Meningiomas: Analysis of Loss of Heterozygosity on Chromosome 10

Vol. 9, 4435–4442, October 1, 2003 Clinical Cancer Research 4435

Meningiomas: Analysis of Loss of Heterozygosity on Chromosome 10 in Tumor Progression and the Delineation of Four Regions of Chromosomal Deletion in Common with Other Cancers

Dana Mihaila, Jorge A. Gutie´rrez, chromosomal deletion: 10pter-D10S89, D10S109-D10S215, Mark L. Rosenblum, Irene F. Newsham, D10S187-D10S209, and D10S169-10qter. These deletions on Oliver Bo¨gler, and Sandra A. Rempel1 on behalf chromosome 10 are shared with other cancer types. 2 Conclusions: These results delineate chromosomal loca- of NABTT CNS Consortium tions of putative tumor suppressor genes on chromosome 10 Hermelin Brain Tumor Center [D. M., M. L. R., I. F. N., O. B., that likely play an early role in meningioma tumorigenesis S. A. R.] and Department of Neuropathology [J. A. G.], Henry Ford as well as tumor progression. Health Sciences Center, Detroit, Michigan 48202

INTRODUCTION ABSTRACT Despite the fact that meningiomas (1, 2) are the most Purpose: Loss of heterozygosity (LOH) of alleles on frequent type of brain tumor (3) and were among the first solid chromosome 10 has been reported in many cancers, leading neoplasms to be studied cytogenetically (4–6), little is known to the identification of tumor suppressor genes on this chro- about their molecular genetic profile, with the exception of the mosome. Several reports implicate LOH of chromosome 10 identification of the NF2 locus on chromosome 22 (7–10). To alleles in meningioma progression, but the frequency and date, allelic losses on chromosomes 1, 9, 10, 14, 18, and 22 have complexity of the loss have not been well characterized. been implicated in the pathogenesis of meningiomas (11–16). Furthermore, the location and identity of the putative tumor Several studies have associated loss of alleles on chromosome suppressor genes on this chromosome that contribute to 10 with malignant meningioma progression. In the first study, meningioma progression are unknown because the currently 2 we have demonstrated LOH in 1 of 2 (50%) atypical and 4 of characterized tumor suppressor genes do not appear to be 13 (30.8%) malignant meningiomas using two chromosome 10p involved. Therefore, this study was undertaken to (a) assess (D10S89 and D10S111) and two chromosome 10q (D10S109 the frequency and complexity of LOH in meningioma pro- and D10S169) loci (11). LOH was observed for D10S89 and gression, (b) map the LOH patterns of individual meningi- D10S169. In a second study, Simon et al. (12) expanded the omas to define the smallest regions of shared chromosomal number of loci to seven, including three 10p markers (D10S179, deletion, and (c) compare the identified regions with chro- D10S89, and D10S111) and four 10q markers (D10S109, mosome 10 deletions in other cancers, and thereby initiate D10S169, D10S187, and D10S209). Their study did not report the localization of the putative tumor suppressor genes. results obtained at individual loci, but combined results for Experimental Design: We examined 11 microsatellite chromosomal arms. LOH was observed on 10q in a small dinucleotide repeat loci in 208 meningiomas of all grades percentage of benign tumors (12%), with increasing LOH in using laser capture microdissection and fluorescence-based atypical (27%) and malignant (40%) tumors. The smallest re- detection of PCR products. gion of allelic deletion using these loci was found to be 10q24– Results: For all markers examined, the incidence of 10qter. In a third study, Weber et al. (13), using two chromo- LOH was much higher in all grades than that previously some 10q markers (D10S185 and D10S212), identified LOH in reported, with incidence and complexity of LOH increasing 1 of 19 (5.3%) benign, 4 of 21 (19.0%) atypical, and 5 of 9 with tumor grade. LOH mapping identified four regions of (55.6%) malignant tumors. Similarly, in a fourth study, von Deimling et al. (14), using two chromosome 10p markers (D10S674 and D10S89) and four chromosome 10q markers (ZNF22, D10S676, D10S677, and D10S169), found LOH for Received 2/4/03; revised 4/29/03; accepted 5/7/03. combined 10q loci in 3 of 56 (5.4%) benign, 4 of 10 (40%) The costs of publication of this article were defrayed in part by the atypical, and 5 of 9 (55.6%) malignant meningiomas. Lamszuz payment of page charges. This article must therefore be hereby marked et al. (15) examined four 10q loci (D10S469, D10S169, advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. D10S187, and D10S209). Reporting results for individual loci, This work was supported by the NIH National Cancer Institute they found LOH in two of five patients at D10S187 and CA62475 (Stuart A. Grossman) Biology Core Allocation (to S. A. R.) D10S209. These five studies examining tumors derived from and the Elsa U. Pardee Foundation (S. A. R.). different patients demonstrate early LOH in a subset of benign 1 To whom requests for reprints should be addressed, at Barbara Jane Levy Laboratory of Molecular Neuro-Oncology, Hermelin Brain Tumor Center, Department of Neurosurgery, Room 3096, Education and Re- search Building, Henry Ford Hospital, 2799 West Grand Boulevard, Detroit, MI 48202. Phone: (313) 916-8689; Fax: (313) 916-9855; E- mail: [email protected]. 2 The abbreviations used are: LOH, loss of heterozygosity; LCM, laser 2 New Approaches to Brain Tumor Therapy, Central Nervous System. capture microdissection; NI, noninformative.

meningiomas with increasing frequency of LOH during tumor inactivated at 96°C for 8 min, and the extracts were used directly progression. as templates for PCR. Lymphocyte DNA was extracted using However, it is difficult to assess the frequency or complex- the Stratagene DNA extraction kit (La Jolla, CA). ity of LOH occurring in the different grades by comparing the PCR. Matched tumor and normal DNAs were PCR am- chromosome 10 LOH data in these reports because different loci plified at 11 polymorphic microsatellite markers mapping to were used, and the results for individual loci were not always chromosome 10: D10S179; D10S189; D10S89; D10S580; reported separately. Furthermore, because meningiomas do not D10S109; D10S215; D10S574; D10S187; D10S209; D10S217; tend to lose the entire chromosome 10 (17), as is the case with and D10S169. One primer from each primer pair was fluores- the majority of astrocytic gliomas (18), detailed LOH studies cently labeled with either D2, D3, or D4 Beckman WellRED may well be useful in defining candidate tumor suppressor loci. dyes (Research Genetics, Huntsville, AL), so that LOH analyses Therefore, we examined 11 microsatellite dinucleotide repeat could be multiplexed. PCR amplifications (PTC-200 Thermal loci in 208 meningiomas of all grades using LCM and fluores- Cycler; MJ Research, Watertown, MA) were performed using 2 cence-based detection of PCR products (a) to assess the fre- ␮l of DNA template, 0.5 unit of platinum Taq polymerase quency and complexity of LOH throughout tumor progression, (Invitrogen, Carlsbad, CA), 1.25 mM deoxynucleotides, 1.5 mM ␮ (b) to map the LOH patterns of individual tumors to define MgCl2, and 4 M of each forward and reverse primer, in a total regions of chromosomal deletion, and (c) to compare these volume of 10 ␮l. Cycling conditions consisted of 95°C for 5 chromosomal deletions with those found in other cancers. min, followed by 45 cycles of denaturing at 95°C for 1 min, annealing at 55°C for 1 min, and extension at 72°C for 1 min according to published reports (19, 20). The final elongation MATERIALS AND METHODS was at 72°C for 10 min. Specimens. A total of 208 paraffin-embedded meningi- LOH Analysis. Loci analyzed were selected based on oma specimens were collected. Tumors were derived from pa- previously reported loci that were found to be informative for tients surgically treated at Henry Ford Hospital between 1968 LOH (11–15). Not all primers amplified well in our hands. and 2001. Institutional review board-approved informed consent Eleven primer sets were finally selected. LOH was assessed was obtained from all patients or from the patient’s guardian for using the CEQ 2000 XL fragment analyzer (Beckman Coulter, use of tumor tissue collected at the time of tumor resection. Fullerton, CA) as reported previously (21). Using 96-well Since 1993, informed consent included the collection of blood plates, each well was loaded with 3 ␮l of amplified DNA, 0.57 for the extraction of lymphocyte DNA. For specimens collected ␮l of Beckman WellRED D1-labeled size standard, and 37 ␮lof before 1993, normal DNA was extracted from microdissected deionized formamide; topped with mineral oil; and mixed. Spec- adjacent brain tissue present on the paraffin-embedded tumor imens were scored as: (a) having maintenance of both alleles; specimens. Two 5-␮m serial sections having diagnostic tumor (b) having LOH; (c) being NI; (d) having microsatellite insta- were obtained for each specimen; one was stained with H&E, bility; or (e) not amplified. LOH was assigned when the peak whereas the other remained unstained. The H&E-stained sec- area of one allele in tumor tissue was Ͻ40% of the other tumor tions were used for grading. All tumors were graded as either allele in comparison with the ratio of peak areas of the two benign, atypical, or anaplastic/malignant, which correspond to alleles in the corresponding constitutional DNA, as reported WHO grades I, II, and III, respectively (2). In addition, the previously (16, 22). neuropathologist circled the area representative of diagnostic Smallest Regions of Allelic Deletion. For each speci- tumor or normal brain on the H&E-stained section. men, the regions of LOH were mapped along the chromosome. LCM and DNA Extraction. All tumors were microdis- Each LOH region was limited to the first maintained locus on sected. LCM (PixCell II; Arcturus Engineering Inc., Mountain either side of the lost allele (except for the telomeric alleles that View, CA) was used to minimize the contamination of tumor were limited to one side only). A composite map indicating the DNA by normal cell DNA, and vice versa. The H&E-stained type and frequency of the LOH patterns for all tumors was used slides were used as reference to localize the homogeneous to generate the smallest regions of allelic deletion (22). regions of diagnostic tumor or normal brain tissue on the un- Data Analyses. For data analyses, the following calcu- stained sections that had been deparaffinized in xylene for 1–2 lations were performed. The number of informative tumors ϭ h, and air dried. To ensure adequate DNA copy number for the number of tumors maintaining both alleles ϩ the number of subsequent PCR reactions, a minimum of 1000 cells were cap- tumors with LOH. The percentage of LOH ϭ (the number of tured using between 1000 and 1500 pulses of the focused tumors with LOH)/(the number of informative tumors) ϫ 100. 30-␮m-diameter laser. The transfer of the cells to capture film was verified by examining the LCM caps at ϫ40 magnification before DNA extraction. A 5-␮l droplet of the digestion buffer RESULTS [10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 1% Tween 20, and Tumor Specimens. Of the 208 tumors collected, 173 0.1% proteinase K] was applied to coat the cells attached to the (83.2%) of the tumors were benign (grade I), 20 (9.6%) were capture film on the LCM cap. After 1 min, the LCM caps were atypical (grade II), and 15 (7.2%) were malignant (grade III) transferred to 0.5-ml microfuge tubes (Perkin-Elmer, Norwalk, tumors. Matched lymphocyte DNA was available for 148 tu- CT) containing 45 ␮l of extraction buffer and warmed at 52°C mors. For 60 tumors, matched normal DNA was obtained from for 5 min. The tubes were then inverted and incubated overnight microdissected adjacent normal brain tissue. (16–18 h) at 52°C. After incubation, the tubes were up-righted LOH Analyses. Table 1 lists the dinucleotide repeat loci and centrifuged at 13,000 rpm for 5 min. Proteinase K was and the primers used for the PCR reactions. Fig. 1 demonstrates

Table 1 Chromosome 10 CA dinucleotide repeat loci and primers Locusa D (Mb)b Locationc Alleles (no.)d Size range (bp) Primers 5Ј to 3Јe Labelf D10S179a p14 11 117–141 GCCCACTTTCAGATTCCTGCT D10S179m GCAGGGAGAAGGACTATGCAT D3 D10S189a 14.3 p14 4 180–188 CAAAAGTAACCATTGAGCCC D4 D10S189m TTGATAGAAGAAGCGATAGATCG D10S89a 45.5 p12.1 8 142–156 AACACTAGTGACATTATTTTCA D10S89m AGCTAGGCCTGAAGGCTTCT D3 D10S580a 113.0 q22.3 6 91–105 AAAACATATTGCGCGTGC D2 D10S580m CATATACGTCAGGAACATCTGC D10S109m 113.7 q22.3 9 99–117 GATCGTTCTTGCTGATTTT D2 D10S109a GAAATCTCAAAAGACAAACAAGT D10S215a 129.7 q22.31 16 152–208 TGGCATCATTCTGGGGA D4 D10S215m GCTTTACGTTTCTTCACATGGT D10S574a 130.2 q24.1 8 124–136 GTGGGACTCTGTGATTGTG D10S574m TGCTTAATGGGGACAGG D3 D10S187a 151.3 q25.3 11 92–114 CCCTGATAGGCACTCATGTG D10S187m TTCCTCATAACCTCCGCTTC D2 D10S209a 154.4 q26.11 7 181–216 CAAATGTGCTCATATCCTGC D10S209m CCCATCAGTAGTAAAGGGGC D4 D10S217a 160.6 q26.2 9 196–212 CCACGATGCAGAGGTT D10S217b CCAGGTGGCTAGGAGG D2 D10S169a 163.6 q26.3 7 99–117 GATCTGTGACTGCCTTCCT D2 D10S169m AAGAGGAGGAGTCCATTCAG a The Genome Database (GDB) primer designations. b D, distance as measured in Mb from the telomere (short arm); information for all loci but D10S179 was obtained from the Weizmann Institute Unified Database for Human Genome Mapping. c Chromosomal location was obtained from ENSEMBL Genome Server (The Welcome Trust Sanger Institute) database. Information for D10S179 was obtained from the Cooperative Human Linkage Center database (version V808). d Allele number and size information was obtained from GDB website. e Bold type indicates primers fluorescently labeled with Beckman WellRED dyes. f Label indicates which WellRED dye was used. Sequences were obtained from the GDB database.

typical profiles obtained using these primers for the mainte- deletion were therefore defined, for the most part, by the benign nance of both alleles, the LOH on the shorter allele, the LOH on tumors, and these were the 10p region pter-D10S89 and the 10q the longer allele, and a NI locus. regions D10S109-D10S215, D10S187-D10S209, and D10S169- Overall, of the 208 meningiomas, 202 (97.1%) were het- 10qter. erozygous in their normal tissue for at least one polymorphic It should be noted that mapping was performed placing marker, and 156 of 202 informative cases (77.2%) displayed D10S179 more telomeric than D10S189 on chromosome 10p. LOH. The summary of the PCR results for each chromosome 10 Such positioning would, in fact, define a smaller region of locus used in this study is presented in Table 2. LOH occurred deletion from D10pter-D10S179 than we indicate. However, at each locus examined, and the percentage of tumors having although both markers have been mapped to the same location, LOH ranged from 23% to 49%. the precise distance of D10S79 from the telomere in Mb has not LOH and Meningioma Progression. By grade, there been reported, and it is possible that D10S179 is centromeric to was LOH for at least one locus in 73.4% (127 of 173) of the D10D189. Therefore, we have reported a more conservative, benign tumors, 80.0% (16 of 20) of the atypical tumors, and broader region of deletion in this region of 10p. It should also be 86.7% (13 of 15) of the malignant tumors. The data indicate that noted that overlapping patterns of LOH suggest that another a large percentage of benign tumors have LOH for at least one small region of deletion may exist from D10S580-D10S109. chromosome 10 allele and that the percentage of tumors having However, because only a small number of tumors defined this LOH increases slightly during progression. Furthermore, a sig- region, and none had independent loss, this region is noted but nificant percentage of benign (75 of 173, 43.3%) and atypical (9 is not called a region of deletion. of 20, 45%) tumors have LOH at more than one locus, and a Patterns of LOH. Based on these criteria, several dele- further increase was observed in the percentage of malignant (10 tion patterns were noted. Of the 127 tumors having LOH, 38 of 15, 66.7%) tumors with complex loss. (29.9%) had loss restricted to the q arm, 8 (6.3%) had loss Four Regions of Chromosomal Deletion. Fig. 2 illus- limited to the p arm, and 81 (63.8%) had LOH on both arms. In trates the patterns of LOH observed for the 156 informative contrast, the majority (15 of 16) of the atypical tumors (93.8%) tumors with LOH. The number of tumors in each grade having and 100% of malignant tumors with LOH had loss on both each pattern is indicated. The majority of atypical and malignant chromosomal arms. tumors had LOH at all informative alleles, and therefore they Comparison of Chromosome 10 Deletions in Meningi- did not contribute to the mapping of the smallest regions of omas and Other Cancers. Fig. 3 illustrates the four regions deletion. This observation was not unexpected because the per- of deletion characterized by this study and the regions of dele- centage loss increased with increasing grade. The regions of tion reported for glioblastoma (18), prostate (23–25), endome-

Table 2 Percentage of tumors with LOH by locus For each locus, the total ϭ the number of tumors that were informative ϩ number that were NI. The total number of informative loci (I) ϭ # maintained (M) ϩ # having LOH. The number of tumors at each locus having LOH or M alleles is indicated. The percentage of tumors with LOH (%LOH) ϭ (# of tumors with LOH/# of I tumors) ϫ 100. Locus Total # I # M # LOH %LOH D10S179 179 97 67 30 31 D10S189 183 81 50 31 38 D10S89 172 99 67 32 32 D10S580 145 91 70 21 23 D10S109 195 75 47 28 37 D10S215 156 25 13 12 48 D10S574 173 89 58 31 35 D10S187 188 87 63 24 28 D10S209 173 72 37 35 49 D10S217 149 98 69 29 30 D10S169 188 127 80 47 37

and overlaps with the deletion described for bladder cancer. The region D10S187-D10S209 overlaps the location of DMBT1 gene and q arm deletions described for small cell lung carcinoma and endometrial cancer. Finally, the telomeric deletion D10S169- qter overlaps with the large q telomeric deletion described for endometrial cancer.

DISCUSSION In this study we examined the LOH of 11 dinucleotide repeat loci on chromosome 10 in 208 meningiomas of all grades. We investigated the incidence and complexity of LOH relative to tumor progression. For all alleles examined, the incidence of LOH was much higher in all grades than that reported previously, with incidence and complexity of LOH increasing with tumor grade. Mapping of the regions of LOH of all of the tumors defined four regions of chromosomal deletion. These deletions coincide with those found in other cancers, supporting the hypothesis that candidate tumor suppressor genes in these regions contribute to meningeal tumorigenesis and progression. To expand on previous studies, we examined LOH of alleles used in previous meningioma reports (11–15), as well as additional loci mapping near known and candidate tumor suppressor genes on 10q. The present data are in good agreement Fig. 1 Examples of CEQ 2000 XL allelic profiles. Panels represent normal (N) and matched tumor (T) DNA profiles for samples demon- with our reported data (11) that LOH occurs at markers D10S89 strating maintenance of both alleles (M), LOH for the first (short) allele, and D10S169 and with the 10q LOH reported by Simon et al. LOH for the second (long) allele, or NI amplification (NI). (12) and von Deimling et al. (14). Our results also agree with those of Lamszus et al. (15), confirming LOH on loci D10S187 and D10S209. In further agreement with published results, we observed LOH in benign tumors, and the frequency of LOH trial (26), small cell lung (27), bladder (28), cervical (29) can- increased slightly with increasing grade. Of interest was the high cers, and melanoma (30). Each region deleted in meningioma percentage of benign and atypical tumors having LOH on mul- overlapped with regions of deletion identified in other cancers. tiple loci with further increase in complex loss to malignant The telomeric segment (pter-D10S179) of the meningioma re- tumors. This large increase between atypical and malignant gion pter-D10S89 overlapped with deletions found in cervi- tumors may indicate a discontinuous change in genome stability cal cancer and melanoma. The more centromeric segment with the onset of malignancy. (D10S189-D10S89) overlapped with deletions reported in pros- In contrast with previous reports, however, we observed tate cancer. The q arm potential deletion at D10S580 and the LOH at much higher percentages. We suggest that this increase deleted region D10S109-D10S215 are both encompassed in the in detection of LOH may have resulted from a combination of most centromeric q arm deletion described for prostate cancer effects including the examination of polymorphic loci that had

previously been shown to have LOH in meningiomas and increased odds of detecting LOH by examining a larger number of loci. We do not believe the increase in observed LOH was due to less stringent data calculations because LOH was assigned using a conservative lower limit of 40% loss. This is more stringent than previous reports, where 30% loss was considered indicative of LOH (11), and loss between 30% and 40% was considered suggestive of LOH (22). Furthermore, although the loss ratios for individual loci ranged from 40% to 100% in this study, 77% of the loci had a loss ratio greater than 50%, with almost a quarter of the loci (23.2%) having 100% loss of an allele (data not shown), even under PCR conditions set up to detect small amounts of a given allele. Therefore, the majority of tumors had LOH with a loss ratio much higher than our designated cutoff. In an attempt to characterize regions where the putative tumor suppressor genes inferred by the LOH analyses reside, we mapped and compared the LOH patterns for each meningioma to define the smallest regions of deletion occurring in this tumor population. Mapping resulted in the identification of one region of chromosomal deletion on 10p (pter-D10S89[p12.1]) and three on 10q (D10S109[q22.3]-D10S215[q24.1], D10S187[q25.3]- D10S209[qq26.11], and D10S169[q26.3]-qter). It is interesting to note that there were three major patterns of LOH for the benign tumors. Because the majority of atypical tumors and all of the malignant tumors had loss on both arms, it is tempting to speculate that benign tumors with loss only on the q arm may be less aggressive than those having LOH patterns more similar to the higher-grade tumors with loss on both arms, and this study is under way. An examination of the patterns also indicated diverse patterns of loss for the benign meningiomas, with a given pattern often occurring for a single meningioma. The diversity of patterns might result from instability at fragile sites (31). On chromosome 10, 7 fragile sites (FRA10A-Fra10G) have been localized to the q arm. Of these, FRA10D is in the neighborhood of D10S580 and D10S109, whereas FRA10E and FRA10B are near D10S187, and FRA10F is near D10S209. Further investigation will determine whether these fragile sites impact LOH at the loci examined in this study. In addition, many tumors showed retention for either D10S109 or D10S580. It is possible that the apparent retention between these two markers really represents homozygous deletions. This would result in a slightly larger region of deletion from D10S580 to D10S215. Of the three deletions on the q arm, one (D10S187- D10S209) overlaps with the location of DMBT1 (deleted in malignant brain tumors 1 [10q26.11–26.12]). Although considered a candidate tumor suppressor gene due to its frequent intragenic homozygous deletions and lack of expression in other cancers including glioblastomas (32), its role as a tumor sup-

Fig. 2 For each specimen, the regions of LOH were mapped along the chromosome. Each LOH region was limited to the first maintained locus (vertical bar) on either side of the lost allele (except for the telomeric alleles). The locations of the smallest regions of chromosomal deletion are indicated by a line under the chromosome. The number and grade of tumors having the individual patterns are indicated. B, benign; A, atypical; M, anaplastic/malignant.

Fig. 3 Comparison of chromosome 10 deletions in meningiomas with those in other cancers. Wide vertical bars delineate chromosome 10 deletions found in meningiomas (MNG) using the 11 dinucleotide repeat loci indicated along the chromosome with those re- by ء .ported in other cancers 10p, D10S179 and D10S189 map to the same distance along chromosome 10 but may be re- versed (see “Materials and by 10q, potential ء (”Methods minimum region of loss (see “Materials and Methods”). Known and candidate tumor suppressor genes on 10q are indicated. Narrow vertical bars delineate chromosome 10 deletions found in other cancers. GBM, glioblastoma (18); PC, prostate cancer (23–25); CC, cervical cancer (29); BC, bladder cancer (28); SCLC, small cell lung carcinoma (27); EC, endometrial cancer (26); M, melanoma (30). PTEN, 10q23.3; LAPSER1, 10q21.3; LGII, 10q24; MMXI1, 10q24– 25; DMBT1, 10q26.11–26.12.

pressor gene in malignant gliomas remains controversial (33). substantiate this hypothesis, we compared the regions of dele- This gene has not yet been studied extensively in meningiomas, tion described in these meningiomas with those reported for although one report found no DBMT1 mutations in atypical (0 of other cancers. All four chromosomal deletions described for the 7) and malignant (0 of 7) meningiomas (14). Therefore, for meningiomas overlapped or encompassed chromosomal dele- meningiomas, DMBT1 may not be the candidate gene for this tions described in one or more other cancers. These common- region, but further analysis of a larger number of tumors is alities support the hypothesis that candidate tumor suppressor required. genes contributing to meningiomas likely reside in these re- Other known or candidate tumor suppressor genes on 10q, gions. If the putative tumor suppressor genes in these regions are including PTEN/MMAC1 [10q23.3 (34, 35)], MXI1 [q24–25 the same in meningiomas as these other malignancies, the oc- (36, 37)], LGII [10q (24)], and LAPSER1 [10q24.3 (38)], do not currence of LOH and the loss of these genes may impact colocalize with the chromosomal deletions in meningiomas. meningeal cells earlier in tumor progression than cancer derived Bostrom et al. (39), Wellenreuther et al. (40), and Joachim et al. from the other cell types. (41) have reported that mutation of PTEN is not common in Our observations further suggest that LOH is an early event meningiomas. MXI1, LGII, and LAPSER1 have also not been in a significant number of benign meningiomas, and therefore, extensively studied in meningiomas. Although these candidate the LOH of individual loci themselves may serve as markers to tumor suppressor genes do not reside in any of the smallest identify subsets of benign meningiomas or identify those pa- regions of deletion detected by these analyses, some tumors did tients having more aggressive tumors and/or those at risk for have LOH at D10S574, the locus closest to these genes. There- shorter time to survival or tumor recurrence. fore, without further investigation, we cannot rule out the pos- In conclusion, we observed frequent chromosome 10 allelic sibility that loss or mutation by other mechanisms of one of deletions early in the development of meningiomas, with in- these genes may contribute to the tumorigenesis or progression creased incidence and complexity of allelic loss with progres- for a subset of meningiomas. sion to higher grade. Finally, a comparison of chromosome 10 Our results do suggest that other genes located in the allelic deletions found in this study with those identified in other chromosomal deletion regions may be important. To further cancer types suggests that continued investigation of these re-

gions is warranted to identify those genes that contribute to Wiestler, O. D. Comprehensive allelotype and genetic analysis of 466 meningioma initiation and progression. human nervous system tumors. J. Neuropathol. Exp. Neurol., 59: 544– 558, 2000. 15. Lamszus, K., Kluwe, L., Matschke, J., Meissner, H., Laas, R., and ACKNOWLEDGMENTS Westphal, M. Allelic losses at 1p, 9q, 10q, 14q, and 22q in the progres- We thank Lisa Randazzo for setting up and running the CEQ 2000 sion of aggressive meningiomas and undifferentiated meningeal sarco- XL. We are indebted to the Levy family for their continued support of mas. Cancer Genet. Cytogenet., 110: 103–110, 1999. the Barbara Jane Levy Laboratory of Molecular Neuro-Oncology. 16. Gutmann, D. H., Donahoe, J., Perry, A., Lemke, N., Gorse, K., Kittiniyom, K., Rempel, S. A., Gutierrez, J. A., and Newsham, I. F. Loss of DAL-1, a protein 4.1-related tumor suppressor, is an important early REFERENCES event in the pathogenesis of meningiomas. Hum. Mol. Genet., 9: 1495– 1. Louis, D. N., Scheithauer, B. W., Budka, H., von Deimling, A., and 1500, 2000. Kepes, J. J. Meningiomas. In: P. Kleihues and W. K. Cavenee (eds.), 17. Ketter, R., Henn, W., Niedermayerm, I., Steilen-Gimelm, H., World Health Organization Classification of Tumours. Pathology and Konigm, J., Zang, K. D., and Steudel, W-I. Predictive value of progres- Genetics, Tumors of the Nervous System, pp. 175–196. Lyon, France: sion-associated chromosomal aberrations for the prognosis of meningi- IARC Press, 2000. omas: a retrospective study of 198 cases. J. Neurosurg., 95: 601–607, 2. Kleihues, P., Louis, D. N., Scheithauer, B. W., Rorke, L. B., Reif- 2001. enberger, G., Burger, P. C., and Cavenee, W. K. The WHO classifica- 18. James, C. D., Carlbom, E., Dumanski, J. P., Hausen, M., Norden- tion of tumors of the nervous system. J. Neuropathol. Exp. Neurol., 61: skjøld, M. D., Collins, V. P., and Cavenee, W. K. Clonal genomic 215–225, 2002. alterations in glioma malignancy stages. Cancer Res., 48: 5546–5551, 3. Surawicz, T. S., McCarty, B. J., Kupelian, V., Jukich, P. J., Bruner, 1988. J. M., and Davis, F. G. Descriptive epidemiology of brain and CNS 19. Glasgow, A., Horn, L-C., Taymans, S. E., Stratakis, C. A., Kelly, tumors: results from the Central Brain Tumor Registry of the United P. A., Kohler, U., Gillespie, J., Vonderhaar, B. K., and Bornstein, S. R. States, 1990–1994. J. Neuro-Oncol., 1: 14–25, 1999. Mutational analysis of the PRL receptor gene in human breast tumors 4. Zang, K. D., and Singer, H. Chromosomal constitution of meningi- with differential PRL receptor protein expression. J. Clin. Endocrinol. omas. Nature (Lond.), 216: 84–85, 1967. Metab., 86: 3826–3832, 2001. 5. Zankl, H., and Zang, K. D. Cytological and cytogenetical studies on 20. Trojan, P., Brieger, A., Raedle, J., Esteller, M., and Zeuem, S. brain tumors. Identification of the missing G chromosome in human 5Ј-CpG island methylation of the LKB/STK11 promoter and allelic loss meningiomas as No 22 by fluorescence technique. Hum. Genet., 14: at chromosome 19p13.3 in a sporadic colorectal cancer. Gut, 47: 272– 167–168, 1972. 276, 2000. 6. Mark, J., Levan, G., and Mitelman, F. Identification by fluorescence 21. Bo¨gler, O., Finniss, S., Kittiniyom, K., Rempel, S., Rosenblum, M., of the G chromosome lost in human meningiomas. Hereditas, 71: Mikkelsen, T., and Newsham, I. Studying the heterogeneity of brain 163–168, 1972. tumors using medium throughput LOH analysis. Cytometry, 47: 52–55, 7. Dumanski, J. P., Carlbom, E., Collins, V. P., and Norenskjøld, M. 2002. Deletion mapping of a locus on human chromosome 22 involved in the 22. Newsham, I. F., Gorse, K. M., Rempel, S. A., Luckey, J., Golden, oncogenesis of meningioma. Proc. Natl. Acad. Sci. USA, 84: 9275– J. B., and Bo¨gler, O. Use of horizontal ultrathin gel electrophoresis to 9279, 1987. analyze allelic deletions in chromosome band 11p15.5 in gliomas. 8. Meese, E., Blin, N., and Zang, K. D. Loss of heterozygosity and the J. Neuro-Oncol., 2: 1–5, 2000. origin of meningioma. Hum. Genet., 77: 349–351, 1987. 23. Trybus, T. M., Burgess, A. C., Wojno, K. J., Glover, T. W., and 9. Lekanne Deprez, R. H., Bianchi, A. B., Groen, N. A., Seizinger, Macoska, J. A. Distinct areas of allelic loss on chromosomal regions 10p B. R., Hageijer, A., van Drunen, E., Bootsma, D., Koper, J. W., Avezaat, and 10q in human prostate cancer. Cancer Res., 56: 2263–2267, 1996. C. J., and Kley, N. Frequent NF2 gene transcript mutations in sporadic meningiomas and vestibular schwannomas. Am. J. Hum. Genet., 54: 24. Lacombe, L., Orlow, I., Reuter, V. E., Fair, W. R., Dalbagni, G., 1022–1029, 1994. Zhang, Z. F., and Cordon-Cardo, C. Microsatellite instability and deletion analysis of chromosome 10 in human prostate cancer. Int. J. Cancer, 10. Wellenreuther, R., Kraus, J. A., Lenartz, D., Menon, A. G., 69: 110–113, 1996. Schramm, J., Louis, D. N., Ramesh, V., Gusella, J. F., Wiestler, O. D., and von Deimling, A. Analysis of the NF2 gene reveals molecular 25. Teixeira, M. R., Waehre, H., Lothem, R. A., Stenwig, A. E., Pandis, variants of meningioma. Am. J. Pathol., 146: 827–832, 1995. N., Giercksky, K. E., and Heim, S. High frequency of clonal chromosome abnormalities in prostatic neoplasms sampled by prostatectomy or 11. Rempel, S. A., Schwechheimer, K., Davis, R. L., Cavenee, W. K., ultrasound-guided needle biopsy. Genes Chromosomes Cancer, 28: and Rosenblum, M. L. Loss of heterozygosity for loci on chromosome 211–219, 2000. 10 is associated with morphologically malignant meningioma progression. Cancer Res., 53: 2386–2392, 1993. 26. Nagase, S., Sata, S., Tezuka, F., Wada, Y., Yamima, A., and Horii, A. Deletion mapping on chromosome 10q25–q26 in human endometrial 12. Simon, M., von Deimling, A., Larson, J. J., Wellenreuther, R., cancer. Br. J. Cancer, 74: 1979–1983, 1996. Kaskel, P., Waha, A., Warnick, R. E., Tew, J. M., Jr., and Menon, A. G. Allelic losses on chromosome 14, 10, and 1 in atypical and malignant 27. Kim, S. K., Ro, J. Y., Kemp, B. L., Lee, J. S., Kwon, T. J., Hong, meningiomas: a genetic model of meningioma progression. Cancer Res., W. K., and Mao, L. Identification of two distinct tumor-suppressor loci 55: 4696–4701, 1995. on the long arm of chromosome 10 in small cell lung cancer. Oncogene, 17: 1749–1753, 1998. 13. Weber, R. G., Bostrom, J., Wolter, M., Baudis, M., Collins, V. P., Reifenberger, G., and Lichter, P. Analysis of genomic alterations in 28. Kagan, J., Liu, J., Stein, J. D., Wagner, S. S., Babkowski, R., benign, atypical, and anaplastic meningiomas: toward a genetic model Grossman, B. H., and Katz, R. L. Cluster of allele losses within a 2.5 cM of meningioma progression. Proc. Natl. Acad. Sci. USA, 94: 14719– region of chromosome 10 in high-grade invasive bladder cancer. On- 14724, 1997. cogene, 16: 909–913, 1998. 14. von Deimling, A., Fimmers, R., Schmidt, M. C., Bender, B., Fass- 29. Poignee, M., Backsch, C., Beer, K., Jansen, L., Wagenbach, N., bender, F., Nagel, J., Jahnke, R., Kaskel, P., Duerr, E-M., Koopmann, J., Stanbridge, E. J., Kirchmayer, R., Scheider, A., and Durst, M. Evidence Maintz, D., Steinbeck, S., Wick, W., Platten, M., Muller, D. J., Przkora, for a putative senescence gene locus within the chromosomal region R., Waha, A., Blumcke, B., Wellenreuther, R., Meyer-Puttlitz, B., 10p14–p15. Cancer Res., 61: 7118–7121, 2001. Schmidt, O., Mollenhauer, J., Poustka, A., Stangl, A. P., Lenartz, D., 30. Robertson, G. P., Herbst, R. A., Nagane, M., Huang, H. J., and von Ammon, K., Henson, J. W., Schramm, J., Louis, D. N., and Cavenee, W. K. The chromosome 10 monosomy common in human

melanoma results from loss of two separate tumor suppressor loci. 36. Wechsler, D. S., Hawkins, A. L., Li, X., Jabs, E. W., Griffin, C. A., Cancer Res., 59: 3596–3601, 1999. and Dang, C. V. Localization of the human Mxi1 transcription factor 31. Callahan, G., Denison, S. R., Phipplips, L. A., Shidhar, V., and gene (MXI1) to chromosome 10q24–q25. Genomics, 21: 669–672, Smith, D. I. Characterization of the common fragile site FRA9E and its 1994. potential role in ovarian cancer. Oncogene, 22: 590–601, 2003. 37. Shapiro, D. N., Valentine, V., Eagle, L., Yin, X., Morris, S. W., and 32. Mollenhauer, J., Wiemann, S., Scheurlen, W., Korn, B., Hayashi, Prochownik, E. V. Assignment of the human MAD and MXI1 genes to Y., Wilgenbus, K. K., von Deimling, A., and Poustka, A. DMBT1, a chromosomes 2p12–p13 and 10q24–q25. Genomics, 23: 282–285, new member of the SRCR superfamily, on chromosome 10q25.3-q26.1 1994. is deleted in malignant brain tumors. Nat. Genet., 17: 32–39, 1997. 38. Cabeza-Arelaiz, Y., Thompson, T. C., Sepulveda, J. L., and Chi- 33. Sasaki, H., Betensky, R. A., Cairncross, J. G., and Louis, D. N. nault, A. C. LAPSER1: a novel candidate tumor suppressor gene from DMBT1 polymorphisms: relationship to malignant glioma tumorigene- 10q24.3. Oncogene, 20: 6707–6717, 2001. sis. Cancer Res., 62: 1790–1796, 2002. 39. Bostrom, J., Cobbers, J. M., Wolter, M., Tabatabai, G., Weber, 34. Steck, P. A., Pershouse, M. A., Jasser, S. A., Yung, W. K., Lin, H., R. G., Lichter, P., Collins, V. P., and Reifenberger, G. Mutation of the Ligon, A. H., Langford, L. A., Baumgard, M. L., Hattier, T., Davis, T., PTEN (MMAC1) tumor suppressor gene in a subset of glioblastomas but Frye, C., Hu, R., Swedlund, B., Teng, D. H., and Tavtigian, S. V. not in meningiomas with loss of chromosome arm 10q. Cancer Res., 58: Identification of a candidate tumor suppressor gene, MMAC1, at chro- 29–33, 1998. mosome 10q23.3 that is mutated in multiple advanced cancers. Nat. 40. Wellenreuther, P. N., Rollbrocker, R., Hayashi, Y., Meyer-Puttlitz, Genet., 15: 356–362, 1997. B., Duerr, E. M., Lenartz, D., Schramm, M. D. J., Wiestler, O. D., 35. Li, J., Yen, C., Liaw, D., Podsypanina, K., Bose, S., Wang, S. I., Parsons, R., Eng, C., and von Deimling, A. Analysis of the PTEN gene Puc, J., Miliaresis, C., Rodgers, L., McCombie, R., Bigner, S. H., in human meningiomas. Neuropathol. Appl. Neurobiol., 24: 3–8, 1998. Giovanella, B. C., Ittmann, M., Tycko, B., Hibshoosh, H., Wigler, 41. Joachim, T., Ram, Z., Rappaport, Z. H., Simon, M., Schramm, J., M. H., and Parsons, R. PTEN, a putative tyrosine phosphatase gene Wiestler, O. D., and von Deimling, A. Comparative analysis of the NF2, mutated in human brain, breast, and prostate cancer. Science (Wash. TP53, PTEN, KRAS, NRAS, and HRAS genes in sporadic and radiation- DC), 275: 1943–1947, 1997. induced human meningiomas. Int. J. Cancer, 94: 218–221, 2001.

Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2003 American Association for Cancer Research. Meningiomas: Analysis of Loss of Heterozygosity on Chromosome 10 in Tumor Progression and the Delineation of Four Regions of Chromosomal Deletion in Common with Other Cancers

Dana Mihaila, Jorge A. Gutiérrez, Mark L. Rosenblum, et al.

Clin Cancer Res 2003;9:4435-4442.

Updated version Access the most recent version of this article at: http://clincancerres.aacrjournals.org/content/9/12/4435

Cited articles This article cites 38 articles, 12 of which you can access for free at: http://clincancerres.aacrjournals.org/content/9/12/4435.full#ref-list-1

Citing articles This article has been cited by 2 HighWire-hosted articles. Access the articles at: http://clincancerres.aacrjournals.org/content/9/12/4435.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/9/12/4435. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.