protein following ICK knockdown. (C) Cells were transfected with either pCMV6-GFP or pCMV6-ICK-GFP, lysed 72 hr later and 20 µL of total cell lysate was analysed with Western blotting against ICK, p53, p21 and actin (loading control) . (D) Graph represents mean + SD from 3 replicate measurements of p53 protein following ICK overexpression. *P<0.05 Students t-test. (E) Graph represents mean + SD from 3 replicate measurements of p21 protein following ICK overexpression. *P<0.05 Student’s t-test.

To investigate how ICK regulates the p53/p21 pathway, C4-2B cells transfected with either scrambled control or siRNA-1 were collected 72 hr post transfection. Changes in p53 expression were investigated at the mRNA level in triplicate experiments using qRT-PCR. As shown in figure 5.7, the level of p53 mRNA was unaffected by knockdown of ICK. Similarly, p53 mRNA level was unchanged when C4-2B cells were transfected with either the empty vector (pCMV6-GFP) or ICK overexpression vector (pCMV6-ICK-GFP), suggesting that the effect of ICK on p53 protein expression is not mediated through regulation of p53 mRNA expression.

(A) (B)

1.2 1.2

1 1

0.8 0.8

0.6 0.6

0.4 0.4

0.2 0.2

mRNA level (relative to to control) level (relative mRNA mRNA level (relative to to control) level (relative mRNA 0 0 Scramble siRNA-1 pCMV6-GFP pCMV6-ICK-GFP

Figure 5.7. qRT-PCR analysis of p53 mRNA following ICK knockdown and overexpression in C4-2B cells. Comparison of p53 mRNA level in C4-2B cells 72 hr following transfection with (A) scrambled control, siRNA-1, (B) pCMV6- GFP or pCMV6-ICK-GFP. Graphs represents mean + SD from 3 replicate experiments.

5.3 Discussion

In this study, it has been demonstrated for the first time that ICK expression is crucial for the survival of PCa cells, possibly through the regulation of the p53/p21 signalling pathway. Although ICK has not been reported to regulate cell viability, in PCa cells, knockdown of ICK was found to increase the percentage of apoptotic population and a concomitant increase in Cl-PARP. However, significant induction of apoptosis was observed only 96 hr after the transfection of siRNA-1. Since an almost complete knockdown of the ICK protein was observed within 48 hr of the transfection, this observation suggested that inactivation of ICK does not lead to an immediate induction of apoptosis.

PCa cells are highly resistant to chemotherapy-induced apoptosis. Deregulation of pro or antiapoptotic signalling pathways have been proposed as the underlying mechanisms. One of the best studied pathways is the p53/p21 signalling cascade, which is frequently inactivated in different cancers. The finding that p53/p21 expression is suppressed by ICK in PCa cells suggests that aberrant expression of ICK may also contribute to p53 inactivation in cancer cells, leading to suppression of apoptosis. Although Western blotting was performed with the stable ICK overexpressing HPr-1 cells, p53 was undetectable due to the fact that the cells were immortalised with the HPV E6 protein, which led to degradation of endogenous p53 protein. However, unlike the EGFR, p53 mRNA was not affected by ICK knockdown, suggesting that ICK regulates p53 through post-translational modifications. Currently, it is unclear whether ICK phosphorylates p53 and modulates its protein stability, since no consensus ICK phosphorylation site can be found in the p53

61 protein sequences. However, it is worth noting that among the PCa cell lines examined in this study, ICK level was found to be lower in cell lines that carry p53 mutation (DU145) or deletion (PC-3), suggesting that ICK may be less essential in cells where p53 has been inactivated.

In summary, the simultaneous induction of the p53/p21 pathway and apoptosis after ICK knockdown suggests that ICK may play an important role in regulating cell viability of PCa cells.

Chapter 6.0 General discussion

The main aim of the current study was to understand the function and mechanisms of ICK in the growth and survival of PCa cells. By screening a panel of proteins known to play roles in regulation of (1) cell proliferation and (2) cell survival, the results of this study have for the first time identified two novel downstream effectors regulated by ICK in PCa cells.

Following ICK knockdown in C4-2B cells, there were significant changes in the level of epidermal growth factor receptor (EGFR) mRNA and protein. EGFR is a cell surface receptor which, when it binds to extracellular ligands such as EGF, activates signalling cascades which include the mitogen- activated protein (MAPK) and the phosphatidylinositide 3-kinase (PI3K) pathways through the cytoplasmic domain of the receptor (Dhillon et al., 2007). Phosphorylation of specific tyrosine residues following ligand binding allows proteins such as growth factor receptor bound protein-2

(GFRB2) to dock with the receptor and form a GFRB- son of sevenless complex which in turn activates Ras, followed by Raf, mitogen- activated protein kinase kinase (figure 6.1). Aberrant activation of EGFR through overexpression, gene amplification as well as mutation has been shown to correlate with PCa disease progression. EGFR expression was found to be upregulated in low androgen environments and is suggested to play a role in the development of CRPC (Traish and Morgentaler, 2009). Since ICK has also been shown to be upregulated in PCa, it is possible that ICK may contribute to the EGFR upregulation observed in the tumour.

The results of the luciferase dual reporter assay outlined here imply that ICK regulates EGFR expression via the promoter region of the gene. The promoter region of EGFR is approximately 670 bp containing binding motifs for 9 transcription factors including max1, p53, STAT3 and c-Myc (GeneCards, 2014). Moreover, Wu et al. (2012) reported that ICK deficiency causes growth retardation, cell cycle delay and down regulation of mTORC1 activity in intestinal epithelial cells in vitro. The group also identified a phosphorylation site on mTORC1 which could bind ICK. c-Myc is a specific downstream target of activated mTORC1 (Fu et al., 2009) and thus provides a possible linkage between ICK and the regulation of EGFR transcription (figure 4.1 and 6.3).

The mTORC1 complex is also activated by EGFR via the PI3K/Akt pathway and regulates protein synthesis and ribosome biosynthesis ultimately leading to cell growth and proliferation (Populo et al., 2012) (figure 6.1). In addition, the MAPK kinase pathway has previously been shown to be upregulated in primary and metastatic PCa and that activation of this pathway can accelerate cancer progression when coupled with PTEN loss (Mulholland et al., 2012). Furthermore, cross-talk

63 between the MAPK and the PI3K/Akt pathway has been identified. Activation of Ras by PI3K stimulates the pathway whereas inactivation of Raf by Akt reduces activity of the pathway (Carracedo and Pandolfi, 2008). These data suggest that mTORC1 could be a central regulator for cell growth and proliferation (figure 4.1) integrating cellular responses to several signalling pathways including ICK. Nevertheless, this effect of ICK on EGFR induction is not restricted to cancer cells, as similar changes in EGFR expression was also observed in HPr-1 cells overexpressing the ICK protein. It is worthwhile noting that ICK expression is responsive to androgen receptor activation. The minimal ICK promoter contains consensus motifs for FOX (forkhead box) A1 and FOXA2 and β- catenin/TCF7L2 transcription factors (Sturgill et al., 2010). The FOXA1/androgen receptor complex regulates prostate cell gene expression and postnatal development (Augello et al., 2011) but may also influence tumour growth and hormone responsiveness in PCa. Recent findings suggest FOXA1 overexpression as a novel mechanism inducing castration resistance in PCa (Gerhardt et al., 2012). Clearly ICK expression may be an important component in the cellular response to androgen stimulation and therefore prostate cell growth, development and tumorigenesis. Since ICK is frequently overexpressed in PCa tissues when compared to the normal prostate, it is therefore worthwhile to further investigate whether aberrant ICK expression may play a promoting role in the development and progression of PCa.

Figure 6.1. EGFR-MAPK signalling cascade. Signal transduction triggered by EGF binding to a cell surface receptor and finishing with the activation of the transcription factor c-Myc in the nucleus. “P” represents phosphate groups. Figure adapted from (Schmidt, 2006) and (Davis et al., 2014).

Apart from regulating EGFR, the current experiments demonstrated that p53 protein levels increased following ICK downregulation (chapter 5.0), and were associated with onset of apoptosis. p53 is a tumour suppressor which acts as a transcription factor regulating the expression of a large network of genes in response to cellular stress (Meek, 2004). In healthy cells p53 is regulated by mouse double minute 2 homlog (MDM2) which binds to the transactivation domain of p53 and inhibits its interaction with the transcriptional apparatus (Meek, 2004). The levels of p53 increase following stress primarily due to post-translational modifications for example, phosphorylation or acetylation, which increase the stability of the protein (Slee et al., 2004). Phosphorylation of p53 by proteins such as ataxia telangiectasia mutated (ATM) and alternative reading frame (ARF) tumour suppressor protein cause activation of p53 which allows for subsequent phosphorylation and inhibition of MDM2 binding (figure 4.2, (Meek, 2004).

The lack of changes in p53 mRNA levels after ICK knockdown suggested that the induction of p53 protein may also be a result of post translational modification (i.e. increased half-life of the protein) (Oren, 1999), although additional experiments are needed to confirm this hypothesis. The concomitant induction of p21 strongly suggested that ICK knockdown led to activation of the p53/p21 pathway as p21 is a direct downstream target of p53 which, when activated, results in cell cycle arrest (Slee et al., 2004) and cellular apoptosis. The results of this study were consistent with a previous report, which showed that knockdown of ICK leads to induction of p21 expression in intestinal epithelial cells (Fu et al., 2009), an effect the authors attributed to decreased levels of c- Myc. Following DNA damage, p53-activated p21 inhibits the functions of cyclin dependent kinases during the G1 phase of the cell cycle as depicted in figure 6.2(Weinberg and Denning, 2002). This may lead to G1 phase cell cycle arrest, DNA repair or apoptosis. In PCa cells, the activation of the p53/p21 pathway following ICK knockdown appeared to induce cellular apoptosis, as evidenced by the increase in the annexin V positive cell population and in Cl-PARP protein levels. Cell cycle arrest may have also happened in the early stage of the ICK knockdown. Nonetheless, the current findings reveal p53/p21 as a novel downstream pathway regulated by ICK in PCa cells as summarized in figure 6.3.

Figure 6.2. p53/p21 signalling. p53 signalling pathway in response to cellular stressor. Activator refers to proteins such as ATM and ARF. “P” refers to phosphorylation. Figure adapted from (Meek, 2004).

6.1 Conclusion and future directions

The current study not only demonstrated for the first time that ICK regulates the survival of PCa cells, but also discovered the important role of ICK in regulating the expression of EGFR and p53, two key proteins that regulate the growth and survival of normal and cancer cells (figure 6.3).

Further studies are required to elucidate how ICK regulates EGFR and p53 signalling pathways. In particular, additional experiments are needed to determine the proteins (including transcription factors) targeted by ICK activity. One approach would be a characterisation of the ICK-dependent phosphoproteome (Rogne and Tasken, 2013). PCa cells would be exposed to different stable isotope labelled amino acids in cell culture allowing cellular proteins to incorporate the label. Tandem mass spectrometry would subsequently be used to identify phosphoserine, phosphothreonine, and phosphotyrosine-containing peptides and their parent proteins. This type of large-scale identification and quantification of phosphorylation events triggered by ICK activity could identify unique phosphoprotein targets and novel phosphorylation sites on known protein targets. A similar

66 approach perhaps preceded by immunoprecipitation could be used to determine whether ICK regulates p53 protein through phosphorylation.

The therapeutic benefits of standard chemotherapy regimens are limited in patients with advanced PCa and the focus has progressed to inhibition of key elements of regulator pathways in PCa cells. The current study emphasises the importance of ICK in PCa cell biology and its potential utility as a target for disruptive treatment. The concept is supported by the study of (Haggarth et al., 2011) who investigated expression of several biomarkers for PCa using tissue arrays. They found over expression of ICK was a diagnostic tool for detection of PCa with 97% accuracy.

One approach to target ICK would be a small molecule inhibitor of ICK enzyme activity. None are currently available but small molecule inhibitors which inhibit key receptor tyrosine kinases (including EGFR) have been successfully introduced to treat various cancers, including breast and colorectal cancer. These molecules tend to be competitive inhibitors of ATP binding at the catalytic domain of the enzyme and have limited specificity. Recently compounds which bind outside the ATP-binding site and modulate kinase activity by allosteric mechanisms have been developed. Inhibitors belonging to this category exhibit a high degree of kinase selectivity because they exploit binding sites and regulatory mechanisms that are unique to a particular kinase. Inhibitors of ICK could be designed and developed using methods such as high-throughput screening using biochemical or cellular assays, analogue synthesis, structure-guided design and fragment-based assembly strategies to target similar allosteric regulatory sites (Zhang et al., 2009).

The data presented demonstrated that ICK expression could be inhibited by siRNA and that this was associated with decreased expression of EGFR and apoptosis. Tissue selective delivery systems are now under development which could target ICK siRNA to PCa cells to initiate this effect in vivo. Nucleic acid aptamers are short single-stranded nucleic acids which fold into complex 3D shapes with pockets and clefts for binding of small molecules, large proteins and even whole cells (Aaldering et al., 2015). These characteristics make aptamers an attractive platform for drug delivery including siRNA. Some progress has been made using this technique for treatment of PCa. Wu et al. (2011) used aptamer conjugation targeting prostate-specific membrane antigen as a tissue-specific intracellular delivery carrier of tumour suppressor microRNA to PCa cells. This resulted in induction of cancer cell death. A similar approach could target ICK siRNA to PCa cells in vivo.

Recent approaches have used newly developed agents to target signaling pathways activated in advanced prostate cancer including the Akt/mTOR pathway (rapamycin and related compounds) and MAPK signaling pathways (kinase inhibitors). Results from studies in genetically engineered mutant mice and in human clinical trials suggest that the agents may not be effective in isolation and combination therapy using inhibitors of multiple signalling pathways potentially in conjunction with chemotherapy may be more effective. Certainly combination therapy blocks castration-resistant prostate cancer in mice (Kinkade et al., 2008). The development of ICK inhibitors would add another significant agent for this type of therapy.

In summary the findings reported in this thesis will further strengthen the prognostic and therapeutic potentials of targeting ICK in the treatment of PCa.

Figure 6.3. Summary of the novel ICK downstream targets identified in this study.

References

AALDERING, L. J., TAYEB, H., KRISHNAN, S., FLETCHER, S., WILTON, S. D. & VEEDU, R. N. 2015. Smart functional nucleic acid chimeras: Enabling tissue specific RNA targeting therapy. RNA Biol, 12, 412-25. ABDOLLAH, F., BOORJIAN, S., COZZARINI, C., SUARDI, N., SUN, M., FIORINO, C., DI MUZIO, N., KARAKIEWICZ, P. I., MONTORSI, F., KARNES, R. J. & BRIGANTI, A. 2013. Survival Following Biochemical Recurrence After Radical Prostatectomy and Adjuvant Radiotherapy in Patients With Prostate Cancer: The Impact of Competing Causes of Mortality and Patient Stratification. European Urology, 64, 557-564. AGGARWAL, R. R., RYAN, C. J. & CHAN, J. M. 2013. Insulin-like growth factor pathway: A link between androgen deprivation therapy (ADT), insulin resistance, and disease progression in patients with prostate cancer? Urologic Oncology-Seminars and Original Investigations, 31, 522-530. AKIN, O., SALA, E., MOSKOWITZ, C. S., KUROIWA, K., ISHILL, N. M., PUCAR, D., SCARDINO, P. T. & HRICAK, H. 2006. Transition Zone Prostate Cancers: Features, Detection, Localization, and Staging at Endorectal MR Imaging. Radiology, 239, 784-792. ALBADINE, R., LATOUR, M., TOUBAJI, A., HAFFNER, M., ISAACS, W. B., E, A. P., MEEKER, A. K., DEMARZO, A. M., EPSTEIN, J. I. & NETTO, G. J. 2009. TMPRSS2-ERG gene fusion status in minute (minimal) prostatic adenocarcinoma. Mod Pathol, 22, 1415-22. ALLOTT, E. H., MASKO, E. M. & FREEDLAND, S. J. 2013. Obesity and Prostate Cancer: Weighing the Evidence. European Urology, 63, 800-809. ALVAREZ-CUBERO, M. J., SAIZ, M., MARTINEZ-GONZALEZ, L. J., ALVAREZ, J. C., LORENTE, J. A. & COZAR, J. M. 2013. Genetic analysis of the principal genes related to prostate cancer: A review. Urologic Oncology: Seminars and Original Investigations, 31, 1419-1429. ARYA, M., BOTT, S. R., SHERGILL, I. S., AHMED, H. U., WILLIAMSON, M. & PATEL, H. R. 2006. The metastatic cascade in prostate cancer. Surgical Oncology, 15, 117-128. ASAI, A., OSHIMA, Y., YAMAMOTO, Y., UOCHI, T. A., KUSAKA, H., AKINAGA, S., YAMASHITA, Y., PONGRACZ, K., PRUZAN, R., WUNDER, E., PIATYSZEK, M., LI, S., CHIN, A. C., HARLEY, C. B. & GRYAZNOV, S. 2003. A novel telomerase template antagonist (GRN163) as a potential anticancer agent. Cancer Res, 63, 3931-9. ATTARD, G. & DE BONO, J. S. 2011. Translating Scientific Advancement into Clinical Benefit for Castration-Resistant Prostate Cancer Patients. Clinical Cancer Research, 17, 3867-3875. ATTIA, S., EICKHOFF, J., WILDING, G., CNEEL, D. M., BLANK, J., AHUJA, H., JUMONVILLE, A., EASTMAN, M., SHEVRIN, D., GLOCLE, M., ALBERTI, D., STAAB, M. J., HORVATH, D., STRAUS, J., MARNOCHA, R. & LIU, G. 2008. Randomized, double-blinded phase II evaluation of docetaxel with or without doxercalciferol in patients with metastatic, androgen-independent prostate cancer. Clinical Cancer Research, 14, 2437-2443. AUGELLO, M. A., HICKEY, T. E. & KNUDSEN, K. E. 2011. FOXA1: master of steroid receptor function in cancer. The EMBO Journal, 30, 3885-3894. AUPRICH, M., CHUN, F. K. H., WARD, J. F., PUMMER, K., BABAIAN, R., AUGUSTIN, H., LUGER, F., GUTSCHI, S., BUDAUS, L., FISCH, M., HULAND, H., GRAEFEN, M. & HAESE, A. 2011. Critical Assessment of Preoperative Urinary Prostate Cancer Antigen 3 on the Accuracy of Prostate Cancer Staging. European Urology, 59, 96-105. AUSTRALIA, P. C. F. O. 2014. Staging and Grading [Online]. Prostate cancer foundation of Australia: Prostate cancer foundation of Australia. Available: http://www.prostate.org.au/articleLive/pages/Staging-and-Grading.html [Accessed 07 May 2014]. BAADE PD, Y. D., CRAMB SM, DUNN J, GARDINER RA. 2013. Epidemiology of prostate cancer in the Asia-Pacific region. Prostate Int., 1, 47-58.

BARBIERI, C. E., BANGMA, C. H., BJARTELL, A., CATTO, J. W. F., CULIG, Z., GRONBERG, H., LUO, J., VISAKORPI, T. & RUBIN, M. A. 2013. The Mutational Landscape of Prostate Cancer. European Urology, 64, 567-576. BARRIE, S. E., POTTER, G. A., GODDARD, P. M., HAYNES, B. P., DOWSETT, M. & JARMAN, M. 1994. PHARMACOLOGY OF NOVEL STEROIDAL INHIBITORS OF CYTOCHROME P450(17-ALPHA) (17- ALPHA-HYDROXYLASE C17-20 LYASE). Journal of Steroid Biochemistry and Molecular Biology, 50, 267-273. BARRY, M., DHILLON, P. K., STAMPFER, M. J., PERNER, S., MA, J., GIOVANNUCCI, E., KURTH, T., MUCCI, L. A. & RUBIN, M. A. 2012. a-Methylacyl-CoA racemase expression and lethal prostate cancer in the Physicians' Health Study and Health Professionals Follow-up Study. Prostate, 72, 301-306. BENSEN, J. T., XU, Z., SMITH, G. J., MOHLER, J. L., FONTHAM, E. T. H. & TAYLOR, J. A. 2013. Genetic polymorphism and prostate cancer aggressiveness: A case-only study of 1,536 GWAS and candidate SNPs in African-Americans and European-Americans. The Prostate, 73, 11-22. BERGSTRÖM, A., PISANI, P., TENET, V., WOLK, A. & ADAMI, H.-O. 2001. Overweight as an avoidable cause of cancer in Europe. International Journal of Cancer, 91, 421-430. BILL-AXELSON, A., HOLMBERG, L., GARMO, H., RIDER, J. R., TAARI, K., BUSCH, C., NORDLING, S., HAGGMAN, M., ANDERSSON, S. O., SPANGBERG, A., ANDREN, O., PALMGREN, J., STEINECK, G., ADAMI, H. O. & JOHANSSON, J. E. 2014. Radical Prostatectomy or Watchful Waiting in Early Prostate Cancer. New England Journal of Medicine, 370, 932-942. BOCCON-GIBOD, L., HAMMERER, P., MADERSBACHER, S., MOTTET, N., PRAYER-GALETTI, T. & TUNN, U. 2007. The role of intermittent androgen deprivation in prostate cancer. Bju International, 100, 738-743. BONACCORSI, L., MARCHIANI, S., MURATORI, M., FORTI, G. & BALDI, E. 2004. Gefitinib ('IRESSA', ZD1839) inhibits EGF-induced invasion in prostate cancer cells by suppressing PI3K/AKT activation. Journal of Cancer Research and Clinical Oncology, 130, 604-614. BOORJIAN, S. A., KARNES, R. J., CRISPEN, P. L., RANGEL, L. J., BERGSTRALH, E. J. & BLUTE, M. L. 2009. Radiation Therapy After Radical Prostatectomy: Impact on Metastasis and Survival. Journal of Urology, 182, 2708-2714. BOSTWICK, D., BURKE, H., DJAKIEW, D., EULING, S., HO, S., LANDOLPH, J., MORRISON, H., SONAWANE, B., SHIFFLETT, T., WATERS, D. & TIMMS, B. 2004. Human prostate cancer risk factors. Cancer, 101, 2371-2490. BOSTWICK, D. G., ALEXANDER, E. E., SINGH, R., SHAN, A., QIAN, J., SANTELLA, R. M., OBERLEY, L. W., YAN, T., ZHONG, W., JIANG, X. & OBERLEY, T. D. 2000. Antioxidant enzyme expression and reactive oxygen species damage in prostatic intraepithelial neoplasia and cancer. Cancer, 89, 123-34. BOWEN, C., BUBENDORF, L., VOELLER, H. J., SLACK, R., WILLI, N., SAUTER, G., GASSER, T. C., KOIVISTO, P., LACK, E. E., KONONEN, J., KALLIONIEMI, O. P. & GELMANN, E. P. 2000. Loss of NKX3.1 expression in human prostate cancers correlates with tumor progression. Cancer Res, 60, 6111-5. BOWEN, C. & GELMANN, E. P. 2010. NKX3.1 activates cellular response to DNA damage. Cancer Res, 70, 3089-97. BRAWLEY, O. W. 2012. Prostate cancer epidemiology in the United States. World Journal of Urology, 30, 195-200. CANIL, C. M., MOORE, M. J., WINQUIST, E., BAETZ, T., POLLAK, M., CHI, K. N., BERRY, S., ERNST, D. S., DOUGLAS, L., BRUNDAGE, M., FISHER, B., MCKENNA, A. & SEYMOUR, L. 2005. Randomized phase II study of two doses of gefitinib in hormone-refractory prostate cancer: A trial of the National Cancer Institute of Canada-Clinical Trials Group. Journal of Clinical Oncology, 23, 455-460.

CAO, Y. & MA, J. 2011. Body Mass Index, Prostate Cancer–Specific Mortality, and Biochemical Recurrence: a Systematic Review and Meta-analysis. Cancer Prevention Research, 4, 486- 501. CARPTEN, J., NUPPONEN, N., ISAACS, S., SOOD, R., ROBBINS, C., XU, J., FARUQUE, M., MOSES, T., EWING, C., GILLANDERS, E., HU, P., BUJNOVSZKY, P., MAKALOWSKA, I., BAFFOE-BONNIE, A., FAITH, D., SMITH, J., STEPHAN, D., WILEY, K., BROWNSTEIN, M., GILDEA, D., KELLY, B., JENKINS, R., HOSTETTER, G., MATIKAINEN, M., SCHLEUTKER, J., KLINGER, K., CONNORS, T., XIANG, Y., WANG, Z., DE MARZO, A., PAPADOPOULOS, N., KALLIONIEMI, O. P., BURK, R., MEYERS, D., GRONBERG, H., MELTZER, P., SILVERMAN, R., BAILEY-WILSON, J., WALSH, P., ISAACS, W. & TRENT, J. 2002. Germline mutations in the ribonuclease L gene in families showing linkage with HPC1. Nat Genet, 30, 181-4. CARRACEDO, A. & PANDOLFI, P. P. 2008. The PTEN-PI3K pathway: of feedbacks and cross-talks. Oncogene, 27, 5527-5541. CELLA, D., PETERMAN, A., HUDGENS, S., WEBSTER, K. & SOCINSKI, M. A. 2003. Measuring the side effects of taxane therapy in oncology - The functional assessment of cancer therapy-taxane (FACT-taxane). Cancer, 98, 822-831. CHEN, T., WU, D., MOSKALUK, C. A. & FU, Z. 2013. Distinct Expression Patterns of ICK/MAK/MOK Protein Kinases in the Intestine Implicate Functional Diversity. PLoS ONE, 8, e79359. CHI, K. N., GLEAVE, M. E., FAZLI, L., GOLDENBERG, S. L., SO, A., KOLLMANNSBERGER, C., MURRAY, N., TINKER, A. & POLLAK, M. 2012. A Phase II Pharmacodynamic Study of Preoperative Figitumumab in Patients with Localized Prostate Cancer. Clinical Cancer Research, 18, 3407- 3413. CHOO, C. K., LING, M. T., CHAN, K. W., TSAO, S. W., ZHENG, Z., ZHANG, D. K., CHAN, L. C. & WONG, Y. C. 1999. Immortalization of human prostate epithelial cells by HPV 16 E6/E7 open reading frames. Prostate, 40, 150-158. COHEN, R. J., SHANNON, B. A., PHILLIPS, M., MOORIN, R. E., WHEELER, T. M. & GARRETT, K. L. 2008. Central Zone Carcinoma of the Prostate Gland: A Distinct Tumor Type With Poor Prognostic Features. The Journal of Urology, 179, 1762-1767. COORY, M. D. & BAADE, P. D. 2005. Urban-rural differences in prostate cancer mortality, radical prostatectomy and prostate-specific antigen testing in Australia. Medical Journal of Australia, 182, 112-115. COTTER, M. P., GERN, R. W., HO, G. Y. F., CHANG, R. Y. & BURK, R. D. 2002. Role of family history and ethnicity on the mode and age of prostate cancer presentation. Prostate, 50, 216-221. DAGVADORJ, A., COLLINS, S., JOMAIN, J. B., ABDULGHANI, J., KARRAS, J., ZELLWEGER, T., LI, H. Z., NURMI, M., ALANEN, K., MIRTTI, T., VISAKORPI, T., BUBENDORF, L., GOFFIN, V. & NEVALAINEN, M. T. 2007. Autocrine prolactin promotes prostate cancer cell growth via janus kinase-2-signal transducer and activator of transcription-5a/b signaling pathway. Endocrinology, 148, 3089-3101. DALL'ERA, M. A., ALBERTSEN, P. C., BANGMA, C., CARROLL, P. R., CARTER, H. B., COOPERBERG, M. R., FREEDLAND, S. J., KLOTZ, L. H., PARKER, C. & SOLOWAY, M. S. 2012. Active Surveillance for Prostate Cancer: A Systematic Review of the Literature. European Urology, 62, 976-983. DAMASCHKE, N. A., YANG, B., BHUSARI, S., SVAREN, J. P. & JARRARD, D. F. 2013. Epigenetic Susceptibility Factors for Prostate Cancer With Aging. Prostate, 73, 1721-1730. DAMBER, L., GRONBERG, H. & DAMBER, J. E. 1998. Familial prostate cancer and possible associated malignancies: Nation-wide register cohort study in Sweden. International Journal of Cancer, 78, 293-297. DANILA, D. C., FLEISHER, M. & SCHER, H. I. 2011. Circulating Tumor Cells as Biomarkers in Prostate Cancer. Clinical Cancer Research, 17, 3903-3912. DANILA, D. C., HELLER, G., GIGNAC, G. A., GONZALEZ-ESPINOZA, R., ANAND, A., TANAKA, E., LILJA, H., SCHWARTZ, L., LARSON, S., FLEISHER, M. & SCHER, H. I. 2007. Circulating tumor cell number

and prognosis in progressive castration-resistant prostate cancer. Clinical Cancer Research, 13, 7053-7058. DAVIS, N. M., SOKOLOSKY, M., STADELMAN, K., ABRAMS, S. L., LIBRA, M., CANDIDO, S., NICOLETTI, F., POLESEL, J., MAESTRO, R., D’ASSORO, A., DROBOT, L., RAKUS, D., GIZAK, A., LAIDLER, P., DULIŃSKA-LITEWKA, J., BASECKE, J., MIJATOVIC, S., MAKSIMOVIC-IVANIC, D., MONTALTO, G., CERVELLO, M., FITZGERALD, T. L., DEMIDENKO, Z. N., MARTELLI, A. M., COCCO, L., STEELMAN, L. S. & MCCUBREY, J. A. 2014. Deregulation of the EGFR/PI3K/PTEN/Akt/mTORC1 pathway in breast cancer: possibilities for therapeutic intervention. Oncotarget, 5, 4603- 4650

DEBES, J. D. & TINDALL, D. J. 2004. Mechanisms of androgen-refractory prostate cancer. New England Journal of Medicine, 351, 1488-1490. DEMARZO, A. M., NELSON, W. G., ISAACS, W. B. & EPSTEIN, J. I. 2003. Pathological and molecular aspects of prostate cancer. Lancet, 361, 955-964. DHILLON, A. S., HAGAN, S., RATH, O. & KOLCH, W. 2007. MAP kinase signalling pathways in cancer. Oncogene, 26, 3279-3290. DHUPKAR, P., DOWLING, M., CENGEL, K. & CHEN, B. 2010. Effects of Anti-EGFR Antibody Cetuximab on Androgen-independent Prostate Cancer Cells. Anticancer Research, 30, 1905-1910. DI LORENZO, G., TORTORA, G., D'ARMIENTO, F. P., DE ROSA, G., STAIBANO, S., AUTORINO, R., D'ARMIENTO, M., DE LAURENTIIS, M., DE PLACIDO, S., CATALANO, G., BIANCO, A. R. & CIARDIELLO, F. 2002. Expression of epidermal growth factor receptor correlates with disease relapse and progression to androgen-independence in human prostate cancer. Clinical Cancer Research, 8, 3438-3444. DOYEN, J., ALIX-PANABIERES, C., HOFMAN, P., PARKS, S. K., CHAMOREY, E., NAMAN, H. & HANNOUN-LEVI, J. M. 2012. Circulating tumor cells in prostate cancer: a potential surrogate marker of survival. Critical Reviews in Oncology/Hematology, 81, 241-56. DUTTA, P. & LI, W. X. 2001. Role of the JAK-STAT Signalling Pathway in Cancer. eLS. John Wiley & Sons, Ltd. ELLIS, M., CONNELL, E., HO, W. & CHEN, C. 2013. Prostate cancer in Australia. Cancer series no. 79. . In: AUSTRALIAN INST HLTH, W. (ed.). Canberra: AIHW: Australian Institute of Health and Welfare ELLWOOD-YEN, K., GRAEBER, T. G., WONGVIPAT, J., IRUELA-ARISPE, M. L., ZHANG, J., MATUSIK, R., THOMAS, G. V. & SAWYERS, C. L. 2003. Myc-driven murine prostate cancer shares molecular features with human prostate tumors. Cancer Cell, 4, 223-38. EVANS, A. J. 2003. alpha-Methylacyl CoA racemase (P504S): overview and potential uses in diagnostic pathology as applied to prostate needle biopsies. Journal of Clinical Pathology, 56, 892-897. EWING, C. M., RAY, A. M., LANGE, E. M., ZUHLKE, K. A., ROBBINS, C. M., TEMBE, W. D., WILEY, K. E., ISAACS, S. D., JOHNG, D., WANG, Y., BIZON, C., YAN, G., GIELZAK, M., PARTIN, A. W., SHANMUGAM, V., IZATT, T., SINARI, S., CRAIG, D. W., ZHENG, S. L., WALSH, P. C., MONTIE, J. E., XU, J., CARPTEN, J. D., ISAACS, W. B. & COONEY, K. A. 2012. Germline Mutations in HOXB13 and Prostate-Cancer Risk. New England Journal of Medicine, 366, 141-149. FENG, H., CHENG, A. S. L., TSANG, D. P., LI, M. S., GO, M. Y., CHEUNG, Y. S., ZHAO, G.-J., NG, S. S., LIN, M. C., YU, J., LAI, P. B., TO, K. F. & SUNG, J. J. Y. 2011. Cell cycle–related kinase is a direct androgen receptor–regulated gene that drives β-catenin/T cell factor–dependent hepatocarcinogenesis. The Journal of Clinical Investigation, 121, 3159-3175. FERNALD, K. & KUROKAWA, M. 2013. Evading apoptosis in cancer. Trends in Cell Biology, 23, 620- 633. FERRO, M., BRUZZESE, D., PERDONÀ, S., MAZZARELLA, C., MARINO, A., SORRENTINO, A., DI CARLO, A., AUTORINO, R., DI LORENZO, G., BUONERBA, C., ALTIERI, V., MARIANO, A., MACCHIA, V. & TERRACCIANO, D. 2012. Predicting prostate biopsy outcome: prostate health index (phi) and

prostate cancer antigen 3 (PCA3) are useful biomarkers. Clinica Chimica Acta, 413, 1274- 1278. FINE, S. W. & REUTER, V. E. 2012. Anatomy of the prostate revisited: implications for prostate biopsy and zonal origins of prostate cancer. Histopathology, 60, 142-152. FITZPATRICK, J. M. & DE WIT, R. 2014. Taxane Mechanisms of Action: Potential Implications for Treatment Sequencing in Metastatic Castration-resistant Prostate Cancer. European Urology, 65, 1198-1204. FLEMING, M. T., SONPAVDE, G., KOLODZIEJ, M., AWASTHI, S., HUTSON, T. E., MARTINCIC, D., RASTOGI, A., ROUSEY, S. R., WEINSTEIN, R. E., GALSKY, M. D., BERRY, W. R., WANG, Y. F., BOEHM, K. A., ASMAR, L., RAUCH, M. A. & BEER, T. M. 2012. Association of Rash With Outcomes in a Randomized Phase II Trial Evaluating Cetuximab in Combination With Mitoxantrone Plus Prednisone After Docetaxel for Metastatic Castration-resistant Prostate Cancer. Clinical Genitourinary Cancer, 10, 6-14. FREEDLAND, S. J. 2011. Screening, Risk Assessment, and the Approach to Therapy in Patients With Prostate Cancer. Cancer, 117, 1123-1135. FRENZEL, K., WALLACE, T. A., MCDOOM, I., XIAO, H. D., CAPECCHI, M. R., BERNSTEIN, K. E. & SAYESKI, P. P. 2006. A functional Jak2 tyrosine kinase domain is essential for mouse development. Experimental Cell Research, 312, 2735-2744. FRIEDLANDER, T. W., NGO, V. T., DONG, H., PREMASEKHARAN, G., WEINBERG, V., DOTY, S., ZHAO, Q., GILBERT, E. G., RYAN, C. J., CHEN, W. T. & PARIS, P. L. 2014. Detection and Characterization of Invasive Circulating Tumor Cells Derived from Men with Metastatic Castration- Resistant Prostate Cancer. International Journal of Cancer, 134, 2284-2293. FU, J., BIAN, M., JIANG, Q. & ZHANG, C. 2007. Roles of Aurora kinases in mitosis and tumorigenesis. Mol Cancer Res, 5, 1-10. FU, W. H., MADAN, E., YEE, M. & ZHANG, H. T. 2012. Progress of molecular targeted therapies for prostate cancers. Biochimica Et Biophysica Acta-Reviews on Cancer, 1825, 140-152. FU, Z. 2012. Regulations and Functions of ICK/MAK/MOK - A Novel MAPK-Related Kinase Family Linked to Human Diseases. In: XAVIER, D. G. D. S. (ed.) Protein Kinases. InTech. FU, Z., KIM, J., VIDRICH, A., STURGILL, T. W. & COHN, S. M. 2009. Intestinal cell kinase, a MAP kinase- related kinase, regulates proliferation and G(1) cell cycle progression of intestinal epithelial cells. American Journal of Physiology-Gastrointestinal and Liver Physiology, 297, G632-G640. FU, Z., LARSON, K. A., CHITTA, R. K., PARKER, S. A., TURK, B. E., LAWRENCE, M. W., KALDIS, P., GALAKTIONOV, K., COHN, S. M., SHABANOWITZ, J., HUNT, D. F. & STURGILL, T. W. 2006. Identification of yin-yang regulators and a phosphorylation consensus for male germ cell- associated kinase (MAK)-related kinase. Mol Cell Biol, 26, 8639-54. FU, Z., SCHROEDER, M. J., SHABANOWITZ, J., KALDIS, P., TOGAWA, K., RUSTGI, A. K., HUNT, D. F. & STURGILL, T. W. 2005. Activation of a nuclear Cdc2-related kinase within a mitogen-activated protein kinase-like TDY motif by autophosphorylation and cyclin-dependent protein kinase- activating kinase. Molecular and Cellular Biology, 25, 6047-6064. GELMANN, E. P., STEADMAN, D. J., MA, J., AHRONOVITZ, N., VOELLER, H. J., SWOPE, S., ABBASZADEGAN, M., BROWN, K. M., STRAND, K., HAYES, R. B. & STAMPFER, M. J. 2002. Occurrence of NKX3.1 C154T polymorphism in men with and without prostate cancer and studies of its effect on protein function. Cancer Res, 62, 2654-9. GENECARDS. 2014. Epidermal Growth Factor Receptor [Online]. Available: http://www.genecards.org/cgi-bin/carddisp.pl?gene=EGFR [Accessed 31 October 2014]. GERHARDT, J., MONTANI, M., WILD, P., BEER, M., HUBER, F., HERMANNS, T., MUNTENER, M. & KRISTIANSEN, G. 2012. FOXA1 promotes tumor progression in prostate cancer and represents a novel hallmark of castration-resistant prostate cancer. Am J Pathol, 180, 848- 61.

GIL, J., KERAI, P., LLEONART, M., BERNARD, D., CIGUDOSA, J. C., PETERS, G., CARNERO, A. & BEACH, D. 2005. Immortalization of primary human prostate epithelial cells by c-Myc. Cancer Res, 65, 2179-85. GILBERT, R., MARTIN, R., BEYNON, R., HARRIS, R., SAVOVIC, J., ZUCCOLO, L., BEKKERING, G., FRASER, W., STERNE, J. C. & METCALFE, C. 2011. Associations of circulating and dietary vitamin D with prostate cancer risk: a systematic review and dose–response meta-analysis. Cancer Causes & Control, 22, 319-340. GLAUSER, D. A. & SCHLEGEL, W. 2007. The emerging role of FOXO transcription factors in pancreatic beta cells. Journal of Endocrinology, 193, 195-207. GOLDEN, T., SWINGLE, M. & HONKANEN, R. E. 2008. The role of serine/threonine protein phosphatase type 5 (PP5) in the regulation of stress-induced signaling networks and cancer. Cancer Metastasis Rev, 27, 169-78. GREEN, S. M., MOSTAGHEL, E. A. & NELSON, P. S. 2012. Androgen action and metabolism in prostate cancer. Molecular and Cellular Endocrinology, 360, 3-13. GRIMM, P., BILLIET, I., BOSTWICK, D., DICKER, A. P., FRANK, S., IMMERZEEL, J., KEYES, M., KUPELIAN, P., LEE, W. R., MACHTENS, S., MAYADEV, J., MORAN, B. J., MERRICK, G., MILLAR, J., ROACH, M., STOCK, R., SHINOHARA, K., SCHOLZ, M., WEBER, E., ZIETMAN, A., ZELEFSKY, M., WONG, J., WENTWORTH, S., VERA, R. & LANGLEY, S. 2012. Comparative analysis of prostate-specific antigen free survival outcomes for patients with low, intermediate and high risk prostate cancer treatment by radical therapy. Results from the Prostate Cancer Results Study Group. Bju International, 109, 22-29. GRUBB, R. L., PINSKY, P. F., GREENLEE, R. T., IZMIRLIAN, G., MILLER, A. B., HICKEY, T. P., RILEY, T. L., MABIE, J. E., LEVIN, D. L., CHIA, D., KRAMER, B. S., REDING, D. J., CHURCH, T. R., YOKOCHI, L. A., KVALE, P. A., WEISSFELD, J. L., URBAN, D. A., BUYS, S. S., GELMANN, E. P., RAGARD, L. R., CRAWFORD, E. D., PROROK, P. C., GOHAGAN, J. K., BERG, C. D., ANDRIOLE, G. L. & TEAM, P. P. 2008. Prostate cancer screening in the Prostate, Lung, Colorectal and Ovarian cancer screening trial: update on findings from the initial four rounds of screening in a randomized trial. Bju International, 102, 1524-1530. GUMULEC, J., MASARIK, M., KRIZKOVA, S., HLAVNA, M., BABULA, P., HRABEC, R., ROVNY, A., MASARIKOVA, M., SOCHOR, J., ADAM, V., ECKSCHLAGER, T. & KIZEK, R. 2012. Evaluation of alpha-methylacyl-CoA racemase, metallothionein and prostate specific antigen as prostate cancer prognostic markers. Neoplasma, 59, 191-200. GUREL, B., IWATA, T., KOH, C. M., JENKINS, R. B., LAN, F., VAN DANG, C., HICKS, J. L., MORGAN, J., CORNISH, T. C., SUTCLIFFE, S., ISAACS, W. B., LUO, J. & DE MARZO, A. M. 2008. Nuclear MYC protein overexpression is an early alteration in human prostate carcinogenesis. Mod Pathol, 21, 1156-67. HAESE, A., DE LA TAILLE, A., VAN POPPEL, H., MARBERGER, M., STENZL, A., MULDERS, P. F. A., HULAND, H., ABBOU, C. C., REMZI, M., TINZL, M., FEYERABEND, S., STILLEBROER, A. B., VAN GILS, M. & SCHALKEN, J. A. 2008. Clinical Utility of the PCA3 Urine Assay in European Men Scheduled for Repeat Biopsy. European Urology, 54, 1081-1088. HAGGARTH, L., HAGGLOF, C., JARAJ, S. J., WESTER, K., PONTEN, F., OSTMAN, A. & EGEVAD, L. 2011. Diagnostic biomarkers of prostate cancer. Scand J Urol Nephrol, 45, 60-7. HAN, M., PARTIN, A. W., ZAHURAK, M., PIANTADOSI, S., EPSTEIN, J. I. & WALSH, P. C. 2003. Biochemical (prostate specific antigen) recurrence probability following radical prostatectomy for clinically localized prostate cancer. Journal of Urology, 169, 517-523. HAYES, J. H. & BARRY, M. J. 2014. Screening for Prostate Cancer With the Prostate-Specific Antigen Test A Review of Current Evidence. Jama-Journal of the American Medical Association, 311, 1143-1149. HEIDENREICH, A., BASTIAN, P. J., BELLMUNT, J., BOLLA, M., JONIAU, S., VAN DER KWAST, T., MASON, M., MATVEEV, V., WIEGEL, T., ZATTONI, F. & MOTTET, N. 2014a. EAU Guidelines on Prostate

Cancer. Part 1: Screening, Diagnosis, and Local Treatment with Curative Intent-Update 2013. European Urology, 65, 124-137. HEIDENREICH, A., BASTIAN, P. J., BELLMUNT, J., BOLLA, M., JONIAU, S., VAN DER KWAST, T., MASON, M., MATVEEV, V., WIEGEL, T., ZATTONI, F. & MOTTET, N. 2014b. EAU Guidelines on Prostate Cancer. Part II: Treatment of Advanced, Relapsing, and Castration-Resistant Prostate Cancer. European Urology, 65, 467-479. HEMMINKI, K. 2012. Familial risk and familial survival in prostate cancer. World Journal of Urology, 30, 143-148. HERBST, R. S. & SHIN, D. M. 2002. Monoclonal antibodies to target epidermal growth factor receptor-positive tumors - A new paradigm for cancer therapy. Cancer, 94, 1593-1611. HESSELS, D., GUNNEWIEK, J., VAN OORT, I., KARTHAUS, H. F. M., VAN LEENDERS, G. J. L., VAN BALKEN, B., KIEMENEY, L. A., WITJES, J. A. & SCHALKEN, J. A. 2003. DD3(PCA3)-based molecular urine analysis for the diagnosis of prostate cancer. European Urology, 44, 8-15. HESSELS, D., VAN GILS, M., VAN HOOIJ, O., JANNINK, S. A., WITJES, J. A., VERHAEGH, G. W. & SCHALKEN, J. A. 2010. Predictive Value of PCA3 in Urinary Sediments in Determining Clinico- Pathological Characteristics of Prostate Cancer. Prostate, 70, 10-16. HOFFMAN, R. M., GILLILAND, F. D., ELEY, J. W., HARLAN, L. C., STEPHENSON, R. A., STANFORD, J. L., ALBERTSON, P. C., HAMILTON, A. S., HUNT, W. C. & POTOSKY, A. L. 2001. Racial and ethnic differences in advanced-stage prostate cancer: the prostate cancer outcomes study. Journal of the National Cancer Institute, 93, 388-395. HORNBERG, E., YLITALO, E. B., CRNALIC, S., ANTTI, H., STATTIN, P., WIDMARK, A., BERGH, A. & WIKSTROM, P. 2011. Expression of Androgen Receptor Splice Variants in Prostate Cancer Bone Metastases is Associated with Castration-Resistance and Short Survival. Plos One, 6. HOWE, L., ARDELL, D., NEWMAN, D. & STEIDLE, C. 2010. Prostate cancer: anatomy of the prostate gland and its zones [Online]. Available: http://www.seekwellness.com/prostate/prostate_cancer.htm [Accessed 01 June 2014. HUBNER, A., MULHOLLAND, D. J., STANDEN, C. L., KARASARIDES, M., CAVANAGH-KYROS, J., BARRETT, T., CHI, H., GREINER, D. L., TOURNIER, C., SAWYERS, C. L., FLAVELL, R. A., WU, H. & DAVIS, R. J. 2012. JNK and PTEN cooperatively control the development of invasive adenocarcinoma of the prostate. Proc Natl Acad Sci U S A, 109, 12046-51. HUMPHREY, P. A. 2004. Gleason grading and prognostic factors in carcinoma of the prostate. Modern Pathology, 17, 292-306. JACKMAN, M., LINDON, C., NIGG, E. A. & PINES, J. 2003. Active cyclin B1-Cdk1 first appears on centrosomes in prophase. Nature Cell Biology, 5, 143-148. JANSSON, K. F., AKRE, O., GARMO, H., BILL-AXELSON, A., ADOLFSSON, J., STATTIN, P. & BRATT, O. 2012. Concordance of Tumor Differentiation Among Brothers with Prostate Cancer. European Urology, 62, 656-661. JARRARD, D. F., MODDER, J., FADDEN, P., FU, V., SEBREE, L., HEISEY, D., SCHWARZE, S. R. & FRIEDL, A. 2002. Alterations in the p16/pRb cell cycle checkpoint occur commonly in primary and metastatic human prostate cancer. Cancer Letters, 185, 191-199. JIANG, N., ZHU, S. M., CHEN, J., NIU, Y. J. & ZHOU, L. Q. 2013. A-Methylacyl-CoA Racemase (AMACR) and Prostate-Cancer Risk: A Meta-Analysis of 4,385 Participants. Plos One, 8. KADER, A. K., SUN, J., ISAACS, S. D., WILEY, K. E., YAN, G., KIM, S. T., FEDOR, H., DEMARZO, A. M., EPSTEIN, J. I., WALSH, P. C., PARTIN, A. W., TROCK, B., ZHENG, S. L., XU, J. & ISAACS, W. 2009. Individual and cumulative effect of prostate cancer risk-associated variants on clinicopathologic variables in 5,895 prostate cancer patients. Prostate, 69, 1195-205. KELLEY, M. R., CHENG, L., FOSTER, R., TRITT, R., JIANG, J., BROSHEARS, J. & KOCH, M. 2001. Elevated and altered expression of the multifunctional DNA base excision repair and redox enzyme Ape1/ref-1 in prostate cancer. Clin Cancer Res, 7, 824-30. KENCH, J. G., CLOUSTON, D. R., DELPRADO, W., EADE, T., ELLIS, D., HORVATH, L. G., SAMARATUNGA, H., STAHL, J., STAPLETON, A. M., EGEVAD, L., SRIGLEY, J. R. & DELAHUNT, B. 2011. Prognostic

factors in prostate cancer. Key elements in structured histopathology reporting of radical prostatectomy specimens. Pathology, 43, 410-9. KEYES, M., CROOK, J., MORTON, G., VIGNEAULT, E., USMANI, N. & MORRIS, W. J. 2013. Treatment options for localized prostate cancer. Canadian Family Physician, 59, 1269-1274. KING, E. R. & WONG, K. K. 2012. Insulin-like Growth Factor: Current Concepts and New Developments in Cancer Therapy. Recent Patents on Anti-Cancer Drug Discovery, 7, 14-30. KINKADE, C. W., CASTILLO-MARTIN, M., PUZIO-KUTER, A., YAN, J., FOSTER, T. H., GAO, H., SUN, Y., OUYANG, X., GERALD, W. L., CORDON-CARDO, C. & ABATE-SHEN, C. 2008. Targeting AKT/mTOR and ERK MAPK signaling inhibits hormone-refractory prostate cancer in a preclinical mouse model. J Clin Invest, 118, 3051-64. KLEIN, E. A., THOMPSON, I. M., TANGEN, C. M., CROWLEY, J. J., LUCIA, M. S., GOODMAN, P. J., MINASIAN, L. M., FORD, L. G., PARNES, H. L., GAZIANO, J. M., KARP, D. D., LIEBER, M. M., WALTHER, P. J., KLOTZ, L., PARSONS, J. K., CHIN, J. L., DARKE, A. K., LIPPMAN, S. M., GOODMAN, G. E., MEYSKENS, F. L. & BAKER, L. H. 2011. Vitamin E and the Risk of Prostate Cancer The Selenium and Vitamin E Cancer Prevention Trial (SELECT). Jama-Journal of the American Medical Association, 306, 1549-1556. KLOTZ, L., BOCCON-GIBOD, L., SHORE, N. D., ANDREOU, C., PERSSON, B. E., CANTOR, P., JENSEN, J. K., OLESEN, T. K. & SCHRODER, F. H. 2008. The efficacy and safety of degarelix: a 12-month, comparative, randomized, open-label, parallel-group phase III study in patients with prostate cancer. Bju International, 102, 1531-1538. KNUDSEN, K. E. & PENNING, T. M. 2010. Partners in crime: deregulation of AR activity and androgen synthesis in prostate cancer. Trends in Endocrinology and Metabolism, 21, 315-324. KNUDSEN, K. E. & SCHER, H. I. 2009. Starving the Addiction: New Opportunities for Durable Suppression of AR Signaling in Prostate Cancer. Clinical Cancer Research, 15, 4792-4798. KO, H. W., NORMAN, R. X., TRAN, J., FULLER, K. P., FUKUDA, M. & EGGENSCHWILER, J. T. 2010. Broad-minded links cell cycle-related kinase to cilia assembly and hedgehog signal transduction. Dev Cell, 18, 237-47. KOJIMA, S., INAHARA, M., SUZUKI, H., ICHIKAWA, T. & FURUYA, Y. 2009. Implications of insulin-like growth factor-I for prostate cancer therapies. International Journal of Urology, 16, 161-167. KOUL, H. K., PAL, M. & KOUL, S. 2013. Role of p38 MAP Kinase Signal Transduction in Solid Tumors. Genes Cancer, 4, 342-59. KURODA, K., LIU, H., KIM, S., GUO, M., NAVARRO, V. & BANDER, N. H. 2009. Docetaxel down- regulates the expression of androgen receptor and prostate-specific antigen but not prostate-specific membrane antigen in prostate cancer cell lines: Implications for PSA surrogacy. The Prostate, 69, 1579-1585. KUTIKOV, A., MORGAN, T. & MANLEY, B. 2009. Basic Principles: Prostate Anatomy [Online]. Available: http://www.urologymatch.com/ProstateAnatomy.htm 01 June 2014]. LAHIRY, P., WANG, J., ROBINSON, J. F., TUROWEC, J. P., LITCHFIELD, D. W., LANKTREE, M. B., GLOOR, G. B., PUFFENBERGER, E. G., STRAUSS, K. A., MARTENS, M. B., RAMSAY, D. A., RUPAR, C. A., SIU, V. & HEGELE, R. A. 2009. A multiplex human syndrome implicates a key role for intestinal cell kinase in development of central nervous, skeletal, and endocrine systems. Am J Hum Genet, 84, 134-47. LAPLANTE, M. & SABATINI, D. M. 2009. mTOR signaling at a glance. J Cell Sci, 122, 3589-94. LAWSON, K., WRIGHT, M., SUBAR, A., MOUW, T., HOLLENBECK, A., SCHATZKIN, A. & LEITZMANN, M. 2007. Multivitamin use and risk of prostate cancer in the National Institutes of Health-AARP Diet and Health Study. Journal of National Cancer Institute, 99, 754-764. LAZZERI, M., HAESE, A., DE LA TAILLE, A., REDORTA, J. P., MCNICHOLAS, T., LUGHEZZANI, G., SCATTONI, V., BINI, V., FRESCHI, M., SUSSMAN, A., GHALEH, B., LE CORVOISIER, P., BOU, J. A., FERNANDEZ, S. E., GRAEFEN, M. & GUAZZONI, G. 2013. Serum Isoform -2 proPSA Derivatives Significantly Improve Prediction of Prostate Cancer at Initial Biopsy in a Total PSA Range of 2-10 ng/ml: A Multicentric European Study. European Urology, 63, 986-994.

LEYTEN, G., HESSELS, D., JANNINK, S. A., SMIT, F. P., DE JONG, H., CORNEL, E. B., DE REIJKE, T. M., VERGUNST, H., KIL, P., KNIPSCHEER, B. C., VAN OORT, I. M., MULDERS, P. F. A., HULSBERGEN- VAN DE KAA, C. A. & SCHALKEN, J. A. 2014. Prospective Multicentre Evaluation of PCA3 and TMPRSS2-ERG Gene Fusions as Diagnostic and Prognostic Urinary Biomarkers for Prostate Cancer. European Urology, 65, 534-542. LILJA, H., ULMERT, D. & VICKERS, A. J. 2008. Prostate-specific antigen and prostate cancer: prediction, detection and monitoring. Nature Reviews Cancer, 8, 268-278. LIN, C., YANG, L., TANASA, B., HUTT, K., JU, B. G., OHGI, K., ZHANG, J., ROSE, D. W., FU, X. D., GLASS, C. K. & ROSENFELD, M. G. 2009. Nuclear receptor-induced chromosomal proximity and DNA breaks underlie specific translocations in cancer. Cell, 139, 1069-83. LIPPI, G., MONTAGNANA, M., GUIDI, G. C. & PLEBANI, M. 2009. Prostate-specific antigen-based screening for prostate cancer in the third millennium: Useful or hype? Annals of Medicine, 41, 480-489. LOEB, S. & CATALONA, W. J. 2014. The Prostate Health Index: a new test for the detection of prostate cancer. Ther Adv Urol., 6, 74-77. LOEB, S., SOKOLL, L. J., BROYLES, D. L., BANGMA, C. H., VAN SCHAIK, R. H. N., KLEE, G. G., WEI, J. T., SANDA, M. G., PARTIN, A. W., SLAWIN, K. M., MARKS, L. S., MIZRAHI, I. A., SHIN, S. S., CRUZ, A. B., CHAN, D. W., ROBERTS, W. L. & CATALONA, W. J. 2013. Prospective Multicenter Evaluation of the Beckman Coulter Prostate Health Index Using WHO Calibration. Journal of Urology, 189, 1702-1706. MA, A. H., XIA, L., DESAI, S. J., BOUCHER, D. L., GUAN, Y., SHIH, H. M., SHI, X. B., DEVERE WHITE, R. W., CHEN, H. W., TEPPER, C. G. & KUNG, H. J. 2006. Male germ cell-associated kinase, a male-specific kinase regulated by androgen, is a coactivator of androgen receptor in prostate cancer cells. Cancer Res, 66, 8439-47. MA, X. M. & BLENIS, J. 2009. Molecular mechanisms of mTOR-mediated translational control. Nat Rev Mol Cell Biol, 10, 307-18. MACINNIS, R. & ENGLISH, D. 2006. Body size and composition and prostate cancer risk: systematic review and meta-regression analysis. Cancer Causes & Control, 17, 989-1003. MACKEIGAN, J. P., MURPHY, L. O. & BLENIS, J. 2005. Sensitized RNAi screen of human kinases and phosphatases identifies new regulators of apoptosis and chemoresistance. Nat Cell Biol, 7, 591-600. MADAN, R. K., S; SARTOR, O AND DAHUT, W 2011. Overcoming Chemotherapy Resistance in Prostate Cancer. Clin Cancer Res, 17, 3892-3902. MADDISON, L. A., HUSS, W. J., BARRIOS, R. M. & GREENBERG, N. M. 2004. Differential expression of cell cycle regulatory molecules and evidence for a "cyclin switch" during progression of prostate cancer. Prostate, 58, 335-344. MAGEE, J. A., ABDULKADIR, S. A. & MILBRANDT, J. 2003. Haploinsufficiency at the Nkx3.1 locus. A paradigm for stochastic, dosage-sensitive gene regulation during tumor initiation. Cancer Cell, 3, 273-83. MASKO, E. M., ALLOTT, E. H. & FREEDLAND, S. J. 2013. The Relationship Between Nutrition and Prostate Cancer: Is More Always Better? European Urology, 63, 810-820. MASSARD, C. & FIZAZI, K. 2011. Targeting continued androgen receptor signaling in prostate cancer. Clinical cancer research : an official journal of the American Association for Cancer Research, 17, 3876-83. MATHEW, P. & DIPAOLA, R. 2007. Taxane Refractory Prostate Cancer. The Journal of Urology, 178, S36-S41. MAW, M. K., FUJIMOTO, J. & TAMAYA, T. 2009. Overexpression of inhibitor of DNA-binding (ID)-1 protein related to angiogenesis in tumor advancement of ovarian cancers. BMC Cancer, 9, 430. MCNEAL, J. E. 1981. THE ZONAL ANATOMY OF THE PROSTATE. Prostate, 2, 35-49. MEEK, D. W. 2004. The p53 response to DNA damage. DNA Repair, 3, 1049-1056.

MEEKER, A. K., HICKS, J. L., PLATZ, E. A., MARCH, G. E., BENNETT, C. J., DELANNOY, M. J. & DE MARZO, A. M. 2002. Telomere shortening is an early somatic DNA alteration in human prostate tumorigenesis. Cancer Res, 62, 6405-9. MITRA, A., FISHER, C., FOSTER, C. S., JAMESON, C., BARBACHANNO, Y., BARTLETT, J., BANCROFT, E., DOHERTY, R., KOTE-JARAI, Z., PEOCK, S., EASTON, D., EELES, R. & IMPACT 2008. Prostate cancer in male BRCA1 and BRCA2 mutation carriers has a more aggressive phenotype. British Journal of Cancer, 98, 502-507. MORRIS, W. J., KEYES, M., SPADINGER, I., KWAN, W., LIU, M., MCKENZIE, M., PAI, H., PICKLES, T. & TYLDESLEY, S. 2013. Population-based 10-year oncologic outcomes after low-dose-rate brachytherapy for low-risk and intermediate-risk prostate cancer. Cancer, 119, 1537-1546. MSAOUEL, P., PISSIMISSIS, N., HALAPAS, A. & KOUTSILIERIS, M. 2008. Mechanisms of bone metastasis in prostate cancer: clinical implications. Best Practice & Research Clinical Endocrinology & Metabolism, 22, 341-355. MUKAI, H. 2003. The structure and function of PKN, a protein kinase having a catalytic domain homologous to that of PKC. Journal of Biochemistry, 133, 17-27. MUKHERJEE, R., MCGUINNESS, D. H., MCCALL, P., UNDERWOOD, M. A., SEYWRIGHT, M., ORANGE, C. & EDWARDS, J. 2011. Upregulation of MAPK pathway is associated with survival in castrate- resistant prostate cancer. Br J Cancer, 104, 1920-1928. MULHOLLAND, D. J., KOBAYASHI, N., RUSCETTI, M., ZHI, A., TRAN, L. M., HUANG, J. T., GLEAVE, M. & WU, H. 2012. Pten Loss and RAS/MAPK Activation Cooperate to Promote EMT and Metastasis Initiated from Prostate Cancer Stem/Progenitor Cells. Cancer Research, 72, 1878- 1889. NAKANISHI, H., GROSKOPF, J., FRITSCHE, H. A., BHADKAMKAR, V., BLASE, A., KUMAR, S. V., DAVIS, J. W., TRONCOSO, P., RITTENHOUSE, H. & BABAIAN, R. J. 2008. PCA3 molecular urine assay correlates with prostate cancer tumor volume: Implication in selecting candidates for active surveillance. Journal of Urology, 179, 1804-1809. NORMANNO, N., DE LUCA, A., BIANCO, C., STRIZZI, L., MANCINO, M., MAIELLO, M. R., CAROTENUTO, A., DE FEO, G., CAPONIGRO, F. & SALOMON, D. S. 2006. Epidermal growth factor receptor (EGFR) signaling in cancer. Gene, 366, 2-16. OHORI, M., SCARDINO, P. T., LAPIN, S. L., SEALEHAWKINS, C., LINK, J. & WHEELER, T. M. 1993. THE MECHANISMS AND PROGNOSTIC-SIGNIFICANCE OF SEMINAL-VESICLE INVOLVEMENT BY PROSTATE-CANCER. American Journal of Surgical Pathology, 17, 1252-1261. ONO, K. & HAN, J. 2000. The p38 signal transduction pathway Activation and function. Cellular Signalling, 12, 1-13. OREN, M. 1999. Regulation of the p53 Tumor Suppressor Protein. Journal of Biological Chemistry, 274, 36031-36034. OUYANG, X., DEWEESE, T. L., NELSON, W. G. & ABATE-SHEN, C. 2005. Loss-of-function of Nkx3.1 promotes increased oxidative damage in prostate carcinogenesis. Cancer Res, 65, 6773-9. PARK, I. J., KIM, M. J., PARK, O. J., PARK, M. G., CHOE, W., KANG, I., KIM, S. S. & HA, J. 2010. Cryptotanshinone sensitizes DU145 prostate cancer cells to Fas(APO1/CD95)-mediated apoptosis through Bcl-2 and MAPK regulation. Cancer Letters, 298, 88-98. PEPE, P. & ARAGONA, F. 2010. Incidence of insignificant prostate cancer using free/total PSA: results of a case-finding protocol on 14 453 patients. Prostate Cancer and Prostatic Diseases, 13, 316-319. PETRYLAK, D. P., TANGEN, C. M., HUSSAIN, M. H. A., LARA, P. J., JONES, J. A., TAPLIN, M. E., BURCH, P. A., BERRY, D., MOINPOUR, C., KOHLI, M., BENSON, M. C., SMALL, E. J., RAGHAVAN, D. & CRAWFORD, E. D. 2004. Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. New England Journal of Medicine, 351, 1513-1520. PFAFFL, M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res, 29, e45.

POPULO, H., LOPES, J. M. & SOARES, P. 2012. The mTOR Signalling Pathway in Human Cancer. International Journal of Molecular Sciences, 13, 1886-1918. PROMEGA. 2014. Subcloning Notebook [Online]. Available: http://www.promega.com/~/media/files/resources/product%20guides/subcloning%20note book/transforming_bacteria_row.pdf?la=en [Accessed 15 August 2014. PUNNEN, S., COOPERBERG, M. R., D'AMICO, A. V., KARAKIEWICZ, P. I., MOUL, J. W., SCHER, H. I., SCHLOMM, T. & FREEDLAND, S. J. 2013. Management of Biochemical Recurrence After Primary Treatment of Prostate Cancer: A Systematic Review of the Literature. European Urology, 64, 905-915. PUNNEN, S., HARDIN, J., CHENG, I., KLEIN, E. A. & WITTE, J. S. 2011. Impact of meat consumption, preparation, and mutagens on aggressive prostate cancer. PloS one, 6, e27711. ROBERTS, P. J. & DER, C. J. 2007. Targeting the Raf-MEK-ERK mitogen-activated protein kinase cascade for the treatment of cancer. Oncogene, 26, 3291-3310. RODDAM, A. W., ALLEN, N. E., APPLEBY, P., KEY, T. J., FERRUCCI, L., CARTER, H. B., METTER, E. J., CHEN, C., WEISS, N. S., FITZPATRICK, A., HSING, A. W., LACEY, J. V., HELZLSOUER, K., RINALDI, S., RIBOLI, E., KAAKS, R., JANSSEN, J., WILDHAGEN, M. F., SCHRODER, F. H., PLATZ, E. A., POLLAK, M., GIOVANNUCCI, E., SCHAEFER, C., QUESENBERRY, C. P., VOGELMAN, J. H., SEVERI, G., ENGLISH, D. R., GILES, G. G., STATTIN, P., HALLMANS, G., JOHANSSON, M., CHAN, J. M., GANN, P., OLIVER, S. E., HOLLY, J. M., DONOVAN, J., MEYER, F., BAIRATI, I. & GALAN, P. 2008. Insulin-like growth factors, their binding proteins, and prostate cancer risk: Analysis of individual patient data from 12 prospective studies. Annals of Internal Medicine, 149, 461- W88. RODRIGUEZ, C., CALLE, E. E., TATHAM, L. M., WINGO, P. A., MIRACLE-MCMAHILL, H. L., THUN, M. J. & HEATH, C. W. 1998. Family history of breast cancer as a predictor for fatal prostate cancer. Epidemiology, 9, 525-529. ROEHRBORN, C. G., BOYLE, P., GOULD, A. L. & WALDSTREICHER, J. 1999. Serum prostate-specific antigen as a predictor of prostate volume in men with benign prostatic hyperplasia. Urology, 53, 581-589. ROGNE, M. & TASKEN, K. 2013. Cell signalling analyses in the functional genomics era. N Biotechnol, 30, 333-8. RUBIN, M. A., BISMAR, T. A., ANDREN, O., MUCCI, L., KIM, R., SHEN, R. L., GHOSH, D., WEI, J. T., CHINNAIYAN, A. M., ADAMI, H. O., KANTOFF, P. W. & JOHANSSON, J. E. 2005. Decreased alpha-methylacyl CoA racemase expression in localized prostate cancer is associated with an increased rate of biochemical recurrence and cancer-specific death. Cancer Epidemiology Biomarkers & Prevention, 14, 1424-1432. RYAN, C. J., HAQQ, C. M., SIMKO, J., NONAKA, D. F., CHAN, J. M., WEINBERG, V., SMALL, E. J. & GOLDFINE, I. D. 2007. Expression of insulin-like growth factor-1 receptor in local and metastatic prostate cancer. Urologic Oncology-Seminars and Original Investigations, 25, 134- 140. SAAD, F. & PANTEL, K. 2012. The current role of circulating tumor cells in the diagnosis and management of bone metastases in advanced prostate cancer. Future Oncology, 8, 321-331. SALAGIERSKI, M. & SCHALKEN, J. A. 2012. Molecular Diagnosis of Prostate Cancer: PCA3 and TMPRSS2:ERG Gene Fusion. The Journal of Urology, 187, 795-801. SARAON, P., JARVI, K. & DIAMANDIS, E. P. 2011. Molecular Alterations during Progression of Prostate Cancer to Androgen Independence. Clinical Chemistry, 57, 1366-1375. SATO, K., QIAN, J., SLEZAK, J. M., LIEBER, M. M., BOSTWICK, D. G., BERGSTRALH, E. J. & JENKINS, R. B. 1999. Clinical significance of alterations of chromosome 8 in high-grade, advanced, nonmetastatic prostate carcinoma. J Natl Cancer Inst, 91, 1574-80. SCHALLER, M. D. 2010. Cellular functions of FAK kinases: insight into molecular mechanisms and novel functions. Journal of Cell Science, 123, 1007-1013.

SCHER, H. I., BEER, T. M., HIGANO, C. S., ANAND, A., TAPLIN, M. E., EFSTATHIOU, E., RATHKOPF, D., SHELKEY, J., YU, E. Y., ALUMKAL, J., HUNG, D., HIRMAND, M., SEELY, L., MORRIS, M. J., DANILA, D. C., HUMM, J., LARSON, S., FLEISHER, M., SAWYERS, C. L. & PROSTATE CANC, F. 2010. Antitumour activity of MDV3100 in castration-resistant prostate cancer: a phase 1-2 study. Lancet, 375, 1437-1446. SCHMIDT, J. 2006. MAPK/ERK pathway [Online]. Available: http://commons.wikimedia.org/wiki/File:MAPKpathway.png#mediaviewer/File:MAPKpathw ay.png [Accessed 18 July 2014. SCHROEDER, F. H., HUGOSSON, J., ROOBOL, M. J., TAMMELA, T. L. J., CIATTO, S., NELEN, V., KWIATKOWSKI, M., LUJAN, M., LILJA, H., ZAPPA, M., DENIS, L. J., RECKER, F., BERENGUER, A., MAATTANEN, L., BANGMA, C. H., AUS, G., VILLERS, A., REBILLARD, X., VAN DER KWAST, T., BLIJENBERG, B. G., MOSS, S. M., DE KONING, H. J., AUVINEN, A. & INVESTIGATORS, E. 2009. Screening and Prostate-Cancer Mortality in a Randomized European Study. New England Journal of Medicine, 360, 1320-1328. SHARMA, P., PATEL, D. & CHAUDHARY, J. 2012. Id1 and Id3 expression is associated with increasing grade of prostate cancer: Id3 preferentially regulates CDKN1B. Cancer Med, 1, 187-97. SHUI, I. M., MUCCI, L. A., KRAFT, P., TAMIMI, R. M., LINDSTROM, S., PENNEY, K. L., NIMPTSCH, K., HOLLIS, B. W., DUPRE, N., PLATZ, E. A., STAMPFER, M. J. & GIOVANNUCCI, E. 2012. Vitamin D-Related Genetic Variation, Plasma Vitamin D, and Risk of Lethal Prostate Cancer: A Prospective Nested Case-Control Study. Journal of the National Cancer Institute, 104, 690- 699. SLEE, E. A., O'CONNOR, D. J. & LU, X. 2004. To die or not to die: how does p53 decide? Oncogene, 23, 2809-2818. SLOVIN, S. F., KELLY, W. K., WILTON, A., KATTAN, M., MYSKOWSKI, P., MENDELSOHN, J. & SCHER, H. I. 2009. Anti-Epidermal Growth Factor Receptor Monoclonal Antibody Cetuximab Plus Doxorubicin in the Treatment of Metastatic Castration-Resistant Prostate Cancer. Clinical Genitourinary Cancer, 7, E77-E82. SMALL, E. J., FONTANA, J., TANNIR, N., DIPAOLA, R. S., WILDING, G., RUBIN, M., IACONA, R. B. & KABBINAVAR, F. F. 2007. A phase II trial of gefitinib in patients with non-metastatic hormone-refractory prostate cancer. Bju International, 100, 765-769. STROM, S., YAMAMURA, Y., FORMAN, M., PETTAWAY, C., BARRERA, S. & DIGIOVANNI, J. 2008. Saturated fat intake predicts biochemical failure after prostatectomy. International Journal of Cancer, 122, 2581-2585. STROPE, S. A. & ANDRIOLE, G. L. 2010. Prostate cancer screening: current status and future perspectives. Nature Reviews Urology, 7, 487-493. STURGILL, T., STODDARD, P., COHN, S. & MAYO, M. 2010. The promoter for intestinal cell kinase is head-to-head with F-Box 9 and contains functional sites for TCF7L2 and FOXA factors. Molecular Cancer, 9, 1-13. SUN, S. H., SPRENGER, C. C. T., VESSELLA, R. L., HAUGK, K., SORIANO, K., MOSTAGHEL, E. A., PAGE, S. T., COLEMAN, I. M., NGUYEN, H. M., SUN, H. Y., NELSON, P. S. & PLYMATE, S. R. 2010. Castration resistance in human prostate cancer is conferred by a frequently occurring androgen receptor splice variant. Journal of Clinical Investigation, 120, 2715-2730. TAM, L., MCGLYNN, L. M., TRAYNOR, P., MUKHERJEE, R., BARTLETT, J. M. S. & EDWARDS, J. 2007. Expression levels of the JAK//STAT pathway in the transition from hormone-sensitive to hormone-refractory prostate cancer. Br J Cancer, 97, 378-383. TAM, W. F., GU, T.-L., CHEN, J., LEE, B. H., BULLINGER, L., FRÖHLING, S., WANG, A., MONTI, S., GOLUB, T. R. & GILLILAND, D. G. 2008. Id1 is a common downstream target of oncogenic tyrosine kinases in leukemic cells. TAYLOR, B. S., SCHULTZ, N., HIERONYMUS, H., GOPALAN, A., XIAO, Y., CARVER, B. S., ARORA, V. K., KAUSHIK, P., CERAMI, E., REVA, B., ANTIPIN, Y., MITSIADES, N., LANDERS, T., DOLGALEV, I., MAJOR, J. E., WILSON, M., SOCCI, N. D., LASH, A. E., HEGUY, A., EASTHAM, J. A., SCHER, H. I.,

REUTER, V. E., SCARDINO, P. T., SANDER, C., SAWYERS, C. L. & GERALD, W. L. 2010. Integrative genomic profiling of human prostate cancer. Cancer Cell, 18, 11-22. THOMPSON, I. M., KOURIL, M., KLEIN, E. A., COLTMAN, C. A., RYAN, A. & GOODMAN, P. 2001. The prostate cancer prevention trial: Current status and lessons learned. Urology, 57, 230-234. THOMPSON, I. M., VALICENTI, R. K., ALBERTSEN, P., DAVIS, B. J., GOLDENBERG, S. L., HAHN, C., KLEIN, E., MICHALSKI, J., ROACH, M., SARTOR, O., WOLF JR, J. S. & FARADAY, M. M. 2013. Adjuvant and Salvage Radiotherapy After Prostatectomy: AUA/ASTRO Guideline. The Journal of Urology, 190, 441-449. THRELFALL, T., ENGLISH, D. & ROUSE, I. 1998. Prostate cancer in Western Australia: trends in incidence and mortality from 1985 to 1996. MJA, 169, 21-24. TING, H.-J., HSU, J., BAO, B.-Y. & LEE, Y.-F. 2007. Docetaxel-induced growth inhibition and apoptosis in androgen independent prostate cancer cells are enhanced by 1α,25-dihydroxyvitamin D3. Cancer Letters, 247, 122-129. TOMLINS, S. A., BJARTELL, A., CHINNAIYAN, A. M., JENSTER, G., NAM, R. K., RUBIN, M. A. & SCHALKEN, J. A. 2009. ETS Gene Fusions in Prostate Cancer: From Discovery to Daily Clinical Practice. European Urology, 56, 275-286. TOMLINS, S. A., RHODES, D. R., PERNER, S., DHANASEKARAN, S. M., MEHRA, R., SUN, X. W., VARAMBALLY, S., CAO, X. H., TCHINDA, J., KUEFER, R., LEE, C., MONTIE, J. E., SHAH, R. B., PIENTA, K. J., RUBIN, M. A. & CHINNAIYAN, A. M. 2005. Recurrent fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer. Science, 310, 644-648. TRAISH, A. M. & MORGENTALER, A. 2009. Epidermal growth factor receptor expression escapes androgen regulation in prostate cancer: a potential molecular switch for tumour growth. British Journal of Cancer, 101, 1949-1956. TROCK, B. J., HAN, M., FREEDLAND, S. J., HUMPHREYS, E. B., DEWEESE, T. L., PARTIN, A. W. & WALSH, P. C. 2008. Prostate cancer-specific survival following salvage radiotherapy vs observation in men with biochemical recurrence after radical prostatectomy. Jama-Journal of the American Medical Association, 299, 2760-2769. TRYGGVADOTTIR, L., VIDARSDOTTIR, L., THORGEIRSSON, T., JONASSON, J. G., OLAFSDOTTIR, E. J., OLAFSDOTTIR, G. H., RAFNAR, T., THORLACIUS, S., JONSSON, E., EYFJORD, J. E. & TULINIUS, H. 2007. Prostate cancer progression and survival in BRCA2 mutation carriers. Journal of the National Cancer Institute, 99, 929-935. VIOLETTE, P. D. & SAAD, F. 2012. Chemoprevention of prostate cancer: myths and realities. Journal of the American Board of Family Medicine : JABFM, 25, 111-9. WANG, L. Y. & KUNG, H. J. 2012. Male germ cell-associated kinase is overexpressed in prostate cancer cells and causes mitotic defects via deregulation of APC/CCDH1. Oncogene, 31, 2907- 2918. WANG, Y. N. & HUNG, M. C. 2012. Nuclear functions and subcellular trafficking mechanisms of the epidermal growth factor receptor family. Cell and Bioscience, 2. WEINBERG, W. C. & DENNING, M. F. 2002. p21(waf1) control of epithelial cell cycle and cell fate. Critical Reviews in Oral Biology & Medicine, 13, 453-464. WHITWORTH, H., BHADEL, S., IVEY, M., CONAWAY, M., SPENCER, A., HERNAN, R., HOLEMON, H. & GIOELI, D. 2012. Identification of Kinases Regulating Prostate Cancer Cell Growth Using an RNAi Phenotypic Screen. PloS one, 7. WIKIPEDIA. 2006. Gleason grading system [Online]. Available: http://en.wikipedia.org/wiki/Gleason_score [Accessed 07 May 2014]. WILLIAMS C, WHITLEY B, HOYO C, GRANT D, IRAGGI J, NEWMAN K, GERBER, TAYLOR L, MCKEEVER M & FREEDLAND S 2011. A high ratio of dietary n-6/ n-3 polyunsaturated fatty acids is associated with increased risk of prostate cancer. Nutrition Research, 1, 1-8. WILT, T. J., BRAWER, M. K., JONES, K. M., BARRY, M. J., ARONSON, W. J., FOX, S., GINGRICH, J. R., WEI, J. T., GILHOOLY, P., GROB, D. M., NSOULI, I., IYER, P., CARTAGENA, R., SNIDER, G., ROEHRBORN, C., SHARIFI, R., BLANK, W., PANDYA, P., ANDRIOLE, G. L., CULKIN, D.,

WHEELER, T. & PROSTATE CANCER INTERVENTION, V. 2012. Radical Prostatectomy versus Observation for Localized Prostate Cancer. New England Journal of Medicine, 367, 203-213. WOHLBOLD, L., LAROCHELLE, S., LIAO, J. C., LIVSHITS, G., SINGER, J., SHOKAT, K. M. & FISHER, R. P. 2006. The cyclin-dependent kinase (CDK) family member PNQALRE/CCRK supports cell proliferation but has no intrinsic CDK-activating kinase (CAK) activity. Cell Cycle, 5, 546-54. WU, D., CHAPMAN, J. R., WANG, L. F., HARRIS, T. E., SHABANOWITZ, J., HUNT, D. F. & FU, Z. 2012. Intestinal Cell Kinase (ICK) Promotes Activation of mTOR Complex 1 (mTORC1) through Phosphorylation of Raptor Thr-908. Journal of Biological Chemistry, 287, 12510-12519. WU, X., DING, B., GAO, J., WANG, H., FAN, W., WANG, X., ZHANG, W., WANG, X., YE, L., ZHANG, M., DING, X., LIU, J., ZHU, Q. & GAO, S. 2011. Second-generation aptamer-conjugated PSMA- targeted delivery system for prostate cancer therapy. Int J Nanomedicine, 6, 1747-56. XU, J. C., STOLK, J. A., ZHANG, X. Q., SILVA, S. J., HOUGHTON, R. L., MATSUMURA, M., VEDVICK, T. S., LESLIE, K. B., BADARO, R. & REED, S. G. 2000. Identification of differentially expressed genes in human prostate cancer using subtraction and microarray. Cancer Research, 60, 1677- 1682. YEAGER, M., ORR, N., HAYES, R. B., JACOBS, K. B., KRAFT, P., WACHOLDER, S., MINICHIELLO, M. J., FEARNHEAD, P., YU, K., CHATTERJEE, N., WANG, Z. M., WELCH, R., STAATS, B. J., CALLE, E. E., FEIGELSON, H. S., THUN, M. J., RODRIGUEZ, C., ALBANES, D., VIRTAMO, J., WEINSTEIN, S., SCHUMACHER, F. R., GIOVANNUCCI, E., WILLETT, W. C., CANCEL-TASSIN, G., CUSSENOT, O., VALERI, A., ANDRIOLE, G. L., GELMANN, E. P., TUCKER, M., GERHARD, D. S., FRAUMENI, J. F., HOOVER, R., HUNTER, D. J., CHANOCK, S. J. & THOMAS, G. 2007. Genome-wide association study of prostate cancer identifies a second risk locus at 8q24. Nature Genetics, 39, 645-649. YONG, S. T. & WANG, X. F. 2012. A novel, non-apoptotic role for Scythe/BAT3: a functional switch between the pro- and anti-proliferative roles of p21 during the cell cycle. PLoS One, 7, e38085. YUAN, X. & BALK, S. P. 2009. Mechanisms mediating androgen receptor reactivation after castration. Urologic Oncology-Seminars and Original Investigations, 27, 36-41. ZHANG, J., YANG, P. L. & GRAY, N. S. 2009. Targeting cancer with small molecule kinase inhibitors. Nat Rev Cancer, 9, 28-39. ZHAO, Y., TINDALL, D. J. & HUANG, H. 2014. Modulation of androgen receptor by FOXA1 and FOXO1 factors in prostate cancer. Int J Biol Sci, 10, 614-9. ZUO, Z., DEAN, N. M. & HONKANEN, R. E. 1998. Serine/threonine protein phosphatase type 5 acts upstream of p53 to regulate the induction of p21(WAF1/Cip1) and mediate growth arrest. J Biol Chem, 273, 12250-8.