DOCSLIB.ORG

Evidence from Molecular Cloning That SPARC, a Major Product of 'Culture

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Evidence from Molecular Cloning That SPARC, a Major Product of 'Culture The EMBO Journal vol.5 no.7 pp. 1465 - 1472, 1986 Evidence from molecular cloning that SPARC, a major product of mouse embryo parietal endoderm, is related to an endothelial cell 'culture shock' glycoprotein of Mr 43 Ivor J.Mason, Amanda Taylor, Jeffrey G.Williams1, tease, tissue plasminogen activator (Strickland et al., 1976, 1980; Helene Sage2 and Brigid L.M.Hogan Marotti et al., 1982; see Mullins and Rohrlich, 1983, for review). on of PE from a Laboratory of Molecular Embryology, National Institute for Medical Interest has also focused the differentiation Research, Mill Hill, London NW7 IAA, and lImperial Cancer Research bipotential stem cell population, the primitive endoderm, which Fund, Clare Hall Laboratories, South Mimms, Potters Bar, Herts EN6 3LD, first appears at about 4.5 days of development in the mouse. This UK, and 2Department of Biological Structure, University of Washington, differentiation can be mimicked in vitro by the addition of retinoic Seattle, Washington 98195, USA acid and cAMP to F9 teratocarcinoma stem cells, providing a Communicated by D.A.Rees model system for following the co-ordinated regulation of a set We describe the molecular cloning and characterization of of genes in embryonic cells (Strickland et al., 1980; Hogan et a secreted, acidic, cysteine-rich glycoprotein (SPARC) of ap- al., 1983 for review). In order to identify genes regulated in this parent Mr 43 000 which is a major product of mouse embryo way and expressed at high levels in PE cells, differentiated F9 parietal endoderm. These cells are specialized for the syn- cell and PE cDNA libraries have been differentially screened for thesis of a rapidly expanding basement membrane, but sequences expressed at higher levels than in undifferentiated F9 SPARC is not itself an integral matrix component. We show cells. Some of the cDNAs selected in this way provided the first that SPARC is related structurally and antigenically to an clones for structural components of basement membranes, in- Mr 43 000 glycoprotein secreted in large amounts by bovine cluding type IV collagen and laminin B chains (Kurkinen et al., aortic endothelial cells as part of a 'culture shock' response 1983a, b; Wang and Gudas, 1983; Barlow et al., 1984; Wang to in vitro conditions promoting their proliferation and et al., 1985). We now report the characterization of a novel and migration. abundant PE product - a secreted glycoprotein of Mr 43 °°° Key words: cDNA/43K glycoprotein/SPARC/endothelial cell/ (SPARC) - which does not appear to be a structural compo- parietal endoderm nent of the extracellular matrix. We show here that SPARC is related to a glycoprotein (43K) secreted in increased amounts by bovine aortic endothelial cells as part of a co-ordinated 'culture shock' response to in vitro conditions stimulating their prolifera- Introduction tion and migration (Sage, 1986; Sage et al., 1984, 1986). This The parietal yolk sac is one of the three membranes surrounding finding supports the idea that SPARC expression may be the mouse embryo. It consists of a homogeneous population of associated with a variety of morphogenetic processes which in- parietal endoderm (PE) cells which synthesize a thick basement volve cell migration, and synthesis and modelling of the ex- membrane known as Reichert's membrane. This activity has made tracellular matrix. PE a favourable model system for studying the expression of genes for the structural components of basement membranes, in- cluding type IV collagen, laminin, entactin and heparan sulfate proteoglycan (Hogan et al., 1982; Kurkinen et al., 1983a, b; 12 3 4 5 Barlow et al., 1984). The parietal yolk sac has the additional feature of being a dynamic tissue, which undergoes extensive - 28S remodelling throughout post-implantation development. As the embryo grows, the yolk sac increases rapidly in surface area and expands into the uterine stroma without creating blood clots or tissue debris that would impede the filtration of fluid through 2.2kb Reichert's membrane. During this process the matrix first thickens, then becomes thinner and eventually breaks down before -18S the end of pregnancy (Clark et al., 1975; Dickson, 1979). The expansion of the yolk sac is accompanied by the continual recruit- ment of cells onto Reichert's membrane by migration of in- dividual vimentin-positive parietal endoderm cells from the margins of a vimentin-negative epithelial layer bordering the yolk Fig. 1. Differential expression of a 2.2 kb RNA in extra-embryonic sac (Lane et al., 1983; Hogan and Newman, 1984). These endoderm and F9 teratocarcinoma cells. Clone pF9.33 (nt 1858-2070; see Figure 2) was hybridized to Northern blots of 10 ytg of total RNA from F9 features suggest that further studies on the gene expression of undifferentiated embryonal carcinoma cells (lane 1); F9 cells treated with parietal endoderm will be relevant to a variety of in vivo pro- retinoic acid and dibutyryl cAMP for 5.5 days (lane 2); PYS cells (lane 3). cesses which involve dynamic interaction between cells and the In a separate experiment pF9.33 was hybridized to 10 yg of total RNA extracellular matrix, for example during tissue morphogenesis, from visceral yolk sac (lane 4) and parietal endoderm (lane 5). The size of or In context it the hybridizing transcript was estimated from its position relative to the 18S angiogenesis wound-related repair. this has already and 28S ribosomal RNA (Wang and Gudas, 1983). From densitometer scans been shown that PE, like many other migratory cells and tissues of lanes 1 and 2, it was calculated the level of 2.2 kb RNA increases about undergoing remodelling, secretes abundant amounts of the pro- 20-fold after treatment of F9 cells with retinoic acid and cAMP. © IRL Press Limited, Oxford, England 1465 I.J.Mason et al. so 100 GCATTCCT6CAGCCCTTCAGACCGCCA4CTCTTCTGCCGCCTGCCTGCCTGCCTGCCTGCCT6CCTGTGCCGAGA6TTCCCA6CATC ATO AGG GCC TGG ATC TTC TTT CTC Met Arg Ala Trp lie Phe Ph. Lou I 150 200 CTT TGC CTG GCC G66 AGO GCC CTG OCA GCC CCT CAG CAG ACT GA GTT GCT GAG GAG ATA GTG GAG AGM ACC GTG OTO GAG GAG ACA Lou CYs Leu Ala GY Arg Ala Lou Ala Ala Pro Gin Gin Thr Glu Val Ala Glu Glu Ie Val Glu Glu Glu Thr Val Val Glu Glu Thr 10 20 30 250 666 GTA CCT GTG GGT GCC AC CCA GTC CAG GTG ATG GGA G TTT GAG GAC GGT GCA GAG G AC6GTC GAG GAG OTO 6T6 GCT GAC GlY Val Pro Va G61Y Ala Asn Pro Val Gin Val G1u Met GlY Glu Phe Glu Asp GlY Ala Glu Glu Thr Val Glu Glu Val Val Ala Asp 40 50 60 300 350 AC CCC TGC CAG AAC CAT CAT TGC A CAT GGC AG GTG TGT GAG CTG GAC GAG AGC AC ACC CCC ATG TGT GTG TGC CAG GAC CCC ACC Asn Pro Cys Gin Asn His His Cys Lys His GlY Lys Vat Cys G1u Lou Asp G1u Sor Asn Thr Pro Met Cys Vat Cys Gin Asp Pro Thr 70 80 90 400 450 AGC TGC CCT GCT CCC ATT GGC GAG TTT GAG AAG GTA TGC AGC AT GAC AAC AG ACC TTC GAC TCT TCC TOC CAC TTC TTT 6CC ACC AG Ser Cys Pro Ala Pro Li.e G1Y Glu Ph. G¢u Lys Vat Cys Sor Asn Asp Asn LYs Thr Ph. Asp Sor Sr CYs His Phe Phe Ala Thr LYs 100 110 A 120 500 550 TGC ACC CTG GAG GGC ACC AAG AAG GGC CAC AG CTC CAC CTG GAC TAC ATC GGA CCA TGC AA TAC ATC 6CC CCC TGC CTG GAT TCC GAG Cys Thr Leu G1u 61 Y Thr Lys Lys 61>Y His Lys Lou His Lou Asp Tyr Ioe 61>Y Pro Cys Lys Tyr Ie. Ala Pro Cys Lou Asp Sor G1iu 130 140 150 600 650 CTG ACC GA TTC CCT CTG CGC ATG CGT GAC TOG CTC AA T GTC CTG GTC ACC TTG TAC GAG AGA OAT GAG GBC AC AC CTC CTC ACT Lou Thr Gl u Pho Pro Lou Arg Met Arg Asp Trp Lou Lys Asn Vat Lou Vat Thr Lou Tyr G1u Arg Asp GI u 61 AsnA Asn Lou Lou Thr 160 170 180 700 GAG AAG CAG AG CTG CGT GTG AG AG ATC CAT GAG AT GAG AG CGC CTG GAG GCT GOA GAC CAC CCC GTG IGA CTO TTG 6CC CGA GAC Glu Lys Gin Lys Lou Arg Val Lys LYs Ile His G1u Asn GI u Lys Arg Lou GI u Ala 6ly Asp His Pro Vat B1u Lou Lou Ala Ar; Asp 190 200 210 750 800 TTT GAG AAG AC TAC AT ATG TAC ATC TTC CCT GTC CAC TGG CAG TTT GGC CAG CTG GAT CAG CAC CCT ATT GAT 666 TAC CTG TCC CAC Ph. Glu Lys Asn Tyr Asn Met Tyr I-o Pho Pro Vat His Trp Gin Ph 6W1Y Gin Lou Asp Gin His Pro Ile Asp 61Y Tyr Lou Sor His 220 230 240 850 900 ACT GAG CTG GCC CCA CTG CGT GCT CCC CTC ATC CCC ATG G CAT TGC ACC ACA COT TTC TTT GAG ACC TOT GAC CTA GAC AC GAC AAG Thr G1u Lou Ala Pro Lou Arg Ala Pro Lou Ile Pro Met OGu His Cys Thr Thr Avg Phe Phe G1 u Thr Cys Asp Lou Asp Asn Asp Lys 250 260 950 1000 TAC ATT GCC CTG GAG GNA TGG 6CC GGC TGC TTT GGC ATC mG G CAG GAC ATC AC AG GAT CTO GTO ATC TA GTTCACGCCTCCTGCTGCA Tyr Iie Ala Lou Glu GIu Trp Ala GlY Cys Phe G6Y IlelLys Glu Gin Asp IIo Asn Lys Asp Lou Vat I 280 290 302 1050 1100 GTCCTOCTCTCTCCCTCTGATGTGTCACCCCTCCCATTACCCCCTTGTTTAATG ||§GGATGGTTGGCTBTTCCGCCTBGB-ATAAGBTGCT - CATA ATmTAACTOTACATT 1150 1200 1250 ACGGTCCTAAAGTAAAAGACTATTCCCG4TACACATTTCCCATA CC ATC°GCCCATCCCACCCCCC oC CT4C 1300 1350 CCAGTGTCTCACTGGCTT GTTGAACOGAOTTOCTAGCATGCACTC4CACAGTCAC(AGATATCTCTAOTrGATCAATTTTI II TTTm ACTCTTAAATACCA -ACTCTO 1400 1450 TGCTTATTTCATTTTGGGGATGTGGGCTTTTCCCCTGTGTTTGGAGTTAGCAGAGGGGTTACAGACACAGGTACAmTTG TAAGATACT6TGAACCTGA8GCCCAC 1501 1550 1600 CAGTCAGPACCCACATGGCAGTCTTAGTAGCCTAGGTCAAGCqGAAACAGMOTAATCCAGAGCTGTGGCACACAT(3CGACTCCCAGCABCCCBB -ACCTTGCTGTCTTCTC - CTCT 1650 1700 TCGGGCGmTCTTTICCATGTTTGGCTGTTGG IITTTA GTTII TG4GSACCATGGGTGGGCCACG4ACATCACTCAACTGCAATTGGGCTTTCAGOBTTCTTBCCBGGGAGCTCTAGBCAICTBGO 1750 800 1850 AGGCTGTTTCAGAGTG4GACTCAGA CAA4CAGGGTTGTACGTAGA(GiGTGAG4CTGGTGAATTGGTI I mI CACTCTAQATGBCTGTCATGTTTCT 1900 1950 GCATGTTCCCCCTCACCTCTCCCCACCCCCTGCCACTTACCTTCTACTATCAA -AACTTCCAAGCCAACATGBTCAATCTC CTAATTGTTCCCCTCCG 2000 2050 CATCATGC GCCTTCTCATTAACCATGCAACTCTCABCGATGT(3ABCTTGACAAGTCTTTCAATAA GTA TTAC( Fig.
Load more

Recommended publications
  • EMBC Annual Report 2007
    EMBO | EMBC annual report 2007 EUROPEAN MOLECULAR BIOLOGY ORGANIZATION | EUROPEAN MOLECULAR BIOLOGY CONFERENCE EMBO | EMBC table of contents introduction preface by Hermann Bujard, EMBO 4 preface by Tim Hunt and Christiane Nüsslein-Volhard, EMBO Council 6 preface by Marja Makarow and Isabella Beretta, EMBC 7 past & present timeline 10 brief history 11 EMBO | EMBC | EMBL aims 12 EMBO actions 2007 15 EMBC actions 2007 17 EMBO & EMBC programmes and activities fellowship programme 20 courses & workshops programme 21 young investigator programme 22 installation grants 23 science & society programme 24 electronic information programme 25 EMBO activities The EMBO Journal 28 EMBO reports 29 Molecular Systems Biology 30 journal subject categories 31 national science reviews 32 women in science 33 gold medal 34 award for communication in the life sciences 35 plenary lectures 36 communications 37 European Life Sciences Forum (ELSF) 38 ➔ 2 table of contents appendix EMBC delegates and advisers 42 EMBC scale of contributions 49 EMBO council members 2007 50 EMBO committee members & auditors 2007 51 EMBO council members 2008 52 EMBO committee members & auditors 2008 53 EMBO members elected in 2007 54 advisory editorial boards & senior editors 2007 64 long-term fellowship awards 2007 66 long-term fellowships: statistics 82 long-term fellowships 2007: geographical distribution 84 short-term fellowship awards 2007 86 short-term fellowships: statistics 104 short-term fellowships 2007: geographical distribution 106 young investigators 2007 108 installation
    [Show full text]
  • Identification of the C-Terminal Activator Domain in Yeast Heat Shock Factor: Independent Control of Transient and Sustained Transcriptional Activity
    The EMBO Journal vol.12 no.13 pp.5007-5018, 1993 Identification of the C-terminal activator domain in yeast heat shock factor: independent control of transient and sustained transcriptional activity Yuqing Chen1, Nickolai A.Barlev2,3, Introduction Ole Westergaard and Bent K.Jakobsen4 In response to hyperthermia, and certain other forms of Department of Molecular Biology, University of Aarhus, C.F.Mollers stress, cells transiently increase transcription from a small Alle, Building 130, DK-8000 Aarhus C, Denmark group of genes that encode a characteristic set of proteins, lPresent address: Department of Zoology, University of Western the heat shock proteins. The heat shock proteins exercise Ontario, London, Canada protective functions in the cell during stress, for instance 2Present address: Laboratory of Structural Genome Organization, Institute of Cytology, Tihkoretsky Avenue 4, 194064 St Petersburg, by renaturing or solubilizing denatured proteins (for reviews Russia see Lindquist, 1986; Pelham, 1986; Bienz and Pelham, 3Present address: Wistar Institute, Pennsylvania University, 1987). 3601 Spruce Street, Philadelphia, PA 19104-4268, USA Heat shock promoters contain a universal sequence 4Present address: Institute of Molecular Medicine, University of element that is necessary and sufficient for their Oxford, John Radcliffe Hospital, Headington, Oxford OX3 9DU, UK transcriptional activation (the heat shock element, HSE). This Communicated by H.R.B.Pelham was originally identified as a 14 bp sequence by deletion analysis of the Drosophila hsp7O promoter (Bienz and In yeast, heat shock factor (HSF) is a trimer that binds Pelham, 1982; Pelham, 1982; Pelham and Bienz, 1982). DNA constitutively but only supports high levels of Careful examination of the HSE has demonstrated that it can transcription upon heat shock.
    [Show full text]
  • The Functions of HSP70 in Normal Cells
    Chapter 1 A General Description of HSPs, The Molecular Structure of HSP70 and The HSP70 Cycle Abstract Fifty years ago the accidental switch of a temperature knob on the incubator where Ferruccio Ritossa kept his fruit flies started a new era, the epoch of heat shock proteins (HSP). In 1986 H. Pelham was the first to suggest that HSPs bind to denatured protein aggregates, thereby restricting their aggregation and breaking them by using ATP as an energy source. Among all HSPs, the protein with a molecu- lar weight of 70 kDa was found to be the most common, drew the most attention and is consequently the HSP we know the most about. HSP70 contains three domains: the ATPase N-domain which hydrolyzes ATP; the substrate domain which binds pro- teins, and the C-domain that forms the “lid” for the substrate domain. Because of its three-domain structure, HSP70 forms a unified ATPase cycle coupled with connec- tion and disconnection of the client protein. The “team” of HSP70 cycle regulators includes HSP40, which delivers clients to HSP70 and stimulates ATP hydrolysis; Hip, which assists HSP70 in retaining the client, and Bag-1 and HspBP1, which accelerate the dissociation of ADP and the release of the client protein. Keywords HSP70 • Hip • Bag-1 • HspBP1 • The HSP70 cycle In this first chapter, I will begin by telling you the amazing story about how heat shock proteins (HSPs) were discovered, their general characteristics, molecular structure and their functional cycle. 1.1 About the Discovery of HSP, or How Drosophila Melanogaster was Accidentally “Heated” The name itself—“heat shock proteins”—results from the simple fact that HSPs were first discovered in cells exposed to elevated temperatures.
    [Show full text]
  • Lecture Slides
    (J. American Chemical Association, 78, 3458-3459) The Secondary Structure of Complementary RNA E. Peter Geiduschek, John W. Moohr, and Smauel B. Weiss, Proceedings of The National Academy of Sciences, 48, 1078-1086, 1962. R.H. DOI RH, and S. SPIEGELMAN Homology test between the nucleic acid of an RNA virus and the DNA in the host cell. Science 1962 Dec 14 1270-2. MONTAGNIER L, SANDERS FK. REPLICATIVE FORM OF ENCEPHALOMYOCARDITIS VIRUS RIBONUCLEIC ACID. Nature. 1963 Aug 17;199:664-7. (Science 143, 1034-1036, March 6, 1964) WARNER RC, SAMUELS HH, ABBOTT MT, KRAKOW JS. (1963) Ribonucleic acid polymerase of Azotobacter vinelandii, II. Formation of DNA- RNA hybrids with single-stranded DNA as primer. Proc Natl Acad Sci U S A. 49:533-8. Double Stranded RNA as a Specific Biological Effector December 8, 2006 Karolinska Institute, Stockholm, Sweden Viral interference (Interferon) effects in animals M. Hoskins (1935) A protective action of neurotropic against viscerotropic yellow fever virus in Macacus rhesus. American Journal of Tropical Medicine, 15, 675-680 G. Findlay and F. MacCallum (1937) An interference phenomenon in relation to yellow fever and other viruses. J. Path. Bact. 44, 405-424. A. Isaacs and J. Lindenmann (1957) Virus Interference. I. The Interferon Proc. Royal Soc. B 147, 268-273. Proceedings of the National Academy of Sciences, USA, Volume 58, Pages 782-789. 1967 Promoter Make transgenic worms geneX Antisense Transcripts Interference (Development 113:503 [1991]) geneX Promoter Make transgeneic worms geneX SENSE Transcripts Also Interference! (Development 113:503 [1991]) In Vitro Promoter Make RNA in vitro geneX Antisense RNA Inject worm gonad Interference! (Guo and Kemphues, 1995) In Vitro geneX Promoter Make RNA in vitro geneX SENSE RNA Inject worm gonad Also Interference! (Guo and Kemphues, 1995) Craig Mello's RNAi Workshop: 1997 C.
    [Show full text]
  • Curriculum Vitae ANTHONY PAUL
    Curriculum Vitae ANTHONY PAUL BRETSCHER Personal: Address: Department of Molecular Biology and Genetics Weill Institute for Cell and Molecular Biology Weill Hall Room 257 Cornell University Ithaca, NY 14853-7202 Telephone: 607-255-5713 Fax: 607-255-5961 e-mail: [email protected] Web site: http://www.mbg.cornell.edu/cals/mbg/faculty- staff/faculty/bretscher.cfm Date of Birth: September 8, 1950 Place of Birth: Harwell, Berkshire, England Citizenship: USA, United Kingdom and Switzerland Marital Status: Married Janice Sperbeck, 5.21.1983 Children: Heidi (b. Nov. 1, 1986), Erika (b. April 24, 1991) Home Address: 293 Ellis Hollow Creek Road, Ithaca, NY 14850 Education: 1971 BA University of Cambridge, UK. Experimental Physics 1974 MA University of Cambridge, UK 1974 PhD University of Leeds. Bacterial Genetics. Advisor: Dr. Simon Baumberg 1974-1977 EMBO Postdoctoral Fellow, Stanford University, CA Advisor: Dr. A. Dale Kaiser 1977-1980 Max Planck Society Fellow, Max Planck Institute for Biophysical Chemistry. Goettingen, Germany. Advisor: Dr. Klaus Weber. Academic Appointments: 1980-1981 Assistant Professor, Department of Cell Biology, Southwestern Medical School, Dallas, TX 1981-1999 Assistant (1981-1987), Associate (1987-1993), Professor (1993-1999) Section of Biochemistry, Molecular and Cell Biology, Cornell University 1999-present Professor of Cell Biology, Department of Molecular Biology and Genetics, Cornell University, NY 2007-present Member, Weill Institute for Cell and Molecular Biology Administrative Appointments: 2007-2011 Associate
    [Show full text]
  • What Makes a Great Lab?
    COMMENT 1826 and acquired international renown. It attracted students from all over Europe and earned Liebig a reputation as a ‘chemist breeder’. His lab was an early example of the research and teaching establishments that SOURCE: LMB ARCHIVE LMB SOURCE: made the German universities the envy of many. It began as a single room, with a fire in the middle surrounded by work benches. Liebig’s work on the compositions of chemical substances and their reactions was outstand- ing, and his focus on agricultural, industrial and biological issues gave his research a highly topical flavour. He trained his protégés carefully, espe- cially in qualitative analysis. Students flocked to him, with the result that European chem- istry during the middle of the nineteenth century bore a distinctly Liebigian flavour as his students moved to influential positions elsewhere. The identification of state-of-the- art problems and the training of students to solve them characterize his achievements. Liebig’s initiative was widely adapted in the natural and biomedical sciences throughout Max Perutz, James Watson, John Kendrew and Francis Crick talk to a BBC presenter (centre) about the German university system. their Nobel prizes in 1962. Training was also part of the brief of physiologist Ivan Pavlov (1849–1936), but he brought his own organizational genius to bear on the ‘physiology factory’ that he masterminded in St Petersburg, Russia, What makes famously studying dogs. He adapted aspects of manufacturing to the production of sci- entific knowledge. Pavlov’s staff were among the first to specialize in different tasks: surgi- a great lab? cal, chemical, dog handling.
    [Show full text]
  • Heat Shock Proteins in Thermotolerance and Other Cellular Processes1
    [CANCER RESEARCH 47, 5249-5255, October 15, 1987) Perspectivesin CancerResearch Heat Shock Proteins in Thermotolerance and Other Cellular Processes1 Stephen W. Carper,2 John J. Duffy, and Eugene W. Gerner Department of Radiation Oncology and Cancer Center, The University of Arizona Health Sciences Center, Tucson, Arizona S5724 Heat shock proteins are a unique set of highly conserved erentially synthesized (for recent reviews, see Refs. 7-13). The proteins induced by heat and other stresses. Their role in expression of hsps and the amino acid sequence of several hsps cellular responses to stress is currently unclear, due in part to are highly conserved throughout evolution, implying that they a variety of experimental findings that are apparently contra may have some universally important function(s). It is com dictory. The purpose of this review is to evaluate the evidence monly accepted that the function of the hsps is either to protect regarding the role of lisps-' in cellular responses to stress and to cells against subsequent heat stress or to enhance the ability of speculate on other possible physiological functions of these cells to recover from the toxic effects of heat or other stresses. unique proteins. This Perspectives article evaluates current evidence regarding Over the past 10 years, hyperthermia has gained increasing this possible role of hsps and considers alternate effects of hsps acceptance as a mode of cancer treatment, especially when used on cellular physiological responses. in combination with radiotherapy (1). In 1985, the United States Food and Drug Administration formally recognized hy perthermia therapy, generally meaning the elevation of tumor Operational Definitions of hsps and Thermotolerance temperatures to 40-45°C, as an effective form of treatment for certain types of cancer.
    [Show full text]
  • Professor Tumani Corrah Honoured
    MRC May 2014 News from the MRC community The Chancellor visits the LMB to announce future support for science The Chancellor of the Exchequer, the Rt Hon George Osborne, visited the MRC Laboratory of Molecular Biology (LMB) in Cambridge on Friday 25 April to announce details of the long-term plan for science capital investment. Mr Osborne was welcomed by MRC LMB Director Sir Hugh Pelham and shown some of the world-class facilities in the new laboratory, which was opened by Her Majesty The Queen last May. In his speech, the Chancellor announced the launch of a consultation on allocating the Government’s £7 billion science capital budget. Mr Osborne lauded the LMB’s achievements and “fantastic pedigree” including the discovery of the structure of DNA, nine Nobel prizes and various spin-out companies. In response, Declan Mulkeen, MRC Chief Science Officer, said: “Government’s commitment to long-term, stable funding for research capital developments is very good news for medical research, and UK science overall.” The Chancellor and Dr Melina Schuh On his visit, the Chancellor was introduced to the work of Dr Melina Schuh, a Group Leader in the MRC LMB Cell Biology Division. Dr Schuh’s laboratory studies show how fertilisable eggs (oocytes) develop in mammals, with the long-term goal of identifying and analysing mechanisms that lead to abnormal eggs, which are the leading genetic cause of miscarriage and congenital birth defects. For further information please visit: www.mrc.ac.uk/Newspublications/News/MRC009816 Professor Tumani Corrah honoured On 10 April 2014 Professor Tumani Corrah, MRC Director, Africa Research Development, was invested with the title ‘Emeritus Director’ by Sir John Savill, MRC Chief Executive, at a ceremony attended by members of the MRC’s Management Board.
    [Show full text]
  • People & Ideas
    Published January 10, 2011 People & Ideas Sean Munro: Revealing the Golgi’s true identity Munro studies how proteins localize within the secretory pathway. lthough cargo proteins move I learnt about the molecular biology revolu- through the different organelles of tion that was happening, and that all seemed A the secretory pathway, other pro- very exciting. I studied Biochemistry at teins remain in place to give each compart- Oxford as an undergraduate. Molecular bi- ment its own unique identity and function. ology hadn’t quite reached Oxford yet, but Sean Munro, from the MRC Laboratory of there was a small amount going on, and I Molecular Biology in Cambridge, England, became interested in gene transcription. has been interested in how proteins ! nd their place within the secretory pathway since his How did that interest lead you to join PhD studies with Hugh Pelham, when he Hugh Pelham’s lab for your PhD? discovered a heat-shock protein that was re- He was working on the transcription of tained in the ER lumen due to a speci! c heat-shock genes at that time. But he was Downloaded from “KDEL” sequence at its C terminus (1). trying to diversify a bit when I got there, so OF MRC CAMBRIDGE IMAGE COURTESY Sean Munro After a brief detour into receptor biology he said, “Why don’t you work on heat-shock as a postdoc with Tom Maniatis, Munro be- proteins and try to understand what they’re gan his own lab and as an independent group actually doing?” He wanted me to study that a protein is not randomly distributed— leader moved from studying the ER to the Hsp70, but a competing lab was reluctant to it’s clearly in a speci! c place.
    [Show full text]
  • Report 1978 Cold Spring Harbor Laboratory
    COLDLABORATORY SPRING HARBOR ANNUAL REPORT 1978 COLD SPRING HARBOR LABORATORY COLD SPRING HARBOR, NEW YORK Cover: Participants at 1978 Symposium (top to bottom) G. Selzer, F. Stahl, and J. Strathern; A. Kornberg, A. Falaschi, and R. Holliday; W. Arber and D. Nathans; W. Udry, A. Bukhari, and D. Baltimore Picture credits: Cover, 82, 90, 140, Ross Meurer; 14, Cindy Carpenter; 19, W. Udry; 11, 12,13, 17, 20, 67, 136, 142, 143, 153, Robert Yaffe COLD SPRING HARBOR LABORATORY COLD SPRING HARBOR, LONG ISLAND, NEW YORK OFFICERS OF THE CORPORATION Dr. Harry Eagle, Chairman Edward Pulling, Vice-Chairman Dr. Bayard Clarkson, Secretary Clarence E. Galston, Treasurer Robert L. Cummings, Assistant Treasurer William R. Udry, Administrative Director BOARD OF TRUSTEES Institutional Trustees Albert Einstein College of Medicine University of Wisconsin Dr. Harry Julian Davies Columbia University Wawepex Society Dr. Charles R. Cantor Bache Bleecker Duke University Dr. Walter Guild Individual Trustees Long Island Biological Association Emilio G. Collado Edward Pulling Robert L. Cummings Massachusetts Institute of Technology Roderick H. Cushman Dr. Herman Eisen Norris Darrell Memorial Sloan-Kettering Cancer Center Walter N. Frank, Jr. Dr. Bayard Clarkson Clarence E. Galston Mary Lindsay New York University Medical Center William S. Robertson Dr. Vittorio Defendi Mrs. Franz Schneider Princeton University Alexander C. Tomlinson Dr. Arnold J. Levine Dr. James D. Watson The Rockefeller University Dr. Rollin Hotchkiss Honorary trustees State University of New York Dr. H. Bentley Glass at Stony Brook Dr. Alexander Hollaender Dr. Joseph R. Kates Officers and trustees listed are as of December 31, 1978 DIRECTOR'S REPORT The collective decisions of knowledgeable men go sourone likes to advertise that we may have no meaningful more often than we want.
    [Show full text]
  • Molecular Cloning and Characterization of the Mrna for Cyclin from Sea Urchin Eggs
    The EMBO Journal vol.6 no.10 pp.2987-2995, 1987 Molecular cloning and characterization of the mRNA for cyclin from sea urchin eggs Jonathon Pines and Tim Hunt mitosis (Hultin, 1961; Wilt et al., 1967; Wagenaar, 1983; University of Cambridge, Department of Biochemistry, Tennis Court Road, Newport and Kirschner, 1984). The hypothesis has recently Cambridge CB2 IQW, UK received strong support from the demonstration that microinjec- Communicated by T.Hunt tion of clam cyclin A mRNA induces meiotic maturation in Xenopus oocytes (Swenson et al., 1986), though it remains to We have isolated a cDNA clone encoding sea urchin cyclin be shown that cyclin can promote entry into mitosis in cyclo- and determined its sequence. It contains a single open reading heximide-arrested fertilized eggs. frame of 409 amino acids which shows homology with clam This paper reports the amino acid sequence of sea urchin cyclin, cyclins. RNA transcribed in vitro from this sequence was based on the DNA sequence of cyclin cDNA clones isolated from efficiently translated in reticulocyte lysates, yielding full-length Arbacia punctulata. Comparison of the clam cyclin A and ur- cyclin. Injection of nanogram amounts of this synthetic chin cyclin sequences, both of which are just over 400 residues mRNA into Xenopus oocytes caused them to mature more long, shows strong homology limited to a sequence of about 36 rapidly than with progesterone treatment. The sea urchin amino acids in the middle of the proteins. Despite the considerable cyclin underwent two posttranslational modifications in the sequence divergence at both ends of the proteins, microinjec- Xenopus oocytes during maturation.
    [Show full text]
  • Front Matter
    MOLECULAR AND CELLULAR BIOLOGY VOLUME 3 * NUMBER 12 * DECEMBER 1983 Aaron J. Shatkin, Editor in Chief (1985) Roche Institute of Molecular Biology Nutley, N.J. Harvey F. Lodish, Editor (1986) Louis Siminovitch, Editor (1985) Massachusetts Institute of Technology Hospital for Sick Children Cambridge, Mass. Toronto, Canada David J. L. Luck, Editor (1987) Paul S. Sypherd, Editor (1985) Rockefeller University University of California New York, N.Y. Irvine, Calif. EDITORIAL BOARD Renato Baserga (1985) Ira Herskowitz (1984) Daniel B. Rifkin (1985) Alan Bernstein (1984) Larry Kedes (1985) Robert G. Roeder (1985) J. Michael Bishop (1984) Marilyn Kozak (1985) James E. Rothman (1984) Joan Brugge (1985) Elias Lazarides (1985) Phillip A. Sharp (1985) Breck Byers (1985) John B. Little (1985) Fred Sherman (1985) John A. Carbon (1984) William F. Loomis, Jr. (1985) Pamela Stanley (1985) Lawrence A. Chasin (1985) Paul T. Magee (1985) Joan A. Steitz (1985) Nam-Hai Chua (1985) Robert L. Metzenberg (1985) James L. Van Etten (1985) Terrance G. Cooper (1984) Robert K. Mortimer (1985) Jonathan R. Warner (1984) James E. Darneil, Jr. (1985) Harvey L. Ozer (1985) Robert A. Weinberg (1984) Gary Felsenfeld (1985) Mary Lou Pardue (1985) I. Bernard Weinstein (1985) Norton B. Gilula (1985) Mark Pearson (1985) Harold Weintraub (1985) James E. Haber (1984) Jeremy Pickett-Heaps (1985) Reed B. Wickner (1985) Benjamin Hall (1985) Robert E. Pollack (1985) Leslie Wilson (1985) Ari Helenius (1984) Keith R. Porter (1985) Edward Ziff (1985) Susan A. Henry (1985) John R. Pringle (1985) Helen R. Whiteley, Chairman, Publications Board Walter G. Peter Ill, Director, Publications Linda M. Illig, Managing Editor, Journals Eleanor S.
    [Show full text]