Role of Microrna-146A in Vascular Inflammation and Atherosclerosis

Role of MicroRNA-146a in Vascular Inflammation and Atherosclerosis

Henry S. Cheng

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Laboratory Medicine and Pathobiology University of Toronto

Role of MicroRNA-146a in Vascular Inflammation and Atherosclerosis

Henry Chong Sio Cheng

Doctor of Philosophy

Laboratory Medicine and Pathobiology University of Toronto

2017 Abstract

Inflammation plays a vital role in acute and chronic diseases of the vasculature, including sepsis and atherosclerosis, respectively. Molecular mechanisms such as microRNAs are key regulators of signaling pathways and are important in governing the balance between physiological and pathological inflammatory responses. While numerous studies have placed miR-146a amongst the echelon of anti-inflammatory microRNAs, the role of endogenous miR-

146a in vascular inflammatory diseases, including atherosclerosis, remains unknown. Therapies that directly repress vascular inflammation are expected to impede the development of sepsis and atherosclerosis. Furthermore, elevation of miR-146a expression in atherosclerotic plaques in humans and polymorphisms in the miR-146a precursor that are associated with coronary artery disease, are suggestive of a role for this microRNA in atherogenesis. Therefore, this dissertation aims to elucidate the regulation of endothelial activation by miR-146a and to determine the role of endogenous miR-146a in a mouse model of atherosclerosis. Surprising, despite the ability of this microRNA to restrain cytokine production in bone marrow-derived cells, loss of this microRNA resulted in reduced atherosclerosis. This was accompanied by hematopoietic stem cell exhaustion and a corresponding reduction in levels of circulating pro-atherogenic cells.

Enhanced inflammatory signaling occurred even though circulating levels of VLDL cholesterol were diminished in these mice. Within the vasculature, miR-146a restrained endothelial ii activation through the regulation of transcriptional and post-transcriptional inflammatory pathways, and loss of miR-146a in the vasculature enhanced atherosclerosis. This dissertation reveals a critical function for a single microRNA in the control of the intensity of inflammatory responses to inflammatory stimuli such as hypercholesterolemia, and highlights the detrimental effects of unrestrained inflammatory signaling in multiple organs: bone marrow (hematopoietic stem cell exhaustion), spleen (extramedullary hematopoiesis and splenomegaly), liver

(cholesterol homeostasis defects) and the vasculature (enhanced endothelial cell activation and monocyte recruitment). Importantly, these findings provide a further impetus to therapeutically augment miR-146a expression/function in atherosclerosis.

iii

Acknowledgments

To my supervisor, Dr. Jason Fish, I am eternally grateful to you for accepting me into your laboratory and giving me a chance as your first graduate student. Your guidance and training has taught me many aspects of scientific research, and without this inspiration I would not be pursing a PhD.

To my mother, father, and brothers, I am thankful for your continuous support and encouragement over the many years. My appreciation for all the sacrifices you have made to help me achieve my goals is indescribable.

To my lab mates, especially Emilie Boudreau who had been in the lab since the beginning; I am appreciative of the time and effort you have put forth in helping me become who I am today. Our time together has made the last few years among my most treasured.

To my advisory committee, Dr. Michelle Bendeck and Dr. Myron Cybulsky, thank you for your guidance throughout my academic career here at the University of Toronto. Your expertise in atherosclerosis molded both my project and my understanding of this disease.

Table of Contents

Acknowledgments ...... iv

Table of Contents ...... v

List of Tables ...... vii

List of Figures ...... viii

Non-standard abbreviations and acronyms ...... x

1 Literature Review ...... 1 1.1 Chronic Inflammation and Atherosclerosis ...... 1 1.1.1 Pathogenesis of atherosclerosis - Overview ...... 1 1.1.2 Cholesterol homeostasis and its impact on atherogenesis ...... 3 1.1.3 In vitro and in vivo models of atherosclerosis ...... 5 1.2 Cellular biology of atherosclerosis: ...... 7 1.2.1 Role of endothelial cells in atherogenesis ...... 7 1.2.2 Role of myeloid cells in atherogenesis ...... 9 1.2.3 Regulation of hematopoiesis during atherogenesis ...... 14 1.3 Molecular Control of Inflammation and Atherogenesis: ...... 16 1.3.1 Regulation of the NF-κB transcriptional pathway ...... 16 1.3.2 RNA binding proteins in the regulation of inflammatory genes ...... 20 1.4 MicroRNA Biology ...... 22 1.4.1 Mechanisms of microRNA production and activity ...... 22 1.4.2 MicroRNA-based regulation of the NF-κB pathway ...... 24 1.4.3 MicroRNAs in lipid metabolism ...... 30 1.4.4 Role of the miR-146 family in inflammation ...... 31 1.4.5 Implicating miR-146 in atherogenesis ...... 32 1.5 RATIONALE AND OBJECTIVES ...... 33

2 MicroRNA-146 Represses Endothelial Activation by Inhibiting Pro-inflammatory Pathways 35 2.1 ABSTRACT: ...... 36 2.2 INTRODUCTION: ...... 37

2.3 MATERIALS AND METHODS: ...... 40 2.4 RESULTS: ...... 47 2.5 DISCUSSION: ...... 73 2.6 Supplemental Table ...... 78 2.7 Supplemental Figures ...... 80

3 Paradoxical suppression of atherosclerosis in the absence of microRNA-146a ...... 91 3.1 ABSTRACT: ...... 92 3.2 INTRODUCTION: ...... 93 3.3 METHODS: ...... 95 3.4 RESULTS: ...... 103 3.5 DISCUSSION: ...... 122 3.6 Supplemental Table ...... 125 3.7 Supplemental Figures: ...... 128

4 Future Directions and Concluding Discussion ...... 138 4.1 MiR-146a regulation of cholesterol homeostasis ...... 139 4.2 Selective HSPC regulation by miR-146a in atherogenesis ...... 142 4.3 MiR-146a-based therapies ...... 143

References ...... 147

List of Tables

Supplemental Table 2.1: Primers used for qRT-PCR ...... 78 Supplemental Table 3.1: Summary of qPCR array of lipoprotein signaling and cholesterol metabolism genes (differentially regulated genes are highlighted in red)...... 125 Supplemental Table 3.2: List of antibodies used for FACS analysis ...... 126 Supplemental Table 3.3: Primer sequences for qRT-PCR analysis (mouse) ...... 127

vii

List of Figures

Figure 1.1: Activation of receptor-mediated NF-κB signaling pathway ...... 18 Figure 1.2: A network of microRNAs negatively regulate NF-κB signaling. Modified from (255)...... 26 Figure 2.1: MiR-146a and miR-146b are induced in response to interleukin-1β (IL-1β) treatment of endothelial cells...... 49 Figure 2.2: MiR-146a and miR-146b expression is sustained after the removal of IL-1β. .. 50 Figure 2.3: MiR-146a over-expression represses the endothelial inflammatory response. . 53 Figure 2.4: Endogenous miR-146 restrains endothelial activation...... 56 Figure 2.5: MiR-146 inhibits the induction of NF-κB, MAPK/EGR and AP-1 pathways. .. 59 Figure 2.6: The MAPK/EGR pathway regulates the transcription of miR-146a and miR- 146b...... 63 Figure 2.7: HuR, a novel miR-146 target, controls endothelial activation by regulating eNOS expression...... 67 Figure 2.8: miR-146a-/- mice demonstrate enhanced endothelial activation following IL-1β treatment...... 71 Supplemental Figure 2.1 ...... 80 Supplemental Figure 2.2 ...... 80 Supplemental Figure 2.3 ...... 81 Supplemental Figure 2.4 ...... 82 Supplemental Figure 2.5 ...... 82 Supplemental Figure 2.6 ...... 83 Supplemental Figure 2.7 ...... 84 Supplemental Figure 2.8 ...... 85 Supplemental Figure 2.9 ...... 87 Supplemental Figure 2.10 ...... 87 Supplemental Figure 2.11 ...... 88 Supplemental Figure 2.12 ...... 88 Supplemental Figure 2.13 ...... 89 Figure 3.1. MiR-146a is expressed in murine atherosclerotic plaques...... 104 viii

Figure 3.2. Reduced atherosclerosis in mice with global deletion of miR-146a...... 106 Figure 3.3. MiR-146a in bone marrow (BM)-derived cells contributes to atherogenesis. 109 Figure 3.4. Diet- and age-dependent splenomegaly in DKO mice...... 112 Figure 3.5. Global loss of miR-146a inhibits BM hematopoiesis and promotes extramedullary hematopoiesis in the spleen...... 114 Figure 3.6. MiR-146a in BM-derived cells regulates BM and extramedullary hematopoiesis and levels of circulating leukocytes and lymphocytes...... 116 Figure 3.7. miR-146a deficient cells appear to be out-competed by wild-type cells in the bone marrow, circulation, and in atherosclerotic plaques in HCD-treated animals, but not in NCD-treated animals...... 118 Figure 3.8. MiR-146a in the vasculature restrains EC activation and atherosclerosis. .... 120 Supplemental Figure 3.1 ...... 128 Supplemental Figure 3.2 ...... 129 Supplemental Figure 3.3 ...... 130 Supplemental Figure 3.4 ...... 131 Supplemental Figure 3.5 ...... 132 Supplemental Figure 3.6 ...... 133 Supplemental Figure 3.7 ...... 134 Supplemental Figure 3.8 ...... 135 Supplemental Figure 3.9 ...... 136

Non-standard abbreviations and acronyms

ABC ATP-binding cassette transporter (A1, G1, G5, G8) acLDL Acetylated LDL AGO Argonaute AMD ARE-mediated decay Ang II Angiotensin II APO Apolipoprotein (A1, B, B100, E) APR Acute phase response ARE AU-rich elements AUF1 AU-rich element RNA binding protein-1 BAEC Bovine aortic endothelial cells BM Bone marrow BMDM Bone marrow derived macrophage BMT Bone marrow transplant CARD10 Caspase recruitment domain family 10 CCL C-C motif chemokine ligand CCR C-C motif chemokine receptor CD Cluster of differentiation CE Cholesterol ester CETP Cholesterol ester transfer protein cIAP Cellular inhibitor of apoptosis protein CMP Common myeloid progenitor CSF1R Colony stimulating factor-1 receptor CXCL C-X-C motif ligand CXCR C-X-C motif receptor CX3CL1 C-X3-C motif ligand-1 (fractalkine) CX3CR1 C-X3-C motif receptor-1 CYP7A1 Cholesterol 7α-hydroxylase enzyme DAMP Damage-associated molecular pattern DC Dendritic cell DGCR8 Di George syndrome critical region gene 8 DKO Double knockout DTA Descending thoracic aorta DTR Diphteheria toxin receptor EC Endothelial cell ECM Extracellular matrix EGR Early growth response ELISA Enzyme-linked immunosorbent assay eNOS Endothelial nitric oxide synthase (NOS3) ER Endoplasmic reticulum ERK Extracellular-signal regulated kinase ESAM Endothelial cell-selective adhesion molecule EV Extracellular vesicle FACS Fluorescent activating cell sorting

FC Free cholesterol Flt3L FMS-like tyrosine kinase 3 ligand FPLC Fast protein liquid chromatography GAPDH Glyceraldehyde-3-phosphate dehydrogenase GC Greater curvature G-CSF Granulocyte colony stimulating factor GM-CSF Granulocyte macrophage colony stimulating factor GMP Granulocyte-macrophage progenitor GWAS Genome wide association studies HAT Histone acetyltransferase HCD High cholesterol diet HDAC Histone deacetyltransferases HDL High-density lipoprotein HPC Hematopoietic progenitor cell HPRT Hypoxanthine-guanine phosphoribotransferase HSC Hematopoietic stem cell HSPC Hematopoietic stem and progenitor cell HUVEC Human umbilical vein endothelial cell HuR Human antigen R (ELAV1) ICAM-1 Intercellular adhesion molecule-1 IDL Intermediate-density lipoprotein IFN Interferon IκB Inhibitory kappa B IKK IκB kinase complex IL Interleukin IPOA3 Importin-3 alpha IRAK Interleukin receptor associated kinase IRES Internal ribosome entry site JAMA Junctional adhesion molecule A JNK c-Jun N-terminal kinase KLF Krüppel-like factor KO Knockout KSRP KH domain-containing RBP LC Lesser curvature LCAT Lecithin cholesterol acyltransferase LDL Low-density lipoprotein LDLR LDL receptor LFA-1 Lymphocyte function-associated antigen-1 LNA Locked nucleic acid LOX-1 Lectin-like oxLDL receptor-1 LpL Lipoprotein lipase LPS Lipopolysaccharide LSK Lineage- Sca-1+ c-Kit+ LT Long-term LXR Liver X receptor LYVE-1 Lymphatic vessel endothelial hyaluronan receptor-1 M-CSF Macrophage-colony stimulating factor MAPK Mitogen-activated protein kinase xi

MCP-1 Monocyte chemoattractant protein-1 (CCL2) MCPIP1 MCP-1 induce protein-1 MEP Megakaryocyte-erythroid progenitor MERTK MER tyrosine kinase protein MHC Major histocompatibility complex MPO Myeloperoxidase MPP Multipotent progenitor cell MSR1 Macrophage scavenger receptor 1 (SR-A1) MyD88 Myeloid differentiation primary response gene 88 NCD Normal cholesterol diet NEMO NF-κB essential modifier NES Nuclear export signal NF-κB Nuclear factor kappa B NLS Nuclear localization sequence ORO Oil Red-O oxLDL Oxidized LDL PABP Poly(A) binding protein PAMP Pathogen-associated molecular pattern PB Peripheral blood pDC Plasmacytoid DC PECAM-1 Platelet endothelial cell adhesion molecule-1 (CD31) PLZF Promyelocytic leukaemia zinc finger PRR Pattern recognition receptor PSGL1 P-selectin glycoprotein ligand 1 PTM Post-translational modification qRT-PCR Quantitative reverse transcriptase polymerase chain reaction RAG Recombination activating gene RBP RNA binding protein RCT Reverse cholesterol transport RHD Rel homology domain RISC RNA inducing silencing complex RIP1 Receptor interacting protein kinases 1 ROS Reactive oxygen species SDF-1 Stromal cell-derived factor-1 (CXCL12) SELE E-selectin SELP P-selectin sICAM-1 Soluble intercellular adhesion molecule-1 SMC Smooth muscle cells SNP Single nucleotide polymorphism SORT1 Sortilin-1 SR Scavenger receptor ST Short-term TAB TAK1 binding protein TAD Transactivation domain TAK1 TGF-β activated kinases 1 TBP Tata binding protein TC Total cholesterol TG Triglyceride xii

TGF-β Transforming growth factor beta TH T-cell helper TIA-1 T-cell-restricted intracellular antigen-1 TLR Toll-like receptor TNF-α Tumor necrosis factor-α TNFR1 TNF-α receptor-1 TPO Thrombopoietin TRAF TNF receptor-associated factor Treg Regulatory T-cell TTP Tristetraprolin TUNEL Terminal deoxynucleotidyl transferase dUTP nick-end labeling UTR Un-translated region VCAM-1 Vascular cell adhesion molecule-1 VEGF Vascular endothelial growth factor VLA-4 Very late antigen-4 VLDL Very low-density lipoprotein VSMC Vascular smooth muscle cell WHHL Watanabe hereditary hyperlipidemic WT Wild type

xiii

Chapter 1

1 Literature Review

The proceeding sections in part have been published in the journal Frontiers in Genetics:

Cheng HS, Njock MS, Khyzha N, Dang LT, Fish, JE (2014). Noncoding RNAs regulate NF-κB signaling to modulate blood vessel inflammation. Frontiers in Genetics, 5, 422.

1.1 Chronic Inflammation and Atherosclerosis

1.1.1 Pathogenesis of atherosclerosis - Overview Atherosclerosis is a chronic inflammatory disease characterized by blood vessel narrowing due to the growth of a lipid-rich plaque (1). At advanced stages of atherosclerosis, plaque rupture can occur, resulting in thrombosis, myocardial infarction, and stroke; which are the most common causes of mortality and morbidity in industrialized countries (2). The development of atherosclerotic plaques (atherogenesis) in humans occurs asymptomatically over the course of several decades. Risk factors contributing to atherogenesis include aging, cigarette smoking, obesity, hypertension, and hypercholesterolemia (3). Many of these risk factors promote systemic inflammation, which is a reoccurring theme at every stage of atherogenesis. The initiation of atherosclerosis involves the activation and dysfunction of endothelial cells (ECs), the mono-cellular layer directly in contact with the lumen of every blood vessel (4). Circulating cholesterol rich low-density lipoproteins (LDL) accumulate within the intima, the region beneath the endothelium and is then readily oxidized (oxLDL) resulting in the irritation and activation of ECs (5). Activated ECs have higher expression of inflammatory mediators such as adhesion molecules, chemokines and chemoattractants to recruit circulating myeloid cells such as neutrophils, dendritic cells (DCs), and monocytes to sites of oxLDL deposits (6). Within the intima, monocytes differentiate into macrophages that take up oxLDL particles and other cholesterol remnants in order to resolve this state of inflammation. Upon taking up these cholesterol-based particles macrophages and DCs will further differentiate into morphologically distinct foam cells (7). Foam cells and other myeloid cells maintain the expression of pro-inflammatory mediators, further perpetuating the inflammatory state. Fatty streaks develop within the lining of the blood vessel from the accumulation of intracellular lipid in foam cells (8). These early lesions are found in most young adults, and further advancement of the atherogenesis process is dependent on the risk factors listed above. Following apoptosis of foam cells, extracellular lipid deposits accumulate within the intima, which furthers the advancement of fatty streaks into an atherosclerotic lesion with a lipid- rich core (atheroma) (9). During atherogenesis, vascular smooth muscle cells (VSMCs) from the medial layer undergo a phenotypic switch from a contractile state to an adverse proliferative state (10). This phenotypic switch, which is induced by pro-inflammatory mediators, allows these

1 2

VSMCs to migrate from the media, induce expression of scavenger receptors, and then take up oxLDL (11). VSMCs have also been shown to differentiate into macrophage-like cells that take up oxLDL particles, further adding to the accumulation of lipid-laden foam cells (12). In addition, VSMCs contribute to the bulk of extracellular matrix (ECM) found in atheroma. The growth of the atheroma continues with the establishment of an atherosclerotic plaque core comprising of highly proliferative VSMCs and macrophages, lipid-laden foam cells and a plethora of leukocytes from circulation, such as neutrophils, T-cells, and B-cells (6). Plaques occur in arteries in regions of disturbed flow, such as bifurcation, branched points, and curvatures. These regions experiences chronic low grade inflammation and succumb to endothelial dysfunction, precursors to atherogenesis (13, 14). In advanced stages of atherogenesis the atheroma begins growing into the lumen, which causes the narrowing of the artery, and restricts blood flow. The atheroma now consists of a sub-endothelial layer, collagen- rich fibrous cap and necrotic core. The necrotic core is formed from the increasing rate of cell death (apoptosis and necrosis) and the lack of clearance of primarily VSMCs and macrophages (9, 15). While increasing macrophage accumulation in early lesions primarily relied on the recruitment of circulating monocytes, macrophage numbers in advanced lesions remain relatively constant and are instead mainly reliant on local proliferation (16). Within the core, the amalgamation of apoptotic cell remnants, cholesterol crystals, cytokines, and ECM proteases further promote inflammation into adjacent regions of the plaque (17). Complications from atherosclerosis are due primarily to the rupture of the fibrous cap allowing contents from the plaque core (thrombus) to dislodge and occlude downstream vascular beds, resulting in myocardial infarction and stroke. Plaque rupture results from the erosion of ECs and the thinning of the fibrous cap (1). VSMCs are responsible for the stability and strengthening of the fibrous cap, highlighting their importance in late stage atherosclerosis and prevention of thrombosis (18). This illustrates the dichotomist role VSMCs have in atherogenesis due to their detrimental contribution of lipid-laden foam cells in early atheromas, to their protective role in later stages mentioned above. Thinning of the fibrous cap can also result from increased macrophage infiltration into the cap, as these cells produce proteases to break down the ECM and collagen (19).

1.1.2 Cholesterol homeostasis and its impact on atherogenesis

It has become apparent that cholesterol and associated lipoproteins are major risk factors contributing to cardiovascular diseases, including atherosclerosis. Use of statins (3-hydroxy-3- metylglutaryl coenzyme A reductase inhibitors) to lower cholesterol has been shown to effectively reduce mortality and morbidity in established cardiovascular disease patients (20). Cholesterol is sequestered in a variety of lipoprotein particles, varying in composition of cholesterol, phospholipids, triglycerides (TG), and apolipoproteins (APO). LDL and very low- density lipoproteins (VLDL) contain higher compositions of cholesterol particles and are considered to be pro-atherogenic. APOB and APOB100 are the major apolipoproteins of LDL and VLDL, respectively (21, 22). LDL and VLDL also contain APOE to mediate clearance by binding to hepatic LDLR (23, 24). The smaller sized HDL, having lower cholesterol and TG content, is considered athero-protective with the main apoprotein being APOA1 (25). APOA1 is also expressed on hepatocytes, which functionally accepts phospholipids and cholesterol. These particles mediate transfer of cholesterol from peripheral tissues to the liver, bile, and intestines as part of the reverse cholesterol transport (RCT) process (26). Macrophages employ the ATP- binding cassette (ABC) transporters ABCA1 and ABCG1 to transfer internal cholesterol to nascent HDL (or lipid poor APOA1) and mature HDL particles, respectively (27). HDL particles are then released from the tissues into the blood and lymphatic circulation. Free cholesterol and cholesterol in circulating HDL are esterified by lecithin-cholesterol acyltransferase (LCAT) (28). Cholesteryl esters are taken up by scavenger receptor-B1 (SR-B1) from hepatocytes for further degradation (29). In humans, cholesteryl esters in HDL are exchanged for TG from VLDL and LDL via cholesteryl ester transfer protein (CETP). VLDL is processed into intermediate-density lipoprotein (IDL) by lipoprotein lipase (LpL) and further processed into LDL by hepatic lipase. IDL and LDL are recognized by hepatocyte LDLR for degradation. Excess cholesterol for fecal excretion is transported into the bile and intestines by ABCG5, ABCG8, and cholesterol 7α- hydroxylase enzyme (CYP7A1) (30).

RCT is a critically important anti-atherosclerotic mechanism, as demonstrated by genetic mouse models, such as ApoE-/- and Ldlr-/- mice (discussed below), as well as Sr-B1-/- and Abca1-/- Abcg1-/- mice, all of which have increased plasma cholesterol and are highly susceptible to atherosclerosis (29, 31). Central to RCT is the family of transcription factors Liver X Receptors (LXRα and LXRβ), responsible for inducing ABCA1 and ABCG1 transcription in macrophages

4 and hepatocytes (32, 33). LXR signaling is activated in part by cholesterol-derived intermediates such as oxysterols and desmosterols, but also by apoptotic cells (34, 35). LXR promotes efferocytosis in a feed-forward mechanism by inducing expression of tyrosine protein kinase MER (MERTK), which is critical for phagocytosis (35). In addition to regulating cholesterol efflux and efferocytosis, LXR signaling is regarded as athero-protective because it can repress NF-κB signaling (discussed in Section 1.3.1). For instance, LXR are SUMOylated upon desmosterol activation, resulting in LXR binding to NF-κB response elements (36). Furthermore, ablation of ABCA1 and ABCG1 enhances TLR4-mediated gene expression, suggesting that LXR mediates suppression of the inflammatory response (37). In support of this, LXRα and LXRβ deficiency in bone marrow (BM)-derived myeloid cells enhanced atherosclerosis in mice, while the overexpression of LXRα in macrophages reduced atherogenesis (38). Of note, the acute phase response (APR) (discussed below) is induced by TLR4 signaling and can suppress LXR-mediated cholesterol efflux activity (39).

The APR is characterized by changes in plasma proteins, primarily those produced by hepatocytes, and is stimulated by local or distant inflammatory responses (40). This mechanism to reduce cholesterol efflux may enhance the clearance of pathogens. For example, HDL can bind LPS, interfering with its ability to bind to the LPS receptor CD14 and thereby diminishing pro-inflammatory cytokine production (41). A prolonged APR can also affect cholesterol efflux in the long run resulting in diseases such as atherosclerosis. For instance, patients with autoimmune diseases such as systemic lupus erythematosus, rheumatoid arthritis and psoriasis, have reduced circulatory HDL and enhanced atherosclerosis (26, 42). Studies activating TLR4 with LPS injections in mice have indicated several aspects of RCT that are affected by inflammation including, decreased expression of liver APOA1, CETP, ABCG5, ABCG8, and CYP7A1 (43-45). Furthermore, HDL collected from mice exposed to LPS has reduced capacity to efflux cholesterol in vitro, indicating that endotoxemia can induce HDL dysfunction (46). Oxidation of HDL and APOA1 by myeloperoxidases (MPO) can also impinge on cholesterol efflux in macrophages (16, 17). In accordance, while native APOA1 injected into atherogenic mice can reduce plaque lipid, collagen, and macrophage content, oxAPOA1 is unable to mediate these changes (47). Furthermore, over expression of MPO in macrophages enhances atherosclerosis in mice (48). Collectively, unresolved inflammation can contribute to atherogenesis by disrupting cholesterol homeostasis.

1.1.3 In vitro and in vivo models of atherosclerosis

Atherosclerosis is a complex chronic disease that, in humans, develops asymptomatically over several decades, which makes simulating disease course in experimental models very difficult. Several animal models have been established to address certain aspects of atherosclerosis, including mice, rabbits, swine, and non-human primates. Each model has its own advantages and disadvantages in terms of how relevant the model is to human atherogenesis. For instance, compared to mice, larger animals like swine and non-human primates yield low litters, lack genetic models, and are financially limiting. Moreover, even though they can develop spontaneous lesions on a regular chow diet and can be accelerated with a high fat and cholesterol diet, studies can still take longer than a year (18, 49). Several similarities between human and swine atherosclerosis pathogenesis have provided insights into lipoprotein profiles and effects of hemodynamics (50, 51). For instance, in vivo transcriptome analysis of ECs in differing regions of athero-susceptibility in coronary and non-coronary arteries shed insight into the involvement of ER (endoplasmic reticulum) stress and reactive oxygen species’ (ROS) in atherogenesis (52). Swine and non-human primates also develop plaques in coronary arteries, carotids, and peripheral vessels similar to humans, whereas mice develop plaques in the aortic root, aortic arch, and brachiocephalic artery. Rabbits are a widely used model as they are very sensitive to dietary cholesterol in developing atherosclerosis (53). While there are genetic strains that exhibit familial hypercholesterolemia, like the Watanabe hereditary hyperlipidemic (WHHL) rabbit, which has a defect in LDLR, and also the recently developed rabbit with targeted deletion of apoE, genetically modified models are limited in this species (54, 55).

Mice are the most frequently used model of atherosclerosis, due to the ease of genetic manipulation. As mice do not naturally develop atherosclerotic lesions, the two main genetically modified models used are ApoE-/- and Ldlr-/-. This lack of spontaneous atherogenesis is likely due to mice having athero-protective HDL as the primary lipoprotein in circulation. Deletion of ApoE or Ldlr in combination with dietary chow induces lipid-laden lesion formations in regions different from that of human atherogenesis (mentioned previously), but more similar to familial hypercholesterolemia caused by loss of LDLR in humans (56). Plaques formed in these mice

6 also lack certain characteristics such as a thick fibrous cap and do not rupture to cause thrombosis. Combination deficiency (ApoE-/-; Ldlr-/-) has been shown to increase the propensity of atherosclerotic plaque development in coronary arteries, similar to human (57). While ApoE-/- mice on regular chow can develop spontaneous lesions over time (10-20 weeks) with plasma cholesterol levels of 400-600 mg/dL, the consumption of a fat and cholesterol rich diet results in plasma cholesterol levels that exceed 1000 mg/dL and plaques that can develop up to twice as fast. It is worth noting that diet-induced hypercholesterolemia may mask atherogenic phenotypes in genetically modified models. For example, a study on lymphocyte involvement (Rag1-/-; ApoE-/-) in atherogenesis showed significant differences in plaque burden on normal chow, which is not apparent when on a high fat diet (58). However, this is not the case in Rag1-/- ; Ldlr-/- mice on diet, which also exceeds 1000 mg/dL plasma cholesterol levels (47). Ldlr-/- mice have low plasma cholesterol levels on normal chow (200-300 mg/dL) and only develop spontaneous lesions after one year of age. Ldlr-/- mice have primarily IDL and LDL in circulation, whereas ApoE-/- mice have larger lipoproteins such as chylomicrons and VLDL (very low-density lipoprotein) (59). ApoE has also been shown to affect atherogenesis independent of correcting cholesterol defects (60). Furthermore, macrophage ApoE can affect foam cell differentiation and cholesterol efflux capabilities independent of altering plasma cholesterol levels (61, 62). Importantly, these ApoE protein functions remain intact in Ldlr-/- mice.

In vitro experiments using cell cultures are widely used to elucidate mechanisms involved with atherogenesis, and allows for ready manipulation of gene expression through loss- and gain- of-function studies, as well as detailed analysis of cell signaling and gene regulatory pathways and cell biology. Fundamental processes such as circulating leukocyte adhesion to ECs can be measured with co-culture assays of fluorescently labeled monocytes adhering to activated ECs. In vivo flow patterns and cell-matrix interactions can also be modeled in in vitro systems to decipher the role of hemodynamics and biophysical properties in endothelial cell biology. The uptake of modified lipoprotein in macrophages can be tested by treating cells with fluorescently labeled oxLDL followed by fluorescence-activated cell sorting (FACS) to quantify the number of labeled cells (63). Cells grown in co-culture but separated with a small-pore barrier can be used to decipher signaling between two cell populations independent of direct contact. Apoptosis can be measuring by staining for DNA degradation (associated with late stage apoptosis) with the terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assay (64).

Immunostaining for the Ki-67 protein can indicate proliferation, as this protein is not present in the quiescent state (65). In vivo strategies, such as bone marrow transplant (BMT), adoptive transfer, and Cre-loxP systems for conditional gene deletion, are used to identify cell specific mechanisms that are overlooked in global knockout models (66). For instance, to investigate myeloid-specific effects, utilizing BMT will result in reconstitution of the recipient mouse’s myeloid populations with donor bone marrow-derived cells. Adoptive transfer of a particular cell type(s) into a recipient mouse can either increase the levels of a certain populations or rescue a deficient cell type that can highlight their role(s) in atherogenesis. Finally, cell specific genetic modification can be achieved using Cre recombinase-mediated excision of targeted genes that have been flanked by loxP sites. This strategy proves useful in atherosclerosis studies due to the overlap in expression of genes, such as cytokines used by multiple cell types involved in plaque progression.

1.2 Cellular biology of atherosclerosis:

1.2.1 Role of endothelial cells in atherogenesis

ECs are essential for the initiation of atherogenesis as they mediate the recruitment of circulating leukocytes into the intima. The sequence of events is as follows: circulating leukocyte capture by chemoattractant cytokines and leukocyte adhesion molecules, reciprocal surface receptor mediated rolling, arrest, followed by lateral migratory diapedesis (67). The retention of oxLDL in the sub-endothelial intima elicits an inflammatory response in ECs by interaction with members of the Toll-like receptors (TLR-2 and TLR-4), lectin-like oxLDL receptor-1 (LOX-1), and scavenger receptors such as CD36 and type I scavenger receptor class A (Msr1) (68). Interestingly, TLR-2, TLR-4, and LOX-1 can also detect bacterial particles such as lipopolysaccharides (LPS), suggesting similar mechanisms used to induce leukocyte recruitment for clearance of both pathogens and oxLDL (69). Furthermore, induction of these receptors by oxLDL or other pro-inflammatory stimuli prompts activation of nuclear factor kappa-B (NF-κB), a transcription factor responsible for mediating expression of over one hundred genes (More in section 1.3.1) (70). Activation of NF-κB in ECs induces a pro- atherogenic gene expression program, which includes induction of adhesion molecules, chemokines and cytokines (71).

Communication between ECs and circulating leukocytes is dependent on different combinations of ligand-receptor signaling. Chemokines are a subset of cytokines with chemotactic properties that have synergistic and specific effects on leukocytes. For example, ECs release factors such as C-C motif chemokine ligand-2 (CCL2 or MCP-1), CCL5 (or RANTES) and C-X3-C motif ligand-1 (CX3CL1 or fractalkine), which interact with their corresponding receptors on pro-inflammatory Ly6Chi monocytes, namely CCR2, CCR5 and CX3CR1, respectively (5). Genetic deficiencies of CCL2, CCL5 and CX3CL1 in experimental models of atherosclerosis results in reduced plaque burden, demonstrating their role in atherogenesis (72). Conversely, the recruitment of the patrolling sentinel anti-inflammatory Ly6Clo monocytes relies only on CCL5-CCR5 interactions. Recruitment of other leukocytes, such as T helper 1 (TH1) T-cell lymphocytes is mediated by C-X-C motif ligand-10 (CXCL10) and CXCR3 interaction (73). Interestingly, interventions to disrupt the CXCL10-CXCR3 axis have shown the expected decrease in TH1 cells but also results in increased recruitment of regulatory T-cells (Treg) (73). Furthermore, combinations of chemokine signaling have been shown to have synergistic effects on monocyte arrest, as seen with CCL5 and CXCL4 (74).

Adhesion of circulating leukocytes requires two groups of surface molecules, the selectins and the immunoglobulin superfamily. ECs induce the expression of E-selectin (SELE) and P-selectin (SELP) to mediate rolling of circulating leukocytes on the luminal surface of the inflamed ECs (75). These selectins interact with P-selectin glycoprotein ligand 1 (PSGL1) on the surface of leukocytes (76). This is followed by complete arrest by surface molecules from the immunoglobulin superfamily, such as vascular cell adhesion molecule-1 (VCAM-1) and intercellular adhesion molecule-1 (ICAM-1) (77). Effector lymphocytes and monocytes express lymphocyte function-associated antigen-1 (LFA-1) and very late antigen-4 (VLA-4), which bind to ICAM-1 and VCAM-1, respectively (78). Once arrested the leukocytes will find exit sites on the EC surface, which are docking structures consisting mostly of VCAM-1 and ICAM-1 (79). Leukocytes undergo two forms of diapedesis; between ECs (paracellular) and the less understood method of migrating directly through ECs (transcellular) (80). Other members of the immunoglobulin superfamily are employed to mediate paracellular diapedesis, such as junctional adhesion molecule A (JAMA), endothelial cell-selective adhesion molecule (ESAM), and platelet endothelial cell adhesion molecule-1 (PECAM-1 or CD31) (81, 82). In experimental mouse models of atherosclerosis, deletion of VCAM-1, SELE, SELP, or JAMA demonstrated a

9 reduction in lipid plaque burden, showcasing the importance of ECs adhesion molecules in atherogenesis (30, 83, 84). However, not all adhesion molecules listed above follow such trends, as deletion of ICAM-1 and PECAM-1 do not reduce plaque burden in mice (30, 85). Surprisingly, PECAM-1 deletion increased atherogenesis even though in a separate study blocking of PECAM-1 with antibodies has shown a decrease in monocyte and neutrophil extravasation (86). The role of PECAM-1 in atherosclerosis remains unresolved.

Hemodynamics and mechanotransduction within ECs play a vital role in the maintenance of vascular homeostasis and contribute to pathophysiology, such as atherogenesis (87). In linear segments of blood vessels, the luminal side of the endothelium is subjected to high shear stress (laminar flow), which has been shown to simulate an anti-inflammatory, anti-oxidative, and anti- proliferative gene expression program through mechanotransduction (52). The reverse is observed in regions with low shear stress (disturbed flow), which occurs primary at branched points, bifurcations, and lesser curvatures of blood vessels. These regions are therefore considered predisposed for atherogenesis due to the chronic low-grade inflammation and low shear stress it experiences (88). These regions also display a higher degree of endothelial dysfunction, as low shear stress results in reduced synthesis of the vasodilator nitric oxide (89). High shear stress has been shown to positively regulate the transcription factor Krüppel-like factor-2 (KLF-2) known as the main activator of endothelial nitric oxide synthase (eNOS or NOS3) within ECs (90, 91). Beyond its role in mediating dilation of arterial vessels, nitric oxide also decreases the surface expression of VLA-4 on leukocytes thereby decreasing their ability to adhere to ECs (92). Furthermore, accelerated atherogenesis is observed when NOS3 or KLF2 is deleted in mouse models of atherosclerosis (93-95).

1.2.2 Role of myeloid cells in atherogenesis

All myeloid cells express the surface marker CD45 and are derived through hematopoiesis prenatally in the embryonic yolk sac or fetal liver, and postnatally in the bone marrow (more in section 1.2.3). Within arteries, myeloid cells (expressing CD68, CD11b, CD11c, F4/80, CD103 and MHC-II) are preferentially found in areas of disturbed hemodynamic flow that are predisposed to atherogenesis (96). While myeloid cells are recruited to the intima, the majority of resident myeloid cells in arteries are found in the adventitia, the third layer of a

10 blood vessel, furthest from the lumen. Healthy blood vessels are constantly monitored by a network of sentinel myeloid cells (patrolling monocytes [Ly6Clo], resident macrophages and dendritic cells) equipped with pattern recognition receptors (PRRs) to sense damage- and pathogen-associated molecular patterns (DAMPs and PAMPs) (69). These PRRs include the family of TLRs and scavenger receptors that recognize DAMPs, such as oxLDL and apoptotic remnants. Myeloid cells are critical for atherogenesis by mediating oxLDL and apoptotic cell clearance (efferocytosis) and promoting the inflammatory cascade. For example, conditional ablation of myeloid cells by treating mice expressing the diphtheria toxin receptor (DTR) in the myeloid lineage (CD11c promoter driving DTR) with diphtheria before subjection to a hypercholesterolemia diet shows reduced intima accumulation of lipoprotein-like particles and foam cells (97). Resident myeloid cells (mostly macrophages) are found in every tissue and are quite diverse depending on where they reside. These macrophages mainly rely on local proliferation for self-renewal rather than recruitment. For example, Lyve-1 (lymphatic vessel endothelial hyaluronan receptor-1) was identified to be uniquely expressed on arterial macrophages and these cells are present throughout adulthood, whereas macrophage derived from circulating monocytes are Lyve-1- (98). When challenged with LPS, Lyve-1+ macrophages are reduced and replaced by Lyve-1- macrophages before a rebound of Lyve-1+ macrophage populations mediated by local proliferation of remaining Lyve-1+ cells. Furthermore, Lyve-1+ macrophages lack the capacity to take up pathogens by phagocytosis. Currently, the role of arterial Lyve-1+ macrophages in atherogenesis remains unknown. The following section will further explore the myriad of characteristics and dynamic roles of several myeloid cell types to atherogenesis.

Recruitment of circulating monocytes and differentiation into macrophages is critical for the initiation of atherosclerosis. This is evident in the reduction of lesions in osteopetrotic (op/op) mice, which have a point mutation in macrophage-colony stimulating factor (M-CSF) (99), a growth factor for macrophage and dendritic cell (DC) differentiation. Furthermore, conditional ablation of CD11b (diphtheria treatment of CD11b-DTR mice) effectively reduces circulating monocytes and hinders the initiation of lesion formation, yet has no effect on established plaques (100). Monocyte extravasation from the bone marrow is dependent on CCR2 activation (101). Mouse monocytes can be divided into the two subtypes: classical Ly6Chi and patrolling Ly6Clo (CD14+CD16- and CD14loCD16+ in humans, respectively). Ly6Chi

(GR1+/Ly6Chi CCR2+ CX3CR1lo) monocytes are regarded as inflammatory as they respond to expression of CCL2 in distressed tissue, whereas Ly6Clo (GR1-/Ly6Clo CCR2- CX3CR1hi) monocytes are considered more reparative by their participation in CX3CL1-mediated wound healing (102, 103). During atherogenesis, hypercholesterolemia-induced monocytosis favours an increase of Ly6Chi over Ly6Clo monocytes, which is due in part to the inhibitory effect of cholesterol on the conversion of Ly6Chi to Ly6Clo monocytes (104). Reduction of the anti- inflammatory Ly6Clo monocytes by targeted deletion of the nuclear receptor Nur77 promotes atherogenesis (104, 105). Ly6Chi monocytes are preferably found transmigrating into the intima and drive atherogenesis by mediating chemokine and adhesion molecule interactions with ECs listed previously (106). In addition to chemoattractant effects on circulating monocytes, CX3CL1-CX3CR1 interaction promotes monocyte survival by inhibiting apoptosis (107). Patrolling Ly6Clo monocytes are thought to be less invasive as they only signal through CCR5 and not CCR2 or CX3CR1(108). Furthermore, it is also conceivable that the comparatively higher surface expression of LFA-1 on Ly6Clo monocytes favours firm adhesion to endothelial ICAM-1 over diapedesis (7). In the steady state, newly recruited intimal Ly6Chi monocytes can undergo apoptosis or exit into the lymphatic system rather than differentiate into macrophages (109). Restoring cholesterol to normal levels can reverse hypercholesterolemia-induced monocyte recruitment as demonstrated in athero-susceptible ApoE-knockout mice treated with viral transduction of ApoE (110).

The failure of macrophages and foam cells to resolve modified lipoprotein deposits and the retention of macrophages in the intima drives atherosclerosis from early to advanced lesions (111). A repertoire of EC-expressed repulsive neuro-immune guidance cues, such as netrin-1, ephrin-B, ephrin-A2, semaphorins 3A and 3E have been implicated in macrophage retention (112, 113). Furthermore, Netrin-1 deficiency in macrophages effectively reduced lesion size in mice (114). Modified LDL (oxLDL) but not native LDL has also been shown to prevent activated macrophages from exiting into the lymphatic system by mechanisms involving CD36 (115). Chemokine receptor CCR7 mediates egress of monocyte-derived myeloid cells from atherosclerotic lesions into the lymphatic vessels (116). More recently, it was demonstrated that CCR7 and CCL19 interaction allowed bacterial activated myeloid cells to reverse transendothelial migrate into arterial circulation, and this process is inhibited by hypercholesterolemia (117). Historically, classification of macrophages was split into the subsets M1 and M2,

12 however as more subsets are discovered the view on macrophages has expanded into a wide spectrum of M1 and M2 “characteristics”. While both M1-like and M2-like macrophages are found within atherosclerotic lesions, M1-like macrophages are identified to be pro-atherogenic and M2-like macrophages anti-atherogenic (80, 96, 118). In the intima, M1-like macrophages modify native LDL into oxLDL by producing reactive oxygen species enzymes, such as 15- lipoxygenase, phospholipases and myeloperoxidases (119). M1-like macrophages also express major histocompatibility complex class II (MHC-II) to mediate an adaptive immunity response from TH1 T-cells to produce more pro-inflammatory cytokines. M2-like macrophages are thought to be more athero-protective due to their participation in tissue remodeling, immune regulation, wound healing, and scavenger-mediated endocytosis of oxLDL (80). Macrophages primarily utilize the scavenger receptors Msr1 and CD36 to take up modified lipoprotein particles, clear cellular debris, induce inflammatory signaling, and induce apoptosis (68). These responsibilities of scavenger receptors would suggest an importance in atherogenesis, however their role remains contentious. For instance, in vitro experiments using cultured macrophages with targeted deletion of Msr1 and CD36 impaired modified lipoprotein uptake and foam cell formation (120). Conversely, deletion of Msr1 and CD36 separately or in combination in mouse models of atherosclerosis have shown no change in foam cell formation nor reduction in plaque progression (121, 122). It is conceivable that an alternative lipid uptake mechanism, such as the receptor-independent process called macropinocytosis (123), could compensate for Msr1 and CD36 deficiency. These scavenger receptors may also play a role in atherogenesis beyond lipid uptake as Msr1 has been shown to be essential for macrophage proliferation in advanced atheromas (124).

Neutrophils are among the first circulating leukocyte populations to respond to endothelial distress (125). Hypercholesterolemia induces an increase in circulating neutrophils that are recruited by CCR-1 and CCR-5 signaling to mediate trafficking into the intima (126). The presence of neutrophils in mouse atherosclerotic lesions is comparatively low (2%) (127), and their depletion has been shown to decrease lesion size (128), demonstrating their importance in atherogenesis. While neutrophils do not express scavenger receptors to mediate oxLDL uptake, their contribution to atherogenesis is through their ability to mediate recruitment of monocytes by perpetuating the inflammatory response (5, 125). For instance, neutrophils release granule proteins like cationic azurocidin and LL-37 to activate adhesion molecules on ECs and

13 attract monocytes, respectively (129). Furthermore, neutrophils rapidly undergo apoptosis in the intima and release resolution signals like RNA to promote scavenger receptor cell recruitment. This was discovered when RNA-activated TLR3 was deleted in a mouse atherogenic model and showed increased early lesion growth (130).

While DCs are phenotypically and functionally similar to macrophages, DCs are considered to be professional antigen presenting cells and mediators of innate and adaptive immunity in many diseases including atherosclerosis (96). Activated DCs increase expression of MHC-II and co- stimulatory surface molecules CD80 and CD86 to mediate T-cell stimulation (131). In mice, deficiency of both CD80 and CD86 results in a reduction in the burden of atherosclerotic lesions and defective antigen priming of plaque T-cells (132). DCs can be separated into two subtypes; classical DCs (cDCs) and plasmacytoid DCs (pDCs). Chemokines such as Flt3L (FMS-like tyrosine kinase 3 ligand) and M-CSF dictate the population of DCs present within the intima. + + - For example, Flt3L with its receptor Flt3 promote a subset of DCs (CD103 Flt3 CX3CR1 CD11b- F4/80-) phenotypically identical to cDCs, whereas M-CSF CSF1R signaling promotes a subset similar to monocyte-derived DCs (CD103- CX3CR1+ CD11b+ F4/80+ DC-SIGN+)(91). This study also highlighted the functional importance of cDCs in suppressing atherogenesis, as global deletion of Flt3 in mice resulted in worse atherosclerosis without alteration in levels of circulating lipids. The absence of cDCs also diminished the abundance of athero-protective Treg cells in the intima, subsequently promoting a pro-inflammatory environment. Furthermore, pDCs are capable of releasing massive amounts of type I interferon (IFN) following TLR7 and TLR9 stimulation (133). IFN-α that is produced by pDCs was suggested to cause CD4 T-cell activation, which mediates VSMC apoptosis in atheromas, thereby leading to plaque instability (134). More compelling evidence using targeted deletion of the transcription factor TCF-4, which is critical for pDC development, revealed a reduction in lesion size in mice (135).

Evidence of the involvement of adaptive immunity has been observed in human lesions at multiple stages of atherogenesis, and its importance has been demonstrated in animal models of atherosclerosis (136). For instance, depletion of T-cells and B-cells by targeted deletion of recombination activating gene-1 or 2 (RAG1 or RAG2) in atherogenic mice effectively reduced lesion size (47, 137, 138). While in its entirety, adaptive immunity seems to promote + atherogenesis, different aspects have been teased apart to show opposing roles. Treg cells (CD4 + + CD25 Foxp3 ) are regarded as athero-protective through their ability to suppress TH1 and TH2

pathogenic responses, and are found in low numbers in human lesions (139). Treg cells produce cytokines such as transforming growth factor beta (TGF-β) and interleukin-10 (IL-10), both of which have been shown to be important in protection against atherogenesis (140, 141).

Furthermore, lesion sizes are greater in atherogenic mouse models with depleted Treg cells -/- -/- -/- + (CD80 CD86 and CD28 ) (132, 142), and smaller when Foxp3 Treg cells are adoptively transferred (143). Conversely, memory-effector T-cells (CD4+ TCRγδ+ CD28-) promote atherogenesis by producing TH1 response-mediated pro-inflammatory cytokines, primarily IFN-γ (144). Depletion of IFN-γ in atherogenic mice reduces the growth of lesions while exogenous injection of IFN-γ promotes atherogenesis (145, 146). In addition, targeted deletion of IL-18 or

Tbx21, genes critical for promoting TH1 cell differentiation, resulted in reduced lesion size in mice (147, 148). Finally, immunization studies have shown benefits of antibodies in combating atherogenesis, which would suggest a protective role for B-cells - as they are major contributors of antibody production (57, 58). Furthermore, depletion of B-cells by splenectomy in atherogenic mice results in exacerbated lesions, which can be tempered if splenic B-cells are transferred into these mice (149). In another model, B-cell deficient bone marrow cells from µMT mice transplanted into atherogenic mice also displayed greater lesions (150). There are two subtypes of B-cells − B-1 and B-2 − which have been shown to have opposing roles in atherogenesis due to their production of the antibodies IgM and IgG, respectively (59, 60). For instance, B-1 expansion and IgM production are lost in IL-5 cytokine deficient mice, which subsequently have larger lesions (151). Conversely, adoptive transfer of B-2 cells into B-cell deficient mice (Rag-2-/-) have detectable levels of IgG but not IgM, and have enhanced lesions (152).

1.2.3 Regulation of hematopoiesis during atherogenesis

Hematopoiesis, the process whereby the full complement of circulating immune cells are generated from self-renewing hematopoietic stem cells (HSCs), normally occurs primarily within the BM (153). While the importance of hypercholesterolemia-induced leukocytosis in atherogenesis is well appreciated (154), the mechanisms underlying the increase of pro- atherogenic cells (such as Ly6Chi monocytes) have not been fully resolved. During development, initial hematopoiesis from the yolk sac and aorta-gonad-mesonephros is relegated

15 to the placenta and fetal liver before becoming localized to the BM near birth. Of note, it had been demonstrated that certain tissue resident macrophages found in a variety of organs in adults are derived from the yolk sac rather than the BM (155). As mentioned in previous sections, tissue resident macrophages are functionally distinct from macrophages derived from blood monocytes (96). The microenvironment and extrinsic cues can affect HSC functionality, mobilization, and maintenance. For example, fetal liver HSCs are more proliferative compared to adult BM HSCs as a result of the higher oxygen levels for available for metabolic pathways (156), whereas the hypoxic environment in the BM favours the quiescent state to preserve HSC renewal (157). HSCs are also responsive to hypercholesterolemia, as discussed below.

The BM harbors two distinct HSC niches: the quiescent osteoblastic niche of long-term HSCs (LT-HSCs) for self-renewal and the vascular niche of short-term HSCs (ST-HSCs) for immediate proliferation and differentiation in response to injury (158). ST-HSCs retain a dynamic balance between self-renewal and differentiation, whereas LT-HSCs are needed when ST-HSCs are depleted. The BM also consists of stromal cells, macrophages, and ECs, which contribute to the maintenance of HSCs and progenitors (HSPCs) (159). For example, stromal cells, ECs, and macrophages can assist hematopoiesis by providing cytokines such as thrombopoietin (TPO), FLT3 ligand, M-CSF and G-CSF (63, 160, 161). Cytokines like G-CSF and stromal cell-derived factor-1 (SDF-1 or CXCL12) produced by stromal cells also dictate mobilization of HSCs (65, 66, 162). Additionally, ECs provide attachment support and mediate regeneration of HSPCs through vascular endothelial growth factor (VEGF) signaling (163, 164). In response to injury, mobilization of BM HSCs can establish extramedullary hematopoiesis in other organs such as spleen, liver and lungs (165).

Quiescent BM HSCs are activated by stimuli produced during the inflammatory response to pathogens (166-168), non-pathogenic injury such as myocardial infarct (169, 170), and hypercholesterolemia (27, 171). Hypercholesterolemia-induced HSPC proliferation results from accumulation of intracellular cholesterol. Recently, use of a proliferation marker (18F-FLT) highlighted the importance of proliferation in aortic lesional macrophages and HSPCs in the BM and spleen during atherogenesis (172). Utilizing BM from Abca1-/-Abcg1-/- mice, Yvan-Charvet et al. demonstrated that HSPCs with deficient cholesterol efflux develop more lipid rafts where IL-3Rβ and GM-CSF receptors are localized, thereby increasing proliferation by IL-3 and G- CSF mediated stimulation (27). Rescue experiments using APOA1 transgenic mice as recipients

16 for the Abca1-/-Abcg1-/- BM could reduce hypercholesterolemia-induced hematopoiesis (27). Similarly, APOE is localized on the surface of HSPCs to negatively regulate hematopoiesis through ABCA1 and ABCG1 mediated cholesterol efflux (171). This study also demonstrated that increasing HDL or activating LXR could reduce hematopoiesis in the absence of APOE. In addition to cholesterol efflux, reactive oxygen species (ROS) as a product of hypercholesterolemia can accelerate hematopoiesis (173). Finally, impaired cholesterol efflux induces the mobilization of HSPCs to the spleen and expansion of splenic Ly6Chi monocytes and macrophages (174, 175). Extramedullary hematopoiesis was associated with increased G-CSF in circulation, which decreased the number of BM macrophages in favour of neutrophil expansion; resulting in less stromal cell support from macrophages to produce the HSC retention cytokine, SDF1 (162, 174). Hypercholesterolemia induces expansion of splenic HSPCs and Ly6Chi monocytes by GM-CSF and IL-3, which promotes growing plaque by increasing monocyte infiltration (175).

1.3 Molecular Control of Inflammation and Atherogenesis:

1.3.1 Regulation of the NF-κB transcriptional pathway

NF-κB mediates transcriptional regulation of hundreds of genes involved with physiology and disease, and is most prominently associated with inflammation and cell survival. In mammals, NF-κB is comprised of five different subunits: RelA (or p65), RelB, c-Rel, p50, and p52. These subunits contain an N-terminal Rel homology domain (RHD) that allows sequence- specific DNA binding, inhibitory protein recruitment, and dimerization. C-terminal to the RHD, all subunits contain a nuclear localization sequence (NLS). RelA, RelB, and c-Rel contain a C- terminal transactivation domain (TAD), which promotes recruitment of transcriptional co- regulatory histone acetyltransferases (HATs) such as CBP and p300. The p50 and p52 subunits promote binding of histone deacetyltransferases (HDACs) to confer transcriptional repression as they lack TADs to recruit HATs. While many combinations of dimers have been reported, the two prominent pairs are RelA:p50 and RelB:p52, which correspond to the canonical and non- canonical pathways, respectively (176). The importance of the various subunits has been deciphered through genetic manipulation in mice. For example, RelA deletion results in embryonic lethality due to liver cell apoptosis (177), whereas RelB deletion only results in

17 defects in hematopoiesis (178). Regulation of NF-κB signaling is governed by receptor mediated signaling cascades, protein complex inhibition, post-translational modification (PTM) and negative feedback mechanisms (discussed below).

The major contributors to the localization of NF-κB subunits in the cytosol are the family of inhibitory κB (IκB) proteins (179). This is achieved by IκB-dependent masking of the NLS region on the NF-κB subunits by tandem ankyrin repeats that are present in all IκBs. Furthermore, IκBs also contain a nuclear export signal (NES) to effectively force NF-κB to remain in the cytosol. Several IκBs have been identified: IκBα, IκBβ, IκBε, BCL-3, IκBz, IκBNS, p105, and p100. Interestingly, p105 and p100 are processed by cleavage of the C- terminal ankyrin repeats to form p50 and p52, respectively. The canonical NF-κB pathway (RelA:p50) is regulated primarily by IκBα and the non-canonical pathway (RelB:p52) by p100. Mice deficient in IκBα have hyperactive NF-κB activity and suffer neonatal lethality (180). The IκB kinase complex (IKK) phosphorylates IκBα and directs proteasome-mediated degradation, thereby releasing RelA:p50 to enter the nucleus through importin-α channels. IKK is comprised of the non-catalytic NF-κB essential modifier (NEMO or IKKγ) and two kinases, IKKα and IKKβ. The IKK complex is necessary for IκBα degradation, specifically by IKKβ, in the canonical pathway, whereas IKKα targets p100 for processing into p52 independent from NEMO and IKKβ. IKKα is activated by phosphorylation of the constitutively active NF-κB inducing kinase (NIK) (181). Ablation of IKKβ or NEMO in mice leads to embryonic lethality at mid- gestation by unrestrained hepatocyte apoptosis, phenotypically mimicking RelA deficiency (177, 182, 183). Interestingly, embryonic lethality can be rescued in both IKKβ and RelA deficient mice by deletion of TNFα receptor 1 (TNFR1), demonstrating the anti-apoptotic effects of the canonical pathway has during development (184, 185). Conversely, IKKα deficient mice die postnatally from morphogenic patterning defects (186).

Activation of IKK is dependent on specific ligand-receptor interactions and formation of adaptor protein complex (Figure 1.1). There are 7 members of the TNF receptor associated factor (TRAF) family, with TRAF2, TRAF3, and TRAF6 having prominent roles in NF-κB signaling (187). TRAF proteins are considered E3 ligases as they promote ubiquitin activity from E2 ligases such as inhibitor of apoptosis proteins (cIAP1 and cIAP2). PTM of lysine residues by ubiquitin can have multifunctional outcomes. For example, ubiquitination of lysine-63 (K63) on NEMO changes its conformation to enhance IKK activity (188). Furthermore, ubiquitin can

18 mediate adaptor protein recruitment, such as in the case for receptor-interacting protein kinase-1 (RIP1), where ubiquitination recruits TGF-β-activated kinase 1 (TAK1) and TAK1-binding proteins (TAB). TNFα stimulation of TNFR1 recruits RIP1, TRADD, TRAF2, cIAP2, TAB, and TAK1 to form the linear ubiquitin assembly complex (LUBAC) to activate IKK (71). TRAF2 and cIAP2 also promote CD40L-CD40 induced non-canonical NF-κB signaling by targeting TRAF3 for ubiquitin-mediated degradation, resulting in increased NIK expression (189). TLR and IL-1R activation of IKK requires a series of adaptor protein activations. Upon receptor stimulation, the adaptor protein, myeloid differentiation primary response gene 88 (MyD88), is recruited followed by IL-1R associated kinases (IRAK4, IRAK2, and IRAK1) and then TRAF6 recruitment. Similar to TRAF2/cIAP2 in TNFR-mediated signaling, TRAF6 in conjunction with the E2 ligase UBC13 allows ubiquitination of TRAF6 and IKK complex.

TLR4 IL1R TNFR

MyD88 LUBAC IRAK4 TRADD IRAK1 TAB TRAF2 TRAF6 TAK1 RIP1 cIAP

UBC13 NEMO IKKα IKKβ IKK

UbiquiDnaDon IκBα PhosphorylaDon p65 p50 NFκB

Figure 1.1: Activation of receptor-mediated NF-κB signaling pathway

The NF-κB signaling pathway employs negative feedback mechanisms by producing proteins and a network of microRNAs (discussed in section 1.4.2) to resolve late stage

19 inflammatory responses. For example, following initially proteasome-dependent degradation of IκB , IκB re-expression is mediated by NF-κB transcription, thereby attenuating inflammatory responses by shuttling NF-κB out of the nucleus (189). Similarly, inflammatory stimuli induce expression of IRAK-M, a kinase-deficient homolog of IRAK1, which effectively halts signaling by preventing dissociation of IRAK1 and IRAK4 from MyD88 (88, 89). Furthermore, IRAK1 is actively degraded following signaling (190). The alternatively spliced variant of MyD88 (MyD88s) is induced by inflammatory stimuli and acts as a dominant negative to MyD88, resulting in the loss of IRAK1 and IRAK4 interaction and downregulation of NF-κB signaling (191-193). In addition, the NF-κB induced anti-apoptosis signaling protein (A20) actively removes K63-linked ubiquitin from RIP1 and TRAF6 to attenuate signaling (194, 195).

There are ample genetic models that have provided evidence for the crucial role of NF- κB signaling in atherogenesis. Deletion of genes encoding prominent receptors for NF-κB signaling, such as TLR4 (196), CD40 (197), TNFR1 (198), and IL-1R (97, 199) effectively reduce atherogenesis in mice. Deletion of genes encoding adaptor proteins, MyD88 (196), IRAK1 (200), and TRAF6 (98, 201) in mice also attenuates atherogenesis. In contrast, deficiency of A20 promotes unrestrained NF-κB activation that increases atherosclerosis (202). While the majority of these studies demonstrate that global knockout of key regulators that disrupt NF-κB signaling can attenuate atherosclerosis, cell type specific deletions of the same adaptor protein have yielded opposing effects in distinct cell types, suggesting context- and cell-dependent roles for NF-κB signaling. For example, deletion of TRAF6 in ECs reduces pro-inflammatory gene expression, monocyte adhesion, and atherogenesis, while TRAF6 deletion in myeloid cells reduces expression of anti-inflammatory IL-10, increases oxLDL-mediated apoptosis, and impairs efferocytosis, thereby exacerbating atherosclerosis (201). Effects on inflammation are similar when inhibiting NF-κB signaling in ECs either by deletion of NEMO or by overexpression of a dominant negative IκBα (71). Deletion of IKKβ in macrophages also inhibits IL-10 and impairs efferocytosis, phenotypically mimicking TRAF6 deficiency in myeloid cells (203). Conversely, IκBα deletion in myeloid cells results in unrestrained NF-κB activity with increased adhesion of monocytes to ECs, thereby promoting atherogenesis in mice (204). Thus, although NF-κB is known to be a critical regulator of inflammatory signaling during atherogenesis, the consequence of manipulating this pathway in genetic models can have diverse, cell- and context-dependent effects on atherogenesis.

1.3.2 RNA binding proteins in the regulation of inflammatory genes

In addition to the intricate mechanisms that control the transcription of inflammatory genes, post-transcriptional regulation provides an additional layer of gene regulation. Following their transcription, messenger RNA (mRNA) transcripts are subjected to splicing, cytosolic transport, RNA editing, stabilization, and translation. Post-transcriptional regulation can occur at any time to modulate the turnover/stability of transcripts during an inflammatory response. While most post-transcriptional regulation occurs in the cytosol, examples of nuclear-mediated alternative splicing mechanisms have demonstrated effectiveness in attenuating inflammatory response (i.e. MyD88s, an alternatively spliced product of the MyD88 gene mentioned in the previous section). Most mRNAs naturally consist of a 5’ 7-methylguanosine cap and a 3’ poly(A) tail that protect them from progressive decay mechanisms, such as deadenylation and exonucleases. Decay mechanisms are heavily influenced by the binding and activity of a diverse array of RNA binding proteins (RBPs). Destabilizing RBPs can bind to the 3’ untranslated region (UTR) of an mRNA to recruit exonuclease complex CCR4-NOT and poly(A)-specific ribonuclease (101, 205), or bind to the 5’UTR to recruit decapping enzymes like DCP1 and DCP2 (206). While many RBPs have shown affinity to diverse RNA elements, such as stem loops and double stranded RNA, the most heavily studied RBPs are found to interact with AU- rich elements (AREs), the function of which is discussed below (207). Characterization of RBPs is complicated due to the fact that many function cooperatively or competitively on a shared mRNA transcript. In addition, some RBPs only mediate mRNA decay, while others have demonstrated a role in both decay and stabilization activities, dependent on the cellular context.

Since the intensity and duration of an inflammatory response needs to be carefully controlled to avoid collateral damage, many inflammatory response genes contain destabilizing AREs as a form of anti-inflammatory control and are subjected to ARE-mediated decay (AMD). Several RBPs identified by mass spectrometry were found to bind to AREs of rapid decaying mRNA, such as tristetraprolin (TTP), KH domain-containing RBP (KSRP), AU-rich element RNA binding protein-1 (AUF1) and human antigen R (HuR, also known as ELAV1) (208). TTP has an anti-inflammatory role and participates in a negative feedback mechanism, as it is induced by inflammatory stimuli such as TNF-α and mediates decay of Tnfa transcripts (209). TTP

21 deficient mice therefore succumb to chronic inflammatory manifestations such as extramedullary myeloid hyperplasia, arthritis, and dermatitis (210). Similarly, AUF1 deficient mice are more sensitive to endotoxemia and septic shock as a result of failed degradation of pro-inflammatory cytokines TNF-α and IL-1β (211). KSRP is induced alongside IFN-α and IFN-β during viral infections and mediates their degradation upon resolution of the inflammatory response (212). While these RBPs are classically known for their role in AMD, emerging studies have demonstrated alternative physiological functions. For example, AUF1 can stabilize telomere length, affecting the aging process (213), and KSRP is involved with promoting processing of the anti-inflammatory microRNA-155 (214).

HuR is a particularly interesting RBP as it is capable of both stabilizing and decaying target mRNA transcripts, as well as promoting or inhibiting their translation, which suggests multiple co-regulatory mechanisms. For instance, HuR competes against TTP in binding to the 3’UTR of HuR mRNA itself, which prevents AMD and also ensures nuclear export (104, 105). Similarly, HuR can compete with other mRNA-decay RBPs like T-cell-restricted intracellular antigen-1 (TIA-1). TIA-1 and HuR both bind to the apoptosis regulator gene, Cytochrome c, and targeted knockdown of HuR or TIA-1 resulted in decreased or increased Cytochrome c expression, respectively (215). Conversely, HuR and TIA-1 have been shown to work cooperatively to mediate gene repression in the absence of TTP (216). Other mechanisms of HuR action include interaction with the RNA inducing silencing complex (RISC), which is a protein complex that is critical for microRNA-mediated post-transcriptional repression (more in section 1.4.1). For example, HuR can promote the translation of cationic amino acid transporter 1 by competing against miR-222 bound RISC to impede microRNA-mediated repression (217). The reverse was demonstrated with repression of c-Myc mRNA by HuR recruitment of RISC and let-7 microRNA to the 3’UTR of c-Myc (218). While most interactions with transcripts occur at the 3’UTR, HuR has been shown to bind 5’UTRs and alter translation. HuR can promote translation by binding to the 5’UTR internal ribosome entry site (IRES) motif to mediate transcript recruitment to polysomes (219). Binding to 5’UTR IRES sites does not always promote translation, in fact several studies have demonstrated the opposite with HuR (220, 221).

Similar to other RBPs, HuR has been widely investigated in relation to inflammation. Many inflammatory response genes contain AREs within their UTRs to elicit rapid turnover and suspend a prolonged response. HuR is ubiquitously expressed and can also be induced by NF-

κB signaling (222). In VSMCs, HuR promotes inflammation by stabilizing IL-6 and TLR4 in the presence of oxysterols (metabolites of cholesterol, prevalent in atherosclerotic plaques) and LPS (109, 223). Similarly, in ECs exposed to VLDL, HuR increases production of pro-inflammatory genes like IL-8, VCAM-1, and TNF-α (168). While the role of VSMC- and EC-specific HuR is pro-inflammatory, the role of myeloid-specific HuR is controversial due to numerous conflicting reports. For example, in vitro activated T-cells and macrophages robustly produce pro- inflammatory cytokines, such as TNF-α, IFN-γ, and IL-6, with assistance from HuR (224, 225). Conversely, in mice with conditional knockout of HuR in myeloid cells or CD4 T-cells, both have exacerbated inflammation highlighted by increased cytokine production (226, 227). Furthermore, overexpression of HuR in myeloid cells and macrophages in mice effectively reduced pro-inflammatory cytokine expression (214, 216). Due to the wide range of myeloid cells that affect both anti- and pro-inflammatory responses these in vivo models of HuR deficiency need to be further refined.

1.4 MicroRNA Biology

1.4.1 Mechanisms of microRNA production and activity Since their discovery nearly two decades ago, over 1000 microRNAs (miRNA) have been found within the human genome, and they have been shown to influence transcriptional responses in most biological processes (119, 228). MiRNAs are small (~21-23 nucleotides (nts)) single stranded RNAs that mediate post-transcriptional regulation by targeting 3’UTR of mRNAs. The binding efficacy depends on complimentary between the mRNA and the 2-8 nts region of the 5’end of the miRNA, termed the ‘seed’ sequence (229). Nucleotide alteration in the seed- matched region of the mRNA is a common experimental approach used to effectively reduce miRNA binding. Individual miRNAs have been demonstrated to target hundreds of mRNAs (230). It is not uncommon for a miRNA to target multiple mRNAs within the same biological pathway (231, 232). This mechanism of multiple targets allows a single miRNA to have modest levels of repression, yet an overall larger impact on a biological pathway (233). Alternatively, several miRNAs can cooperatively regulate a single biological process by targeting individual mRNAs within a single pathway, thereby allowing for redundancy. For example, the miR-17-92 family of miRNA clusters comprise three polycistronic genes that encode fifteen miRNAs that

23 share redundancies in targeting cell cycling and apoptotic pathways (234). Many other miRNAs reside within introns to utilize transcriptional regulation with host mRNA. Furthermore, it is common for these intronic miRNAs to synergize or antagonize their host mRNA as a form of feedback or feed forward mechanism (231, 235, 236).

Canonical miRNA biogenesis begins in the nucleus where the primary miRNA (pri- miRNA) is transcribed by RNA Polymerase II (237). Regions within the pri-miRNA form stem loop structures and are recognized and cleaved by the RNase III complex Drosha and Di George syndrome critical region gene 8 (DGCR8), resulting in a smaller (~70-100 nts) precursor miRNA (pre-miRNA) (238). The pre-miRNA is exported into the cytoplasm by Ran-GTP and the nuclear export receptor, exportin-5 (237). In the cytoplasm the loop end is cleaved by another RNase III ribonuclease, Dicer. The miRNA duplex separates as the mature miRNA (i.e. active) strand is incorporated into the RISC, whereas the other strand (i.e. the passenger strand) is degraded. While this is true for most miRNAs, the active and passenger strands of some miRNAs, such as miR-126, can be readily detected in cells and can have disparate functions by mediating repression of different set of transcripts (126, 231). RISC in conjunction with argonaute-2 (AGO2) localize to the cytoplasmic processing bodies (P-bodies), where miRNA- RISC-AGO2 actively represses translation via hindrance of translational machinery or recruitment of poly(A) binding protein (PABP) and CAF1 deadenylase for mRNA degradation (239). Interestingly, the loop end of the pre-miRNA has been shown to regulate miRNA biogenesis. For example, processing of Let-7 family of miRNAs is repressed due to Lin-28 protein binding, which inhibits Drosha endonucleolytic activity (240). Furthermore, the ribonuclease monocyte chemoattractant protein-1-induce protein-1 (MCPIP1) has been found to recognize a variety of different pre-miRNAs and cleave different regions of the stem loop structure to antagonize Dicer activity (241). While uncommon, some miRNAs undergo alternative biogenesis pathways by foregoing Drosha/DGCR8 or Dicer processing (242).

Extracellular vesicle (EV) transfer of miRNAs allows for cell-cell communication and is an emerging field showcasing the expanding influence of miRNAs on physiology and disease. EVs are comprised of exosomes, microparticles, and apoptotic bodies, varying in size, mechanisms of biogenesis, and contents. While effects from EVs could be due to surface protein interactions with recipient cells or delivery of other contents such as protein and DNA, several studies have demonstrated EV-mediated effects are miRNA-dependent. For example, Njock et

24 al. demonstrated healthy EC-derived EV could repress inflammatory responses from recipient monocyte and macrophages in part by transferring miR-10a. This was evident when ECs pre- treated with miR-10a inhibitors produced EVs with reduced anti-inflammatory potential (243). In another study, EVs isolated from laminar flow-induced ECs were enriched with miR-143 and miR-145, which were capable of reducing atherosclerosis by inducing an athero-protective phenotype (244). Apoptotic bodies are created as a response to the apoptosis cascade program and are present during atherosclerosis. EC-derived apoptotic bodies demonstrate athero- protective properties by donating miR-126-3p to recipient ECs and promoting the expression of CXCL12, resulting in the recruitment of progenitor cells to counteract the events causing apoptosis (245). Other circulating enclosed vesicles like HDL have also been shown to mediate miRNA transfer. For example, HDL carrying miR-223 is taken up by hepatocytes by SR-B1 receptors, and SR-B1 mRNA is subsequently repressed since it is a direct target of miR-233 (246). Furthermore, miRNA from HDL can be transferred to ECs to repress leukocyte adhesion via direct targeting of ICAM-1 mRNA by miR-223 (247). Collectively, miRNAs demonstrate an essential layer of regulation for most biological pathways, in both cell intrinsic and extrinsic manners.

1.4.2 MicroRNA-based regulation of the NF-κB pathway In addition to identification of proteins that serves as negative feedback regulators of NF- κB, a network of microRNAs has been shown to regulate inflammatory signaling (Figure 1.2). Laminar flow initiates a gene expression program that includes up-regulation of athero- protective transcription factors such as KLF2 (91), and inhibition of pro-inflammatory transcription factors such as NF-κB (reviewed in section 1.3.1) (14). Further to transcriptional programs, blood flow also modulates the expression of several miRNAs (248-250). To identify miRNAs that might contribute to the regulation of vascular inflammation, Fang et al. performed miRNA arrays on athero-susceptible versus athero-protective regions of the vasculature in swine models, and found that miR-10a is an EC-enriched miRNA that is decreased in regions that are prone to the development of atherosclerosis, such as the lesser curvature of the aortic arch. The differential flow-mediated regulation of miR-10a in the vasculature was confirmed in mouse models (251). These results suggested that laminar flow promotes the expression of miR-10a; however, it should be noted that miR-10a does not appear to be regulated by KLF2 (244). The

25 aortic arch experiences disturbed flow dynamics and elevated NF-κB activity, which suggests that NF-κB may negatively regulate miR-10a expression. In support of this, Xue et al. showed that miR-10a is down-regulated by TLR-mediated NF-κB activity in intestinal dendritic cells (252). Elucidating the mechanisms responsible for miR-10a flow-dependent regulation in vivo will require further investigation. Functional characterization of this miRNA revealed that miR- 10a negatively regulates NF-κB activity in cultured human ECs by directly targeting MAP3K7 (also known as TAK1) and β-TRC (251). TAK1 is essential for NF-κB signaling as it is a kinase that activates IKKβ (253), which is responsible for IκBα phosphorylation, while β-TRC mediates ubiquitination of phosphorylated IκBα, facilitating ubiquitination-mediated protein degradation (254). In addition, miR-10a also contributes to the repression of NF-κB activity by targeting IRAK4 (243). The role of miR-10a in atherosclerosis has not been tested, but the results of Fang et al. suggest that miR-10a may suppress atherogenesis; linking flow dynamics with NF-κB signaling. The recent generation of miR-10a knockout mice (255) will be useful to test this hypothesis.

CD40 IL1R TLR

MyD88

CYTOPLASM IRAK2 miR146 IRAK1 TRAF6

P TAB2 TAB3 P TAK1

miR10a P P IKKα IKKβ

P miR155 NEMO CARD10

βTRC

P P Ub Ub Ub IκB κB-RAS1 IκB p50 p65

IPOA3 miR181b KLF2 KLF4 p300 miR92a anti-INFLAMMATORY GENES pro-INFLAMMATORY GENES

NUCLEUS

Figure 1.2: A network of microRNAs negatively regulate NF-κB signaling. Modified from (256).

A distinct set of microRNAs is induced by disturbed or oscillatory flow in cultured human cells. For example, miR-663 is up-regulated by oscillatory flow and drives a pro- inflammatory expression profile and enhances monocyte adhesion to the endothelium (257). Oscillatory flow also induces the expression of miR-92a in human cells, while athero-protective laminar flow down-regulates its expression (258). Interestingly, KLF2 and KLF4 have been shown to be miR-92a target genes (258, 259). These two transcription factors inhibit NF-κB dependent inflammatory genes (91, 260) in part by competing with NF-κB for access to the transcriptional co-activators p300/CBP (91, 261). In mice, genetic deficiency of either KLF2 or −/− KLF4 in ApoE mice enhances atherosclerosis, indicating an athero-protective role for KLF2 and KLF4 (94, 261). Furthermore, a role for miR-92a-dependent regulation of KLF2/KLF4 in the pathogenesis of atherosclerosis was recently demonstrated. Loyer et al. found that endothelial miR-92a expression is induced by a combination of low shear stress and oxidized LDL, two key factors that drive EC activation, and they observed that miR-92a levels are enhanced during atherogenesis in mouse models. Using miR-92a inhibitors, they observed an increase in KLF2 and KLF4 levels as well as a decrease in total and phosphorylated p65 in the aortas of atherosclerotic mice, which was accompanied by diminished atherosclerotic plaque formation (262). Thus, miR-92a appears to enhance NF-κB signaling at two levels: by repressing KLF2/KLF4, antagonists of NF-κB-dependent transcription, and by promoting the activation of p65. The mechanisms responsible for this latter effect on p65 are not known. Collectively, these studies underscore the pro-inflammatory and pro-atherogenic function of miR-92a in the endothelium, and link this microRNA with regulation of flow-dependent transcriptional programs.

To identify microRNAs that might be involved in the inflammatory response, Sun et al. profiled microRNA expression in human ECs exposed to the pro-inflammatory cytokine, TNF-α. They found that miR-181b was rapidly down-regulated by this stimulus. The miR-181 family consists of four members (miR- 181a, b, c, and d) in human and mouse. The predominant isoform in ECs is miR-181b, which is expressed at greater than 10-fold higher levels than miR- 181a, while the other two isoforms are nearly undetectable (263). Importantly, circulating levels of miR-181b are decreased in patients with sepsis, a systemic inflammatory response that is associated with EC activation, vascular permeability, and severe organ damage (263). This microRNA is also down-regulated in the circulation and in the intima of atherosclerotic lesions

28 in mouse models of atherosclerosis, and circulating levels are lower in patients with coronary artery disease (264). This suggests that down-regulation of miR-181b occurs in diverse vascular inflammatory conditions. The over-expression of miR-181b in cultured human ECs or systemic delivery of miR-181b mimics in mice represses NF-κB dependent vascular inflammatory gene expression. Treatment with miR-181b mimics also decreases leukocyte recruitment and damage to the lung, and increases survivability in a mouse model of sepsis (263). Systemic mimic injections resulted in miR-181b accumulation in the intimal region (i.e., ECs) of the aorta and in circulating leukocytes, with limited accumulation in the medial layer of the vessel wall. With success in systemic delivery of miR-181b mimic into mice in an acute inflammatory condition (i.e., sepsis), their subsequent study demonstrated that multiple injections of miR-181b mimic can reduce vascular inflammation and reduce lipid-rich plaque accumulation in mouse models of atherosclerosis (264).

By analyzing the targets of miR-181b, Sun et al. found that this microRNA impinges on the NF-κB pathway by targeting the nuclear protein transporter Importin-3α (IPOA3) in human and mouse ECs. The IPOA family has been shown to mediate nuclear import of NF-κB subunits during the inflammatory response (265). Interestingly, the miR-181b-mediated repression of NF-κB activity was only observed in the endothelium and not in leukocytes, despite efficient delivery of miR-181b to leukocytes (264). While miR-181b represses IPOA3 expression in leukocytes, the main isoform used for NF-κB nuclear transport in leukocytes is IPOA5 (which is not targeted by miR-181b): explaining the insensitivity of leukocytes to miR-181b manipulation. This is an important finding considering that inhibition of NF-κB in ECs and leukocytes can have opposite effects on atherogenesis (71, 203). Collectively, these studies highlight the importance, and potential therapeutic relevance, of miR-181b in vascular inflammatory diseases.

Since microRNAs can target and repress several genes, they can have complex effects on signaling pathways. MiR-155 has been intensely studied for its role in controlling inflammation, but in contrast to miR-10a, miR-92a, and miR-181b, which appear to have predominantly pro- or anti-inflammatory roles, studies on miR-155 have often revealed conflicting roles for this microRNA. Many of these differences seem to be attributable to the cell type being studied. For −/− example, miR-155 mice are severely immunocompromised (266), and this appears to be dependent on miR-155 function in B-cells (267). These mice are also resistant to auto-immunity

29 through T-cell mediated effects of miR-155 (268). A role for miR-155 in leukocytes during atherogenesis has also been demonstrated. The levels of miR-155 dramatically increase in atherosclerotic plaques and within plaque macrophages in mice (269, 270). By utilizing bone marrow transplant approaches, one report has found that miR-155 promotes the development of −/− atherosclerotic plaques in the ApoE model by driving an NF-κB-dependent pro-inflammatory response (269), whereas another group has found that miR-155 inhibits atherosclerosis in the hi Ldlr−/− model by antagonizing the levels of circulating neutrophils and pro-inflammatory Ly6C monocytes (271). In addition, injection of miR-155 inhibitors has been shown to reduce plaque −/− formation in ApoE mice, and this is accompanied by reduced ox-LDL uptake and less reactive oxygen species production (270). Additional investigations will be required to resolve the differences in these studies, which used different atherosclerotic mouse models and assessed different time-points of disease progression (272).

Several studies have assessed miR-155 function in vascular ECs and have found a largely anti-inflammatory effect. However, it is important to note that only in vitro experiments have been performed thus far. For example, miR-155 can target angiotensin II type I receptor (AGTR1) and ETS1 in human ECs. Angiotensin II (Ang II) is a potent inducer of inflammation, and ETS1 has been shown to drive the expression of VCAM1 and CCL2 in response to Ang II stimulation. Thus, overexpression of miR-155 inhibits the pro-inflammatory effects of Ang II (273). MiR-155 is also induced by the pro-inflammatory cytokine, TNF-α, and can act as a negative feedback regulator by directly targeting p65 and inhibiting human EC activation (274). A recent report elegantly demonstrated that miR-155 expression is repressed by Notch signaling in mouse bone marrow stromal ECs (275). Deletion of Notch in these cells enhances miR-155 expression and miR-155 can target the NF-κB inhibitor, κB-Ras1, enhancing NF-κB activity in stromal ECs and driving pro-inflammatory cytokine production and myeloproliferation. MiR- 155 has also been shown to antagonize NF-κB signaling in other cell types. For example, miR- 155 can target MyD88 in human macrophages (276), and TAB2 in human dendritic cells (277). MiR-155 also negatively regulates NF-κB signaling in human epithelial cells during H. pylori infection (278). Taken together, the role of miR-155 in controlling vascular inflammation appears to be highly complex and cell-specific, and further investigation is required to fully understand the role of this microRNA in vascular pathology.

1.4.3 MicroRNAs in lipid metabolism

Several hepatic miRNAs have been implicated in regulating plasma cholesterol levels, as the liver is central to lipid metabolism. Highly enriched in the liver is the tissue-specific miR- 122 (279). Inhibitors to antagonize miR-122 in mouse and non-human primate effectively targeted the liver and reduced plasma cholesterol levels (280, 281). While certain genes from these studies have been shown to be de-repressed by silencing of miR-122, the cholesterol defects observed may be attributed to the collective regulation of several hepatic genes (282, 283). Similarly, hepatic miR-27b is induced by increased plasma cholesterol levels and is able to target several genes involved with lipid metabolism and lipoprotein remodeling (284). Many other miRNAs have been shown to target key genes to mediate lipid metabolism changes. For example, Goedeke et al. performed a genome-wide screening assay with hepatocytes to identify miR-148a as a negative regulator of LDLR (285). In support of this, genome-wide association studies (GWAS) on patients with abnormal circulatory lipid levels identified several miRNAs affected by single-nucleotide polymorphisms (SNPs) in their promoter regions, including miR- 148a (286). This study also implicated three other miRNAs, miR-128-1, miR-130b, and miR- 301b, in cholesterol regulation by negatively regulating LDLR. Furthermore, these four miRNAs also antagonize the RCT pathway by targeting ABCA1 (285, 286).

Several other miRNAs also influence plasma cholesterol levels by antagonizing cholesterol efflux primarily targeting ABCA1, ABCG1, or SR-B1 (246, 287, 288). MiR-33a and miR-33b both target ABCA1 and ABCG1, and are particularly of interest as both are co- expressed with their host genes, sterol regulatory binding transcription factor-1 and -2 (Srebf1 and Srebf2, or SREBP1 and SREBP2), which are prominent transcription factors for cholesterol, fatty acid, and lipid biosynthesis (235, 288, 289). Repression of cholesterol efflux highlights the synergistic effects miR-33 has with the main objective of SREBPs in promoting cholesterol balance. Inhibitors repressing miR-33 effectively increased ABCA1, ABCG1, and HDL levels in mice and in non-human primates (288, 290). Despite these encouraging reports, several studies on the role of miR-33 in atherogenesis arrive at different conclusions. For instance, miR- 33-/- in ApoE-/- mice complimented the study Rayner et al. conducted with anti-miR-33 injections into Ldlr-/- mice, both revealing an increase of HDL and repression of atherosclerosis (154, 291).

Conversely, studies by Rotllan et al., Ouimet et al., and Marquart et al. report no significant changes to circulating cholesterol or HDL levels in anti-miR-33 treated Ldlr-/- mice (292-294), while only the study by Marquart et al. had negative effect on plaque progression. These anti- atherogenic effects can be in part attributed to anti-inflammatory properties miR-33 has in macrophages. Antagonizing miR-33 in atherogenic mice promotes a classical M2-like + population of macrophages and FOX3P Tregs in atherosclerotic plaques (294).

1.4.4 Role of the miR-146 family in inflammation There are two members in the miR-146 family and are located in different loci. In the human genome, miR-146a resides in chromosome 5 and miR-146b in chromosome 10 (11 and 19 in mice, respectively). MiR-146a/b shares the same targets while differing by two nucleotides in the non-seed region (295). Despite their similarities, miR-146a is more actively expressed as a result of having two NF-κB binding elements in their promoter (296). NF-κB-dependent induction of miR-146a plays a critical role in attenuating NF-κB signaling. This is accomplished through the targeting of TRAF6 and IRAK1, two adaptor proteins that act upstream of the NF- κB pathway (295). More recently, the caspase recruitment domain family 10 (CARD10), an adaptor protein for GPCR-mediated NF-κB activity, was identified as a target of miR-146a in cultured human ECs (297, 298). MiR-146a/b were also previously found to be highly elevated in senescent human fibroblasts (299), epithelial cells (300), and ECs (301, 302), and ectopic expression of miR-146a suppressed the SASP phenotype of senescent cells (299). In support of this, delivery of E-selectin targeting nanoparticles enriched with miR-146a and miR-181b efficiently suppressed NF-κB-inducible cytokines and monocyte adhesion to ECs (303). The work presented in the following chapter further examines the role of miR-146a/b in regulating inflammatory pathways in ECs.

In addition to the anti-inflammatory role of miR-146a in ECs, this microRNA also plays several important roles in repressing inflammatory signaling in immune cells. In monocytes for example, miR-146a participates in endotoxin tolerance elicited by LPS. Following initial exposure to a low dose of LPS, miR-146a expression is induced and maintained for days, allowing for suppression of a subsequent inflammatory response to a high dose of LPS (304). Antagonism of miR-146a induction in human cultured monocytes and in mouse models prevents

−/− endotoxin tolerance from occurring (305, 306) and miR-146a mice are hypersensitive to LPS, and produce extremely high levels of pro-inflammatory cytokines that cause lethal septic shock (198). The expression of miR-146a is also down-regulated in macrophages exposed to oxidized LDL (307). Over-expression of miR-146a inhibits LDL cholesterol uptake by macrophages and the secretion of pro-inflammatory cytokines through targeting of TLR4 (307). Furthermore, miR- −/− 146a mice produce an expanded population of pro-inflammatory Ly6Chi monocytes in response to inflammatory stimulation (308), suggesting that the innate inflammatory response may be exaggerated and prolonged in these mice. These mice also have protracted T-cell responses (309), defective regulatory T-cell functions (310), expansion of several intestinal T- cell populations (311), and develop an autoimmune-like myeloproliferative disease later in life (197), suggesting that miR-146a-mediated feedback loops are necessary to prevent prolonged activation of the immune system.

1.4.5 Implicating miR-146 in atherogenesis The collective data above support an anti-inflammatory role for miR-146a in ECs and leukocytes. This is primarily attributed to the suppressive power of miR-146a over the NF-κB signaling pathway and attenuation of the inflammatory response. This would suggest miR-146a would be anti-atherogenic based on its ability to suppress inflammation. However, repression of NF-κB and consequently the inflammatory response from ECs can restrain atherogenesis (71), while repression in leukocytes promotes atherogenesis (203). Thus, it remains unclear what the exact role of miR-146a is in atherogenesis. This uncertainty is exemplified when opposing phenotypes on atherosclerosis are also observed from genetic ablation of TRAF6, a bona fide target of miR-146a (201).

Interestingly, circulating levels of miR-146a increase during atherogenesis in mice (264), and elevated expression of miR-146a is observed in atherosclerotic plaques in mice (264, 269) and in humans (312). Furthermore, a SNP (rs2910164) changing guanine (G) to cysteine (C) in the stem loop of pre-miR-146a, results in increased levels of mature miR-146a and has been positively associated with coronary artery disease patients (313-316). Coronary artery disease patients with CC homozygotes with elevated miR-146a expression have correspondingly reduced levels of IRAK1 and TRAF6 (314). Conversely, a conflicting report using in vitro cell models

33 demonstrated G allele mediated greater repressive power over IRAK1 and TRAF6 and elevated expression of miR-146a (317). These examples of increased miR-146a expression may be due to the activation of inflammatory pathways during the course of disease progression.

More recently, Li et al. provided evidence intravascular injections of miR-146a mimetic into Ldlr-/- and Ldlr-/-;ApoE-/- mice can reduce atherosclerosis (318). Reduced plaque size was attributed to repression of IRAK1 and TRAF6, which resulted in decreased accumulation of macrophages within the plaque. However, Li et al. did not identify the recipient cells for the injected miR-146a mimetics, which is important based on the conflicting studies regarding cell specific NF-κB regulation on atherogenesis mentioned above. Furthermore, Sun et al. showed injection of mimetic could be delivered into ECs and intimal myeloid cells (264). While the potential athero-protective mechanism of miR-146a mimetic has not been completely clarified, these findings are encouraging for the future of miRNA-based therapies. The role of endogenous miR-146a remains unexplored.

1.5 RATIONALE AND OBJECTIVES

Atherosclerosis is a complex chronic disease manifested from the unresolved inflammatory responses initiated by accumulation of oxLDL within blood vessel walls. ECs are a key proponent to the initiation of atherogenesis by activating inflammatory programs to mediate circulating leukocyte recruitment to the growing plaque. As such, understanding the regulation of inflammatory pathways such as NF-κB signaling provides insight and potential strategies to intervene against inflammation-driven diseases like atherosclerosis. While the regulation of NF-κB signaling by miR-146a has been well documented in myeloid cells, the molecular activities of miR-146a in ECs remain unclear. Given there are alternative phenotypic outcomes for atherogenesis when antagonizing NF-κB signaling in different cell types, it is imperative to unravel cell specific effects mediated by miR-146a in atherosclerosis.

Thus, the aims of the thesis are as follows:

1. Examine the role of miR-146a in acute vascular inflammation.

2. Examine the role of miR-146a in a chronic inflammation model, namely hypercholesterolemia-mediated atherosclerosis in mice.

3. Distinguish the cell-specific role of miR-146a between myeloid cells and ECs during atherogenesis.

Collectively, these aims will address the role of miR-146a in experimental disease models and enrich our understanding of miR-146a biology in vascular diseases and inflammation. We hypothesize that endothelial miR-146a restrains inflammatory signaling during acute and chronic vascular inflammation.

Chapter 2

2 MicroRNA-146 Represses Endothelial Activation by Inhibiting Pro- inflammatory Pathways

The proceeding chapter has been published in full in the Journal of EMBO Molecular Medicine:

Cheng HS, Sivachandran N, Lau A, Boudreau E, Zhao J, Baltimore D, Delgaldo-Olguin P, Cybulsky M, Fish, JE (2013). MicroRNA‐146 represses endothelial activation by inhibiting pro‐ inflammatory pathways. EMBO molecular medicine, 5(7), 1017-34.

2.1 ABSTRACT:

Activation of inflammatory pathways in the endothelium contributes to vascular diseases, including sepsis and atherosclerosis. We demonstrate that miR-146a and miR-146b are induced in endothelial cells upon exposure to pro-inflammatory cytokines. Despite the rapid transcriptional induction of the miR-146a/b loci, which is in part mediated by EGR-3, miR-

146a/b induction is delayed and sustained compared to the expression of leukocyte adhesion molecules, and in fact coincides with the down-regulation of inflammatory gene expression. We demonstrate that miR-146 negatively regulates inflammation. Over-expression of miR-146a blunts endothelial activation, while knock-down of miR-146a/b in vitro or deletion of miR-146a in mice has the opposite effect. MiR-146 represses the pro-inflammatory NF-κB pathway as well as the MAP kinase pathway and downstream EGR transcription factors. Finally, we demonstrate that HuR, an RNA binding protein that promotes endothelial activation by suppressing expression of endothelial nitric oxide synthase (eNOS), is a novel miR-146 target. Thus, we uncover an important negative feedback regulatory loop that controls pro-inflammatory signaling in endothelial cells that may impact vascular inflammatory diseases.

36 37

2.2 INTRODUCTION:

The endothelium plays a central role in the pathogenesis of vascular inflammatory diseases such as sepsis (319) and atherosclerosis (2, 4). During sepsis, massive circulating levels of pro-inflammatory cytokines activate the endothelium and drive pathological increases in vascular permeability and tissue edema, which lead to acute organ dysfunction (319). Blocking endothelial activation can limit mortality in mouse models of sepsis (320). Endothelial activation also plays a pervasive role in atherosclerosis, a chronic vascular inflammatory disorder that is characterized by vessel narrowing, thrombosis and occlusion (2, 4). Cell-surface expression of leukocyte adhesion molecules such as vascular cell adhesion molecule-1 (VCAM-1), intercellular adhesion molecule-1 (ICAM-1) and E-Selectin, and secretion of chemokines such as monocyte chemoattractant protein-1 (MCP-1), facilitates the binding of circulating leukocytes to the blood vessel wall. Following egress into the intima, these cells mature into inflammatory macrophages, and their secretion of pro-inflammatory cytokines further promotes endothelial activation, and serves to drive a feed-forward loop that perpetuates leukocyte recruitment (4).

Identifying molecules that negatively regulate inflammatory pathways in the endothelium may provide novel therapeutic targets for the treatment of acute or chronic vascular inflammatory diseases.

Activation of pro-inflammatory transcriptional programs such as the NF-κB signaling pathway (71, 321, 322) and the mitogen-activated protein kinase (MAPK)/early growth response

(EGR) pathway (323-326) can cooperatively drive endothelial activation and vascular inflammation. Considering that prolonged or exaggerated inflammatory responses are detrimental, it is not surprising that cellular negative feedback loops act to control the duration

38 and intensity of an inflammatory response (321). For example, activation of the NF-κB pathway leads to the induction of IκB proteins, which bind to NF-κB proteins in the nucleus and exports them to the cytoplasm (327). EGR transcription factors also induce the expression of their own repressor proteins (328). In addition to feedback regulation at the level of transcription, microRNAs have recently been identified that serve in post-transcriptional negative feedback loops that modulate inflammatory signaling. MicroRNAs bind to the 3' UTRs of target mRNAs and inhibit their translation and/or stability (229). MiR-146a was previously found to be transcriptionally induced by NF-κB in response to activation of innate immune signaling in monocytes (295). MiR-146a targets the adaptor proteins TRAF6 and IRAK1/2 (295, 305, 329,

330) and miR-146a can inhibit activation of the NF-κB pathway (197, 329), suggesting that miR-

146a participates in a negative feedback loop to control NF-κB signaling in monocytes.

However, the function of miR-146a/b is poorly understood in endothelial cells.

We previously identified miR-146a and miR-146b as being highly enriched in endothelial cells isolated from differentiating embryonic stem cells (231). Herein we demonstrate that miR-

146a and miR-146b are enriched in endothelial cells in vivo and that they are strongly induced in endothelial cells in response to pro-inflammatory cytokines. We also identify a novel transcriptional pathway involving EGR proteins that participates in the induction of miR-146a and miR-146b. Through delayed induction kinetics miR-146a/b appear to act as negative feedback regulators of inflammatory signaling in endothelial cells. MiR-146 inhibits endothelial activation by dampening the activation of pro-inflammatory transcriptional programs, including the NF-κB, AP-1 and MAPK/EGR pathways, likely through regulation of IL-1β signaling pathway adaptor proteins (i.e. TRAF6, IRAK1/2). In addition, miR-146 acts to suppress endothelial activation by modulating post-transcriptional pro-inflammatory pathways via

39 targeting of the RNA binding protein HuR. We provide evidence that HuR facilitates endothelial activation by repressing expression of endothelial nitric oxide synthase (eNOS), a major source of nitric oxide, which potently inhibits leukocyte adhesion (331). Thus miR-146 represses both transcriptional and post-transcriptional activation of the inflammatory program. Our results reveal a potent anti-inflammatory action of miR-146a/b in the endothelium and suggest that therapeutic elevation of this microRNA family may be a useful treatment strategy for vascular inflammatory diseases, including sepsis and atherosclerosis.

2.3 MATERIALS AND METHODS:

Reagents used: Recombinant human IL-1β and TNF-α were from Invitrogen, and were used at a concentration of 10 ng/mL. Mouse recombinant IL-1β was from R&D Systems. The MAP kinase inhibitor, UO126, was from Sigma-Aldrich and was dissolved in DMSO and used at a concentration of 10 µM. L-NAME was purchased from Sigma-Aldrich and was used at a concentration of 0.1 mM.

Cell culture and treatments: Human umbilical vein endothelial cells (HUVEC) and media

(Endothelial Cell Medium with 5% FBS and Endothelial Cell Growth Supplement) were purchased from ScienCell. Bovine aortic endothelial cells (BAEC) and media were purchased from Lonza. Cells were used at passages 3-8. HeLa-S3 and THP-1 cells were purchased from

ATCC. HeLa cells were maintained in DMEM with 10% FBS and THP-1 cells were maintained in RPMI1640 with L-glutamine and 0.05 nM β-mercaptoethanol and 10% FBS.

Monocyte adhesion assay: THP-1 cells were labeled with CellTrackerTM Green (Invitrogen) immediately prior to the experiment. HUVEC were cultured to confluence in 12-well plates and were treated with IL-1β for 4 h. Labeled THP-1 cells (105) were then added to each well for 90 minutes and unbound cells were removed by washing with PBS. For experiments using L-

NAME, cells were treated with IL-1β and 0.1 mM L-NAME for 4 h, and THP-1 cells were allowed to adhere for 15 minutes. Adherent cells were fixed with 4% paraformaldehyde and

41 imaged using a Leica Microsystems inverted fluorescent microscope (Model #DMIL) with an

Olympus DP71 camera. Adherent THP-1 cells were quantified in 3 random fields of view per well using ImageJ. Triplicate wells were analyzed for each experiment.

Transfection: HUVEC were transfected at ~50% confluency with control or miR-146a mimics

(20 nM, Dharmacon), or scrambled control, EGR-3, HuR or TRAF6 siRNAs (Silencer Select s4544, 4390843, s4610 or s14389, respectively, 40 nM, Invitrogen) and analyzed after 24-72 h.

For inhibitor experiments, HUVEC were transfected at ~90% confluency with control or miR-

146a locked-nucleic acid (LNA) inhibitors (20 nM, Power Inhibitors, Exiqon) and analyzed 48-

72 h later. All HUVEC transfections were performed using RNAiMax (Invitrogen). HeLa cells were transfected with plasmids and microRNA mimics using Lipofectamine 2000 (Invitrogen).

Bioinformatic analysis of miR-146a and miR-146b proximal promoter regions: The genomic regions surrounding the miR-146a and miR-146b transcriptional start sites were assessed for the presence of Evolutionary Conserved Regions (ECRs) using ECR Browser

(http://ecrbrowser.dcode.org/), and rVista (http://rvista.dcode.org/) was used to identify conserved transcription factor binding sites.

Luciferase assays and cloning: Constructs containing the wild-type TRAF6 3' UTR or a TRAF6 3' UTR with one of the two miR-146 binding sites mutated (in pMIR-REPORT) were previously described (295). A 600-bp region of the 3' UTR of human EGR3, which contains the potential miR-146 binding site, was PCR amplified from HUVEC cDNA using the following primers: 5'-TAGAAGGAGAGAGAAGAAGATGAAGTTTGC and 5'-GAATTTCACC

TTTTCACAATATCAAGCATA (with XbaI linkers), and was cloned into the XbaI site located in the 3' UTR of pGL3-promoter (Promega). Similarly a 517-bp region of the 3' UTR of human HuR (ELAVL1) was amplified using the following primers: 5'-GAGGCGTAAAATGGCTCTGT and 5'-AGTTACAGGCTGGTGGCTTT (with XbaI linkers). The miR-146 seed match in the HuR 3' UTR (AGTTCTC) was mutated to (ACAAGAC) by site-directed mutagenesis (QuikChange II Kit, Agilent). To generate a luciferase construct that included a concatemer of the potential miR-146 binding site in the 3' UTR of EGR3, the following oligos (containing a 5' phosphate group) were synthesized: 5'-GGGAGTTTTCCTTTG TTTTAATAAAACTGTT CTCAGACATTA, 5'-CCTAATGTCTGAGAACAGTTTTATTAA AACAAAGGAAAACTC; miR-146 seed match underlined). These oligos were annealed together, ligated using T4 ligase (since they contain CC and GG over-hangs, respectively), and run on an agarose gel. The band corresponding to 5 copies of the sequence was gel purified, blunt-end filled using DNA polymerase and blunt-end cloned into the XbaI site of pGL3. Oligonucleotides containing a mutated miR-146 binding site were also cloned (5'-GGGAGTTTTCCTTTGTTTTAATAAA ACTGTAGACAGACATTA and 5'-CCTAATGTCTGTCTACAGTTTTATTAAAACAAAGGA AAACTC; mutated miR-146 seed match underlined). The sequence, directionality and the number of concatemers inserted were confirmed by DNA sequencing.

HeLa cells grown in 12-well dishes were transfected with 1 µg of luciferase construct, 100 ng of pRL Renilla luciferase construct (Promega) (for normalization of transfection efficiency), and 20 nM of control or miR-146a mimic (Dharmacon), using Lipofectamine 2000. Cellular lysates were isolated 24 h post-transfection using Passive Lysis Buffer and luciferase activity was monitored using the Dual Luciferase Reporter Assay System (Promega) using a GloMax 20/20 Luminometer (Promega).

A miR-146b promoter/reporter construct (containing a 1 kb fragment of the miR-146b proximal promoter) was a kind gift from Dr. E. Flemington (Tulane University Health Sciences Center). Site-directed mutagenesis was used to delete a putative EGR binding site 858-848 bp upstream of the mature miR-146b sequence using the following primers: 5'-GGGTTCCTG GCCCCCTTCCTCCTTTC and 5'-GAAAGGAGGAAGGGGGCCAGGAACCC. HeLa cells were transfected with 1 µg of wild-type or EGR-deleted miR-146b promoter/luciferase constructs together with a 0.5 µg of an empty or EGR3 expression construct (a kind gift from Dr. J.D. Powell (John Hopkins)) as above. A Renilla construct (100 ng) was co-transfected to control for

43 transfection efficiency. To analyze NF-κB activity, HUVEC were first transfected with control, miR-146a mimic, miR-146 inhibitor, TRAF6 or HuR siRNAs, and after 24 h the cells were electroporated with 1 µg of a 5x NF-κB element-luciferase reporter (Promega) and 0.5 µg of Renilla (to control for electroporation efficiency) using a Lonza 4D Nucleofector with the P5 Primary Cell Kit. After 24 h, cells were treated with 10 ng/mL of IL-1β for 6 h, and luciferase activity was assessed as above.

Gene expression analysis: RNA was isolated using Trizol (Invitrogen), reverse transcribed using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems), and quantitative

Reverse-Transcriptase PCR (qRT-PCR) was performed as described previously (332). For analysis of pri-miR-146a and pri-miR-146b, RNA was treated with DNase I (Ambion) to remove traces of genomic DNA. Real-time PCR was conducted in triplicate using a Roche Lightcycler

480® with Roche 480 Probes Master Mix or LC 480 SYBR Green I Master (Roche) for

Taqman® and Sybr green chemistries, respectively. Data was normalized to Tata box binding protein (TBP) or Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) using the Delta-Delta Ct method. The primers used are indicated in Supplemental Table 2.1.

MiR-146a and U6 were reverse-transcribed using the Taqman® MicroRNA Reverse

Transcription kit (Applied Biosystems) and analyzed using Taqman Primer sets (Applied

Biosystems). The miR-146a primer set did not cross react with miR-146b (<1% cross reactivity).

Since the miR-146b primer set from Applied Biosystems cross-reacted with miR-146a, we used the miScript system (Qiagen) for analysis of miR-146b. MiScript primers for miR-146b only partially cross-reacted with miR-146a (<20% cross reactivity). To quantify the number of copies of miR-146a and miR-146b, comparison was made to a standard curve generated by reverse transcribing a known amount of miR-146a or miR-146b mimic (Dharmacon). The MiScript

44 system was also used for the analysis of other microRNAs (miR-10a, miR-17, miR-31, miR-155 and miR-181b) in wild-type and miR-146a-/- hearts. Expression was normalized to miR-126.

HuR immunoprecipitation: HUVEC were harvested and lysed in RIPA buffer (Santa Cruz) containing protease inhibitors and 100U/mL RNAse OUT (Invitrogen). Protein-RNA complexes were isolated from 1.75 mg of total clarified protein with 5 µg of either HuR antibody (Santa

Cruz, G-8) or V5 antibody (Invitrogen) using 60 µL protein A/G beads (Santa Cruz) by rotating at 4oC for 4 h. Beads were washed 3x in RIPA buffer and resuspended in 1 mL Trizol

(Invitrogen), followed by RNA isolation.

Western blotting: Western blotting was performed as described (231). For analysis of phosphorylated ERK, HUVEC were serum starved overnight (in basal medium containing 0.1%

FBS) prior to stimulation with IL-1β (20 ng/mL). The following antibodies were used: phospho-

ERK (p42/44Thr202/Tyr204, Cell Signaling, 9101), ERK2 (Santa Cruz, C-14), E-Selectin (Santa

Cruz, H-300), ICAM-1 (Santa Cruz, G-5), TRAF6 (Santa Cruz, D-10), eNOS (Santa Cruz, C-

20), VCAM-1 (for human samples; Santa Cruz, E-10), Vcam-1 (for mouse samples; R&D

Systems, AF643), HuR (for human samples; Santa Cruz, G-8), HuR (for mouse samples; Santa

Cruz, 3A2), GAPDH (Santa Cruz, 0411), Actin (Sigma, A2066) and Vinculin (Santa Cruz, H-

300). HRP-conjugated secondary antibodies were from Cell Signaling or Santa Cruz, and blots were developed using SuperSignal West Pico Chemiluminescence Substrate (Pierce).

Enzyme-linked immunosorbent assay (ELISA): MCP-1 protein was quantified in supernatants using a Quantikine ELISA kit from R&D Systems, according to the manufacturer's recommendations.

Mouse experiments: All animal protocols were approved by the Animal Care Committee at the

University Health Network. Adult (3-4 months) wild-type and miR-146a-/- mice (on a C57/BL6 background) were injected with 100 µL of PBS or 125 ng of recombinant mouse IL-1β (in PBS) by intravascular injection. Hearts (including a portion of the ascending aorta) were harvested at 2 h or 4 h post-injection and processed for RNA analysis. For analysis of microRNA expression in the endothelium, endothelial cells were isolated from the vessel wall using a modified protocol

(13). Briefly, descending thoracic aortae were dissected, adipose tissue was removed, and aortae were pinned en face in ice-cold PBS containing 1 mM aurintricarboxylic acid (Sigma). Tissues were treated with 5U DNase I (Fermentas) and Liberase TM (1:100 in Ca2+/Mg2+-containing

PBS, Roche) for 8 min at 37oC. Intimal cells were visualized by overlaying 0.1 µM Fluoresbrite polystyrene microspheres (Polysciences). Intimal cells were scraped gently with a 30G needle and harvested directly into RNA extraction buffer (RNAqueous-micro kit, Invitrogen).

Endothelium-depleted vessel wall tissue was homogenized in RNA extraction buffer.

Immunostaining: Cryosections were stained as described (333). Primary antibodies were:

FITC-Pecam-1 (1:200) (BD Biosciences) and Vcam-1 (1:100) (Proteintech). Vcam-1 was detected by incubation with Alexa Fluor 647 Goat Anti-Rabbit (Invitrogen). Sections were imaged using an Eclipse Ni-U Nikon microscope and processed using NIS-Elements Imaging

Software.

Statistical analysis: Unless otherwise indicated, data represent the mean of at least three independent experiments and error bars represent the standard error of the mean. Pair-wise comparisons were made using a Student's t-test. Comparison of three or more groups was performed using a 1-way analysis of variance (ANOVA) with Newman-Keuls post-hoc test. A p value of less than 0.05 was considered to be statistically significant. In all figures *, ** and *** represent a p-value of <0.05, <0.01 and <0.001, respectively.

2.4 RESULTS:

Induction of miR-146a and miR-146b (miR-146a/b) by inflammatory stimuli in endothelial cells - Treatment of human umbilical vein endothelial cells (HUVEC) with the pro-inflammatory cytokine, IL-1β, induced the rapid induction of mRNAs encoding leukocyte adhesion molecules, such as VCAM-1, E-Selectin and ICAM1 (Fig. 2.1A). We next measured levels of miR-146a and miR-146b. Since miR-146a and miR-146b differ by only 2 nucleotides near their 3' ends, we designed primers that amplified only miR-146a or miR-146b (see Methods). We found that these microRNAs were dramatically induced in response to IL-1β treatment (Fig. 2.1B). Similar induction of miR-146a/b was observed following tumor necrosis factor-α (TNF-α) treatment

(Suppl. Fig. 2.1). MiR-146a/b levels were increased during the late stages of an inflammatory response (i.e. 8-72 hours (h) post-treatment), but levels were only modestly elevated at early stages (i.e. 1-4 h post-treatment) (Fig. 2.1B, Suppl. Fig. 2.1). Interestingly, the induction of miR-

146a/b coincided with the down-regulation of adhesion molecule genes (Fig. 2.1A,B).

Quantification of miR-146a/b levels revealed that miR-146a was expressed ∼9-fold higher than miR-146b in unstimulated cells, and ∼3-fold higher than miR-146b in IL-1β-treated cells (Fig.

2.1C). We next measured the transcription of the miR-146a and miR-146b genomic loci. MiR-

146a is processed from a two-exon non-protein coding mRNA transcript on chromosome 5, and we therefore measured unspliced pre-mRNA of this transcript as a surrogate of transcription (as we have done previously (332)). MiR-146b is processed from a single exon transcript on chromosome 10, and primers were designed to measure the levels of this transcript. We found that transcription of miR-146a and miR-146b were rapidly (within 1 h) and dramatically (40- and

20-fold, respectively) induced in response to IL-1β (Fig. 2.1D). The transcription of miR-146a

48 and miR-146b was sustained for the duration of IL-1β treatment. This is in contrast to VCAM-1,

SELE (E-Selectin) and ICAM-1 mRNA, which were down-regulated after 8 h of IL-1β treatment.

Despite the rapid transcription of the miR-146a and miR-146b genes, delayed expression of mature microRNAs implies inefficient or delayed processing of miR-146a/b in cytokine- stimulated endothelial cells.

A VCAM-1 SELE ICAM-1

B C mature miR-146a mature miR-146b control 72 h IL-1β

mature mature miR-146a miR-146b D pri-miR-146a pri-miR-146b

Cheng et al_Figure 1 49

Figure 2.1: MiR-146a and miR-146b are induced in response to interleukin-1β (IL-1β) treatment of endothelial cells.

(A) Levels of pro-inflammatory genes (VCAM-1, SELE (E-Selectin), ICAM1) were measured in

IL-1β-treated human umbilical vein endothelial cells (HUVEC) by quantitative reverse transcriptase real-time PCR (qRT-PCR), revealing that these inflammatory genes were rapidly induced by IL-1β, but decreased by 24 hours (h). Data represent the mean ± SEM of 3 independent experiments. (B) Levels of mature miR-146a and miR-146b were assessed by qRT-

PCR (n = 3). MiR-146a/b were dramatically increased following prolonged treatment with IL-

1β. (C) The copy numbers of miR-146a and miR-146b were quantified in non-stimulated (NS) and 72 h IL-1β-treated endothelial cells (n = 3). (D) Assessment of the primary transcripts (pri- cursors), pri-miR-146a and pri-miR-146b, by qRT-PCR demonstrated rapid transcriptional up- regulation, which mirrored that of other inflammatory genes (n = 5). The transcription of miR-

146a/b appeared to be sustained during prolonged inflammation.

MiR-146a/b expression is sustained following removal of pro-inflammatory cytokines - To determine the stability of the IL-1β-mediated induction of miR-146a/b we treated endothelial cells with IL-1β for 24 h and then removed the cytokine. In contrast to inflammatory genes such as VCAM-1 and SELE, which were rapidly down-regulated upon removal of IL-1β (Fig. 2.2A), miR-146a/b remained elevated for more than 2 days (Fig. 2.2B). MiR-146b expression was especially long-lived. While the levels of pri-miR-146a decreased following the removal of IL-

1β, levels of pri-miR-146b remained unchanged, suggesting that the transcription of the miR-

146b locus is maintained following the removal of pro-inflammatory cytokines (Fig. 2.2C). The

50 induction of miR-146a/b by IL-1β therefore appears to be highly stable, even in the absence of the initiating stimulus.

* * * * * *

Relative mRNA Expression Relative mRNA NS 0 24 48 72

NS 0 24 48 72 Relative miRNA Expression Relative miRNA

* * *

NS 0 24 48 72 Relative pri-miRNA Expression Relative pri-miRNA

Figure 2.2: MiR-146a and miR-146b expression is sustained after the removal of IL-1β. Cheng et al_Figure 2

Endothelial cells were treated with IL-1β for 24 h, after which IL-1β was removed. Levels of

VCAM-1 and SELE (A), mature miR-146a/b (B) and pri-miR-146a/b (C) were monitored at various time-points after the removal of IL-1β by qRT-PCR. While VCAM-1 and SELE rapidly

51 returned to base-line levels, miR-146a/b levels remained elevated. The transcription of miR-146a decreased by 24 h after removal of IL-1β, while transcription of miR-146b was sustained in the absence of IL-1β. Data represents the mean ± SEM of 3 independent experiments. Statistical analyses were performed using t-test to compare post-IL-1β removal time-points to 24 h of IL-1β treatment (i.e. time zero). Significant p-values (from left to right) in (A) are 0.0004, <0.0001,

0.0004, <0.0001, 0.0006 and 0.0001, respectively. p-value in (B) is 0.0049. p-values is (C) are

0.012, 0.001 and 0.001, respectively.

Over-expression of miR-146a inhibits the endothelial inflammatory response - To assess the function of elevated levels of miR-146 in endothelial cells, we over-expressed miR-146a via transfection of miR-146a mimic. Over-expression of miR-146a in HUVEC resulted in decreased expression of TRAF6 (Fig. 2.3A), a known target of miR-146 (295). Next we assessed the expression of several pro-inflammatory genes (VCAM-1, ICAM-1, SELE and MCP-1) by qRT-

PCR, and found that the basal levels of these mRNAs were suppressed in unstimulated miR-146a over-expressing cells (Fig. 2.3B, left). Importantly, miR-146a over-expression also dampened the induction of these inflammatory genes in response to IL-1β treatment (Fig. 2.3B, right).

Nitric oxide (NO) generated by eNOS potently inhibits leukocyte adhesion to the endothelium

(331), and eNOS (NOS3) is known to be transcriptionally (334) and post-transcriptionally (335) repressed following treatment of endothelial cells with pro-inflammatory cytokines. The level of

NOS3 mRNA in unstimulated cells over-expressing miR-146a was elevated (Fig. 2.3B, left).

After 8 h of IL-1β treatment, NOS3 mRNA was decreased by 45.0 ± 6.5% (p=0.004, not shown).

Over-expression of miR-146a blunted this IL-1β-dependent decrease in NOS3 mRNA levels

(Fig. 3B, right). Western blotting confirmed that the induction of VCAM-1, E-Selectin and

ICAM-1 protein was inhibited in miR-146a over-expressing cells (Fig. 2.3C), and that the loss of eNOS expression was blunted (Fig. 2.3D). Consistent with a reduction in inducible adhesion molecule expression and an increase in eNOS protein, miR-146a over-expression in HUVEC reduced the number of THP-1 monocytes that adhered to IL-1β-treated endothelial cells (Fig.

2.3E). Over-expression of miR-146a in aortic endothelial cells also inhibited leukocyte adhesion

(Suppl. Fig. 2.2), suggesting that miR-146a broadly represses endothelial activation. MiR-146a therefore inhibits the endothelial inflammatory response, including the induction of adhesion molecules and chemoattractants and the loss of eNOS expression.

B A unstimulated IL-1β treated control mimicmiR-146amimic 1.0 0.1 densitometry TRAF6

GAPDH C - 2h 4h - 2h 4h IL-1β

0.1 0.3 1.0 0.1 0.1 0.6 densitometry VCAM-1

0.0 0.2 1.0 0.0 0.0 0.4 E-Selectin D - 8h 24h - 8h 24h IL-1β 0.0 0.1 1.0 0.0 0.2 0.5 1.0 0.8 0.3 1.1 0.9 0.6 densitometry ICAM-1 eNOS

GAPDH GAPDH

control mimic miR-146a mimic control mimic miR-146a mimic E control mimic control mimic (NS) miR-146a mimic (NS) miR-146a mimic

control mimic (IL-1β) miR-146a mimic (IL-1β)

NS NS IL-1β IL-1β

Figure 2.3: MiR-146a over-expression represses the endothelial inflammatory response.

(A) MiR-146a was over-expressed in endothelial cells by transfectionCheng of miR et-146a al_Figure mimic and 3 levels of a known target of miR-146, TRAF6, were assessed by western blot. GAPDH was used as a loading control and densitometry is indicated above. A representative experiment is shown.

(B) Expression of TRAF6 (white bar), inflammatory genes (VCAM-1, ICAM1, SELE (E-

Selectin), and MCP-1; black bars), as well as NOS3 (eNOS) (grey bar), were measured in unstimulated (left) and IL-1β-stimulated cells (right) by qRT-PCR. For inflammatory genes, gene expression was analyzed 1.5 h after addition of IL-1β, while NOS3 was assessed after 8 h.

Data is presented as mRNA levels in miR-146a mimic-transfected cells compared to control mimic-transfected cells, with the dotted line indicating a ratio of 1 (i.e. no change) (n = 4). p- values (t-test) from left to right are 0.031, 0.023, 0.0002, 0.0001, 0.002, 0.014, 0.006, 0.012,

0.012, 0.006, 0.011 and 0.045, respectively. (C) Western blotting was performed to measure expression of VCAM-1, E-Selectin and ICAM-1 protein in control and miR-146a mimic- transfected cells. Densitometry is indicated. (D) Western blotting of eNOS protein was performed in control and miR-146a mimic-transfected cells. (E) Adhesion of the mononuclear cell line, THP-1, to unstimulated and IL-1β-treated endothelial cells transfected with control or miR-146a mimic was visualized (left) and quantified (right), revealing a strong anti-adhesive effect of miR-146a over-expression. Scale bar is 200 µm. Shown is a representative experiment

(mean ± SEM) with 3 replicate wells and 3 images per well for each condition. ANOVA, p<0.0001. *** indicates a significant difference between IL-1β-treated control and miR-146a mimic-transfected cells, p<0.001.

Endogenous miR-146 inhibits the endothelial inflammatory response - We next utilized a miR-

146 locked-nucleic acid (LNA) inhibitor to assess the function of endogenous miR-146 in endothelial cells. In addition to reducing the level of mature miR-146a by 81.7 ± 6.5%, this inhibitor also reduced the level of miR-146b by 92.5 ± 2.7% (not shown), likely owing to the

55 limited (two nucleotide) difference in sequence between miR-146a and miR-146b. Treatment with miR-146 inhibitor elevated the level of the miR-146 target, TRAF6 (Fig. 2.4A).

Additionally, miR-146 inhibitor increased the basal levels of VCAM-1 mRNA, and had a potent affect on the IL-1β-inducible expression of VCAM-1, ICAM-1, SELE and MCP-1 (Fig. 2.4B).

Endogenous miR-146 appeared to restrain the intensity as well as the duration of the inflammatory response, since these inflammatory genes remained at elevated levels 24 h after IL-

1β treatment (Fig. 2.4B). In addition, the decrease in eNOS (NOS3) mRNA that was observed after a 24 h treatment with IL-1β was augmented by miR-146 inhibitor (Fig. 2.4C). Western blotting confirmed that the loss of eNOS protein in response to IL-1β treatment was enhanced by miR-146 inhibition (Fig. 2.4D) and that IL-1β-inducible VCAM-1, E-Selectin and ICAM-1 protein expression was greatly enhanced by miR-146 inhibition (Fig. 2.4E). Finally, inhibition of miR-146 in endothelial cells enhanced the adhesion of THP-1 monocytes following IL-1β treatment (Fig. 2.4F).

A B control inhibitor miR-146 inhibitor control miR-146 inhibitorinhibitor VCAM-1 ICAM-1 1.0 6.0 densitometry TRAF6

GAPDH

0 1 4 8 24 0 1 4 8 24 C NOS3 (eNOS) IL-1β treatment (hours) IL-1β treatment (hours) SELE MCP-1

0 1 4 8 24 0 1 4 8 24

control IL-1β treatment (hours) IL-1β treatment (hours) miR-146 inhibitorinhibitor D - 4h 8h 24h - 4h 8h 24h IL-1β F 1.0 0.5 0.4 0.4 0.5 0.4 0.3 0.0 densitometry control inhibitor (NS) miR-146 inhibitor (NS) eNOS

GAPDH

control miR-146 inhibitor inhibitor control inhibitor (IL-1β) miR-146 inhibitor (IL-1β) E - 4h 8h 24h - 4h 8h 24h IL-1β 0.0 1.0 1.7 1.2 0.0 5.2 5.4 1.9 densitometry VCAM-1

0.0 1.0 0.4 0.0 0.0 14 8.9 0.0 control inhibitor E-Selectin miR-146 inhibitor

0.0 1.0 1.2 0.7 0.1 1.0 1.6 3.5 ICAM-1

GAPDH

NS NS control miR-146 IL-1β IL-1β inhibitor inhibitor Cheng et al_Figure 4 Figure 2.4: Endogenous miR-146 restrains endothelial activation.

(A) Endothelial cells were transfected with a miR-146 LNA inhibitor (which reduces levels of miR-146a and miR-146b by >80%), and the level of a known target of miR-146, TRAF6, was measured by western blot. (B) The expression of inflammatory genes (VCAM-1, ICAM-1, SELE, and MCP-1) in unstimulated and IL-1β-stimulated cells was assessed by qRT-PCR. Data represents mean ± SEM of 3 independent experiments. Significant p-values (t-test) are indicated above. (C) Levels of NOS3 mRNA were assessed by qRT-PCR in control inhibitor and miR-146 inhibitor transfected cells after 24 h of IL-1β treatment (n = 3). Data is expressed relative to untreated cells. * denotes a significant difference between groups, p<0.05. (D) Levels of eNOS protein were measured in control and miR-146 inhibitor transfected cells. (E) Western blotting was performed to measure VCAM-1, E-Selectin and ICAM-1 protein expression in control inhibitor and miR-146 inhibitor transfected cells. (F) Monocyte adhesion assays were performed in control and miR-146 inhibitor transfected endothelial cells. Representative images are shown

(above) and quantification of a representative experiment (3 replicate wells, 3 images per well) is shown (below). Scale bar is 200 µm. ANOVA, p<0.0001. *** indicates a significant difference between IL-1β-treated control and miR-146 inhibitor-transfected cells, p<0.001.

MiR-146 negatively regulates the NF-κB, AP-1 and MAPK/Early growth response (EGR) pathways - MiR-146 targets TRAF6, IRAK1 and IRAK2 (295, 330), which are key adaptor molecules of the IL-1β signal transduction pathway. Several signaling pathways are activated downstream of TRAF6/IRAK1/2 including the NF-κB, p42/p44 MAPK and JNK/AP-1 pathways. We found that miR-146a over-expression inhibited the IL-1β-mediated induction of an NF-κB-dependent reporter in endothelial cells, while inhibiting miR-146 enhanced NF-κB

58 activity in response to IL-1β treatment (Fig. 2.5A). In addition, we assessed the activation of the p42/p44 MAPK pathway by measuring the levels of phosphorylated ERK (pERK). Levels of pERK were reduced in unstimulated miR-146a over-expressing cells, and the induction of pERK in response to IL-1β was also inhibited (Fig. 2.5B, top). In contrast, pERK levels were enhanced in cells treated with miR-146 inhibitor (Fig. 2.5B, bottom). EGR transcription factors are induced downstream of MEK (MAPKK) in the p42/p44 MAPK pathway (336). We assessed the expression of EGR-1 and EGR-3 in response to IL-1β treatment and found that EGR-1 and EGR-

3 were potently induced after only 1 h of IL-1β, and that EGR-3 was induced to a greater extent than EGR-1 (Fig. 2.5C). Consistent with the reduced levels of pERK, we found that miR-146a over-expression inhibited the activation of EGR-1 and EGR-3 mRNA in response to IL-1β, while inhibition of miR-146 enhanced the induction of EGR-3 mRNA (Fig. 2.5D). Interestingly, we found that EGR-3 was a predicted target of miR-146 (Fig. 2.5E). To determine whether miR-146 could directly repress EGR-3 we performed luciferase assays in which a region of the EGR-3 3'

UTR or a concatemer of the predicted miR-146 binding site in the EGR-3 3' UTR, were inserted downstream of the luciferase open reading frame (ORF). As a control, we assessed luciferase activity of constructs bearing the TRAF6 3' UTR. While TRAF6 luciferase reporters were highly repressed in response to miR-146a over-expression (Fig. 2.5E), EGR-3 3' UTR (Suppl. Fig. 2.3) or concatemer constructs (Fig. 2.5E), were refractory to miR-146-mediated repression. This suggests that miR-146 does not directly target EGR-3, but that it instead represses activation of

EGR proteins via inhibition of upstream signal components (i.e. TRAF6/IRAK1/2). Finally, the activation of the AP-1 pathway also appeared to be modestly inhibited by miR-146 since the IL-

1β-mediated induction of c-Fos was reduced in cells over-expressing miR-146a, while the induction of c-Jun was enhanced when miR-146 was inhibited (Fig. 2.5F).

A NF-κB promoter-reporter B - 15’ 30’ - 15’ 30’ IL-1β 1.0 2.7 1.2 0.6 1.2 0.5 densitometry control mimic control inhibitor miR-146a mimic miR-146 inhibitor pERK

ERK

control mimic miR-146a mimic - 15’ 30’ - 15’ 30’ IL-1β 1.0 1.9 1.3 1.6 3.0 1.6 densitometry pERK

ERK Relative Luciferae Activity Relative Luciferae NS IL-1β Activity Relative Luciferae NS IL-1β

control inhibitor miR-146 inhibitor

C D 1h IL-1β

EGR-1 EGR-1 EGR-3 EGR-3 Relative mRNA Expression Relative mRNA

E 3’-UUGGGUACCUUAAGUCAAGAGU-5’ miR-146a F 5’--TGTTTTAATAAAACTGTTCTCAG--3’ EGR-3 1h IL-1β Wild-type 3’ UTR c-Fos Mutant 3’ UTR c-Jun

EGR-3 TRAF6

Figure 2.5: MiR-146 inhibits the induction of NF-κB, MAPK/EGRCheng and AP et -al1 pathways._Figure 5

(A) The activity of a NF-κB promoter-luciferase reporter construct was assessed in endothelial cells transfected with control mimic, miR-146a mimic, control inhibitor or miR-146 inhibitor.

MiR-146a over-expression reduced IL-1β-induced NF-κB-dependent promoter activity, while inhibition of miR-146 enhanced activity. Data represents the mean ± SEM of 3 independent experiments. ANOVA, p<0.0001 for mimic and inhibitor data. ** and *** indicate a significant difference between the indicated groups, p<0.01 and p<0.001, respectively. (B) Activation of the

MAP kinase pathway was assessed by measuring the levels of phosphorylated ERK (pERK)

(p42/p44). Total levels of ERK2 were used as a loading control. MiR-146a over-expression inhibited the basal and IL-1β-induced levels of pERK, while miR-146 inhibitor had the opposite effect. (C) Induction of EGR-1 and EGR-3 in response to IL-1β was assessed by qRT-PCR, demonstrating rapid and transient induction (n = 3). (D) MiR-146a over-expression inhibited the

IL-1β-mediated induction of EGR-1 and EGR-3, while inhibition of miR-146 enhanced the induction of EGR-3 (n = 3). Significant p-values (t-test) from left to right are 0.002, 0.004 and

0.022, respectively. (E) Schematic of a potential miR-146 binding site in the 3' UTR of EGR-3

(top). Luciferase assays utilizing wild-type or seed-mutated EGR-3 concatemer or TRAF6 3'

UTR sequences were performed in the presence of control or miR-146a mimic (p=0.042, t-test, n

= 3). (F) Activation of the JNK/AP-1 pathway was assessed by measuring the induction of c-Fos and c-Jun by qRT-PCR. MiR-146a over-expression reduced c-Fos expression, while inhibition of miR-146 enhanced c-Jun expression in response to IL-1β (n = 4). Significant p-values (t-test) from left to right are 0.005, 0.024, respectively.

EGR proteins control the transcription of the miR-146a/b genes - Our data suggests that miR-

146a and miR-146b may participate in a negative feedback loop in endothelial cells to restrain

61 endothelial inflammation. MiR-146a is known to be NF-κB-responsive, while miR-146b is not

(337). We found that miR-146a can repress the NF-κB signaling pathway (Fig. 2.5A), revealing a miR-146a/NF-κB negative regulatory loop that acts to restrain inflammation in endothelial cells. To test whether a miR-146-mediated negative feedback loop might also involve EGR proteins, we antagonized the EGR pathway to assess if this pathway mediates the transcription of miR-146a/b. Inhibition of the MAP kinase pathway with the MEK inhibitor, U0126, repressed the rapid induction of EGR-3 following a 1 h treatment with IL-1β (Fig. 2.6A) and inhibited the induction of pri-miR-146a and pri-miR-146b at the same time-point (Fig. 2.6B). Since EGR-3 is induced downstream of the MAP kinase pathway, which is regulated by miR-146 (Fig. 5B), we tested whether EGR-3 might be involved in the IL-1β-induced transcription of these microRNAs. Knock-down of EGR-3 by siRNA (Fig. 2.6C) inhibited the transcription of both pri-miR-146a and pri-miR-146b in response to IL-1β (Fig. 2.6D). To define the cis elements that mediate this effect, we examined evolutionarily conserved regions (ECRs) surrounding the miR-

146a and miR-146b genes for conserved EGR binding sites. No conserved EGR sites were found in the ECRs surrounding the promoter of miR-146a (10 kb up- and down-stream of the transcriptional start site of pri-miR-146a), suggesting that the EGR site(s) that mediate induction of miR-146a transcription may act at a distance or act through a non-conserved or non-canonical

EGR site. However, a conserved EGR site was identified in the miR-146b promoter (858-848 nucleotides upstream of the mature miR-146b sequence; chr.10:104,195,419-104,195-428, Fig.

2.6E). The transcriptional start site of pri-miR-146b is ∼700 nucleotides upstream of the miR-

146b mature sequence (295). This would place this EGR site in the proximal promoter of miR-

146b. Over-expression of EGR-3 resulted in robust induction of a miR-146b proximal promoter/reporter construct (296), and mutation of the conserved EGR binding site in the miR-

146b promoter (Fig. 2.6F) eliminated this induction (Fig. 2.6G). Furthermore, the miR-146b

62 promoter was moderately responsive to IL-1β stimulation, and this effect was completely abrogated when the EGR binding site was mutated (Fig. 2.6H). Taken together these data suggest that activation of the MAP kinase/EGR pathway regulates the transcription of the miR-146a/b loci, and that miR-146 can in turn repress the MAPK/EGR pathway; thereby forming a negative feedback loop.

A DMSO B C control siRNA D U0126 EGR-3 siRNA 1h IL-1β 1h IL-1β EGR-3 EGR-3 siRNA vs control) siRNA (U0126 vs DMSO) Relative Fold Induction Relative Fold Induction EGR-3 (

Relative mRNA Expression Relative mRNA NS 1h IL-1β Expression Relative mRNA NS 1h IL-1β

E miR-146b genomic locus: ------TTCCTGGCCCTCCCACACCTTCCTCCTTTCTCAGAAGAGCCAGCATGGGGC human ------TGCCCGGCCCTCCCACACCTTCCTCCTTTCTCAGAAGAGCCAGGATGGGGC cow ------TGCCCAGCCCTCCCACACCTTCCTCCTTTCTCAGAAGAGCCAGGATGGGGC dog GGCAGCATGCCCGGTCCTCCCACACCTTCCTCCTTTCTCAGAAGAGCCTGCATGG--- mouse GGCAGCATGCCCGGTCCTCCCACACCTTCCTCCTTTCTCAGAAGAGCCTGCATGG--- rat * ** * * *** ** *** ********* ** **** * * * * * * * ** * *** * EGR binding site

F G miR-146b prom- H miR-146b prom-luciferase luciferase wild-type miR-146b promoter EGR deletion

cCTCCCACACCt WT

cC------CCt EGR Fold Induction deletion (EGR-3 OE vs control)

Relative Luciferase Activity Relative Luciferase NS NS EGR IL-1β IL-1β wild-type deletion

Figure 2.6: The MAPK/EGR pathway regulates the transcription of miR-146a and miR- 146b. Cheng et al_Figure 6 (A) Treatment of endothelial cells with the MEK inhibitor, U0126, inhibited the basal expression (t-test, p=0.0003) and IL-1β-dependent induction (t-test, p=0.037) of EGR-3 (n = 3).

(B) Induction of pri-miR-146a and pri-miR-146b by IL-1β was reduced in cells pre-treated with the MAP kinase inhibitor, U0126. Data represents the relative induction of pri-miR-146a/b in cells treated with U0126 compared to cells treated with DMSO (vehicle) (n = 4). p=0.037 for pri-miR-146a and p=0.010 for pri-miR-146b (t-test). (C) EGR-3 knock-down by siRNA transfection reduced the basal (t-test, p<0.0001) and IL-1β-induced levels (t-test, p=0.004) of

EGR-3 (n = 5). (D) The induction of pri-miR-146a and pri-miR-146b was also reduced in EGR-3 knock-down cells (n = 5). p=0.023 for pri-miR-146a and p=0.013 for pri-miR-146b (t-test). (E)

Schematic indicating a potential EGR binding site (shaded area) in the miR-146b promoter.

Sequence comparison between various species is indicated. Asterisks indicate conserved nucleotides across all species. (F) Schematic of deletion of the EGR binding site in the miR-146b promoter. (G) A miR-146b promoter-luciferase reporter was responsive to EGR-3 over- expression (OE) in bovine aortic endothelial cells (BAEC) and mutation of a conserved EGR binding site abrogated this responsiveness. Data depicts the fold induction with EGR-3 OE compared to control. Shown is a representative experiment (n = 3 replicates). p=0.0017 (t-test).

(H) A miR-146b promoter-luciferase reporter was modestly induced in response to IL-1β and this induction was not observed when the EGR site was mutated. IL-1β was added at concentrations of 10, 20 or 40 ng/mL. Shown is a representative experiment (n = 3 replicates).

ANOVA, p=0.011. * and ** indicate a significant difference between the indicated groups, p<0.05, p<0.01, respectively.

MiR-146 targets the RNA-binding protein HuR to control endothelial activation - HuR was previously found to promote endothelial activation in response to LPS treatment of endothelial cells by facilitating NF-κB activation (338). Interestingly, microRNA target prediction programs

(Targetscan and Pictar) suggested that HuR might be a direct target of miR-146 (Fig. 2.7A,

Suppl. Fig. 2.4). We confirmed that luciferase constructs containing the HuR 3' UTR could be repressed by miR-146a (Fig. 2.7B), and also found that levels of HuR mRNA (Suppl. Fig. 2.5) and protein (Fig. 2.7C) were suppressed or elevated when miR-146 was over-expressed or knocked-down in endothelial cells, respectively. To test the functional importance of HuR in IL-

1β-mediated endothelial activation, we knocked down HuR and measured the adhesion of THP-1 cells to endothelial cells. HuR knock-down inhibited THP-1 adhesion to IL-1β treated endothelial cells (Fig. 2.7D). Additionally, HuR knock-down also inhibited THP-1 adhesion to

TNF-α treated cells (Suppl. Fig. 2.6), suggesting that HuR broadly facilitates endothelial activation. To assess the contribution of HuR to the enhanced adhesiveness of miR-146 inhibitor- treated endothelial cells, we knocked-down HuR, and were able to block the increase in THP-1 adhesion (Fig. 2.7E). Interestingly, VCAM-1, ICAM-1, SELE and MCP-1 contain AU-rich elements (AREs) in their 3' UTRs (Suppl. Fig. 2.7). Since AREs can confer instability to transcripts that is antagonized by HuR binding to these sites (339), we tested whether HuR could regulate the expression of these inflammatory genes. While VCAM-1 and MCP-1 were highly enriched in HuR immunoprecipitates from IL-1β-treated cells (Suppl. Fig. 2.8A), HuR knock- down failed to affect the induction of VCAM-1 or MCP-1 at the mRNA or protein level (Fig.

2.7F, Suppl. Fig. 2.8B,C, Suppl. Fig. 2.9B), suggesting that they are not functional targets of

HuR. Additionally, we found that NF-κB activity was not altered by HuR knock-down (Suppl.

Fig. 2.8D), neither was the induction of EGR-3 (Suppl. Fig. 2.9B). This was in contrast to knock- down of another miR-146 target, TRAF6, which decreased NF-κB activity (Suppl. Fig. 2.8D), the induction of adhesion molecules and EGR transcription factors (Fig. 2.7F, Suppl. Figs. 2.9B).

In contrast to the lack of regulation of adhesion molecules, eNOS mRNA and protein levels were elevated in HuR knock-down cells and eNOS failed to be down-regulated in response to IL-1β

(Fig. 2.7F,G). Knock-down of TRAF6 did not affect the basal levels of NOS3 mRNA, but did inhibit the down-regulation of NOS3 in response to IL-1β (Fig. 2.7F). Finally, inhibition of nitric oxide activity by treatment with L-NAME rescued the reduction in adhesion in HuR knock-down cells (Fig. 2.7H), suggesting that HuR regulates endothelial activation by modulation of NO activity. These results suggest that the miR-146 targets, TRAF6/IRAK1/2 and HuR cooperate to control endothelial activation through distinct pathways. While TRAF6/IRAK1/2 affects NF-κB transcriptional activity and the induction of leukocyte adhesion molecules and chemokines, HuR affects NO-dependent leukocyte adhesion.

A 3’-UUGGGUACCUUAAGUCAAGAGU-5’ miR-146a D E control siRNA control siRNA 5’--AAGAUUAACCCUCAAAGUUCUCU--3’ HuR HuR siRNA HuR siRNA + IL-1β B control mimic 4 miR-146a mimic 1.5 3

1.0 * 2 1 0.5

0 0 Relative # of Cells Adhered Relative # of Cells Relative # of Cells Adhered Relative # of Cells HuR WT HuR Mut NS NS

Relative Luciferase Activity Relative Luciferase IL-1β IL-1β 3’ UTR 3’ UTR

control inhib miR-146miR-146 inhib inhib C - 8h 24h - 8h 24h IL-1β - 4h 8h 24h - 4h 8h 24h IL-1β 1.0 0.8 0.6 0.5 0.6 0.5 densitometry 1.0 0.6 0.9 0.7 1.4 1.7 1.9 2.2 densitometry HuR HuR

GAPDH GAPDH

control mimic miR-146a mimic control inhibitor miR-146 inhibitor

F control siRNA HuR siRNA G VCAM-1 NOS3 - 4h 8h - 4h 8h IL-1β * 1.0 0.8 0.5 1.3 1.3 1.5 densitometry * eNOS

* GAPDH HuR

control siRNA HuR siRNA 0 2 4 8 24 0 2 4 8 24 Relative mRNA Expression Relative mRNA IL-1β treatment (hours) Expression Relative mRNA IL-1β treatment (hours) control siRNA H HuR siRNA control siRNA TRAF6 siRNA + IL-1β VCAM-1 NOS3

* * * * *

0 2 4 8 24 0 2 4 8 24 Adhered Relative # of Cells Relative mRNA Expression Relative mRNA IL-1 treatment (hours) Expression Relative mRNA IL-1 treatment (hours) β β controlcontrol L-NAME Cheng et al_Figure 7 Figure 2.7: HuR, a novel miR-146 target, controls endothelial activation by regulating eNOS expression.

(A) Schematic of a potential miR-146 binding site in the 3' UTR of HuR. (B) Luciferase assays utilizing wild-type or seed-mutated HuR 3' UTR sequences were performed in the presence of control or miR-146a mimic (mean ± SEM, p=0.008, t-test, n = 4). (C) HuR protein levels were quantified by western blot in cells transfected with control or miR-146a mimic (left) or control or miR-146 inhibitor (right). (D) The adhesion of THP-1 cells to vehicle or IL-1β treated cells transfected with control or HuR siRNAs revealed that HuR promotes endothelial activation. A representative experiment is shown (3 replicate wells, 3 images per well). ANOVA, p<0.0001.

*** indicates a significant decrease in THP-1 adhesion in IL-1β-treated HuR knock-down cells, p<0.001. (E) THP-1 adhesion assays were performed with endothelial cells transfected with control or miR-146 inhibitor and control or HuR siRNA. HuR knock-down reduced the elevated adhesion of THP-1 to endothelial cells transfected with miR-146 inhibitor. A representative experiment is shown (3 replicate wells, 3 images per well). ANOVA = 0.016. * indicates a significant difference between indicated groups, p<0.05. (F) Knock-down of HuR (above) or

TRAF6 (below) was performed and the induction of adhesion molecules (typified by VCAM-1) and eNOS (NOS3) was assessed by qRT-PCR. Expression of other inflammatory genes is indicated in Fig. S9B. HuR knock-down did not reduce the induction of VCAM-1, in contrast to

TRAF6 knock-down, which strongly inhibited VCAM-1 induction. However, HuR knock-down significantly elevated levels of NOS3. Shown is the mean ± SEM of 3 independent experiments.

Significant p-values (t-test) are indicated above. (G) Levels of eNOS protein were elevated in

HuR knock-down cells, and eNOS was not down-regulated in HuR knock-down cells treated with IL-1β. (H) The nitric oxide inhibitor, L-NAME, negated the reduced THP-1 adhesion observed in HuR knock-down cells. A representative experiment is shown (3 replicate wells, 3 images per well). ANOVA, p<0.0001. *** indicates a significant difference between groups, p<0.001.

MiR-146a knock-out mice have an exaggerated acute vascular inflammatory response -

Assessment of miR-146a/b expression in blood vessels revealed that this microRNA family is enriched in the endothelium compared to cells in the vascular wall (Fig. 2.8A). To assess the role of miR-146a in controlling endothelial activation in vivo, we utilized miR-146a-/- mice (198).

MiR-146a-/- mice on a C57/BL6 background are phenotypically normal at birth, but develop chronic inflammation, including myeloproliferation in the spleen and bone marrow and enlarged spleens beginning around 5-6 months of age (197). We therefore utilized young mice (3-4 months of age) for our experiments, since they do not appear to have an overt inflammatory phenotype. MiR-146a was expressed at much higher levels than miR-146b in the heart, and loss of miR-146a did not affect expression of miR-146b, suggesting that miR-146b is likely unable to compensate for loss of miR-146a (Fig. 2.8B). Additionally, we assessed the expression of several other microRNAs that are known to modulate inflammatory signaling, and found that these were not appreciably altered in miR-146a-/- mice (Suppl. Fig. 2.10). Similar to our findings using miR-

146 inhibitors in vitro, we found that levels of HuR mRNA and protein were increased in the hearts of miR-146a-/- mice (Fig. 2.8C), suggesting that HuR is also a target of miR-146a in vivo.

Levels of TRAF6 protein were also highly elevated (Fig. 2.8C). To determine the role of miR-

146a in the regulation of an acute vascular inflammatory response, wild-type and miR-146a-/- mice were injected with PBS or IL-1β and the expression of several inflammatory genes were measured in harvested hearts. We found that the basal expression of these genes in PBS-injected mice was not altered in miR-146a-/- mice compared to wild-type mice (Fig. 2.8D). However, miR-146a-/- mice had enhanced expression of Vcam-1, Icam-1, Sele, Mcp-1, Egr-1 and Egr-3 in response to a 2 h IL-1β treatment, and Icam-1 and Sele remained significantly elevated at 4 h

(Fig. 2.8D). In contrast to markers of endothelial activation, levels of eNOS (Nos3) mRNA tended to be lower in miR-146a-/- mice, although this difference did not reach statistical significance, and no difference was observed following IL-1β treatment (Suppl. Fig. 2.11).

Induction of Vcam-1 protein was confirmed by western blotting (Fig. 2.8E) and immunofluorescence (Fig. 2.8F). Vcam-1 protein was predominant increased in the endothelium, although expression was also observed in regions immediately adjacent to the endothelium.

Taken together, these data demonstrate that miR-146a restrains endothelial activation in vivo.

endothelium wild-type A B C -/- vessel wall miR-146a-/- HuR 2.5x106 wild-typemiR-146a 2.0x106 1.0 2.7 HuR 1.5x106 1.0 2.5 1.0x106 Traf6

6 Copies/ng of RNA 0.5x10 Actin

miR-146a miR-146b Expression Relative mRNA WT KO Relative miRNA Expression Relative miRNA

miR-126 miR-146a miR-146b D wild-type miR-146a-/- Vcam-1 Sele Icam-1

Relative mRNA Expression Relative mRNA NS 2h IL-1β 4h IL-1β Expression Relative mRNA NS 2h IL-1β 4h IL-1β Expression Relative mRNA NS 2h IL-1β 4h IL-1β

Mcp-1 Egr-1 Egr-3

Relative mRNA Expression Relative mRNA NS 2h IL-1β 4h IL-1β Expression Relative mRNA NS 2h IL-1β 4h IL-1β Expression Relative mRNA NS 2h IL-1β 4h IL-1β

E F WT Vcam-1 Pecam-1 -/- -/-

Lumen wild-typemiR-146awild-typemiR-146a 1.0 0.7 1.3 2.6 Vcam-1 MUT Lumen Actin

PBS IL-1β (2 h) + IL-1β (4 h) Cheng et al_Figure 8 Figure 2.8: miR-146a-/- mice demonstrate enhanced endothelial activation following IL-1β treatment.

(A) Endothelial cells and cells in the vessel wall were isolated from the descending aorta of wild-type mice, and expression of miR-126 (as a control for endothelial cells) and miR-146a/b were measured by qRT-PCR. Expression was normalized to U6. MiR-146a was significantly enriched in the endothelium compared to the vessel wall (n = 4). Significant p-values (t-test) are indicated above. (B) Levels of miR-146a and miR-146b were quantified by qRT-PCR in hearts from wild-type and miR-146a-/- mice (3-4 months of age, n = 3). Expression of miR-146a was >

6-fold higher than miR-146b and miR-146b expression was not affected by loss of miR-146a.

(C) Expression of HuR mRNA was elevated in the hearts of miR-146a-/- mice as assessed by qRT-PCR (left, p=0.031, t-test, n = 3). Western blot revealed elevated levels of HuR and Traf6

(right). (D) Wild-type and miR-146a-/- mice (3-4 months of age, n = 4) were injected with PBS or

125 ng of IL-1β by tail vein injection and hearts were harvested after 2 or 4 h. Expression of inflammatory genes was assessed by qRT-PCR. While basal levels of these genes were unchanged in unstimulated mice (PBS injection), the induction of Vcam-1, Icam-1, Sele, Mcp-1,

Egr-1 and Egr-3 was enhanced at 2 h in IL-1β treated mice, and Sele and Icam-1 were still elevated at 4 h. Significant p-values (t-test) are indicated above. (E) Expression of Vcam-1 protein was elevated after a 2 h IL-1β treatment in miR-146a-/- mice compared to wild-type mice.

(F) Localization of Vcam-1 expression was assessed by immunofluorescence, revealing an enhancement of Vcam-1 expression in the endothelium and in puncta adjacent to the endothelium of miR-146a-/- mice treated with IL-1β for 4 h. Scale bars = 20 µm.

2.5 DISCUSSION:

Acute inflammation is essential for wound repair and for the innate immune response to invading pathogens. However, the intensity and duration of an acute inflammatory response must be tightly regulated, especially considering that inflammation has a detrimental effect on the function of the vasculature. For example, an excessive inflammatory response during sepsis results in organ failure and death due to profound and systemic increases in endothelial cell permeability (320), while chronic vascular inflammation drives the progression of atherosclerosis (4). We demonstrate here that miR-146a and miR-146b act to restrain the intensity and duration of endothelial activation in response to pro-inflammatory cytokine stimulation. While miR-146a over-expression blunts endothelial activation and recruitment of leukocytes in response to IL-1β treatment, knock-down of miR-146a/b in vitro has the opposite effect. Importantly, miR-146a-/- mice display enhanced induction of leukocyte adhesion molecules and chemokines in response to IL-1β treatment, demonstrating that miR-146a restrains vascular inflammation in vivo. We find that the anti-inflammatory activity of miR-

146a/b is mediated by suppression of pro-inflammatory transcription factors (i.e. NF-κB, EGR-

1/3, AP-1) as well as through modulation of post-transcriptional pro-inflammatory pathways

(mediated by the targeting of HuR).

MiR-146a/b levels accumulate in the late stages of an inflammatory response, when other inflammatory genes such as VCAM-1, ICAM-1 and SELE are being down-regulated (Fig. 2.1), and miR-146a/b levels remain elevated for several days, even in the absence of pro-inflammatory cytokines (Fig. 2.2). The initial transcription of miR-146a is mediated, to a large extent, by NF-

κB (295). We also identify a role for EGR-3 in the transcriptional regulation of both miR-146a

74 and miR-146b (Fig. 2.6). Since miR-146a/b repress activation of the NF-κB and EGR pathways

(Fig. 2.5), miR-146a/b induction in response to pro-inflammatory cytokines forms a negative feedback loop to control endothelial activation. Curiously, the NF-κB (327) and EGR pathways

(Fig. 2.5C) are only transiently active following induction of inflammation, yet the transcription of miR-146a/b is maintained in the late stages of an inflammatory response (Fig. 2.1D), and in the case of miR-146b, transcription is maintained even in the absence of cytokine (Fig. 2.2C).

The transcriptional pathways that mediate this continued transcription are unknown. In addition, the mechanisms that control the delayed appearance of mature miR-146a/b during inflammation are also not known.

Considering the kinetics of miR-146 induction, we posit that miR-146 may play a role in the resolution of vascular inflammation and that the prolonged expression of miR-146 is a molecular marker of inflammatory 'memory'. This is consistent with a recent report demonstrating that miR-146a is involved in the resolution of T-cell activation (309). In endothelial cells, elevated levels of miR-146a/b may promote cytokine desensitization, whereby an initial cytokine treatment blunts the intensity of a subsequent response to cytokine exposure

(340, 341). Others have observed that induction of miR-146a in monocytes following exposure to LPS promotes tolerance to this stimulus (305, 342). Perhaps a similar mechanism involving miR-146a and/or miR-146b is operative in endothelial cells to restrain inflammation in response to pro-inflammatory cytokines.

Such desensitization might serve to prevent chronic activation of inflammation in the vasculature, and we anticipate that miR-146 expression in the endothelium may therefore play a protective role against the development of atherosclerosis, a chronic inflammatory disease.

While the expression of miR-146a and miR-146b is elevated in human atherosclerotic plaques

(312), the function of miR-146 in disease progression is not known.

We find that miR-146 restrains vascular inflammation by repressing the NF-κB and EGR pathways, which play important roles in atherogenesis (71, 188, 189). Additionally, miR-146a also targets TLR4 (Yang et al, 2011), which is expressed in several vascular and leukocyte cell types, and has been implicated in the etiology of atherosclerosis (343). We also identify HuR as a novel target of miR-146 and find that HuR acts to promote endothelial activation and leukocyte recruitment in response to IL-1β. A prior report demonstrated that HuR knock-down repressed endothelial activation in vitro in response to LPS. This was accompanied by a reduction in the activation of NF-κB and an elevation of eNOS mRNA (338). While we also find that knock- down of HuR results in reduced adhesion of monocytes to IL-1β treated endothelial cells (Fig.

2.7D), HuR does not regulate NF-κB activity in IL-1β-treated cells (Suppl. Fig. 2.8D), nor does it regulate the induction of adhesion molecules (Fig. 2.7F, Suppl. Figs. 2.8B, 2.9B). Instead HuR represses the expression of eNOS and cells with reduced levels of HuR are not able to downregulate eNOS expression in response to IL-1β treatment (Fig. 2.7F,G). Importantly, eNOS down-regulation plays a key role in atherogenesis (344, 345), and our findings suggest that HuR may play a role in eNOS regulation. In addition we show that inhibition of NO activity can rescue the reduced leukocyte adhesion observed in HuR knock-down cells (Fig. 2.7H). While

HuR does not directly bind to NOS3 mRNA, it does bind to a known positive regulator of NOS3 transcription (Lin et al, 2005), KLF2 (Suppl. Fig. 2.12A), and knock-down of HuR results in elevated levels of KLF2 (Suppl. Fig. 2.12B). Finally, we found that HuR protein levels were reduced at the late stages of endothelial activation (Fig. 2.5C), suggesting that miR-146 up- regulation at this stage may repress HuR, thereby forming a negative feedback loop. MiR-146

76 therefore inhibits endothelial activation by coordinately repressing the induction of adhesion molecules (through targeting of TRAF6/IRAK1/2) and by promoting the expression of eNOS, an inhibitor of leukocyte adhesion (through targeting of HuR) (Suppl. Fig. 2.13).

From recent discoveries it appears that a microRNA network acts in endothelial cells to restrain inflammation (346). For example, miR-10a levels are decreased in regions of the mouse aorta that are susceptible to the development of atherosclerosis (251). MiR-10a represses NF-κB activity by targeting MAP kinase kinase kinase 7 (MAP3K7, also known as TAK1) and β- transducin repeat-containing gene (β-TRC), which mediate IκB degradation (251). Additionally,

TNF-α up-regulates miR-31 and miR-17-5p, which directly repress the adhesion molecule genes

SELE and ICAM1, respectively (347). More recently, miR-181b was found to repress the expression of importin-α3, which is required for the nuclear import of NF-κB proteins (263).

Over-expression of miR-181b in the vasculature inhibits the expression of NF-κB-dependent genes and protects mice from sepsis (263). The existence of several microRNAs that converge on the NF-κB pathway suggests that tight control of this pathway is crucial for the maintenance of vascular homeostasis. Our findings have added miR-146a and miR-146b to this microRNA- mediated NF-κB regulatory network in the endothelium (Suppl. Fig. 2.13). In addition to regulating the NF-κB pathway, miR-146 also controls the EGR and AP-1 pathways, which are known to drive inflammatory gene expression (190, 323), and miR-146 targets HuR, which promotes endothelial activation by antagonizing eNOS expression. This implies that miR-146 may have an even broader anti-inflammatory role than miR-10a, miR-31, miR-17-5p or miR-

181b. Our findings suggest that strategies to enhance miR-146a or miR-146b in the vasculature may be therapeutically useful to dampen the endothelial response to inflammatory cytokines, and

77 may potentially be used to shut off the reiterative inflammatory loop that drives atherogenesis or to quell the vascular damage associated with cytokine storm in the setting of sepsis.

2.6 Supplemental Table

Supplemental Table 2.1: Primers used for qRT-PCR

Gene Forward Primer (5' -> 3') Reverse Primer (5' -> 3') human VCAM1 GTTGAAGGATGCGGGAGTAT GGATGCAAAATAGAGCACGA human SELE (E- CTGGCCTGCTACCTACCTGT AGCTACCAAGGG AATGTTGG Selectin) human ICAM1 CGGCCAGCTTATACACAAGA GTCTGCTGGGAATTTTCTGG human CCL2 TCATAGCAGCCACCTTCATT CGAGCCTCTGCACTGAGAT (MCP1) human EGR1 CAGCACCTTCAACCCTCAG TAACTGGTCTCCACCAGCAC human EGR3 ACAATCTGTACCCCGAGGAG GTAAGAGAGTTCCGGGTTGG human pri-miR- 146a (exon CGGCTGAATTGGAAATGATA TGCTGCCTCTCAAACAGAAG 1/intron 1) human pri-miR- AAGAAAGCATGCAAGAGCAG GCCTTGGCATTGATGTTGTA 146b human c-FOS TACTACCACTCACCCGCAGA AGTGACCGTGGGAATGAAGT human c-JUN GAGAGCGGACCTTATGGCTA GTGAGGAGGTCCGAGTTCTT human NOS3 GGCATCACCAGGAAGAAGACC TCACTCGCTTCGCGATCAC (eNOS) human TRAF6 CCAAATCCATGCACATTCA TTCTCATGTGTGACTGGGTGT human TBP TCGGAGAGTTCTGGGATTGT CACGAAGTGCAATGGTCTTT human ELAVL1 CTCTCGCAGCTGTACCACTC CACGTTGACGCCAGAGAG (HuR) human KLF2 Taqman assay #Hs00360439_g1 human GAPDH AGGTGAAGGTCGGAGTCAAC GAGGTCAATGAAGGGGTCAT GCACAAAGAAGGCTTTGAAGC GATTTGAGCAATCGTTTTGTA mouse Vcam1 A TTCAG mouse Sele (E- ATGACCACTGCAGGATGCAT GAACCAAAGACTCGGGCATGT Selectin) T CTGCCTTGGTAGAGGTGACTG AGGACAGGAGCTGAAAAGTT mouse Icam1 A GTAGA mouse Ccl2 (Mcp- GTCCCTGTCATGCTTCTGG ATTGGGATCATCTTGCTGGT 1)

78 79

CTACCAATCCCAGCTCATCAA mouse Egr-1 CTCATCCGAGCGAGAAAAGC AC CGACTTCTTCTCCTTTTGCTTG mouse Egr-3 AAGCCCTTTGCCTGTGAGTTC A mouse Elavl1 CCAAGGTTGTAGATGAAGAT GTACACCACCAGGCACAGAG (HuR) GC mouse NOS3 CCAAGGTGATGAGCTCTGTG GAAGATATCTCGGGCAGCAG (eNOS) CTGCTCTAACTTTAGCACCTG mouse Tbp ACCCACCAGCAGTTCAGTAC T

2.7 Supplemental Figures

miR-146amiR-146a miR-146b miR-146b Relative miRNA Expression Relative miRNA

TNF-α Treatment Relative miRNA Expression Relative miRNA

SupportingSupplemental Information Figure Figure 1: 2. TNF-1 α induces miR-146a and miR-146b expression. HUVEC were stimulated with TNF-α and expression of miR-146a and miR-146b was assessed by qRT-PCR.TNF- Shownα is Treatmentthe mean +/- SEM of 2 independent experiments. NS = non-stimulated. TNF-α induces miR-146a and miR-146b expression. HUVEC were stimulated with TNF-α and Supporting Informationexpression Figure 1: of TNF- miRα- 146ainduces and miR-146a miR-146b and was miR-146b assessed expression.by qRT-PCR. Shown is the mean +/- SEM Bovine Aortic Endothelial Cells HUVEC were stimulated with TNF-α and expression of miR-146a and miR-146b was assessed by qRT-PCR. Shown is ofthe 2 meanindependent +/- SEM experiments. of 2 independent NS =experiments. non-stimulated. NS = non-stimulated. ** control mimic miR-146a mimic

Bovine Aortic Endothelial Cells

** control mimic miR-146a mimic Relative # of Cells Adhered Relative # of Cells

NS NS IL-1β IL-1β

Supporting Information Figure 2: Over-expression of miR-146a inhibits monocyte adhesion to IL-1β-treated bovine aortic endothelial cells (BAEC). Shown is a representative experiment (quantification of 3 images from 3 indendent wells). ANOVA, p<0.0001. ** indicates a significant decrease (p<0.01) in the number of cells adhered to IL-1β-treated BAEC transfected with miR-146a mimic compared to control mimic. Relative # of Cells Adhered Relative # of Cells

NS NS IL-1β IL-1β

Supporting InformationSupplemental Figure 2: Over-expression Figure 2.2 of miR-146a inhibits monocyte adhesion to IL-1β-treated bovine aortic endothelial cells (BAEC). Shown is a representative experiment (quantification of 3 images from 3 indendent wells). ANOVA, p<0.0001. ** indicates a significant decrease (p<0.01) in the number of cells adhered to IL-1β-treated BAEC transfected with miR-146a mimic compared to control mimic.

Over-expression of miR-146a inhibits monocyte adhesion to IL-1β-treated bovine aortic endothelial cells (BAEC). Shown is a representative experiment (quantification of 3 images from 3 independent wells). ANOVA, p<0.0001. ** indicates a significant decrease (p<0.01) in the number of cells adhered to IL-1β-treated BAEC transfected with miR-146a mimic compared to control mimic.

control mimic miR-146a mimic

EGR-3 EGR-3 3’ UTR 3’ UTR (inverted)

Supporting InformationSupplemental Figure 3: miR-146a Figure does 2.3 not directly regulate EGR-3 - A Luciferase construct containing a fragment of the EGR-3 3’ UTR that includes a putative miR-146 binding site was transfected into HeLa cells together with control or miR-146a mimic, and luciferase activity was measured. M NoiR change-146a does in luciferase not directly activity regulate was observed. EGR-3. AsA Luciferasea control, a constructluciferase containing a fragment of the construct containing theEGR same-3 EGR-33’ UTR 3’ thatUTR, includes but in the a putativeinverse orientation, miR-146 bindingwas used. site Data was transfected into HeLa cells from a representative experiment (transfections performed in triplicate) is shown. together with control or miR-146a mimic, and luciferase activity was measured. No change in luciferase activity was observed. As a control, a luciferase construct containing the same EGR-3 3’ UTR, but in the inverse orientation, was used. Data from a representative experiment HuR (ELAVL1) (transfections3’ UTR performed in triplicate) is shown. 5’ -- CUUUGAUUUGUAGUUUUAAAGAUUAACCCUCAAAGUUCUCUUCAUAA -- 3’ human 5’ -- CUUUGAUUUGUAGUUUUAAGGAUUAACCCUCAAAGUUCUCUUCAUAA -- 3’ mouse 5’ -- CUUUGAUUUGUAGUUUUAAGGAUUAACCCUCAAAGUUCUCUUCAUAA -- 3’ rat

3’ - UUGGGUACCUUAAGUCAAGAGU - 5’ miR-146a 3’ - UCGGAUACCUUAAGUCAAGAGU - 5’ miR-146b

Supporting Information Figure 4: A potential miR-146 binding site in HuR is highly conserved across species - A portion of the 3’ UTR of HuR is shown from human, mouse and rat, with the potential miR-146 binding site highlighted in yellow. The sequence of miR-146a and miR-146b is shown below, with the sequence differences between miR-146a and miR-146b indicated in red. The sequence of human, mouse and rat miR-146a and miR-146b are identical to that shown. control mimic miR-146a mimic

EGR-3 EGR-3 3’ UTR 3’ UTR (inverted)

Supporting Information Figure 3: miR-146a does not directly regulate EGR-3 - A Luciferase construct containing a fragment of the EGR-3 3’ UTR that includes a putative miR-146 binding site was transfected into HeLa cells together with control or miR-146a mimic, and luciferase activity was measured. No change in luciferase activity was observed. As a control, a luciferase construct containing the same EGR-3 3’ UTR, but in the inverse orientation, was used. Data from a representative experiment (transfections performed in triplicate) is shown.

HuR (ELAVL1) 3’ UTR

5’ -- CUUUGAUUUGUAGUUUUAAAGAUUAACCCUCAAAGUUCUCUUCAUAA -- 3’ human 5’ -- CUUUGAUUUGUAGUUUUAAGGAUUAACCCUCAAAGUUCUCUUCAUAA -- 3’ mouse 5’ -- CUUUGAUUUGUAGUUUUAAGGAUUAACCCUCAAAGUUCUCUUCAUAA -- 3’ rat

3’ - UUGGGUACCUUAAGUCAAGAGU - 5’ miR-146a 3’ - UCGGAUACCUUAAGUCAAGAGU - 5’ miR-146b

Supplemental Figure 2.4 Supporting Information Figure 4: A potential miR-146 binding site in HuR is highly conserved across species - A portion of the 3’ UTR of HuR is shown from human, mouse and A rat,potential with the miR potential-146 miR-146 binding binding site in site HuR highlighted is highly in yellow.conserved The sequence across species. of miR-146a A portion and of the 3’ miR-146b is shown below, with the sequence differences between miR-146a and miR-146b UTRindicated of HuR in red. is shownThe sequence from human, of human, mouse mouse and and rat,rat miR-146a with the and potential miR-146b miR are-146 identical binding site to that shown. highlighted in yellow. The sequence of miR-146a and miR-146b is shown below, with the sequence differences between miR-146a and miR-146b indicated in red. The sequence of human, mouse and rat miR-146a and miR-146b are identical to that shown.

HuR control mimic HuR control inhibitor

miR-146a mimic 0.009 miR-146 inhibitor 2.0 2.0 0.025 0.019 0.030 0.011 0.005 1.5 1.5 0.048 1.0 1.0

0.5 0.5

0.0 0.0 0 1 1.5 2 4 8 0 1 4 8 24 Relative mRNA Expression Relative mRNA Relative mRNA Expression Relative mRNA IL-1β treatment (hours) IL-1β treatment (hours)

Supplemental Figure 2.5 Supporting Information Figure 5: miR-146 controls the expression of HuR mRNA. Over-expression of miR-146a in endothelial cells reduced levels of HuR mRNA in IL-1β-treated MHUVECiR-146 (left), controls as assessed the expression by qRT-PCR, of HuR while mRNA. inhibition Over of -miR-146expression increased of miR HuR-146a mRNA in endothelial (right). p-values of significant differences (t-test) are indicated above (n = 4-5). cells reduced levels of HuR mRNA in IL-1β-treated HUVEC (left), as assessed by qRT-PCR, while inhibition of miR-146 increased HuR mRNA (right). p-values of significant differences (t- test) are indicated above (n = 4-5). ** control siRNA HuR siRNA

Relative # of Cells Adhered Relative # of Cells α α NS NS TNF- TNF-

Supporting Information Figure 6: HuR knock-down represses THP-1 adhesion to TNF-α- treated endothelial cells - Shown is a representative experiment (quantification of 3 images in 3 independent wells). ANOVA, p<0.0001. ** indicates a significant decrease (p<0.01) in THP-1 adhesion to TNF-α-treated HUVEC transfected with HuR siRNA compared to control siRNA. HuR control mimic HuR control inhibitor

miR-146a mimic 0.009 miR-146 inhibitor 2.0 2.0 0.025 0.019 0.030 0.011 0.005 1.5 1.5 0.048 1.0 1.0

0.5 0.5

0.0 0.0 0 1 1.5 2 4 8 0 1 4 8 24 Relative mRNA Expression Relative mRNA Relative mRNA Expression Relative mRNA IL-1β treatment (hours) IL-1β treatment (hours)

Supporting Information Figure 5: miR-146 controls the expression of HuR mRNA. Over-expression of miR-146a in endothelial cells reduced levels of HuR mRNA in IL-1β-treated HUVEC (left), as assessed by qRT-PCR, while inhibition of miR-146 increased HuR mRNA (right). p-values of significant differences (t-test) are indicated above (n = 4-5).

** control siRNA HuR siRNA Relative # of Cells Adhered Relative # of Cells α α NS NS TNF- TNF- Supporting Information Figure 6: HuR knock-down represses THP-1 adhesion to TNF-α- treated endothelial cells - ShownSupplemental is a representative Figure 2. experiment6 (quantification of 3 images in 3 independent wells). ANOVA, p<0.0001. ** indicates a significant decrease (p<0.01) in THP-1 adhesion to TNF-α-treated HUVECHuR knocktransfected-down with represses HuR siRNA THP -compared1 adhesion to to control TNF- αsiRNA.- treated endothelial cells. Shown is a representative experiment (quantification of 3 images in 3 independent wells). ANOVA, p<0.0001. ** indicates a significant decrease (p<0.01) in THP-1 adhesion to TNF-α-treated HUVEC transfected with HuR siRNA compared to control siRNA.

0k 1k 2k 3k

VCAM-1

0k 1k 2k 3k

SELE

0k 1k 2k 3k

ICAM-1

MCP-1

0k 1k 2k

KLF2

ATTTA WWWATTTAWWW WWATTTAWW WWTATTTATWW WTATTTATW WWWWATTTAWWWW TTATTTATT WWWTATTTATWWW

Supplemental Figure 2.7

SupportingPredicted InformationAU-rich elements Figure 7:(AREs) Pedicted in the AU-rich 3’ UTRs elements of genes (AREs) invo inlved the in3’ UTRsendothelial of activation. genesPrediction involved of inAREs endothelial was performed activation using - Prediction AREsite of AREs(348) .was The performed coding region using AREsiteof each transcript is (Gruber et al, Nucleic Acids Research, 2010). The coding region of each transcript is indicated in orange.indicated The variousin orange. types Th ofe AREsvarious are types indicated of AREs by colored are indicated trianges. by colored triangles.

A HuR Immunoprecipitation B ** ** - 4h 8h - 4h 8h IL-1β VCAM-1

GAPDH HuR

control siRNA HuR siRNA

C D NF-kB-luciferase reporter control siRNA * untreated HuR siRNA * IL-1β treated MCP-1 Protein (ng/mL)

NS 4h IL-1β 8h IL-1β Activity Relative Luciferae HuR HuR siRNA added control TRAF6 control TRAF6 Supplemental Figure 2.8 Supporting Information Figure 8: HuR binds to VCAM-1 and MCP-1 mRNA but does not regulate the induction of these genes by IL-1β - (A) HuR was immunoprecipitated from IL-1β- HuRtreated binds endothelial to VCAM cells- 1(4 and h), RNAMCP was-1 mRNAisolated andbut doesthe expression not regulate of several the induction inflammatory of these genes genes by ILand-1 eNOSβ. (A) (NOS3 HuR) was was immunoprecipitatedassessed by qRT-PCR. from Control IL -immunoprecipitation1β- treated endothelial was performed cells (4 h),using RNA was an antibody to V5. VCAM-1 and MCP-1 were significantly enriched in HuR immunoprecipitates isolatedcompared and to V5the immunoprecipitates expression of several (n = 4). inflammatory Repeated measures genes ANOVA,and eNOS p=0.0021. (NOS3 **) wasindicates assessed a by significant difference compared to V5 immunoprecipitation, p<0.01. (B) Expression of VCAM-1 in qRTresponse-PCR. to ControlIL-1β treatment immunoprecipitation was not affected bywas HuR performed knock-down. using A representative an antibody blotto V5. is shown. VCAM -1 and (C) Expression of MCP-1 was not affected by HuR knock-down, as assessed by ELISA. Shown is the MCPmean- +/-1 were SEM significantly(n = 3). (D) Activation enriched of NF-in HuRκB signaling immunoprecipitates was not affected compare by HuR knock-down,d to V5 but was significantly decreased in TRAF6 knock-down cells, as assessed by NF-κB-luciferase reporter immunoprecipitatesassay (n = 4). Repeated (n measures = 4). Repeated ANOVA, measures p<0.0001. ANOVA, * indicates p=0.0021.a signficant **difference, indicates p<0.05. a significant difference compared to V5 immunoprecipitation, p<0.01. (B) Expression of VCAM-1 in response to IL-1β treatment was not affected by HuR knock-down. A representative blot is shown. (C) Expression of MCP-1 was not affected by HuR knock-down, as assessed by ELISA. Shown is the mean +/- SEM (n = 3). (D) Activation of NF-κB signaling was not affected by HuR knock-down, but was significantly decreased in TRAF6 knock-down cells, as assessed by NF-

κB-luciferase reporter assay (n = 4). Repeated measures ANOVA, p<0.0001. * indicates a significant difference, p<0.05.

A siRNA added controlHuR TRAF6

HuR

* TRAF6

Vinculin

B control siRNA control siRNA HuR siRNA TRAF6 siRNA

SELE SELE

0 2 4 8 24 0 2 4 8 24 Relative mRNA Expression Relative mRNA Relative mRNA Expression Relative mRNA IL-1β treatment (hours) IL-1β treatment (hours)

MCP-1 MCP-1

0 2 4 8 24 0 2 4 8 24 Relative mRNA Expression Relative mRNA Relative mRNA Expression Relative mRNA IL-1β treatment (hours) IL-1β treatment (hours) EGR-3 EGR-3

0 1 2 0 1 2 Relative mRNA Expression Relative mRNA Relative mRNA Expression Relative mRNA IL-1β treatment (hours) IL-1β treatment (hours)

Supporting Information Figure 9: The miR-146 targets, HuR and TRAF6, have divergent effects on the induction of inflammatory genes - (A) Western blot demonstrating the efficient knock-down of HuR or TRAF6. Vinculin was used as a loading control. * indicates a nonspecific band. (B) The induction of SELE, MCP-1 and EGR-3 was assessed in HuR (left) or TRAF6 (right) knock-down cells in response to IL-1β treatment. While TRAF6 knock-down decreased the induction of these genes, HuR knock-down had no effect (n = 3). 87

Supplemental Figure 2.9

The miR-146 targets, HuR and TRAF6, have divergent effects on the induction of inflammatory genes. (A) Western blot demonstrating the efficient knock-down of HuR or TRAF6. Vinculin was used as a loading control. * indicates a nonspecific band. (B) The induction of SELE, MCP-1 and EGR-3 was assessed in HuR (left) or TRAF6 (right) knock-down cells in response to IL-1β treatment. While TRAF6 knock-down decreased the induction of these genes, HuR knock- down had no effect (n = 3).

wild-type miR-146a-/-

Relative miRNA Expression Relative miRNA

miR-17 miR-31 miR-10a miR-155 miR-181b Supporting InformationSupplemental Figure 10:Figure MicroRNAs 2.10 previously implicated in regulating inflammation are not appreciably altered in miR-146a-/- mice - MicroRNA expression was assessed in the hearts of wild-type and miR-146a-/- mice (3-4 months of age) by qRT-PCR. Data MicroRNAswas normalized previously to the expression implicated of miR-126 in regulating (n = 6). inflammation are not appreciably altered in miR-

146a-/- mice. MicroRNA expression was assessed in the hearts of wild-type and miR-146a-/- mice (3-4 months of age) by qRT-PCR. Data was normalized to the expression of miR-126 (n = 6).

A B -/- Nos3 wild-type miR-146a-/- wild-typemiR-146a 1.0 0.7 densitometry

eNOS

Actin

Relative mRNA Expression Relative mRNA NS 2h IL-1β 4h IL-1β

Supporting Information Figure 11: Expression of eNOS is modestly decreased in miR-146a-/- mice - (A) Nos3 (eNOS) mRNA expression was assessed by qRT-PCR in wild-type and miR-146a-/- hearts, revealing a trend towards decreased levels in knock-out mice (n = 3-6). NS = non-stimulated. (B) Expression of eNOS protein was assessed in wild-type and miR-146a-/- hearts by western blot. A representative blot is shown. wild-type miR-146a-/-

Relative miRNA Expression Relative miRNA

miR-17 miR-31 miR-10a miR-155 miR-181b Supporting Information Figure 10: MicroRNAs previously implicated in regulating inflammation are not appreciably altered in miR-146a-/- mice - MicroRNA expression was assessed in the hearts of wild-type and miR-146a-/- mice (3-4 months of age) by qRT-PCR. Data was normalized to the expression of miR-126 (n = 6).

A B -/- Nos3 wild-type miR-146a-/- wild-typemiR-146a 1.0 0.7 densitometry

eNOS

Actin

Relative mRNA Expression Relative mRNA NS 2h IL-1β 4h IL-1β

Supplemental Figure 2.11 Supporting Information Figure 11: Expression of eNOS is modestly decreased in -/- miR-146a mice - (A) Nos3 (eNOS) mRNA expression- /was- assessed by qRT-PCR in Expressionwild-type and of eNOSmiR-146a is mode-/- hearts,stly decreased revealing in a miRtrend-146a towardsmice. decreased (A) Nos3 levels (eNOS) in knock-out mRNA mice (n = 3-6). NS = non-stimulated. (B) Expression of eNOS protein-/- was assessed in expressionwild-type and was miR-146a assessed -/-by hearts qRT- PCRby western in wild -blot.type A and representative miR-146a blothearts, is shown. revealing a trend towards decreased levels in knock-out mice (n = 3-6). NS = non-stimulated. (B) Expression of

eNOS protein was assessed in wild-type and miR-146a-/- hearts by western blot. A representative blot is shown.

A B KLF2 KLF2

V5 IP HuR IP siRNA HuR control siRNA Supplemental Figure 2.12 Supporting Information Figure 12: KLF2 mRNA is bound by HuR and knock-down of HuR leads to increased levels of KLF2 transcripts - (A) KLF2 mRNA was enriched in HuR immunoprecipitates from unstimulated HUVEC compared to control immunoprecipitates (V5), as assessed by qRT-PCR (t-test, p=0.017, n = 4). (B) KLF2 mRNA was increased in HUVEC transfected with HuR siRNA (t-test, p=0.030, n = 5).

KLF2 mRNA is bound by HuR and knock-down of HuR leads to increased levels of KLF2 transcripts. (A) KLF2 mRNA was enriched in HuR immunoprecipitates from unstimulated HUVEC compared to control immunoprecipitates (V5), as assessed by qRT-PCR (t-test, p=0.017, n = 4). (B) KLF2 mRNA was increased in HUVEC transfected with HuR siRNA (t-test, p=0.030, n = 5).

IL-1! IL-1R

TRAF6 / IRAK1/2 HuR

NF-!B / EGR !"#$%&'( KLF2

Adhesion molecules / eNOS MCP1

Endothelial Activation / Leukocyte Adhesion

Supplemental Figure 2.13 Supporting Information Figure 13: Schematic of a miR-146 feedback loop that controls endothelial activation. Pro-inflammatory cytokines activate the NF-!B and EGR transcription factors, which induce the expression of leukocyte adhesion molecules and chemokines, such as MCP-1. These pathways also induce the expression of miR-146, which targets TRAF6 and IRAK1/2, and functions as a negative regulator that represses inflammatory signaling. MiR-146 also targets HuR, which represses KLF2, a potent transcriptional activator of eNOS. Nitric oxide produced by eNOS is a vasodilator and a repressor of leukocyte and platelet adhesion to the endothelium. 90

Schematic of a miR-146 feedback loop that controls endothelial activation. Pro-inflammatory cytokines activate the NF-!B and EGR transcription factors, which induce the expression of leukocyte adhesion molecules and chemokines, such as MCP-1. These pathways also induce the expression of miR-146, which targets TRAF6 and IRAK1/2, and functions as a negative regulator that represses inflammatory signaling. MiR-146 also targets HuR, which represses KLF2, a potent transcriptional activator of eNOS. Nitric oxide produced by eNOS is a vasodilator and a repressor of leukocyte and platelet adhesion to the endothelium.

Chapter 3

3 Paradoxical suppression of atherosclerosis in the absence of microRNA- 146a

The proceeding chapter has been published in full in the journal Circulation Research: Cheng HS, Besla R, Li A, Chen Z, Shikatani EA, Nazari-Jahantigh M, Hammoutene A, Nguyen MA, Geoffrion M, Cai L, Khyzha N, Li T, MacParland SA, Husain M, Cybulsky MI, Boulanger C, Temel RE, Schober A, Rayner K, Robbins CS, and Fish JE (2017). Paradoxical suppression of atherosclerosis in the absence of microRNA-146a. Circ Res, 121(4), 354-367.

3.1 ABSTRACT:

Rationale: Inflammation is a key contributor to atherosclerosis. MicroRNA-146a (miR-146a) has been identified as a critical brake on pro-inflammatory NF-κB signaling in several cell types, including endothelial cells and bone marrow-derived cells. Importantly, miR-146a expression is elevated in human atherosclerotic plaques, and polymorphisms in the miR-146a pre-cursor have been associated with risk of coronary artery disease.

Objective: To define the role of endogenous miR-146a during atherogenesis.

Methods and Results: Paradoxically, Low-density lipoprotein receptor (Ldlr)-/- mice deficient in miR-146a develop less atherosclerosis, despite having highly elevated levels of circulating pro- inflammatory cytokines. In contrast, cytokine levels are normalized in Ldlr-/-;miR-146a-/- mice receiving wild-type bone marrow transplantation, and these mice have enhanced endothelial cell activation and elevated atherosclerotic plaque burden compared to Ldlr-/- mice receiving wild- type bone marrow; demonstrating the athero-protective role of miR-146a in the endothelium. We find that deficiency of miR-146a in bone marrow-derived cells precipitates defects in hematopoietic stem cell function, contributing to extramedullary hematopoiesis, splenomegaly, bone marrow failure and decreased levels of circulating pro-atherogenic cells in mice fed an atherogenic diet. These hematopoietic phenotypes appear to be driven by unrestrained inflammatory signaling that leads to the expansion and eventual exhaustion of hematopoietic cells, and this occurs in the face of lower levels of circulating LDL cholesterol in mice lacking miR-146a in bone marrow-derived cells. Furthermore, we identify Sort1, a known regulator of circulating LDL levels in humans, as a novel target of miR-146a.

Conclusions: Our study reveals that miR-146a regulates cholesterol metabolism and tempers chronic inflammatory responses to atherogenic diet by restraining pro-inflammatory signaling in endothelial cells and bone marrow-derived cells.

92 93

3.2 INTRODUCTION:

Atherosclerosis is a chronic inflammatory vascular disease characterized by the narrowing of blood vessels due to the growth of lipid-rich plaques (1). The initiation of atherogenesis relies on the recruitment of circulating leukocytes by activated endothelial cells (ECs) to regions of deposited oxidized LDL (5). Activated ECs and leukocytes utilize the nuclear factor κ light chain enhancer of activated B cells (NF-κB) signaling pathway to propagate inflammatory gene expression, including induction of adhesion molecules, chemoattractants and cytokines to drive inflammation in the vessel wall (70, 71). NF-κB signaling is tightly controlled, and this includes regulation by a network of microRNAs, which titrate the expression of signaling components post-transcriptionally (256). In particular, microRNA-146a (miR-146a) has been well characterized in both ECs and leukocytes as a negative regulator of NF-κB activity through its ability to target upstream adaptor proteins, including TRAF6 and IRAK1 (295, 349).

Characterization of miR-146a deficient mice has revealed defects in multiple aspects of immune cell biology (197, 198). Older (>1 year) miR-146a-/- mice develop multi-organ inflammation, bone marrow (BM) failure, splenomegaly and lymphoadenopathy (198, 214). When challenged by pro-inflammatory stimuli (e.g. lipopolysaccharide [LPS] or interleukin-1β [IL-1 β]) these mice have exacerbated NF-κB-dependent inflammatory responses, and demonstrate expansion of pro-inflammatory Ly6Chi monocytes (214, 308, 349). Interestingly, the hyperactivation of NF-κB caused by low-grade inflammation during normal ageing or through repeated LPS challenge drives the proliferation and eventual exhaustion of hematopoietic and progenitor stem cells in these mice, resulting in eventual loss of circulating leukocytes and lymphocytes (214).

The NF-κB pathway is activated in ECs, macrophages and smooth muscle cells (SMCs) within human atherosclerotic lesions (350). However, defining the role of NF-κB signaling in atherogenesis has been complicated, as ablation of NF-κB activity in ECs reduces atherogenesis (71), whereas inhibition within macrophages enhances atherogenesis (203). Of interest, recent studies have shown that injection of miR-146a mimic into atheroprone mice reduces atherogenesis, and it has been suggested that this is due to suppression of macrophage NF-κB signaling (318). The role of endogenous miR-146a in atherogenesis remains undefined. Here we

94 show that genetic ablation of miR-146a in BM-derived cells reduces atherogenesis and that this is paradoxically accompanied by enhanced circulating levels of pro-inflammatory cytokines despite reduced levels of circulating LDL cholesterol. Lack of miR-146a in BM-derived cells leads to monocytosis in response to high cholesterol diet, followed by BM exhaustion; depleting circulating levels of pro-atherogenic cells. Conversely, deletion of miR-146a in the vasculature promotes atherogenesis by increasing endothelial activation. Thus, unrestrained inflammatory signaling in miR-146a deficient tissues has diverse consequences during atherogenesis, and our studies emphasize the importance of tight control of inflammatory pathways in the setting of hypercholesterolemia.

3.3 METHODS:

Mouse models of atherosclerosis: All animal protocols were approved by the Animal Care Committee at the University Health Network (Toronto). All mice used were age and sex matched unless stated otherwise and were all on the C57BL/6 background. Ldlr-/- and miR-146a-/-;Ldlr-/- mice were placed on high cholesterol diet (1.25% cholesterol, D12108C from Research Diets Inc.) at the age of 10 weeks. For bone marrow (BM) transplant models, 10 week-old recipient mice were subjected to whole-body irradiation (10 Gys) followed by injection of bone marrow (BM) donor cells (1 x 106 cells) by tail vein injection, followed by recovery for 8 weeks. Plasma was collected by retro-orbital bleeds or cardiac puncture followed by centrifugation at 13,000g for 10 minutes. Mice were perfused with PBS before tissue extraction. Gene expression analysis from lesser curvature intimal cells of the aorta was performed as before (1). Whole tissue RNA or protein extraction was performed by homogenization in Trizol or Laemmli sample buffer, respectively. Aortic roots were embedded in OCT (optimal cutting temperature compound) and sectioned by the MIRC Core Histology Facility (McMaster University).

Cells: Blood was collected by retro-orbital bleeds using heparin-coated capillary tubes (Fisherbrand K41B22365566). Erythrocytes were lysed using RBC Lysis Buffer (BioLegend). Total white blood cell count was determined by preparing a 1:20 dilution of (undiluted) peripheral blood in RBC Lysis Buffer, followed by counting using a hemocytometer. For solid organs, single-cell suspensions were obtained as follows: for bone marrow, the femur of one leg was crushed with mortar and pestle and homogenized through a 40-µm-nylon mesh. Spleens were homogenized through a 40-µm-nylon mesh, after which RBC lysis was performed using RBC Lysis Buffer (BioLegend) for 10 minutes. For aortic tissue, the aorta was perfused with 10 ml PBS before digestion. The entire aorta (from the aortic sinus to the iliac bifurcation) was cut in small pieces and subjected to enzymatic digestion with 450 U ml-1 collagenase I, 125 U ml- 1 collagenase XI, 60 U ml-1 DNase I and 60 U ml-1 hyaluronidase (Sigma-Aldrich) for 30 minutes at 37°C while shaking. Single-cell suspensions of digested tissues were obtained by homogenizing digested tissue though 40-µm-nylon mesh.

Flow cytometry: Antibodies used for flow cytometric analyses are provided in Supplemental Table 3.2. Data was acquired on an LSRII flow cytometer (BD Biosciences) and analyzed with FlowJo v8.8.6 (Tree Star, Inc.). Aortic single cell suspensions were treated with FcBlock (BD Biosciences) for 15 minutes before incubation with antibody cocktail for an additional 30 minutes. Single cell suspensions of peripheral blood, spleen and bone marrow were stained with antibody cocktails for 30 minutes. Samples were fixed before flow analysis (BD Cytofix).

Gene expression analysis: RNA was isolated using Trizol (Invitrogen), reverse transcribed using the High‐Capacity cDNA Reverse Transcription kit (Applied Biosystems) and quantitative reverse‐transcriptase PCR (qRT‐PCR) was performed as described previously (349). MiR‐146a and U6 were reverse‐transcribed using the Taqman® MicroRNA Reverse Transcription kit (Applied Biosystems) and analyzed using Taqman Primer sets (Applied Biosystems). Real‐time PCR was conducted in triplicate using a Roche Lightcycler 480® with Roche 480 Probes Master Mix or LC 480 SYBR Green I Master (Roche) for Taqman® and Sybr green chemistries, respectively. Data was normalized to hypoxanthine-guanine phosphoribosyltransferase (HPRT) or U6 using the Delta‐Delta Ct method. The primers used are indicated in Supplemental Table 3.3. Lipoprotein Signaling and Cholesterol Metabolism genes were assessed using an RT2 Profiler PCR Array (Qiagen), which contains 84 genes in these pathways, according to the manufacturer’s suggestions.

Luciferase assays: Luciferase constructs (pGL3) containing approximately 250 bp of wild-type mouse Sort1 3’UTR (Sort1WT/gGL3) or a mutant version with the miR-146a binding site mutated (Sort1MUT/pGL3) were constructed. 3’ UTR sequences were generated as gBlocks gene fragments (Integrated DNA technologies) with XbaI linkers (red): 5’- AATTTCTAGAAACTGTATAGTGTACATGTTAATGATTTATCAGTATGCCCCGAATTCC TAGTGCAGTTCTCATTCTCCGCATGCCCTCAGCTGTGGTCAGGTGACTTCCTGTCCCC TGGCAGCTCTGCTGAGTCCCTGTGTTTGAGCCTCCAGGGAGAAGGGTTTGGGCTGCA

TTCTTCTTATCCCCATGCACAGAAACGCTCAGGGTCCCCACGTGCCTGTTGTCCTCCC CTCTTCTAGAATAT-3’

The underlined region contains the miR-146a binding site, which was mutated (GTTCTCA à GTTAGAA) to generate the Sort1MUT/pGL3 construct. After digesting with XbaI, the gBlock fragment was cloned into the XbaI site in the 3’ UTR of pGL3. The directionality and sequence of the insert was confirmed by sequencing.

BAEC (bovine aortic endothelial cells) grown in 12-well dishes were transfected with 1 µg of luciferase construct and 100 ng of pRL Renilla luciferase construct (Promega) (for normalization of transfection efficiency), using Lipofectamine 2000. Cellular lysates were isolated 24 h post-transfection using Passive Lysis Buffer and luciferase activity was monitored using the Dual Luciferase Reporter Assay System (Promega) using a GloMax 20/20 Luminometer (Promega).

Lipid measurements in plasma: Plasma measurements of total cholesterol, low- and high- density lipoprotein, triglyceride and glucose were performed by the Clinical Chemistry department at The Centre for Phenogenomics (Toronto). Animals were fasted overnight prior to acquisition of plasma samples. Analytes and LIH (lipemia, icterus, hemolysis) were scored on a Beckman AU480 Biochemistry Analyzer.

Liver lipid analysis: Liver lipid content was determined based upon the method described by Carr et al (351). A piece of frozen liver was thawed and minced with a razor blade. Following transfer to a tared 16x100mm glass tube, the wet weight of the liver piece was measured using an analytical balance. To extract the lipids from the tissue, 3 ml 2:1 chloroform:methanol

(CHCl3:MeOH) was added to the tube which was then incubated at 60°C for 3 hours and subsequently overnight at room temperature. After centrifuging the tube at 1,500xg for 10 min, the 2:1 CHCl3:MeOH lipid extract was transferred to a new 16x100 mm glass screw top tube.

The tube containing the extracted liver was washed with 2 ml 2:1 CHCl3:MeOH and centrifuged as described above. The 2:1 CHCl3:MeOH lipid extract and wash were combined and the

98 solvent was evaporated under nitrogen at 55°C. The dried lipid extract was dissolved in 6 ml of

2:1 CHCl3:MeOH. After the addition of 1.2 ml dilute H2SO4 (0.05%, v/v), the tube was vortexed for 20 seconds and the phases separated by centrifugation as described above. The upper aqueous phase was removed and an aliquot (typically 1 ml) of the lower phase lipid-containing organic phase was transferred to a new 16x100 mm glass screw top tube using a volumetric glass pipet. After adding 2 ml 1% Trition-X100 dissolved in CHCl3, the organic solvent was evaporated under nitrogen at 55°C. The dried sample was dissolved in 1 ml water while being heated at 60°C for 10 min. After vortexing and centrifuging as above, samples were analyzed for lipids using commercially available enzymatic kits for total cholesterol (Pointe Scientific, cholesterol reagent), free cholesterol (Wako, Free Cholesterol E), and triglyceride (Wako, L-

Type Triglycerides M). To determine protein content of the liver piece, the CHCl3:MeOH was removed from the extracted liver by placing the uncapped tubes in a 100°C vacuum oven for 20 minutes. 4 ml 1N NaOH was added to the tube and the capped tube was incubated in a 100°C vacuum oven vortexed every 30 minutes until the tissue was dissolved. A modified Lowry assay using BSA as a standard was used to determine the protein concentration of the tissue lysate. Note: Organic-solvent resistant, Teflon lined caps were used to seal the tubes throughout the protocol.

Gas Chromatography (GC) analysis of neutral sterol in feces: Feces were transferred to a 20 mL glass scintillation vial and desiccated overnight in a vacuum oven set at 80°C. The dried feces were weighed and crushed into a fine powder using a mortar and pestle. A portion of fecal powder (~25 mg) was weighed in a 16x100 mm glass screw top tube containing 100 µg 5-alpha cholestane (Steraloids, C3300-000). To saponify the fecal lipid, 2 ml 95% EtOH and 200 µL 50% KOH were added to the tube, which was then sealed with a Teflon-lined cap and incubated at 60°C for 3 hours with periodic vortexing. The neutral sterol was extracted from the sample by adding 2 mL hexane followed by 2 mL water with vortexing (20 seconds) between each addition. The tube was centrifuged at 1500xg for 10 min at room temperature. A 400 µl aliquot of the upper hexane phase was diluted 4-fold with hexane and transferred to a GC vial for analysis of sterol mass. The extracted sterol was analyzed by injecting 1 µL of sample onto a ZB50 (0.53- mm inner diameter × 15 m × 1 µm) gas-liquid chromatography column (Phenomenex) at 250°C

99 and installed in a Agilent Technologies 7890B gas chromatograph equipped with a Agilent Technologies 7693 autosampler using on-column injection and a flame ionization detector (FID).

GC analysis of biliary cholesterol: Gallbladder bile (2 µl) was transferred into a 16x100mm glass screw top tube containing 10 µg 5α-cholestane and 0.75 ml water. To the tube was added sequentially, 2.25 ml 2:1 MeOH:CHCH3, 1.5 ml CHCH3, and 0.75 ml water. After each addition, the tube was capped and vortexed for 20 seconds. After centrifuging the tube at 1500xg for 10 minutes at room temperature, the organic, bottom phase of the bile extract was transferred to a new 16x100mm glass screw top. The organic solvent was evaporated under nitrogen at 55°C. To saponify the lipid, 1 ml 95% EtOH and 100 µL 50% KOH was added to the tube which was then sealed with a Teflon-lined cap and incubated at 60°C for 3 hours with periodic vortexing. The cholesterol was extracted from the sample by adding 1 mL hexane followed by 1 mL water with vortexing (20 seconds) between each addition. The tube was centrifuged at 1500xg for 10 min at room temperature. The upper hexane phase was transferred to a glass 12x75 mm tube. After evaporating the hexane as described above, the dried cholesterol was dissolved in 50 µl hexane and transferred to a tear drop GC vial insert. The sample was then analyzed by GC-FID as described above.

FPLC analysis of lipoproteins: 100 µL of pooled plasma was separated on a Superose column (Amersham) at a flow rate of 0.4 mL/min as described previously (291). Cholesterol in each fraction was measured using the Total Cholesterol E kit (Wako, 439-17501).

VLDL secretion assay in vivo: Mice were fasted for 4 hours prior to intraperitoneal injection with 300 µL of poloxamer 407 in PBS (1000 mg/kg, Sigma). Retro-orbital bleeds using heparinized capillary tubes were performed prior to poloxamer 407 injection (0 h), and then 30 minutes, 1 h, 2 h and 3 h after. Triglycerides from isolated plasma samples were quantified using L-Type Triglyceride M Enzyme kit (Wako Diagnostics), as specified by the manufacturer,

100 and total cholesterol was measured by the Clinical Chemistry department at The Centre for Phenogenomics (Toronto).

Triglyceride secretion in IL-6 treated primary mouse hepatocytes: Primary mouse hepatocytes were isolated as described before (352, 353) and cultured in DMEM/F-12 (Gibco, Waltham) with 2 mM L-Glutamine (Sigma-Aldrich Canada Co., Oakville), 10% fetal calf serum (Sigma-Aldrich Canada Co.), 1% ITS-A (Gibco), 1% Penicillin/Streptomycin (Wisent Inc. Saint- Bruno), and 0.04 µg/mL EGF (Sigma-Aldrich Canada Co.). 0.5-1.0 x 106 cells were plated onto one well of a collagen-coated 12-well plate. Non-adherent/dead cells were removed after 4 h and cells were then cultured over-night. The following day, media was changed followed by the addition of recombinant mouse IL-6 (Peprotech, Cat. #216-16) for 6 h. Media was collected (1 mL total volume) and 100 µL was used to measure triglycerides using the L-Type Triglyceride M Enzyme kit (Wako Diagnostics), as specified by the manufacturer.

Cholesterol efflux assays and oxLDL uptake assays: Bone marrow cells were harvested from femurs of wild-type and miR-146a-/- mice and differentiated into macrophages for 7 days in differentiation media (DMEM with 10% (v/v) FBS, 20% (v/v) L929 conditioned media and 1% (v/v) penicillin and streptomycin) to generate bone marrow-derived macrophages (BMDMs). Cholesterol efflux experiments were performed essentially as previously described (291, 354). BMDMs were cholesterol-loaded with 37.5 µg/mL acetylated LDL (Alfa Aesar) and labeled with 1 µCi/mL [3H] cholesterol (Perkin Elmer) for 24 h. BMDMs were washed extensively with PBS and equilibrated in 2% fatty acid-free BSA in DMEM media for 4 h prior to being treated with 50 µg/mL apoA1 (Alfa Aesar) (or BSA alone, where indicated) for 6 or 24 h. Medium and cellular [3H] were counted and expressed as a percentage of total cellular [3H] cholesterol content.

Peritoneal macrophages were isolated from mice injected with 1 mL of thioglycolate 4 days prior. Peritoneal macrophages were grown overnight in DMEM with 10% FBS and Penicillin/Strep. Prior to flow analysis, macrophages were treated with 4 uL of DiI-MOX-LDL (5mg/mL) (Kalen Biomedical, LLC) for 2 hours.

101

Enzyme-linked immunosorbent assay (ELISA): IL-6, TNF-α and soluble ICAM-1 protein was quantified from plasma isolated from mice that were fasted overnight using Quantikine ELISA kits from R&D Systems, according to the manufacturer’s recommendations.

Plaque measurement from aorta: Mice were perfused with PBS followed by 2% paraformaldehyde before extraction of the aorta. Adipose tissues were removed from the aorta before staining with Oil Red-O (ORO) (Sigma-Aldrich). Stock stain was 0.3 g/10 mL isopropanol. Working solution stain was comprised of a 3:2 ratio of stock ORO to water. Aortas were stained for 30 minutes followed by 2 washes of 60% isopropanol. The aortic arch and descending thoracic aorta were pinned for en face plaque area measurement and pictures were captured using a stereo microscope (Leica M165FC). Plaque percentage was calculated using ImageJ.

Combined in situ PCR and immunostaining: Sections (4 µm thick) from aortic root were fixed with Paxgene (Qiagen) and incubated with recombinant DNase I (Roche) overnight in SecureSeal™ hybridization chambers (Applied Biosystems) at 37°C. In situ PCR was performed with a miR-146a-5p ultramer extension primer (GACCCCTTAATGCGTCTAAAGACCCCTTAATGCGTCTAAAGACCCCTTAATGCGTCT AAAAACCCATGGAATTCAGTTCTCA) in digoxigenin-labeled PCR system at 50°C for 30 min in a Thermoblock (Eppendorf). After stringent washing with SSC buffer and blockade of nonspecific binding sites using TNB (Perkin Elmer) and biotin/avidin binding sites using a blocking kit (Vector Lab), sections were incubated with a peroxidase-conjugated anti- digoxigenin antibody (Fab fragments from sheep, 1:100 dilution; Roche) for 1 h at 37°C. A tyramide-based amplification system (TSA Plus Biotin; Perkin Elmer) and Dylight 549– conjugated streptavidin (KPL) were used to visualize the probe. Sections were subsequently incubated with anti-CD31 (PECAM-1) antibody (Santa Cruz, sc-1506, goat polyclonal, 200µg/ml) followed by anti-goat FITC secondary antibody (Jackson ImmunoResearch, 705-165- 147; diluted 1:100 in PBS). For Mac-2 staining, supernatant of cultured M3/38.1.2.8 HL2 cells

102

(ATCC TIB-166) were used as Primary Mac-2 antibody (one drop approximately 50µl) followed by either anti-rat Cy5 (diluted 1:200 in PBS, purple) or anti-rat FITC (diluted 1:100 in PBS, green) secondary antibody.

Western blotting: Western blotting was performed as described (349). The following antibodies were used: TRAF6 (Santa Cruz, D-10), HuR (Santa Cruz, 3A2), and GAPDH (Santa Cruz, 0411). HRP-conjugated secondary antibodies were from Cell Signaling or Santa Cruz, and blots were developed using SuperSignal West Pico Chemiluminescence Substrate (Pierce). For phospho-p65 western blots, 25 µL of Dynabeads® M-280 sheep anti-mouse IgG were mixed with 500 µL of ChIP dilution buffer and rotated for 10 min at 4 °C. Then, 5 µL of the anti-p65 rabbit polyclonal antibody (Santa Cruz Biotechnology, sc-372) was added to the mix and incubated at 4°C overnight with rotation. Afterwards, 150 µg of cell lysate was added to the antibody-Dynabeads mix and rotated overnight at 4°C. Beads were collected using a magnetic separator. The supernatant was removed and beads were washed four times with RIPA buffer. After washing, 30 µL of 4x loading buffer was added to the magnetic beads. Beads were heated at 95°C for 10 min and the supernatant was loaded to a 12% SDS-PAGE gel and Western blotting was performed using anti-p65 (the same as used for IP) and anti-phospho-p65 (Cell Signaling, Cat. #3033) antibodies. Anti-Actin antibody (Sigma, Cat. #A2066) was used as a loading control.

Statistical analyses: Unless otherwise indicated, data represent the mean of at least three independent experiments and error bars represent the standard error of the mean. Pair‐wise comparisons were made using a Student’s t‐test. Comparison of three or more groups was performed using a 1‐way analysis of variance (ANOVA) with Newman–Keuls post hoc test. A p‐ value of 0.05 or less was considered to be statistically significant. In all figures *, ** and *** represent a p‐value of 0.05, 0.01 and 0.001, respectively.

103

3.4 RESULTS:

MiR-146a expression is increased in endothelial cells and intimal cells during murine atherogenesis – Ldlr-/- mice were placed on a high cholesterol diet (HCD) for 18 weeks to visualize the expression of miR-146a in atherosclerotic plaque (Fig. 3.1A). In situ PCR on aortic root cross-sections revealed that miR-146a was expressed in intimal cells including Mac-2+ macrophages and was robustly expressed in CD31+ ECs. The in situ signal was specific for miR-146a, as staining was not detected in miR-146a-/- mice (Fig. 3.1A). Expression of miR-146a in the aortic root appeared to progressively increase in the intima during the progression of atherosclerosis (Suppl. Fig. 3.1). The absence of signal in the media implies that contractile SMCs in the aortic root do not express miR-146a at sufficient levels to be detected by this technique. Additionally, using quantitative RT-PCR (qRT-PCR) at an early stage of atherogenesis (i.e. Ldlr-/- mice, 4 weeks HCD) we found a significant elevation of miR-146a expression in the lesser curvature (LC) of the aortic arch, a region of the aorta where atherosclerotic plaque forms, compared to regions that are protected from atherosclerosis, namely the greater curvature (GC) of the aortic arch and the descending thoracic aorta (DTA) (Fig. 3.1B,C). However, miR-146a expression was at appreciable levels in all regions examined (not shown), which may reflect the known expression of miR-146a in the vascular endothelium (349).

104

A -/- Ldlr -/- ; miR-146a -/- Ldlr

B C qRT-PCR 8 ** * n o i 6 ess r p x

LC E 4 GC DTA 146a - 2 R i root m 0 C C A G L T D

Figure 3.1. MiR-146a is expressed in murine atherosclerotic plaques.

(A) Cross-sections of Ldlr-/- or Ldlr-/-;miR-146a-/- mouse aortic roots after 18 weeks of high cholesterol diet (HCD). Expression of miR-146a, assessed by in situ PCR (red) overlaps with Mac-2 positive macrophages (purple) and CD31 positive endothelial cells (EC) (green) in the intima, and signal is absent in miR-146a-/- mice. See Suppl. Fig. 3.1 for miR-146a expression during the progression of atherosclerosis. (B) Schematic of the aorta, indicating the aortic root Figure(examined 1 in panel A), the greater curvature (GC, athero-protective) and lesser curvature (LC, athero-susceptible) of the aortic arch and the descending thoracic aorta (DTA, athero-protective). (C) Expression of miR-146a (normalized to U6 levels) in the specified regions of the aorta in Ldlr-/- mice after 4 weeks of HCD (n = 5).

105

Global deletion of miR-146a activates pro-inflammatory pathways yet suppresses atherogenesis, and is accompanied by reduced circulating LDL cholesterol levels in mice on HCD – To elucidate the role of miR-146a during atherogenesis we generated global double knockout (DKO; miR-146a-/-; Ldlr-/-) mice by crossing miR-146a-/- mice with Ldlr-/- mice. Two time-points (12 and 18 weeks of HCD) were assessed to determine the effect of miR-146a on the progression of atherosclerotic phenotypes (Fig. 3.2A). Analyses of male and female mice were grouped together as we found no significant differences between sexes for the parameters measured, except for body weight (not shown). At the 12-week time-point, no differences in body weight (Fig. 3.2B) or aortic arch plaque burden (Fig. 3.2D) were observed between Ldlr-/- and DKO mice. However, the circulating inflammatory marker, IL-6, was elevated in the majority of DKOs at this stage, although the difference did not reach statistical significance (Fig. 3.2E). By 18 weeks, despite no differences in body weight (Fig. 3.2B) or food intake (Fig. 3.2C), DKO mice surprisingly had less lipid plaque in the aortic arch (Fig. 3.2D). This decrease in atherosclerosis occurred despite signs of elevated systemic inflammatory signaling, including enhanced circulating levels of sICAM-1 and IL-6 (Fig. 3.2E). Atherosclerotic plaque formation was unaltered in the descending thoracic aorta of DKO mice: this region is typically protected from atherosclerosis (Suppl. Fig. 3.2A). Plaque burden in the aortic root was also comparable between groups (Suppl. Fig. 3.2B,C).

Unexpectedly, DKO mice displayed progressive lipid metabolism defects, resulting in lower circulating total cholesterol and LDL cholesterol. High-density lipoprotein (HDL) levels and triglyceride levels were modestly affected (Fig. 3.2F). Assessment of lipoprotein profiles by FPLC revealed a striking decrease in cholesterol content in very low-density lipoprotein (VLDL) fractions (Fig. 3.2G). Measurement of total cholesterol and triglyceride levels in the liver revealed no significant differences at 12 weeks (Fig. 3.2H) or 18 weeks of HCD (Suppl. Fig. 3.2D). Likewise, cholesterol levels in bile and feces were unchanged at 12 weeks of HCD (Fig. 3.2H). Assessment of VLDL secretion from the liver suggested a decrease in cholesterol and triglyceride secretion in DKO mice (Fig. 3.2I). Taken together these data demonstrate that lack of miR-146a decreases circulating VLDL/LDL cholesterol yet paradoxically enhances inflammatory signaling in mice on a pro-atherogenic diet

106

A B C ) %

HCD ( 100 )

g 30 (

ng t i n gh i

10 weeks 18 weeks i a e 20 m 12 weeks w

e 75 analysis y -/- R

Ldlr od

analysis B 10 Ldlr -/- ; miR-146a -/- (DKO) Food 0 50 12w HCD 18w HCD 0 1 2 3 4 5 6 Days on Diet

D 60 * Ldlr -/- Ldlr -/- E *** 20 ) )

% 800 ( L 15 ) m

O * / 40 L R m ng / O (

1 10 pg c ( r

M-

600 6

A DKO DKO -

L c 20 I i CA t I

r 5 s o A

0 400 0 12w HCD 18w HCD 12w HCD 18w HCD 12w HCD 18w HCD 12w HCD 18w HCD ) ) g 200 150 / g /

F 400 H g ) g m ( m )

1500 ( g/dL l es

o 150 m r d ( 300 g/dL i e r

t 100 m ol (

es er 1000 l yce t l es 100 * g

200 ho i es id r C

* T

c hol i *** 50 c i t ycer C ** t

500 a l a 50 100 p igl a p t r e e T h h To a a r r t t n

0 I 0 0 n 0 1 6 9 12 18 1 6 9 12 18 I Weeks on HCD Weeks on HCD 4 100 250 100 ) ) ) g ) L m / μ

/ 80

80 g g/dL

200 g g/dL 3 * μ μ ( ( m m l ( ( l o o

r 60 ol ol 60 r e 150 r e t t e er **

t 2 t

* es es l l es es 100 40 40 ho ho hol hol C C

l C C 1 e L L 20 50 20 il D eca * B L F HD 0 0 0 0 1 6 9 12 18 1 6 9 12 18 Weeks on HCD Weeks on HCD ) ) G L I 1000 2000 μ 15 ) dL

VLDL / g dL 100

/ 800 m

g 1500 / ( g l m ( μ

10 o

(

600 r l e es t o

r 1000 d i e es r t 400 l es l

5 ho yce l

C 500 g ho l

i 200 r C IDL/LDL a t

l HDL T a t 0 0 To 0

To 5 0 5 0 5 0 0 0.5 1 2 3 0 0.5 1 2 3 1 2 2 3 3 4 Fraction Time post-injection (h) Time post-injection (h) Figure 2 Figure 3.2. Reduced atherosclerosis in mice with global deletion of miR-146a.

107

(A) Schematic of HCD regimen for Ldlr-/- and Ldlr-/-;miR-146a-/- (DKO) mice. (B) Weights of male mice after 12 or 18 weeks HCD (n = 3-5). Weights of female mice were also unchanged between genotypes (not shown). (C) Food consumption in mice (n = 4 mice per cage). T0 is 18 weeks of HCD. (D) Percentage of Oil Red-O (ORO) regions quantified from aortic arches of Ldlr-/- and DKO mice after HCD for 12 or 18 weeks. Representative images are shown to the right. The descending side of the aorta is to the right. See Suppl. Fig. 3.2 for aortic root and descending thoracic aorta analysis. n = 18-22 for 12 week time-point and n = 4 for 18 week time- point. (E) Circulating levels of pro-inflammatory markers, IL-6 and sICAM-1 in wild-type and DKO mice (n = 5-8). (F) Time-course of plasma cholesterol measurements (n = 3-5; one group of mice were used for weeks 1, 6 and 9, and a separate group was used for weeks 12 and 18). Mice were fasted overnight prior to sample collection. (G) FPLC trace of cholesterol content in lipoprotein fractions in plasma after 18 weeks of HCD (pooled analysis of 5 samples). (H) Intrahepatic cholesterol and triglyceride levels in mice after 12 weeks HCD (n = 13-14). See Suppl. Fig. 3.2D for 18 weeks HCD. Bile cholesterol (n = 3) and fecal cholesterol (n = 4) in mice after 18 weeks HCD. (I) Assessment of VLDL secretion by measurement of triglycerides and cholesterol in plasma following injection of Poloxamer 407 (12 weeks HCD; n = 4, 2).

Deletion of miR-146a in BM-derived cells enhances inflammatory signaling, yet paradoxically suppresses atherogenesis and alters cholesterol metabolism – Next we performed BM transplantation experiments to elucidate the role of miR-146a in BM-derived cells during atherogenesis. Ldlr-/- mice were lethally irradiated and reconstituted with either miR-146a+/+ (WT) or miR-146a-/- (KO) BM (Fig. 3.3A). Reconstitution of hematopoiesis following transplantation of WT or KO BM cells appeared to be normal, as circulating levels of leukocytes and lymphocytes were similar 8 weeks after BM transplantation, prior to the administration of HCD (Suppl. Fig. 3.3A). Body weight was similar between the two groups after 12 weeks of HCD (Fig. 3.3B), as was food intake (Fig. 3.3C). While lipid plaque burden was not significantly altered at early stages (i.e. 4 weeks HCD), mice receiving KO BM developed less lipid plaque in the aorta following 12 weeks of HCD (Fig. 3.3D; Suppl. Fig. 3.3B), and markers of macrophage content in the aortic arch were reduced (Suppl. Fig. 3.3C). Plaque burden in the descending thoracic aorta (Suppl. Fig. 3.3B) and aortic root (Suppl. Fig. 3.3D) appeared to be unchanged. The decrease in plaque burden in the aortic arch was paradoxically accompanied by

108 signs of systemic inflammatory signaling, with higher levels of circulating soluble intercellular adhesion molecule (sICAM-1), interleukin-6 (IL-6), and tumour necrosis factor alpha (TNF-α) detected in the plasma of mice receiving KO BM after 12 weeks of HCD (Fig. 3.3E), with a trend towards elevated IL-6 levels being observed after 4 weeks of HCD (Fig. 3.3E). These findings suggest that loss of miR-146a expression in BM-derived cells surprisingly results in reduced atherosclerosis, despite the ability of miR-146a to restrain inflammatory signaling. The similarity in phenotypes observed in DKO mice and mice receiving KO BM suggests that loss of miR-146a function in BM-derived cells is the predominant contributor to the observed phenotypes.

Interestingly, we found a progressive decrease in total cholesterol, LDL, triglycerides (TG) and HDL levels in the plasma of mice receiving KO BM (Fig. 3.3F). FPLC revealed a marked reduction in cholesterol content in VLDL fractions (Fig. 3.3G). However, levels of total and free cholesterol and triglycerides in the liver were not significantly different (Fig. 3.3H), neither were cholesterol esters (not shown), and fecal cholesterol levels were also unchanged (Fig. 3.3H). To determine potential mechanisms for the altered lipid metabolism we assessed gene expression in livers of Ldlr-/- and DKO mice (18 weeks HCD), and Ldlr-/- mice receiving WT or KO BM (12 weeks HCD). We observed an elevation of a macrophage marker (F4/80), as well as several pro-inflammatory cytokines such as IL-1β and IL-6, and an increase in IL-10, in DKO livers and in the livers of Ldlr-/- mice receiving KO BM, compared to their respective controls (Fig. 3.3I). Importantly, dysregulation of IL-6 and IL-10 have previously been implicated in altered lipid metabolism (355-357). Indeed, we found that exposing primary hepatocytes to IL-6 decreased triglyceride secretion (Fig. 3.3J). Acute phase response genes were elevated in DKO livers, but not in recipients of KO BM (not shown). We also assessed the expression of a panel of 84 lipid signaling and cholesterol metabolism genes by qRT-PCR arrays. A small number of genes were significantly dysregulated in either experimental group (9 genes in DKOs compared to Ldlr-/- mice, and 19 genes in KO BMT recipients compared to WT BMT recipients) (Suppl. Fig. 3.4, Suppl. Table 3.1). However, the only genes that were significantly decreased in both models were ApoB (1.25-fold decrease in DKOs vs. Ldlr-/- and 1.61-fold decrease in KO BMT vs. WT BMT recipients) and Cnbp (1.43-fold decrease in DKOs vs. Ldlr-/- and 1.69-fold decrease in KO BMT vs. WT BMT recipients), but these changes were modest. Although not on the qRT-PCR array, we also assessed the expression of Sort1, since it

109 is a known regulator of circulating LDL levels that was identified by GWAS in humans (358), and it has been shown to promote IL-6 signaling and secretion in macrophages in mouse models (359). Interestingly, Sort1 is also predicted to be a miR-146a target gene (Fig. 3.3K). We found that Sort1 expression in the liver was elevated in both models (2.21-fold increase in DKOs vs. Ldlr-/- and 1.68-fold increase in KO BMT vs. WT BMT recipients) (Fig. 3.3I). Furthermore, we confirmed that Sort1 is a bone fide miR-146a target gene by luciferase assay (Fig. 3.3K). Thus, loss of miR-146a from BM-derived cells perturbs cholesterol metabolism, potentially through dysregulated NF-κB-dependent inflammatory pathways in the liver, including macrophage accumulation and IL-6 secretion, and perhaps through regulation of Sort1. Of note, despite the lower levels of VLDL/LDL cholesterol, miR-146a-/- mice display an exaggerated inflammatory response to HCD.

12 weeks HCD A B 40 C D 40 ) ** WT BM HCD ) Irradiation / Transplant 100 % ( % (

) O

g 30

d 30 (

10 weeks 8 weeks 12 weeks ng e t 75 i R n i 4 weeks gh i a +/+ e miR-146a (WT) BM analysis 20 Oil 20

-/- m

50 h Ldlr w e c

-/- y analysis r miR-146a (KO) BM R KO BM

c 10 B 10 25 i t r o Food A 0 0 0 E 1000 50 22 0 1 2 3 4 5 6 7 ** *** 4w HCD 12w HCD * Days on Diet ) 40 L ) 20 ) L m / L

800 m G H / m /

ng 30 ) (

ng L ( 80 6 1

ng 18 ) 60 μ 15 ( ) ) )

g - M- g 6 g g / / 20 / m - 150 F / g g g 100 600 L g N I VLDL CA

m 60 μ m m / I T ( ( ( (

g s 4 l C 10 μ 40 C G 10 o ( r T F T

100 e t c c c o i i 40 i r t t t e es a a 400 14 a

0 l t p p p

4w HCD 12w HCD 12w HCD e e 12w HCD e es 2 ho 20 l

5 h h h 50 C

a 20 a a l r r r ho t t t n C IDL/LDL n n I I I l 1000 400 HDL eca a F

F t ) 0 0 0 0 0 ) To 5 0 5 0 5 0 1 2 2 3 3 4

g/dL 800 300 m g/dL Fraction ( m ( ol 600 5’- ...CCAGAUCCUUAAUGUAGUUCUCA ... -3’ human SORT1

er K es t 200 * miR-146a id 3’- UUGGGUACCUUAAGUCAAGAGU-5’ es ** 400 Color Key

hol I J 5’- ... CCGAAUUCCUAGUGCAGUUCUCA ... -3’ mouse Sort1 ycer C

l 100 igl -3 0 3 a r 200 1.5 y 1.5 t t T log 2 value i v To i t evel 0 0 c L * ns IL-10 A

0 4 12 0 4 12 * * e

IL-6 d i 1.0 1.0 Weeks on HCD Weeks on HCD * * r

IL-1b ase * * r e Sort1 yce f 200 100 l i

g * ) * * c ) F4/80 i r

* * T

Tnf-a * Lu 80 g/dL 0.5 0.5 g/dL

150 Mcp-1 ve i m m ve t ( ( * i t -/- a l ol a ol

60 e l r e e R er t t 100 Ldlr ** R

es 0.0 0.0 es l ) ) 40 o L L WT MUT tr m m Sort1 Sort1 hol hol *** DKO(18w vs HCD) on

C ng/ C KO vs(12w WT HCD) BMT c 5 ng/ 3' UTR 3' UTR 50 ( L 20 L 20 6 ( - 6

D IL - IL control mimic miR-146a mimic L HD 0 0 0 4 12 0 4 12 Figure 3 Weeks on HCD Weeks on HCD Figure 3.3. MiR-146a in bone marrow (BM)-derived cells contributes to atherogenesis.

110

(A) Ldlr-/- mice lethally irradiated and given bone marrow (BM) transplantation from wild-type (WT BM) or miR-146a-/- (KO BM) donors followed by HCD for 4 or 12 weeks. (B) Body weights of female mice after 12 weeks HCD (n = 5-7). Weights of male mice were also unchanged (not shown). (C) Food consumption in mice (n = 4 mice per cage). T0 is 12 weeks of HCD. (D) Percentage of Oil Red-O (ORO) regions per aortic arch measured by en face imaging after 4 or 12 weeks HCD (n = 9-11). Representative images of plaque burden in aortas of Ldlr-/- mice with WT BM (top) and KO BM (bottom) after 12 weeks HCD are shown to the right. See Suppl. Fig. 3.3B,D for aortic root and descending thoracic aorta analyses. (E) Circulating pro- inflammatory markers, sICAM-1, IL-6 and TNF-α, measured by ELISA of plasma samples (n = 4-7). (F) Time-course of plasma cholesterol measurement in Ldlr-/- mice receiving WT or KO BM (n = 4-7; one group of mice was used for weeks 0 and 4, and a separate group was used for week 12). (G) FPLC trace of cholesterol content of lipoprotein fractions from plasma after 12 weeks of HCD (pooled analysis of 4 samples). (H) Intrahepatic total cholesterol (TC), free cholesterol (FC) and triglycerides (TG) after 12 weeks HCD (n = 4). Fecal cholesterol levels after 12 weeks of HCD (n = 8). (I) Expression of inflammatory genes, Sort1 and a macrophage marker (F4/80) from liver tissues. Shown is a heat map of qRT-PCR data (n = 4-8). Values are relative to the controls for each group, as indicated. * indicates a significant difference in expression. (J) Triglyceride measurements in the media of cultured primary mouse hepatocytes treated with recombinant mouse IL-6 for 6 h (n = 4). (K) The predicted miR-146a binding in the human and mouse SORT1 3’ UTR (above) and luciferase analyses in BAECs (n = 5).

Diet- and age-dependent hematopoiesis defects in miR-146a-/- mice – Strikingly, the spleens of DKO mice fed HCD for 18 weeks (6-7 months of age) were ~2.5 times larger than Ldlr-/- mice on the same atherogenic diet (Fig. 3.4A). At earlier stages (i.e. 12 weeks of HCD; 5-6 months of age) spleen weight was not significantly changed (Fig. 3.4A). Of note, aged miR-146a-/- mice (>8 months of age) have previously been shown to spontaneously develop splenomegaly, which is accompanied by BM hematopoiesis defects (214). Since we observed a splenomegaly phenotype in young mice on HCD, this suggests that atherogenic diet may accelerate the development of splenomegaly. Similar to global knock-outs, mice receiving KO BM transplants and fed HCD developed larger spleens and had pale femurs, suggestive of BM dysfunction (Fig. 3.4B,C). We previously showed that prolonged hypercholesterolemia results in the outsourcing

111 of hematopoiesis from the BM to the spleen (175). It appears that this phenotype may be accelerated and exaggerated in miR-146a-/- mice, even in the face of lower circulating VLDL/LDL cholesterol levels.

To further investigate the effects of ageing on splenomegaly and atherogenesis, DKO mice were fed a 12-week HCD regime starting at 20 weeks of age (rather than the typical 10 weeks of age) (Fig. 3.4D). In contrast to younger DKO mice, which had unaltered plaque burden in the aorta following 12 weeks of HCD (Fig. 3.2D), older mice had reduced atherosclerosis in the aortic arch following the same duration of diet (Fig. 3.4E). No differences in plaque formation were observed in the descending thoracic aorta (not shown). This reduction in aortic arch atherosclerosis was accompanied by splenomegaly (Fig. 3.4F,G). Importantly, the splenomegaly phenotype at this age was dependent on exposure to HCD, as this was not observed in DKO mice on a regular chow diet (Fig. 3.4F,G). The pale femur phenotype in older DKO mice also appeared to be dependent on exposure to HCD (Fig. 3.4F). The increased spleen size in older DKO mice on HCD corresponded with an increase in splenic CD45+ leukocytes (Fig. 3.4H). Intriguingly, these findings highlight a potential relationship between the reduced atherogenesis observed in DKO mice on HCD, and development of splenomegaly and pale femurs; suggesting that defective hematopoiesis may contribute to the phenotype. While prior studies have linked splenomegaly with reduced circulating cholesterol (360), the contribution of splenomegaly to reduced LDL cholesterol in miR-146a-/- mice remains unclear. While leukocyte content in the spleen at 12 weeks of HCD was not significantly different in DKOs (Suppl. Fig. 3.5A) and spleens were not significantly larger (Fig. 3.4A) − despite reduced levels of plasma cholesterol at this stage (Fig. 3.2F) − mice receiving miR-146a-/- BMT had greatly enlarged spleens at 12 weeks of HCD (Fig. 3.4C), which coincided with reduced circulating LDL (Fig. 3.3F). Furthermore, oxLDL uptake and cholesterol efflux were similar in wild-type and miR- 146a-/- macrophages (Suppl. Fig. 3.5B,C), suggesting that miR-146a deficient macrophages appear to not be more avid at sequestering cholesterol. However, expansion of macrophages in the liver and spleen may contribute to the sequestering of cholesterol from circulation. The contribution of splenomegaly to cholesterol lowering in miR-146a-/- mice will require further exploration.

112

A B C WT BM KO BM Ldlr -/- Ldlr -/- WT BM 0.3 Ldlr -/- 0.3 Ldlr -/- KO BM *** *** Ldlr -/- ) ) DKO g g ( (

t t 0.2 0.2 gh gh i i e e W W

n n ee 0.1 ee 0.1 l l p p S S

0.0 WT BM KO BM 0.0 12w HCD 18w HCD Ldlr-/- Ldlr-/- 12w HCD

60 D HCD E Ldlr -/- (HCD) ) * -/- %

( Ldlr (NCD) 20 weeks 12 weeks

O DKO (HCD) d

e 40 -/- DKO (NCD) Ldlr R DKO Oil h c 32 weeks of NCD r

A 20

c i t

-/- r

Ldlr o DKO A ND 0

F Ldlr -/- DKO G H ) 7

*** *** 0 8 HCD NCD ** * x1 (

0.3 r ) e g b ( 6

t m u gh N i 0.2 e ll e

W 4

n + 5 ee l 4

p 0.1

S 2 CD

n ee l

0.0 p 0 S Figure 3.4. Diet- and age-dependent splenomegaly in DKO mice.

(A) Spleen weight in Ldlr-/- or DKO mice after 12 or 18 weeks of HCD (n = 12-16 for 12 weeks HCDFigure; n = 5 for 4 18 weeks HCD). (B) Representative images of spleens and femurs in WT and KO BMT mice on HCD for 12 weeks. (C) Quantification of spleen weight in WT and KO BMT mice on HCD for 12 weeks (n = 5-7). (D) Mice were placed on HCD or normal cholesterol diet (NCD) at 20 weeks of age for 12 weeks. (E) Percentage of ORO region per aortic arch measured

113 en face (n = 3-4). Ldlr-/- mice on NCD were from a separate experiment and are included for comparison purposes (n = 5). (F) Representative images of spleens and femurs. (G) Quantification of spleen weights (n = 3-4). Ldlr-/- mice on NCD were from a separate experiment and are included for comparison purposes (n = 5). (H) Quantification of total CD45+ cells in spleens by FACS analysis (n = 3-4).

Loss of miR-146a leads to reduced BM hematopoiesis while promoting extramedullary hematopoiesis in the spleen in mice fed a HCD – The enlarged spleens in DKO mice on 18- weeks of HCD contained more CD45+ leukocytes and lymphocytes (Fig. 3.5A; See Suppl. Fig. 3.6 for flow cytometry gating strategies). This was in contrast to the depletion of these cells from the BM of DKO mice (Fig. 3.5B). Prior studies have observed defects in BM hematopoietic stem cell (HSC) longevity in aged (>8 months) miR-146a-/- mice, or in younger mice following repeated challenge with LPS (214). Assessing the spectrum of hematopoietic cells in the BM revealed normal levels of hematopoietic progenitors cells (HPC-1, -2) and HSCs, but levels of multipotent progenitor cells (MPPs) were significantly decreased in DKOs (Fig. 3.5C; Suppl. Fig. 3.7A). The consequences of decreased MPP levels were further evident in the decreased numbers of downstream progenitor cells (e.g. Sca-1 negative progenitors [LS-K], common myeloid progenitors [CMPs], granulocyte-macrophage progenitors [GMPs], megakaryocyte-erythroid progenitors [MEPs]) (Fig. 3.5C). Taken together, these data are suggestive of an HSC functional defect in the BM. Interestingly, despite this defect in HSC function in the BM, HSCs and downstream progenitor cells appeared in the spleens of DKO mice on HCD for 18 weeks but not in Ldlr-/- mice (Fig. 3.5D), demonstrating that loss of miR- 146a accelerates extramedullary hematopoiesis. The dysregulation of hematopoiesis in the spleen and BM was accompanied by modest effects on circulating leukocytes such as neutrophils and B-cells, while anti-inflammatory Ly6Clo monocytes were significantly increased (Suppl. Fig. 3.7B).

114

A Spleen Spleen B Bone Marrow Bone Marrow CD45+ cells Lymphocytes CD45+ cells Lymphocytes

8 6 5 3 ) ) ) )

p=0.052 7 7 7 7

4 0 0 0 *** 0 *** * x1 x1 x1 ( x1 ( (

( 2

r r r r 3 e e e e b b b b 4 3 m m m m u u u u 2 N N N N 1 ll ll ll ll e e e e

C 1 C C C

0 0 0 0 Ldlr -/- DKO

C Bone Marrow Hematopoietic Stem Cells HSC 3 1.5 Ldlr -/- ) ) 6

5 DKO 0

0 MPP x1 x1 ( ( 2 1.0

r r e e b b m m ** -

u LS K u N N 1 0.5 ll ll e e C C * ** * 0 0.0 * Progenitors LSK HPC-1 HPC-2 HSC MPP LS-K CMP GMP MEP (CMP, GMP, MEP)

D Spleen Hematopoietic Stem Cells * 4 ) 5 0

x1 3 (

r e b 2 m u N ll

e 1

C * * * * * * 0 * * - LSK HPC-1 HPC-2 HSC MPP LS K CMP GMP MEP FigureFigure 3.5. Global5 loss of miR-146a inhibits BM hematopoiesis and promotes extramedullary hematopoiesis in the spleen.

115

Increase of splenic (A) and decrease in bone marrow (B) CD45+ leukocytes and Ly6G-/CD115- lymphocytes in DKO mice on diet for 18 weeks, determined by FACS analysis (n = 5). (C) Decrease of MPPs and downstream progenitor cells (e.g. LS-K, MEP, CMP, GMP) in BM of DKO mice after 18 weeks of HCD (n = 5). (D) Increase of splenic hematopoietic and multipotent stem cells in DKO mice after 18 weeks of HCD (n = 5). See also Suppl. Fig. 3.7.

miR-146a in BM-derived cells regulates BM and extramedullary hematopoiesis, and levels of circulating leukocytes and lymphocytes – Similar to the non-transplanted DKO mice on 18 weeks HCD, mice receiving KO BM accumulated more CD45+ leukocytes and lymphocytes in their spleens; however, this occurred following just 12 weeks HCD (Fig. 3.6A). The BM in these mice was depleted of these cells by 12 weeks HCD (Fig. 3.6B). This was accompanied by elevated NF-κB signaling in the BM of KO mice, as well as enhanced expression of TRAF6, a miR-146a target gene (Fig. 3.6C). Progenitors downstream of HSCs, namely MPPs, LS-K, CMPs, GMPs and MEPs were diminished in the BM (Fig. 3.6D), while extramedullary hematopoiesis was evident in mice receiving KO BM (Fig. 3.6E). Correspondingly, mice receiving KO BM had decreased levels of circulating atherogenic leukocytes including neutrophils, B-cells, and Ly6Chi monocytes, but levels of athero-protective Ly6Clo monocytes were increased after 12 weeks of HCD (Fig. 3.6F). Assessing circulating levels of leukocytes and lymphocytes at earlier stages (i.e. 4 weeks of HCD) revealed monocytosis in mice receiving KO BM (Fig. 3.6F), suggesting that the reduction of hematopoiesis at later stages of atherosclerosis is preceded by enhanced hematopoiesis at earlier stages, similar to previous studies that revealed HSC exhaustion in KO mice in the context of repeated LPS stimulation (214).

116

A Spleen Spleen B Bone Marrow Bone Marrow C Bone Marrow CD45+ Cells Lymphocytes CD45+ Cells Lymphocytes 12 weeks HCD 4 *** 3 5 3 *** *** *** WT BM KO BM -/- -/- ) ) ) ) Ldlr Ldlr 8 8 7 7 0 0 0 0 4 3 TRAF6 x1 x1 x1 x1 ( ( ( 2 ( 2

r r r 3 r -actin e e e e b b b 2 b m m m m phospho- u u u 2 u N N N 1 N 1 p65 ll ll ll 1 ll e e e 1 e p65 C C C C

0 0 0 0 Ldlr -/- WT BM Ldlr -/- KO BM

D Bone Marrow E Spleen Hematopoietic Stem Cells Hematopoietic Stem Cells * 15 60 ** 10 40 ) ) 5 5 5 20

x10 10 x10 ( (

r 2 r * e e * ** * b b ** * m ** m u u N N 5 * ll 1 ll * e e ** C C * ** * * * * ** ** * 0 * * 0 - P P P K 1 2 C - K P P P K 1 2 C K S - - S E S - - S PP M M E C PP S M M L C C H S C M L C H M L C G M P P M L G P P H H H H

F PB Ly6Chi PB Ly6Clo PB PB Monocytes Monocytes Neutrophils B Cells ns ns 3 * * * ** * ** ) ) ) ) 6 6 6 6 4 4 4 x10 x10 x10 x10 2 ( ( ( (

r r r r e e e e b b b b m m m m u u u u N N N 2 N 1 2 2 ll ll ll ll e e e e C C C C

0 0 0 0 4w 12w 4w 12w 4w 12w 4w 12w HCD HCD HCD HCD HCD HCD HCD HCD FigureFigure 3.6. 6 MiR-146a in BM-derived cells regulates BM and extramedullary hematopoiesis and levels of circulating leukocytes and lymphocytes.

117

Lethally-irradiated Ldlr-/- mice (mix of males and females) were reconstituted with bone marrow from wild-type (WT BM) or miR-146a-/- (KO BM) donors, followed by HCD for 12 weeks. Increase of splenic (A) and a decrease of bone marrow (B) leukocytes and lymphocytes, as assessed by FACS analysis (n = 5-7). (C) Western blot of TRAF6 and phospho-p65 (normalized to β-actin and total p65, respectively), in mice receiving WT or KO BM after 12 weeks of HCD. Phospho-p65/p65 blots from WT/KO animals are from the same membrane with identical imaging parameters. (D) Decrease of a subset of multipotent stem cells, but no changes to the long-term HSCs in the BM of mice receiving KO BM transplants (n = 5-7). (E) Increase of splenic hematopoietic and multipotent stem cells in mice receiving KO BM (n = 5-7). (F) Early monocytosis (4 weeks HCD), followed by a decrease in peripheral blood (PB) pro-atherogenic cells (neutrophils, B-Cells, and Ly6Chi monocytes), and an increase of anti-atherogenic Ly6Clo monocytes after 12 weeks of HCD (n = 3 for 4 weeks HCD; n = 9-11 for 12 weeks HCD).

We next assessed the functionality of WT (CD45.1) and KO (CD45.2) BM-derived cells in a competitive 1:1 BM transplant. Following reconstitution of the BM compartment of lethally irradiated Ldlr-/- mice for 8 weeks, mice were placed on either normal chow diet (NCD) or HCD diet. Assessing circulating levels of leukocytes in mice fed a NCD revealed that KO BM cells preferentially contributed to neutrophil and Ly6Chi monocyte populations compared to WT BM cells (Fig. 3.7A). A short duration on HCD (4 weeks) expanded the leukocyte populations examined, and KO cells were predominant compared to WT cells (Fig. 3.7A). This was especially the case for neutrophils and Ly6Chi monocytes. However, in mice that received HCD for 12 or 32 weeks, the abundance of KO BM-derived cells were decreased. WT BM-derived cells were less affected (Fig. 3.7A). This suggests that long-term HCD impairs the ability of KO BM-derived cells to contribute to circulating leukocyte populations. Assessing the abundance of WT vs. KO leukocytes in the aorta at advanced stages of atherosclerosis revealed that neutrophils, macrophages and monocytes (Ly6Chi and Ly6Clo) appeared to be primarily WT BM- derived, while B and T cell populations had similar contributions from WT and KO cells (Fig. 3.7B). This was in contrast to the aorta in mice fed a NCD, where the majority of the cells appeared to be derived from KO cells (Fig. 3.7B). Consistent with the reduced abundance of KO BM-derived cells in the circulation and atherosclerotic plaques in mice fed HCD, hematopoietic

118

cells in the BM appeared to be primarily of WT origin under conditions of HCD feeding (Fig. 3.7C). However, the opposite was observed in mice fed a NCD (Fig. 3.7C).

A Peripheral Blood Cells CD45.1 - WT BM CD45.2 - miR-146a-/- BM CD45+ Cells Ly6Chi Monocyte Ly6Clo Monocyte Neutrophils B Cells T Cells 6 8

) 30 ) ) * ) 30 ) )

6 * 5 6 10 6 ** 6 6 0 0 0 0 0 2 0 ** 6 x1 x1 x1 x1 x1 x1 ( ( ( ( (

( 4

r r r r r r e e 20 e e 20 e e b b b b b b 4 m m m m m ** m

u * 5 u u u u 1 u * N N N N N N 2 ll ll ll ll 10 ll

10 ll e e e e 2 e e C C C C C C

0 0 0 0 0 0 ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) D w w w D w w D w w D w D w w w D w w w 4 4 w 4 w 4 w w 4 4 NC ( 12 32 NC ( 12 32 NC ( 12 32 NC ( 12 32 NC ( 12 32 NC ( 12 32 ( ( ( ( ( ( ( ( ( ( ( ( HCD HCD HCD HCD HCD HCD HCD HCD HCD HCD HCD HCD HCD HCD HCD HCD HCD HCD

B Aortic Cells (NCD, 32w) Aortic Cells (HCD, 32w)

60 60 ) ) 2 2 0 0 x1 x1 ( (

r 40 40 r e e b b m m u u N 20 N 20 ll ll e e C C

0 0 i i s h lo s s s h lo s s il ll ll il ll ll M e e M e e C -C y6C y6C -C -C oph y6C y6C - roph L T tr L L B T t L B u u e e N N

C Bone Marrow Hematopoietic Cells (NCD, 32w) Bone Marrow Hematopoietic Cells (HCD, 32w) ) ) )

) 6 6 5 4 4 5 0 0 0 20 0 20 x1 x1 x1 x1 ( ( ( (

r r r r e e e e 4 4 b b b b m m m m u u u 10 u 10 N N N N ll ll ll 2 ll 2 e e e e C C C C

0 0 0 0 1 2 - K P P P 1 2 - K P P P K - - C P E K - - C P E S C C S P S M M S C C S P S M M L P P H M L C G M L P P H M L C G M Figure 7 H H H H Figure 3.7. miR-146a deficient cells appear to be out-competed by wild-type cells in the bone marrow, circulation, and in atherosclerotic plaques in HCD-treated animals, but not in NCD-treated animals.

Competitive bone marrow transplantation was performed into Ldlr-/- recipients. A 1:1 mix of BM from WT (CD45.1) and KO (CD45.2) was used. (A) Peripheral blood was analyzed by FACS following NCD or HCD for 4, 12 or 32 weeks (n = 8, 5, 4, 2, respectively). Comparison was made between WT and KO within each time-point. Cells in the aorta (B) and the bone

119 marrow (C) were analyzed by FACS in animals receiving NCD or HCD for 32 w (n = 2 per group).

MiR-146a in the vasculature restrains EC activation and atherosclerosis – Deletion of miR- 146a has a major effect on BM-derived cell function, promoting systemic inflammatory signaling, extramedullary hematopoiesis, BM failure and lipid dysregulation. To further distinguish the role of miR-146a in BM-derived cells versus the rest of the body, we transplanted lethally irradiated Ldlr-/- and DKO mice with miR-146a+/+ (WT) BM (Fig. 3.8A). Transplanted mice were placed on HCD for 12 weeks. Interestingly we found no differences in circulating IL- 6, sICAM-1, or TNF-α levels (Fig. 3.8B) or circulating cholesterol or lipoproteins (Fig. 3.8C). This suggests that the dysregulation of inflammation and circulating lipoprotein levels are dependent on deletion of miR-146a from BM-derived cells, rather than in other cell types, such as hepatocytes. In addition, no changes were observed in spleen size (Fig. 3.8D). Levels of leukocytes in the spleen and in the circulation were also normalized, and only a modest decrease in leukocyte levels in the BM was seen (Fig. 3.8E). Interestingly, NF-κB-dependent cytokines known to accelerate HSC proliferation (i.e. IL-6, TNF-α and IL-10) (214, 361, 362) were highly expressed in the BM of Ldlr-/- mice reconstituted with KO BM, but this was not observed in DKO mice reconstituted with WT BM (Fig. 3.8F). Finally, with the normalization of these parameters following transplantation of wild-type BM in DKO mice, lipid plaque burden in the aorta was elevated compared to Ldlr-/- mice receiving wild-type BM transplant (Fig. 3.8G).

To determine whether miR-146a in the vasculature affects EC activation in the aorta, we stimulated WT or KO mice with the pro-inflammatory cytokine, IL-1β. We found that miR-146a target genes (e.g. HuR and TRAF6) were elevated in the aortic arch of KO mice, and that levels of VCAM-1, E-Selectin (SELE) and ICAM-1 were induced to a greater extent in KO compared to WT mice (Suppl. Fig. 3.8A,B). In the setting of atherosclerosis, we found that expression of adhesion and chemokine genes appeared to be elevated in intimal cells of the aorta from DKO mice receiving WT BM compared to Ldlr-/- mice receiving WT BM (Suppl. Fig. 3.8C). These observations are consistent with our previous study that demonstrated that miR-146a restrains EC activation (349).

120

A Irradiation / Transplant HCD

10 weeks 8 weeks 12 weeks

-/- Ldlr miR-146a+/+ (WT) BMT DKO

B 1000 40 40 C 1000 ) ) dL / ) L g )

L 750 m m / L (

800 m

/ m / ng ( on

ng i ( t 1

ng 20 20 500 ( a

r - M- t 6 - F n

600 L N I CA ce I T 250 s on C 400 0 0 0 l l l s e l o o o e s ta r L r L r o te D te te id c To L HD es es es ycer Glu hol hol hol C C C rigl T D E Spleen Bone Marrow Peripheral Blood CD45+ Cells CD45+ Cells CD45+ Cells 0.3 6 8 10 ) ) ) ) 6 7 * 8 g 0 0 ( 0

t x1 x1 x1 ( (

0.2 (

i r r r e e e e b b b W 3 4 5

m m m n u u u N N ee 0.1 N l ll ll ll p e e e S C C C

0.0 0 0 0

F ns G Ldlr -/- WT BMT 4 ns 60 ns

14 * ) 40 * % A *** A ** A 50 ( O RN

3 RN

RN 10

R 30

m 40 m

O 0 6 - h - 1 f

6 -

30 c L I r

2 L

3 I Tn 3 20

WT BMT ve i

c DKO ve ve i t i i t t 2 t 2 a r l a a l l 1 o

e 10 e e A R 1 R R 1

0 0 0 0 WT BMT KO BMT WT BMT Ldlr -/- Ldlr -/- DKO

Figure 3.8. MiR-146a in the vasculature restrains EC activation and atherosclerosis. Figure 8 (A) Schematic of lethally-irradiated Ldlr-/- or DKO mice given bone marrow transplantation from wild-type (WT BM) donors followed by HCD for 12 weeks. (B) Circulating pro-

121 inflammatory markers, sICAM-1, IL-6 and TNF-α, measured by ELISA (n = 5-8). (C) Circulating cholesterol, HDL, TG, LDL and glucose levels after 12 weeks of HCD (n = 5). (D) Quantification of spleen weight after 12 weeks of HCD (n = 12-15). (E) FACS analysis of myeloid cells from spleen, BM, and peripheral blood (n = 12-15). (F) Gene expression in BM cells from BM transplanted animals (n = 3-7). (G) Percentage of ORO region per aortic arch measured by en face staining (n = 11-14). Representative images are shown to the right. See also Suppl. Fig. 3.8 for data on endothelial cell activation in the aorta.

122

3.5 DISCUSSION:

MiR-146a has been identified as a vital brake in inflammatory signaling pathways (197,

214, 309, 349) and levels are elevated in human atherosclerotic plaques (312). Recent studies have also uncovered a single nucleotide polymorphism in the miR-146a gene that influences miR- 146a expression and susceptibility to coronary artery disease (313-316). However, no studies have directly assessed the function of endogenous miR-146a during atherogenesis. Here we report that deletion of miR-146a within BM-derived cells surprisingly reduces atherosclerotic plaque formation, while deletion of miR-146a in the vasculature enhances endothelial activation and atherogenesis. These diverse phenotypes arise from a common defect in distinct cellular compartments, namely unrestrained NF-κB-dependent inflammatory signaling. To our surprise, ablation of miR-146a from BM-derived cells reduced atherosclerosis, while paradoxically elevating indices of systemic inflammatory signaling (i.e. pro-inflammatory cytokines and sICAM-1) (see Suppl. Fig. 3.9 for an overview of miR-146a deficient phenotypes). This increase in circulating cytokines would typically be accompanied by abundant inflammatory immune cells in circulation. However, we observed a decrease in pro-atherogenic cells including Ly6Chi monocytes, T-cells and neutrophils, and an increase in athero-protective Ly6Clo monocytes. This implies that miR-146a deficient leukocytes present in circulation are likely to be especially pro-inflammatory, demonstrating that miR-146a is important in quelling their activation. The paucity of circulating immune cells is the consequence of defective BM hematopoiesis, which likely arises due to hematopoietic cell exhaustion. Hypercholesterolemia stimulates hematopoiesis in the BM and spleen to produce pro-inflammatory cells, such as Ly6Chi monocytes that contribute to plaque growth (159, 175, 363-365). We find evidence of precocious monocytosis at early stages of atherogenesis in mice that received miR-146a-/- BM. In addition, transplanted miR-146a deficient cells out-compete transplanted wild-type cells in the BM and in circulation during early atherogenesis. However, prolonged exposure to hypercholesterolemia appears to lead to a defect in the contribution of miR-146a-/- cells to hematopoietic cell populations in the BM, circulation and in atherosclerotic plaques, implying that activation of BM hematopoiesis by HCD can not be sustained in the absence of miR-146a. Consequently, these mice initiate extramedullary hematopoiesis in the spleen. Although spleen- derived Ly6Chi monocytes can contribute to atherogenesis (175), the circulating cells generated

123 in the spleen of mice receiving miR-146a deficient BM appear to be insufficient to compensate for the reduction in leukocyte output from the BM. Defects in hematopoiesis have previously been observed in aged miR-146a-/- mice (214). In this case, older mice (>8 months of age) developed a progressive loss of hematopoietic stem and progenitor cells (HSPCs) as a result of increased NF-κB-dependent IL-6 production in the BM. Enhanced IL-6 production in miR-146a-/- mice promoted hematopoietic cell proliferation leading to eventual exhaustion. This phenotype could be accelerated by repeated challenge with LPS, which drives IL-6 production (214). Similarly, in our model of atherosclerosis we observed an increase in TRAF6 expression, NF-κB activity, and IL-6 expression (an NF-κB- regulated cytokine) in the BM, as well as IL-6 protein levels in circulation. Since hypercholesterolemia drives stress-induced hematopoiesis (159, 172, 174) and premature HSC ageing and senescence (366), it is likely that increased cycling of hematopoietic cells leads to stem cell exhaustion in the absence of miR-146a. A notable phenotype observed in both the global and BM-restricted miR-146a loss-of- function models, is the reduction in VLDL/LDL cholesterol in circulation. Defects in cholesterol homeostasis in miR-146a global knock-outs could be rescued by transplantation of wild-type BM, demonstrating that miR-146a in BM-derived cells, rather than hepatocytes, regulates lipid metabolism. It is important to note that the defects that we observe in miR-146a-/- mice (i.e. enhanced levels of circulating cytokines, monocytosis, outsourcing of hematopoiesis to extramedulary sites, splenomegaly and eventual BM failure) are known to be driven by hypercholesterolemia (159, 175, 365). That we observe these phenotypes even in the face of lower VLDL/LDL cholesterol suggests that it is not lower cholesterol per se that is solely responsible for the decrease in atherosclerosis in these mice, although it likely contributes to altered initiation and progression of atherosclerosis. MiR-146a-/- mice are especially sensitive to the inflammatory effects of hypercholesterolemia (even though VLDL/LDL cholesterol levels are decreased), and the hematopoietic phenotypes that we observe are not apparent in mice fed a normal cholesterol diet. The reduced atherosclerosis appears to be at least partly attributable to an unchecked chronic inflammatory response to hypercholesterolemia that drives BM hematopoiesis defects and a decrease in circulating pro-atherogenic inflammatory cells. The role of miR-146a in monocyte recruitment and macrophage biology in the plaque has not been explored here, but should be assessed in future studies.

124

We demonstrate that a lack of miR-146a appears to impair VLDL secretion from the liver. This is accompanied by macrophage accumulation, inflammatory gene expression (including IL-6) as well as an increase in Sort1 expression in the liver; each of which may contribute to the phenotype. Although miR-146a deficient bone marrow-derived macrophages have unaltered oxLDL uptake and cholesterol efflux, the expansion of macrophages in the liver or spleen may influence circulating cholesterol levels through cholesterol sequestration. Altered VLDL secretion also occurs in response to pro-inflammatory cytokines such as IL-6 (367-369), and we confirm that exposure to IL-6 reduces triglyceride secretion from cultured primary mouse hepatocytes. Finally, we identify Sort1 as a novel miR-146a target gene. SORT1 has been shown to play an important, though controversial role in VLDL secretion (370). Genome-wide association studies in humans identified SORT1 as a causative gene in the regulation of circulating LDL levels and risk of atherosclerotic disease (358). Over-expression of SORT1 in the liver of mice enhances VLDL break down in the liver and inhibits secretion (358). SORT1 can also bind extracellular LDL and direct its catabolism (371). However, other studies have found that deletion of Sort1 in mice can also result in reduced LDL levels (359, 372), suggesting that the contribution of SORT1 to cholesterol metabolism remains to be fully resolved. Finally, additional studies found that lack of SORT1 in macrophages can inhibit secretion and signaling of cytokines, such as IL-6 (359), while over-expression can enhance LDL uptake (373). This is of interest considering that Sort1 is likely dysregulated in bone marrow-derived cells in our miR- 146a loss-of-function models. Further studies will be required to delineate the contribution of miR-146a-dependent Sort1 regulation within bone marrow-derived cells to the VLDL/LDL phenotype. Furthermore, additional miR-146a target genes in bone marrow-derived cells may contribute. Our study emphasizes the important role that miR-146a plays in controlling the output of inflammatory signaling pathways in ECs and hematopoietic cells in the setting of an atherogenic diet, and further confirms the critical role of hypercholesterolemia in hematopoietic cell stress. Our findings are intriguing in light of polymorphisms in miR-146a in human patients that alters susceptibility to coronary artery disease. Furthermore, our studies suggest that elevating the expression of miR-146a in BM-derived cells or ECs is likely to suppress human atherogenesis by restraining NF-κB signaling, which is in agreement with recent studies in mouse models (303, 318).

125

3.6 Supplemental Table

Supplemental Table 3.1: Summary of qPCR array of lipoprotein signaling and cholesterol

metabolismSupplemental*Table*1:*Analysis*of*qPCR*array*of*lipoprotein*signaling*and*cholesterol*metabolism*genes. genes (differentially regulated genes are highlighted in red).

Gene Relative*change: tAtest: Relative*change: tAtest: DKO*vs!Ldlr&/&!(18*w) p*value miRA146aA/A*BMT*vs* p*value (n*=*4) WT*BMT*(12*w)*(n*=*4) Abca1 0.822 0.140 0.694 0.018 Abca2 1.025 0.902 0.677 0.093 Abcg1 1.020 0.917 1.208 0.477 Acaa2 0.665 0.128 0.475 0.005 Akr1d1+ 0.931 0.600 0.535 0.036 Angptl3 0.930 0.460 0.656 0.115 Ankra2 0.922 0.666 0.791 0.335 Apoa1 0.791 0.196 0.540 0.046 Apoa2 0.861 0.306 0.572 0.084 Apoa4 1.304 0.394 0.868 0.670 Apob 0.805 0.009 0.627 0.048 Apoc3 0.686 0.051 0.434 0.002 Apod 0.793 0.610 0.716 0.665 Apoe 0.487 0.297 0.415 0.214 Apof 0.965 0.759 0.715 0.051 Apol8 2.378 0.197 0.684 0.353 Cdh13 0.941 0.784 0.548 0.067 Cel 0.818 0.716 0.767 0.601 Cela3b+ 3.161 0.288 1594.995 0.423 Cnbp 0.700 0.048 0.593 0.044 Colec12 0.834 0.199 0.558 0.006 Crp 0.871 0.524 0.578 0.081 Cxcl16 0.869 0.315 0.832 0.371 Cyb5r3 1.695 0.038 0.513 0.229 Cyp11a1 1.801 0.351 0.828 0.678 Cyp39a1 0.853 0.289 0.898 0.767 Cyp46a1 1.488 0.169 0.388 0.146 Cyp51 1.823 0.311 0.702 0.326 Cyp7a1 0.449 0.012 0.808 0.600 Cyp7b1 0.640 0.207 0.418 0.057 Dhcr24 1.812 0.042 0.750 0.192 Dhcr7 1.481 0.134 0.575 0.136 Ebp 0.812 0.137 0.668 0.002 Fdft1 0.796 0.358 0.568 0.014 Fdps 2.644 0.198 0.457 0.150 Hdlbp 0.893 0.069 0.794 0.294 Hmgcr 1.223 0.255 0.675 0.261 Hmgcs1 0.950 0.834 0.527 0.043 Hmgcs2 0.543 0.001 0.680 0.187 Idi1 1.787 0.360 0.920 0.793 Idi2 0.004 0.392 1.214 0.693 Il4 0.919 0.867 0.519 0.103 Insig1 1.604 0.055 0.462 0.085 Insig2 0.638 0.007 0.465 0.147 Lcat 0.702 0.002 0.803 0.208 Ldlrap1 0.849 0.504 0.835 0.214 Lep 7.050 0.166 0.347 0.450 Lipe 1.055 0.516 0.780 0.210 Lrp10 0.910 0.281 0.915 0.663 Lrp12 0.643 0.005 0.568 0.076 Lrp1b 0.004 0.392 0.000 0.391 Lrp6 0.866 0.077 0.695 0.023 Lrpap1 0.945 0.599 0.669 0.001 Mbtps1 0.895 0.352 0.692 0.023 Mvd 1.457 0.064 0.738 0.551 Mvk 1.341 0.268 0.652 0.305 Npc1l1 0.001 0.423 0.000 0.422 Nr0b2 0.865 0.570 0.341 0.052 Nr1h4 0.794 0.339 0.861 0.685 Nsdhl 1.716 0.117 0.599 0.219 Olr1 0.857 0.611 0.574 0.177 Osbpl1a 0.848 0.192 0.721 0.025 Osbpl5 0.973 0.929 0.943 0.697 Pcsk9 1.938 0.107 0.478 0.100 Pmvk 1.113 0.492 0.503 0.078 Ppard 1.013 0.877 0.829 0.585 Prkaa1 0.853 0.189 0.994 0.971 Prkaa2 0.817 0.197 0.683 0.023 Prkag2 0.972 0.861 0.679 0.124 Scap 0.910 0.626 0.602 0.183 Scarf1 0.797 0.262 0.789 0.212 Snx17 0.897 0.443 0.798 0.037 Soat1 1.010 0.919 0.880 0.422 Soat2 0.785 0.263 0.688 0.160 Sorl1 1.163 0.527 1.481 0.237 Srebf1 1.040 0.896 0.398 0.004 Srebf2 1.118 0.540 0.728 0.089 Stab1 0.988 0.933 0.942 0.705 Stab2 0.852 0.269 0.785 0.225 Stard3 0.834 0.185 0.628 0.102 Tm7sf2 1.626 0.244 0.477 0.006 Trerf1 1.231 0.287 1.055 0.839 Vldlr 0.565 0.121 0.322 0.056

#-of-genes-significantly-dysregulated: 9 19

126

Supplemental Table 3.2: List of antibodies used for FACS analysis

ANTIGEN COMPANY CLONE Ly6C BD AL-21 CD11c BD HL3 CD11b BD M1/70 CD115 eBiosciences AF598 MHC II eBiosciences M5/114.15.2 CD45.1 Biolegend A20 CD45.2 eBiosciences 104 F4/80 eBiosciences BM8 CD4 BD L374 CD8a BD 53-6.7 B220 BD RA3-6B2 CD3e BD 17A2 Ter119 BD TER-119 CD127 eBiosciences A7R34 NK1.1 Biolegend PK136 Ly6G BD 1A8 CD34 eBiosciences RAM34 CD16/32 BD 2.4G2 CD117 BD 2B8 CD150 eBiosciences mShad150 CD48 Biolegend HM48-1 Sca1 eBiosciences D7

127

Supplemental Table 3.3: Primer sequences for qRT-PCR analysis (mouse)

Gene Forward Primer (5' -> 3') Reverse Primer (5' -> 3')

IL-1β GTCCCTGTCATGCTTCTGG ACCAGCAAGATGATCCCAAT

Tnf-α GTAGCCCACGTCGTAGCAAAC GCACCACTAGTTGGTTGTCTTTGA Ccl12 GTCCCTGTCATGCTTCTGG ATTGGGATCATCTTGCTGGT (Mcp-1) IL-6 TGGATGCTACCAAACTGGAT CAAAGCCAGAGTCCTTCAGA GCCCAGAAATCAAGGAGCAT IL-10 GCTCCACTGCCTTGCTCTTATT T Elav1 GTACACCACCAGGCACAGAG CCAAGGTTGTAGATGAAGATGC (HuR) Traf6 TATGATCTGGACTGCCCAAC AGTCTCATGTGCAACTGGGTA

Irak1 TTTATGGCTTCTTGCCCAAT TTTACATCAGGATAGCCCCA GCACAAAGAAGGCTTTGAAG GATTTGAGCAATCGTTTTGTATTC Vcam1 CA AG GAACCAAAGACTCGGGCATG Sele ATGACCACTGCAGGATGCATT T CTGCCTTGGTAGAGGTGACTG AGGACAGGAGCTGAAAAGTTGTA Icam1 A GA Nos3 CCAAGGTGATGAGCTCTGTG GAAGATATCTCGGGCAGCAG

Sort1 AATTTGGCATGGCTATTGGT GTGCAAACAGATCTCCCCTT

Cd68 AGCTGCCTGACAAGGGACACT AGGAGGACCAGGCCAATGAT

F4/80 GGATGTACAGATGGGGGATG GGAAGCCTCGTTTACAGGTG CAAGCTTGCTGGTGAAAAGG TGAAGTACTCATTATAGTCAAGG Hprt A GCATATC

128

3.7 Supplemental Figures:

Ldlr -/- mice 4 weeks HCD lumen

EC 12 weeks HCD lumen

24 weeks HCD lumen

Supplemental Figure 3.1

Cross-sections of mouse aortic roots during the progression of atherosclerosis (Ldlr-/- mice; 4, 12 and 24 weeks of HCD). Expression of miR-146a, assessed by in situ PCR (red) overlaps with Mac-2 positive leukocytes found in the intima. Regions of miR-146a expression adjacent to the lumen are suggestive of endothelial cell (EC) expression.

Online Figure I

129

A 18 weeks HCD B 18 weeks HCD C Ldlr-/- )

2 0.3 -/- Ldlr-/- DKO Ldlr m

m DKO (

ve l 0.2 va

r e p

r 0.1 a

e qu a l

P 0.0 500 µm DKO

500 µm

D 18 weeks HCD

60 10 100 200 Ldlr -/- ) ) ) ) g g g g DKO / / / / g g 8 g g m m 75 150 m m ( ( ( (

40 C C E 6 G T F T C

c c c c i i i i 50 100 t t t t a a a 4 a p p p p e 20 e e e h h h h a a 25

a 50 a r r r 2 r t t t t n n n n I I I I 0 0 0 0

Supplemental Figure 3.2

(A) Representative images of en face Oil Red-O staining in the aorta of Ldlr-/- and Ldlr-/-;miR- 146aOnline-/- (DKO) Figure mice IIafter 18 weeks of HCD reveals changes in plaque formation in the aortic arch, but not in the descending thoracic aorta. (B) Representative images of sections through the aortic root of Ldlr-/- and DKO mice after 18 weeks of HCD. (C) Quantification of plaque area per valve (n = 4). No major changes in plaque formation in the root were noted. (D)

130

Intrahepatic content of total cholesterol (TC), free cholesterol (FC), cholesterol esters (CE) and triglycerides (TG) after 18 weeks of HCD (n = 4).

A Post-BM transplant, Pre-diet B 12 weeks HCD

PB CD45+ PB Lymphocytes

WT BM 4 2 Ldlr -/- KO BM ) ) -/- 7 7 Ldlr 0 0 x1 x1 ( (

r r e ns e b 2 b 1 ns m m u u N N ll ll e e C C

0 0

WT BM KO BM Ldlr -/- Ldlr -/-

C 12 weeks HCD D

WT BM Aortic Arch Ldlr -/- 1.25 n o i 1.00 ess r

p 0.75 x E

ve 0.50 i t a l

e 0.25 KO BM R Ldlr -/- 0.00 Cd68 F4/80 macrophage markers

Supplemental Figure 3.3

Online Figure III 131

Lethally-irradiated Ldlr-/- mice received bone marrow (BM) transplantation from wild-type (WT BM) or miR-146a-/- (KO BM) donors followed by 8 weeks recovery. (A) FACS analysis of CD45+ leukocytes and lymphocytes in peripheral blood (PB) prior to start of high cholesterol diet (HCD) regimen, revealing similar levels of circulating cells (n = 6-8). (B) Representative images of en face Oil Red-O staining in the aorta of Ldlr-/- mice receiving WT or KO BM after 12 weeks of HCD. (C) Macrophage content in the aortic arch as assessed by mRNA levels of macrophage markers (CD68, F4/80). Data is normalized to HPRT (n = 3-4). (D) Representative images of sections through the aortic root of Ldlr-/- mice receiving WT or KO BM after 12 weeks of HCD.

Color Key

-1 0 1 log 2 value

Dhcr24 * Cyb5r3 * Tm7sf2 * Hmgcs2 * Cyp7a1 * Srebf1 * Cnbp * * Lrp12 * Apoc3 * Acaa2 * Insig2 * Snx17 * Lcat * Hmgcs1 * Akr1d1 * Apoa1 * Colec12 * Fdft1 * Lrpap1 * Apob * * Osbpl1a * Mbtps1 * Lrp6 * * Ebp * Abca1 * Prkaa2 -/-

Ldlr

DKO(18w vs HCD) KO vs(12w WT HCD) BMT Supplemental Figure 3.4

Online Figure IV 132

The expression of 84 lipoprotein signaling and cholesterol metabolism genes was assessed by qRT-PCR array of RNA isolated from livers of Ldlr-/- or DKO mice (18 weeks of HCD) or Ldlr-/- mice receiving WT or KO BMT (12 weeks HCD) (n = 4 per group). The relative change in expression in DKO mice was compared with Ldlr-/- mice and relative change in expression in KO bone marrow transplant (BMT) mice was compared to WT BMT. Genes that were significantly dysregulated in either comparison are depicted in a heat map, with * indicating significantly dysregulated genes. Genes that were significantly dysregulated in both comparisons are highlighted in red. See Online Table I for the complete dataset.

A 12 weeks HCD Ldlr -/- DKO Spleen Bone marrow Blood CD45+ cells CD45+ cells CD45+ cells 4 10 6 ) ) ) 8 7 6 0 0 0 x1 x1 x1 ( ( (

r r r e e e b b 2 5 b 3 m m m u u u N N N ll ll ll e e e C C C

0 0 0

B C

100 50 WT BMDMs

s WT peritoneal macs ll KO BMDMs e KO peritoneal macs 40 C 75 ve i x t i

u 30 s l o 50 ff P E

L 20 % D L

x 25

o 10 - iI D 0 0 L L L L D D 1 D D 1 L L L L c c A c c A A A po A A po A A + + 6 h 24 h

Supplemental Figure 3.5

Online Figure V 133

(A) FACS analysis of CD45+ leukocytes from spleen, BM and peripheral blood of Ldlr-/- and DKO mice after 12 weeks HCD (n = 5-8). (B) DiI-labeled ox-LDL uptake analysis in peritoneal macrophages isolated from WT of KO mice (n = 4). (C) Cholesterol efflux assay in bone marrow-derived macrophages (BMDMs) isolated from WT or KO mice (n = 6).

A Ly6Clo MONOCYTES MONOCYTES 15 15 1 1

CD CD Ly6Chi

Side Scatter MONOCYTES NEUTROPHILS

CD45 Ly6G Ly6C

CD8+ T CELLS T CELLS CD3 CD8 B CELLS CD4+ T CELLS

B220 CD4

HPC-1 HPC-2 Sca-1 CD48 LINEAGE Side Scatter MPP HSC

CD45 CD117 CD117 CD150

GMP

CMP CD16/32

MEP

CD34

Supplemental Figure 3.6

Gating schematic for FACS analysis of (A) myeloid and lymphoid cells, and (B) hematopoietic stemOnline cells. Figure VI

134

Bone Marrow A HPC-1 HPC-2 Hematopoietic

CD48 MPP HSC Stem Cells

CD150

Ldlr -/- DKO CD48

CD150

B 18 weeks HCD hi lo PB Neutrophils PB B Cells PB Ly6C PB Ly6C Monocytes Monocytes 6 8 3 2 p=0.067 ) ) ) ) 5 5 5 5 * 0 0 0 6 0 x1 x1 x1 x1 ( ( ( ( 2

r r r r e e e e b b b 3 4 b 1 m m m m u u u u N N N 1 N ll ll ll ll e e 2 e e C C C C

0 0 0 0 Ldlr -/- DKO

Supplemental Figure 3.7

(A) Representative FACS plots for HPC-1, HPC-2, HSC, and MPP populations from the BM. MPPs are decreased, while no changes to the long-term HSCs were observed in DKO mice after 18 weeks HCD. Quantification is in Figure 5C. (B) FACS analysis of PB neutrophils, B-cells, Ly6COnlinehi and Figure Ly6Clo monocytesVII in Ldlr-/- and DKO mice (18 weeks of HCD) (n = 5).

135

A B -/-

2.0 wild-typemiR-146a n o i 1.5 *

ess HuR r p x 1.0 E TRAF6 ve i t a l 0.5 e GAPDH R

0.0 HuR Irak1 Traf6

2.5 wild-type

n -/-

o miR-146a i 2.0 * * ess r 1.5 * p x E

1.0 ve i t a l

e 0.5 R

0.0 Vcam1 Sele Icam1

C 30 Ldlr -/- n

o DKO i

ess 20 r p x E

ve i

t 10 a l e R

0 R f6 1 1 le 1 1 a m e m p s3 u r rak S c o H T I ca ca M N V I

Supplemental Figure 3.8

Online(A) FigureRNA expression VIII by qRT-PCR of aortic arches harvested from WT and miR-146a-/- mice injected intravenously with IL-1β for 2 hours. n = 8. (B) Western blot of miR-146a target genes (HuR and TRAF6) in WT and miR-146a-/- aortas. A representative blot of 4 is shown. (C) RNA expression of lesser curvature aortic cells (EC and intimal cells) from aged Ldlr-/- and DKO mice (10 months) on HCD for 2 weeks. n = 2.

136

Initiation Early Athero Late Athero

L LD Cholesterol Activity

B Cytokines/ NF- Splenomegaly/ Circulating Leukocytes Bone Marrow Hematopoiesis/

Atherogenesis

Ldlr -/- Ldlr -/-;miR-146a-/- or or wild-type BMT miR-146a-/- BMT

Supplemental Figure 3.9

Schematic overview of the atherosclerotic phenotypes observed in mice with a deficiency of miR-146a in bone marrow-derived cells. Note that phenotypes are similar when miR-146a is Online Figuredeleted globally, IX but the phenotypes take longer to manifest. While total and LDL cholesterol levels are normal at the early stages of cholesterol, there is a progressive decrease in LDL

137 cholesterol that appears to be due to defects in VLDL secretion, which is accompanied by inflammation (e.g. IL-6 expression) and Sort1 expression in the liver. Despite the lower levels of LDL cholesterol, circulating inflammatory cytokines are increased, NF-κB activity is elevated and splenomegaly occurs. In the bone marrow, an initial increase in hematopoiesis in response to hypercholesterolemia is followed by a progressive decrease in hematopoiesis. Levels of circulating pro-atherogenic cells (such as Ly6Chi monocytes, neutrophils and T-cells) are reduced as atherosclerosis progresses, and extramedullary hematopoiesis in the spleen occurs, but is unable to compensate for reduced hematopoiesis in the bone marrow.

138

Chapter 4

4 Future Directions and Concluding Discussion

139

Collectively, the studies presented in this thesis explored the involvement of miR-146a in the regulation of vascular inflammation and the pathophysiology of atherosclerosis, a chronic disease heavily influenced by inflammation. We uncovered and dissected an anti-inflammatory role for miR-146a in the endothelium in an acute inflammatory setting (Chapter 2) as well as in a chronic hypercholesterolemia-induced atherosclerosis setting (Chapter 3). We found that the induction of miR-146a in endothelial cells exposed to an acute inflammatory stimulus played a critical role in the negative feedback regulation of inflammatory signaling. Thus, miR-146a controls the intensity and the duration of the inflammatory response. MiR-146a accomplishes this through the repression of adaptor molecules (i.e. TRAF6, IRAK1) that transduce NF-κB signaling downstream of IL-1β, as well as through the regulation of the RNA binding protein, HuR. We found that HuR plays an important role in destabilizing KLF2 mRNA and that suppression of HuR leads to enhanced expression of the vasodilatory and anti-inflammatory enzyme, eNOS. In the setting of atherosclerosis, we found that miR-146a also negatively regulates inflammatory signaling, as evidenced by the enhanced levels of circulating pro- inflammatory cytokines in the knock-out mice on a hypercholesterolemic diet. These mice also had enhanced endothelial activation, as would be expected from our findings in Chapter 2. Surprisingly, however, we observed a reduction in atherosclerosis phenotypes in miR-146a-/- mice, including reduced lipid plaque burden, circulating pro-atherogenic leukocytes, and circulating cholesterol-rich lipoproteins. These phenotypes appear to be driven by the detrimental effects of unrestrained inflammatory signaling in multiple organs: bone marrow (hematopoietic stem cell exhaustion), spleen (extramedullary hematopoiesis and splenomegaly), liver (cholesterol homeostasis defects) and the vasculature (enhanced endothelial cell activation and monocyte recruitment). The findings presented here reveal new avenues for future research into the mechanisms whereby miR-146a regulates cholesterol homeostasis and hematopoiesis, and suggest that development of therapeutic approaches to augment miR-146a expression in the setting of atherosclerosis would be warranted.

4.1 MiR-146a regulation of cholesterol homeostasis

Our studies unexpectedly revealed that miR-146a is a potent regulator of cholesterol metabolism. miR-146a-/-;Ldlr-/- mice have progressive defects in plasma cholesterol, particularly

140

VLDL fractions, and appear to have defective VLDL secretion from the liver. Curiously, the effect on circulating lipoprotein levels is mediated by miR-146a activity in bone marrow-derived cells. As discussed in Chapter 3, we propose two models whereby this might occur. We find that miR-146a suppresses inflammatory signaling and that in the absence of miR-146a, levels of IL-6 are greatly enhanced in the livers of hypercholesterolemic mice. Furthermore, we find that IL-6 treatment of primary mouse hepatocytes suppresses the secretion of triglycerides. This data suggests that cross-talk between bone marrow-derived cells (likely macrophages) and hepatocytes may be responsible for the regulation of cholesterol homeostasis. In our second model (which is not mutually exclusive), we find that miR-146a can target SORT1, and that this gene is de-repressed in the livers of miR-146a knockout mouse models. This was an interesting finding as SORT1 was identified in a GWAS on patients with higher risk of myocardial infarction and elevated LDL (374). Musunuru et al showed that hepatic SORT1 can reduce plasma cholesterol and VLDL levels in mice (358). In addition, they also demonstrated that SORT1 can reduce ApoB secretion and can bind extracellular LDL to mediate its catabolism (371). Of note, however, a separate study using Sort1-/-; Ldlr-/- mice revealed decreased plasma cholesterol levels (372), a finding that is contradictory to the previously mentioned studies and ours (358, 371). Thus, the role of SORT1 in cholesterol metabolism has not been completely resolved, and requires further exploration.

Our findings with the DKO and miR-146a-/- BM transplanted mice revealed an inverse proportional relationship between up-regulated SORT1 in the liver with down-regulated levels of cholesterol and VLDL in the plasma. However, the aforementioned studies on SORT1 focused on the role of this protein in hepatocytes, as they used viral vectors and silencer RNA (siRNA) to simulate gain and lost of function of SORT1 in hepatocytes in mice, whereas our models with miR-146a-/- BM transplantation would presumably have normal levels of miR-146a and SORT1 in hepatocytes. This is suggestive of a role for SORT1 in myeloid cells in our atherosclerosis model. Future experiments that manipulate SORT1 in myeloid cells in miR-146a-/- mice would be informative to determine whether myeloid SORT1 contributes to lipid metabolism in these mice.

Interestingly, two studies provide compelling evidence for additional roles for SORT1 that are independent of effects on plasma cholesterol levels. For instance, SORT1 in macrophages can promote LDL uptake and foam cell formation, resulting in enhanced

141 atherogenesis (373). In addition, SORT1 in macrophages can bind intracellular IL-6 with high affinity and promote its secretion (359). While we did not see differences in oxLDL uptake in the miR-146a-/- macrophages (Supplemental Figure 3.5B,C), we did observe a progressive increase in IL-6 expression in tissues and in circulation. However, it is difficult to attribute the increase in IL-6 levels exclusively to SORT1 activity since miR-146a also regulates NF-κB- mediated IL-6 transcription. To formally test the role of SORT1 in macrophage secretion of IL- 6, we could use SORT1 siRNAs in miR-146a-/- bone marrow-derived macrophages. It would also be informative to analyze other NF-κB-inducible cytokine affinities with SORT1 and perhaps identify a group of cytokines uniquely regulated by miR-146a. The mechanisms uncovered in macrophages could be shared with other hematopoietic cell types, such as HSPCs. Recently, pluripotent LSK cells from miR-146a-/- mice were shown to be capable of producing a plethora of LPS-induced NF-κB dependent cytokines including IL-6, which is capable of inducing HSPCs proliferation (168). Other cytokines that we observed to be elevated in the BM, such as IL-10 and TNF-α, are also important for inducing HSPCs and are also enhanced in miR- 146a-/- LSK cells (168, 361, 375). The BM niche is highly sensitive to changes in the microenvironment, including the influx of cytokines, and it will be of interest to determine how the miR-146a/SORT1 axis contributes to the regulation of the hematopoietic response to inflammation.

While a role for miR-146a in cholesterol metabolism has not been previously described, several studies have shown important roles for miR-146a in the liver. For example, hepatic miR- 146a had been associated with fibrosis in the context of nonalcoholic fatty liver disease (376), and promotes hepatitis C virus pathogenesis in a feed forward manner (377). To our surprise, the qPCR array analyses on liver tissues from DKOs and Ldlr-/- mice receiving miR-146a-/- BM transplant mice yielded a very different expression landscape between the two groups (Supplemental Table 3.1 and Supplemental Figure 3.4). We expected the two groups to have similar expression patterns based on their near identical plasma cholesterol profiles. Within the panel of 84 lipid metabolism related genes, only two (ApoB and Cnbp) were similarly decreased in both DKOs and Ldlr-/- with miR-146a-/- BM transplanted mice. While the decreased ApoB expression compliments the reduced cholesterol phenotype we observe in these animals, there were other deregulated genes noted from the qPCR arrays (7 genes in DKOs, 17 genes in Ldlr-/- mice receiving miR-146a-/- BM transplantation; Supplemental Figure 3.4). The down-regulated

142 genes from transplanted mice are likely attributable to the myeloid populations lacking miR- 146a, potentially as the result of enhanced production of NF-κB inducible cytokines. It is also conceivable that myeloid cells could mediate hepatic gene expression changes by transferring microvesicles (MVs) (as described in section 1.4.1). Perhaps myeloid MVs containing miR- 146a are essential for regulating lipid metabolism pathways in hepatic cells. Utilizing in vitro co-culture models between WT or miR-146a-/- myeloid cells and WT or miR-146a-/- hepatocytes could provide insight into the activity of extracellular signaling molecules, such as cytokines and MVs, in the context of hypercholesterolemia.

4.2 Selective HSPC regulation by miR-146a in atherogenesis

The depletion of MPPs and downstream progenitor cells in the BM ultimately reduced the output of circulatory pro-atherogenic leukocytes in DKO mice, which may contribute to the reduced atherogenesis in these mice. Decreases in circulating cells occurred despite the extramedullary hematopoiesis that occurs in the spleens of these mice. Zhao et al previously identified a similar hematopoietic phenotype in aged miR-146a-/- mice. After 8 months of age, miR-146a-/- mice developed splenomegaly and depletion of HSPCs in their BM (214). Our study using hypercholesterolemia to induced this phenotype (within 7 months) further supports their model of HSPC exhaustion caused by unrestrained inflammation and enhanced cycling of HSPCs in the absence of miR-146a. However, a stark difference between our models is that while Zhao et al reported depletion in all HSPCs in the BM, our HSC populations were unaffected by hypercholesterolemia, and instead only downstream progenitors were affected. As mentioned above, Zhao et al assessed a plethora of NF-κB induced cytokines produced in the BM of aged miR-146a-/- mice, including IL-10, IL-6 and TNF-α, which can stimulate HSPC proliferation (168, 361, 375), and demonstrated that IL-6 plays a critical role. We also observed dysregulation of these same cytokines in our model. It is conceivable that hypercholesterolemia could elicit additional cytokines in DKO mice that differ from models of ageing or repeated LPS stimulation. Thus, measuring other cytokines in the BM of DKOs and comparing to the cytokine profile by Zhao et al could reveal new mechanisms that regulate HSPC maintenance under hypercholesterolemia-induced stress. Alternatively, diverse types of stress (e.g.

143 hypercholesterolemia, ageing, acute inflammation) may activate the proliferation of distinct hematopoietic cells (i.e. HSCs vs. HPSCs), leading to their replicative senescence.

The reduction in certain HSPCs populations in the BM could alternatively be due to defective cell retention in the BM. Indeed, we observed a dramatic accumulation of HSCs, HPSCs and down-stream progenitors in the spleens of mice lacking miR-146a, which would support this model. Studies by Labbaye et al identified a novel role for miR-146a in regulating megakaryocyte proliferation and differentiation, as well as retention of progenitor cells in the BM (378). They found that the transcription factor promyelocytic leukaemia zinc-finger (PLZF), involved in the regulation of hematopoietic genes like TPO receptors (379), represses the expression of miR-146a (378). Furthermore, miR-146a was found to target CXCR4, a receptor for CXCL12 (or SDF1) that is critical for HSPC maintenance in the BM niches (162, 378). In addition, defective CXCL12-CXCR4 signaling can result in HSPC mobilization from the BM (66). More recently, it was demonstrated that the BM hypoxic microenvironment could increase miR-146a expression and thereby decrease CXCR4 expression, resulting in dysfunctional monocyte differentiation (380). Thus, this PLZF/miR-146a/CXCR4 axis initially found to regulate megakaryopoiesis could also affect other progenitor cells. While our study focused on the proliferation aspect driven by NF-κB regulated cytokines, it is also possible that homing and migration defects may be a contributing factor to the progressive decrease in HSPCs. Given that hypercholesterolemia can affect retention of HSPCs (174), it would be interesting to examine HSPCs homing properties in DKO mice.

4.3 MiR-146a-based therapies

The studies presented in this thesis further expand our understanding of the function of miR-146a and demonstrate the importance of this miRNA in regulating vascular inflammation and atherosclerosis. While these studies demonstrate the consequences associated with the absence of miR-146a, we did not evaluate the effects of exogenous miR-146a mimetic or inhibitors in vivo. However, Li et al have previously shown that repeated injections of liposome- encapsulated miR-146a mimetics can reduce atherosclerosis by reducing macrophage accumulation and pro-inflammatory TNF-α production (318). However, their study focused on the delivery of mimetic to macrophages and did not assess the effects of miR-146a over-

144 expression on other recipient cell types. Sun et al demonstrated that exogenous miRNA mimetics can be taken up by aortic intimal cells (including ECs) and peripheral blood mononuclear cells (PMBC) when liposome-encapsulated mimetic is delivered systemically (264). This would suggest the reduction of macrophages observed in the Li et al study could in part be due to repression of NF-κB activity in ECs from exogenous miR-146a, thereby diminishing the recruitment of circulating monocytes. This is further supported by their finding that there was no observable change in macrophage proliferation (Ki67 measurement). The conclusions from Li et al might falsely ascribe the beneficial effects of miR-146a delivery to the repression of NF-κB activity in macrophages during atherogenesis. For instance, they suggest that the effects from exogenous miR-146a are due to repressed NF-κB adaptor proteins, IRAK1 and TRAF6; however, targeted deletion of Traf6 in macrophages promotes, rather than accelerates atherogenesis (201). Polykratis et al demonstrated that Traf6 ablation in macrophages reduced the oxLDL-induced stimulation of pro-inflammatory cytokines like IL-6 and TNF-α, which phenocopy macrophages with over-expression of miR-146a. While Traf6 ablation in macrophages decreased pro-inflammatory cytokine production, it resulted in impaired macrophage efferocytosis capacity, which led to the promotion of atherogenesis (201). Li et al did not measure apoptosis or efferocytosis in their study. Therefore, the effects observed by Li et al may be due to ECs receiving the miR-146a mimetic to reduce recruitment of circulating leukocytes to growing plaques. Indeed, delivery of a combination of miR-146a and miR-181b via E-Selectin-targeted nanoparticles to the endothelium can reduce plaque size in atherosclerotic mice (303). While our study utilized BMT to exclude the role of miR-146a from leukocytes, it is not the optimal method to elucidate their role in ECs. In order to overcome these limitations, manipulations using the cell-specific Cre-loxP system in mice would provide a better understanding of miR-146a in ECs and macrophages.

Another confounding factor to the utilization of miR-146a mimetics is the effect of systemic delivery on other organs besides the vasculature. This is important for miR-146a based therapy considerations, as we have identified a role for miR-146a in altering liver function and cholesterol homeostasis. Organ distribution of systemically delivered mimetic was demonstrated using miR-155-/- mice administered with miR-155 loaded exosomes (381). Bala et al showed the distributions are as follows from highest to lowest frequencies: liver, adipose tissue, lung, muscle, and kidney. Sun et al showed no changes in liver NF-κB activity from miR-181b

145 mimetic delivery (264). However, they did not measure miR-181b levels, which leaves open the possibility of uptake by hepatocytes, without affects on NF-κB suppression. This cell specific affect is not uncommon as miR-181b was shown to repress NF-κB activity in ECs but not in macrophages (264). Conversely, exosome delivered miRNAs can be detected in hepatocytes and liver mononuclear cells (381). Perhaps systemic injections of liposomes are only taken up by circulating leukocytes and ECs, which would exclude their direct uptake by hepatocytes. In support of this, Sun et al showed systemic mimetic delivery does not reach the media or adventitia layers of the aorta (264). It is apparent that the vehicle used for miRNA delivery will be a major considering factor to determine the organ destinations. Perhaps the method employed by Ma et al using microparticles designed to recognize activated ECs by recognizing E-selectin can be used to avoid off target effects (303). Other approaches have used particular formulations of nanoparticles that are preferentially taken up by the endothelium, while not being taken up by hepatocytes or immune cells (382).

Ours and several other in vivo studies have highlighted the importance of miR-146a in HSC biology (214, 378). Thus, alteration of hematopoiesis and homing within the BM niche should be considered when systemically delivering miR-146a. The previously discussed miR- based systemic delivery studies have not assessed the possibility of mimetic delivery to the BM (264, 318). It is possible that mimetics are taken up by circulating HSPCs before returning to the BM. Although the presence of circulating HSPCs are relatively low (383), they are capable of homing back to the BM (384). Similar to the concerns regarding liver delivery, enhancing miR- 146a in the BM niche could present unfavourable phenotypes. For instance, over-expression of miR-146a in HSPCs alters hematopoiesis by promoting differentiation of certain myeloid cells while hindering lymphopoiesis (385). However, when examined in a BM chimerism competitive experiment, they demonstrated HSPCs over-expressing miR-146a succumbed to apoptosis. Similarly, ablation of miR-146a in BM cells also promotes the production of myeloid cells before the eventual depletion of the HSPC populations (386). Collectively, these studies suggest a specific threshold of miR-146a is required for maintenance of HSPCs. Furthermore, increased circulating myeloid cells would be detrimental for atherogenesis, thus should be a consideration for systemic miR-146a delivery.

Collectively, insights gained from these studies provide new perspectives for the role of miR-146a in the regulation of vascular pathophysiology. Its well-studied properties would place

146 miR-146a among the echelon of anti-inflammatory miRNAs and would deem it worthy of consideration as a miR-based therapy against inflammatory diseases. However, given that an individual miRNA can mediate repression on hundreds of genes, our limited knowledge of other roles warrant more attention. Thus, in addition to identifying which cell types are receiving mimetic delivery, it would be imperative to evaluate the repression of the direct target genes of miR-146a. Clarification of these issues and the limitations presented in this discertation can also be achieved by designing cell-specific manipulation (knock-down or over-expression) of miR- 146a in mouse models of atherosclerosis. The work and ideas presented in this thesis highlight the importance of these future directions while also expanding our knowledge of miR-146a influence in complex inflammatory-based diseases like atherosclerosis.

References

1. Hansson, G. K. (2005) Inflammation, atherosclerosis, and coronary artery disease. N Engl J Med. 352, 1685–1695 2. Gimbrone, M. A. J., and Garcia-Cardena, G. (2012) Vascular endothelium, hemodynamics, and the pathobiology of atherosclerosis. Cardiovasc Pathol. 22, 9–15 3. Murray, C. J., and Lopez, A. D. (1997) Global mortality, disability, and the contribution of risk factors: Global Burden of Disease Study. Lancet. 349, 1436–1442 4. Pober, J. S., and Sessa, W. C. (2007) Evolving functions of endothelial cells in inflammation. Nat. Rev. Immunol. 7, 803–815 5. Weber, C., and Noels, H. (2011) Atherosclerosis: current pathogenesis and therapeutic options. Nature Medicine. 17, 1410–1422 6. Jonasson, L., Holm, J., Skalli, O., Bondjers, G., and Hansson, G. K. (1986) Regional accumulations of T cells, macrophages, and smooth muscle cells in the human atherosclerotic plaque. Arteriosclerosis. 6, 131–138 7. Woollard, K. J., and Geissmann, F. (2010) Monocytes in atherosclerosis: subsets and functions. Nature Reviews Cardiology. 7, 77–86 8. Stary, H. C., Chandler, A. B., Dinsmore, R. E., Fuster, V., Glagov, S., Insull, W., Rosenfeld, M. E., Schwartz, C. J., Wagner, W. D., and Wissler, R. W. (1995) A definition of advanced types of atherosclerotic lesions and a histological classification of atherosclerosis. A report from the Committee on Vascular Lesions of the Council on Arteriosclerosis, American Heart Association. Circulation. 92, 1355–1374 9. Tabas, I. (2005) Consequences and therapeutic implications of macrophage apoptosis in atherosclerosis: the importance of lesion stage and phagocytic efficiency. Arteriosclerosis, Thrombosis, and Vascular Biology. 25, 2255–2264 10. Owens, G. K. (2004) Molecular Regulation of Vascular Smooth Muscle Cell Differentiation in Development and Disease. Physiological Reviews. 84, 767–801 11. Allahverdian, S., Chehroudi, A. C., McManus, B. M., Abraham, T., and Francis, G. A. (2014) Contribution of intimal smooth muscle cells to cholesterol accumulation and macrophage-like cells in human atherosclerosis. Circulation. 129, 1551–1559 12. Feil, S., Fehrenbacher, B., Lukowski, R., Essmann, F., Schulze-Osthoff, K., Schaller, M., and Feil, R. (2014) Transdifferentiation of vascular smooth muscle cells to macrophage-like cells during atherogenesis. Circulation Research. 115, 662–667 13. Jongstra-Bilen, J., Haidari, M., Zhu, S. N., Chen, M., Guha, D., and Cybulsky, M. I. (2006) Low-grade chronic inflammation in regions of the normal mouse arterial intima predisposed to atherosclerosis. Journal of Experimental Medicine. 203, 2073–2083 14. Won, D., Zhu, S. N., Chen, M., Teichert, A. M., Fish, J. E., Matouk, C. C., Bonert, M., Ojha, M., Marsden, P. A., and Cybulsky, M. I. (2007) Relative Reduction of Endothelial Nitric-Oxide Synthase Expression and Transcription in Atherosclerosis-Prone Regions of the Mouse Aorta and in an in Vitro Model of Disturbed Flow. The American Journal of Pathology. 171, 1691–1704 15. Bennett, M. R., Evan, G. I., and Schwartz, S. M. (1995) Apoptosis of human vascular smooth muscle cells derived from normal vessels and coronary atherosclerotic plaques. J. Clin. Invest. 95, 2266–2274 16. Zheng, L., Nukuna, B., Brennan, M. L., Sun, M., Goormastic, M., Settle, M., Schmitt,

147 148

D., Fu, X., Thomson, L., Fox, P. L., Ischiropoulos, H., Smith, J. D., Kinter, M., and Hazen, S. L. (2004) Apolipoprotein A-I is a selective target for myeloperoxidase- catalyzed oxidation and functional impairment in subjects with cardiovascular disease. J. Clin. Invest. 114, 529–541 17. Bergt, C., Pennathur, S., Fu, X., Byun, J., O'Brien, K., McDonald, T. O., Singh, P., Anantharamaiah, G. M., Chait, A., Brunzell, J., Geary, R. L., Oram, J. F., and Heinecke, J. W. (2004) The myeloperoxidase product hypochlorous acid oxidizes HDL in the human artery wall and impairs ABCA1-dependent cholesterol transport. Proc. Natl. Acad. Sci. U.S.A. 101, 13032–13037 18. Reiser, R., Sorrels, M. F., and Williams, M. C. (1959) Influence of High Levels of Dietary Fats and Cholesterol on Atherosclerosis and Lipid Distribution in Swine. Circulation Research. 7, 833–846 19. Hansson, G. K., and Hermansson, A. (2011) The immune system in atherosclerosis. Nature Publishing Group. 12, 204–212 20. Patel, T. N., Shishehbor, M. H., and Bhatt, D. L. (2007) A review of high-dose statin therapy: targeting cholesterol and inflammation in atherosclerosis. Eur. Heart J. 28, 664–672 21. Hegele, R. A. (2009) Plasma lipoproteins: genetic influences and clinical implications. Nat. Rev. Genet. 10, 109–121 22. Sniderman, A. D. (2004) Applying apoB to the diagnosis and therapy of the atherogenic dyslipoproteinemias: a clinical diagnostic algorithm. Curr. Opin. Lipidol. 15, 433–438 23. Linton, M. F., Atkinson, J. B., and Fazio, S. (1995) Prevention of atherosclerosis in apolipoprotein E-deficient mice by bone marrow transplantation. Science. 267, 1034– 1037 24. Sacks, F. M. (2015) The crucial roles of apolipoproteins E and C-III in apoB lipoprotein metabolism in normolipidemia and hypertriglyceridemia. Curr. Opin. Lipidol. 26, 56–63 25. Chistiakov, D. A., Orekhov, A. N., and Bobryshev, Y. V. (2016) ApoA1 and ApoA1- specific self-antibodies in cardiovascular disease. Lab Invest. 96, 708–718 26. Tall, A. R., and Yvan-Charvet, L. (2015) Cholesterol, inflammation and innate immunity. Nat. Rev. Immunol. 15, 104–116 27. Yvan-Charvet, L., Pagler, T., Gautier, E. L., Avagyan, S., Siry, R. L., Han, S., Welch, C. L., Wang, N., Randolph, G. J., Snoeck, H. W., and Tall, A. R. (2010) ATP-binding cassette transporters and HDL suppress hematopoietic stem cell proliferation. Science. 328, 1689–1693 28. Asztalos, B. F., Schaefer, E. J., Horvath, K. V., Yamashita, S., Miller, M., Franceschini, G., and Calabresi, L. (2007) Role of LCAT in HDL remodeling: investigation of LCAT deficiency states. The Journal of Lipid Research. 48, 592–599 29. Acton, S., Rigotti, A., Landschulz, K. T., Xu, S., Hobbs, H. H., and Krieger, M. (1996) Identification of scavenger receptor SR-BI as a high density lipoprotein receptor. Science. 271, 518–520 30. Cybulsky, M. I., Iiyama, K., Li, H., Zhu, S., Chen, M., Iiyama, M., Davis, V., Gutierrez- Ramos, J.-C., Connelly, P. W., and Milstone, D. S. (2001) A major role for VCAM-1, but not ICAM-1, in early atherosclerosis. J. Clin. Invest. 107, 1255–1262 31. Yvan-Charvet, L., Ranalletta, M., Wang, N., Han, S., Terasaka, N., Li, R., Welch, C., and Tall, A. R. (2007) Combined deficiency of ABCA1 and ABCG1 promotes foam cell accumulation and accelerates atherosclerosis in mice. J. Clin. Invest. 117, 3900–3908 32. Peet, D. J., Turley, S. D., Ma, W., Janowski, B. A., Lobaccaro, J. M., Hammer, R. E.,

149

and Mangelsdorf, D. J. (1998) Cholesterol and bile acid metabolism are impaired in mice lacking the nuclear oxysterol receptor LXR alpha. Cell. 93, 693–704 33. Zhao, C., and Dahlman-Wright, K. (2010) Liver X receptor in cholesterol metabolism. Journal of Endocrinology. 204, 233–240 34. Westerterp, M., Bochem, A. E., Yvan-Charvet, L., Murphy, A. J., Wang, N., and Tall, A. R. (2014) ATP-binding cassette transporters, atherosclerosis, and inflammation. Circulation Research. 114, 157–170 35. A-Gonzalez, N., Bensinger, S. J., Hong, C., Beceiro, S., Bradley, M. N., Zelcer, N., Deniz, J., Ramirez, C., Díaz, M., Gallardo, G., de Galarreta, C. R., Salazar, J., Lopez, F., Edwards, P., Parks, J., Andujar, M., Tontonoz, P., and Castrillo, A. (2009) Apoptotic cells promote their own clearance and immune tolerance through activation of the nuclear receptor LXR. Immunity. 31, 245–258 36. Ghisletti, S., Huang, W., Ogawa, S., Pascual, G., and Lin, M. E. (2007) Parallel SUMOylation-Dependent Pathways Mediate Gene- and Signal-Specific Transrepression by LXRs and PPARγ. Molecular Cell. 25, 57–70 37. Yvan-Charvet, L., Welch, C., Pagler, T. A., Ranalletta, M., Lamkanfi, M., Han, S., Ishibashi, M., Li, R., Wang, N., and Tall, A. R. (2008) Increased inflammatory gene expression in ABC transporter-deficient macrophages: free cholesterol accumulation, increased signaling via toll-like receptors, and neutrophil infiltration of atherosclerotic lesions. Circulation. 118, 1837–1847 38. Teupser, D., Kretzschmar, D., Tennert, C., Burkhardt, R., Wilfert, W., Fengler, D., Naumann, R., Sippel, A. E., and Thiery, J. (2008) Effect of macrophage overexpression of murine liver X receptor-alpha (LXR-alpha) on atherosclerosis in LDL-receptor deficient mice. Arteriosclerosis, Thrombosis, and Vascular Biology. 28, 2009–2015 39. Castrillo, A., Joseph, S. B., Vaidya, S. A., Haberland, M., Fogelman, A. M., Cheng, G., and Tontonoz, P. (2003) Crosstalk between LXR and toll-like receptor signaling mediates bacterial and viral antagonism of cholesterol metabolism. Molecular Cell. 12, 805–816 40. Epstein, F. H., Gabay, C., and Kushner, I. (1999) Acute-Phase Proteins and Other Systemic Responses to Inflammation. N Engl J Med. 340, 448–454 41. Pajkrt, D., Doran, J. E., Koster, F., Lerch, P. G., Arnet, B., van der Poll, T., Cate, ten, J. W., and van Deventer, S. J. (1996) Antiinflammatory effects of reconstituted high- density lipoprotein during human endotoxemia. J. Exp. Med. 184, 1601–1608 42. Sherer, Y., and Shoenfeld, Y. (2006) Mechanisms of Disease: atherosclerosis in autoimmune diseases. Nat Clin Pract Rheumatol. 2, 99–106 43. Feingold, K. R., and Grunfeld, C. (2010) The acute phase response inhibits reverse cholesterol transport. J. Lipid Res. 51, 682–684 44. Masucci-Magoulas, L., Moulin, P., Jiang, X. C., Richardson, H., Walsh, A., Breslow, J. L., and Tall, A. (1995) Decreased cholesteryl ester transfer protein (CETP) mRNA and protein and increased high density lipoprotein following lipopolysaccharide administration in human CETP transgenic mice. J. Clin. Invest. 95, 1587–1594 45. McGillicuddy, F. C., la Llera Moya, de, M., Hinkle, C. C., Joshi, M. R., Chiquoine, E. H., Billheimer, J. T., Rothblat, G. H., and Reilly, M. P. (2009) Inflammation impairs reverse cholesterol transport in vivo. Circulation. 119, 1135–1145 46. la Llera Moya, de, M., McGillicuddy, F. C., Hinkle, C. C., Byrne, M., Joshi, M. R., Nguyen, V., Tabita-Martinez, J., Wolfe, M. L., Badellino, K., Pruscino, L., Mehta, N. N., Asztalos, B. F., and Reilly, M. P. (2012) Inflammation modulates human HDL

150

composition and function in vivo. Atherosclerosis. 222, 390–394 47. Song, L., Leung, C., and Schindler, C. (2001) Lymphocytes are important in early atherosclerosis. J. Clin. Invest. 108, 251–259 48. McMillen, T. S., Heinecke, J. W., and LeBoeuf, R. C. (2005) Expression of human myeloperoxidase by macrophages promotes atherosclerosis in mice. Circulation. 111, 2798–2804 49. Getz, G. S., and Reardon, C. A. (2012) Animal Models of Atherosclerosis. Arteriosclerosis, Thrombosis, and Vascular Biology. 32, 1104–1115 50. Prescott, M. F., McBride, C. H., Hasler-Rapacz, J., Linden, Von, J., and Rapacz, J. (1991) Development of complex atherosclerotic lesions in pigs with inherited hyper- LDL cholesterolemia bearing mutant alleles for apolipoprotein B. Am. J. Pathol. 139, 139–147 51. Gerrity, R. G., Richardson, M., Somer, J. B., Bell, F. P., and Schwartz, C. J. (1977) Endothelial cell morphology in areas of in vivo Evans blue uptake in the aorta of young pigs. II. Ultrastructure of the intima in areas of differing permeability to proteins. Am. J. Pathol. 89, 313–334 52. Civelek, M., Manduchi, E., Riley, R. J., Stoeckert, C. J., and Davies, P. F. (2011) Coronary Artery Endothelial Transcriptome In Vivo: Identification of Endoplasmic Reticulum Stress and Enhanced Reactive Oxygen Species by Gene Connectivity Network Analysis. Circulation: Cardiovascular Genetics. 4, 243–252 53. Kamimura, R., Suzuki, S., Sakamoto, H., Miura, N., Misumi, K., and Miyahara, K. (1999) Development of Atherosclerotic Lesions in Cholesterol-loaded Rabbits. Exp. Anim. 48, 1–7 54. Buja, L. M., Kita, T., Goldstein, J. L., Watanabe, Y., and Brown, M. S. (1983) Cellular pathology of progressive atherosclerosis in the WHHL rabbit. An animal model of familial hypercholesterolemia. Arteriosclerosis, Thrombosis, and Vascular Biology. 3, 87–101 55. Niimi, M., Yang, D., Kitajima, S., Ning, B., Wang, C., and Li, S. (2016) ApoE knockout rabbits: A novel model for the study of human hyperlipidemia. Atherosclerosis. 245, 187–193 56. Hobbs, H. H., Russell, D. W., Brown, M. S., and Goldstein, J. L. (1990) The LDL receptor locus in familial hypercholesterolemia: mutational analysis of a membrane protein. Annu. Rev. Genet. 24, 133–170 57. Palinski, W., Miller, E., and Witztum, J. L. (1995) Immunization of low density lipoprotein (LDL) receptor-deficient rabbits with homologous malondialdehyde- modified LDL reduces atherogenesis. Proc. Natl. Acad. Sci. U.S.A. 92, 821–825 58. Hulthe, J., Wikstrand, J., Lidell, A., Wendelhag, I., Hansson, G. K., and Wiklund, O. (1998) Antibody Titers Against Oxidized LDL Are Not Elevated in Patients With Familial Hypercholesterolemia. Arteriosclerosis, Thrombosis, and Vascular Biology. 18, 1203–1211 59. Lahoute, C., Herbin, O., Mallat, Z., and Tedgui, A. (2011) Adaptive immunity in atherosclerosis: mechanisms and future therapeutic targets. Nature Reviews Cardiology. 8, 348–358 60. Lewis, M. J., Malik, T. H., Ehrenstein, M. R., Boyle, J. J., and Botto, M. (2009) Immunoglobulin M Is Required for Protection Against Atherosclerosis in Low-Density Lipoprotein Receptor–Deficient Mice. Circulation. 120, 417–426 61. Fazio, S., Babaev, V. R., Murray, A. B., Hasty, A. H., Carter, K. J., Gleaves, L. A.,

151

Atkinson, J. B., and Linton, M. F. (1997) Increased atherosclerosis in mice reconstituted with apolipoprotein E null macrophages. Proc. Natl. Acad. Sci. U.S.A. 94, 4647–4652 62. van Eck, M., Herijgers, N., Vidgeon-Hart, M., and Pearce, N. J. (2000) Accelerated atherosclerosis in C57Bl/6 mice transplanted with ApoE-deficient bone marrow. Atherosclerosis. 150, 71–80 63. He, H., Xu, J., Warren, C. M., Duan, D., Li, X., Wu, L., and Iruela-Arispe, M. L. (2012) Endothelial cells provide an instructive niche for the differentiation and functional polarization of M2-like macrophages. Blood. 120, 3152–3162 64. Kyrylkova, K., Kyryachenko, S., Leid, M., and Kioussi, C. (2012) Detection of Apoptosis by TUNEL Assay. Methods and Protocols. 887, 41–47 65. Asada, N., Katayama, Y., Sato, M., Minagawa, K., Wakahashi, K., Kawano, H., Kawano, Y., Sada, A., Ikeda, K., Matsui, T., and Tanimoto, M. (2013) Matrix-embedded osteocytes regulate mobilization of hematopoietic stem/progenitor cells. Cell Stem Cell. 12, 737–747 66. Greenbaum, A., Hsu, Y. M. S., Day, R. B., Schuettpelz, L. G., Christopher, M. J., Borgerding, J. N., Nagasawa, T., and Link, D. C. (2013) CXCL12 in early mesenchymal progenitors is required for haematopoietic stem-cell maintenance. Nature. 495, 227–230 67. Vestweber, D. (2015) How leukocytes cross the vascular endothelium. Nat. Rev. Immunol. 15, 692–704 68. Kzhyshkowska, J., Neyen, C., and Gordon, S. (2012) Immunobiology. Immunobiology. 217, 492–502 69. Zimmer, S., Grebe, A., and Latz, E. (2015) Danger Signaling in Atherosclerosis 70. Kempe, S., Kestler, H., Lasar, A., and Wirth, T. (2005) NF-kappaB controls the global pro-inflammatory response in endothelial cells: evidence for the regulation of a pro- atherogenic program. Nucleic Acids Research. 33, 5308–5319 71. Gareus, R., Kotsaki, E., Xanthoulea, S., van der Made, I., Gijbels, M. J. J., Kardakaris, R., Polykratis, A., Kollias, G., de Winther, M. P. J., and Pasparakis, M. (2008) Endothelial cell-specific NF-kappaB inhibition protects mice from atherosclerosis. Cell Metabolism. 8, 372–383 72. Combadiere, C., Potteaux, S., Rodero, M., Simon, T., Pezard, A., Esposito, B., Merval, R., Proudfoot, A., Tedgui, A., and Mallat, Z. (2008) Combined Inhibition of CCL2, CX3CR1, and CCR5 Abrogates Ly6Chi and Ly6Clo Monocytosis and Almost Abolishes Atherosclerosis in Hypercholesterolemic Mice. Circulation. 117, 1649–1657 73. Heller, E. A., Liu, E., Tager, A. M., Yuan, Q., Lin, A. Y., Ahluwalia, N., Jones, K., Koehn, S. L., Lok, V. M., Aikawa, E., Moore, K. J., Luster, A. D., and Gerszten, R. E. (2006) Chemokine CXCL10 promotes atherogenesis by modulating the local balance of effector and regulatory T cells. Circulation. 113, 2301–2312 74. Hundelshausen, von, P., Koenen, R. R., Sack, M., Mause, S. F., Adriaens, W., Proudfoot, A. E. I., Hackeng, T. M., and Weber, C. (2005) Heterophilic interactions of platelet factor 4 and RANTES promote monocyte arrest on endothelium. Blood. 105, 924–930 75. McEver, R. P. (2015) Selectins: initiators of leucocyte adhesion and signalling at the vascular wall. Cardiovasc. Res. 107, 331–339 76. Zarbock, A., Ley, K., McEver, R. P., and Hidalgo, A. (2011) Leukocyte ligands for endothelial selectins: specialized glycoconjugates that mediate rolling and signaling under flow. Blood. 118, 6743–6751 77. van Buul, J. D., Kanters, E., and Hordijk, P. L. (2007) Endothelial Signaling by Ig-Like

152

Cell Adhesion Molecules. Arteriosclerosis, Thrombosis, and Vascular Biology. 27, 1870–1876 78. Herter, J., and Zarbock, A. (2013) Integrin Regulation during Leukocyte Recruitment. The Journal of Immunology. 190, 4451–4457 79. Barreiro, O., Yáñez-Mó, M., Serrador, J. M., Montoya, M. C., Vicente-Manzanares, M., Tejedor, R., Furthmayr, H., and Sánchez-Madrid, F. (2002) Dynamic interaction of VCAM-1 and ICAM-1 with moesin and ezrin in a novel endothelial docking structure for adherent leukocytes. The Journal of Cell Biology. 157, 1233–1245 80. Moore, K. J., Sheedy, F. J., and Fisher, E. A. (2013) Macrophages in atherosclerosis: a dynamic balance. Nat Rev Immunol. 13, 709–721 81. Nourshargh, S. (2006) The role of JAM-A and PECAM-1 in modulating leukocyte infiltration in inflamed and ischemic tissues. Journal of Leukocyte Biology. 80, 714–718 82. Wegmann, F., Petri, B., Khandoga, A. G., Moser, C., Khandoga, A., Volkery, S., Li, H., Nasdala, I., Brandau, O., Fässler, R., Butz, S., Krombach, F., and Vestweber, D. (2006) ESAM supports neutrophil extravasation, activation of Rho, and VEGF-induced vascular permeability. Journal of Experimental Medicine. 203, 1671–1677 83. Schmitt, M. M. N., Megens, R. T. A., Zernecke, A., Bidzhekov, K., van den Akker, N. M., Rademakers, T., van Zandvoort, M. A., Hackeng, T. M., Koenen, R. R., and Weber, C. (2014) Endothelial Junctional Adhesion Molecule-A Guides Monocytes Into Flow- Dependent Predilection Sites of Atherosclerosis. Circulation. 129, 66–76 84. Bourdillon, M. C., Randon, J., Barek, L., Zibara, K., Covacho, C., Poston, R. N., Chignier, E., and McGregor, J. L. (2006) Reduced Atherosclerotic Lesion Size in P- Selectin Deficient Apolipoprotein E-Knockout Mice Fed a Chow but Not a Fat Diet. Journal of Biomedicine and Biotechnology. 2006, 1–8 85. Harry, B. L., Sanders, J. M., and Feaver, R. E. (2008) Endothelial cell PECAM-1 promotes atherosclerotic lesions in areas of disturbed flow in ApoE-deficient mice. Atherosclerosis, Thrombosis, and Vascular Biology. 28, 2003–2008 86. Liao, F. (1995) Migration of monocytes across endothelium and passage through extracellular matrix involve separate molecular domains of PECAM-1. Journal of Experimental Medicine. 182, 1337–1343 87. Davies, P. F. (2009) Hemodynamic shear stress and the endothelium in cardiovascular pathophysiology. Nat Clin Pract Cardiovasc Med. 6, 16–26 88. Wesche, H., Gao, X., Li, X., Kirschning, C. J., Stark, G. R., and Cao, Z. (1999) IRAK-M is a novel member of the Pelle/interleukin-1 receptor-associated kinase (IRAK) family. J. Biol. Chem. 274, 19403–19410 89. Kobayashi, K., Hernandez, L. D., Galan, J. E., Janeway, C. A. J., Medzhitov, R., and Flavell, R. A. (2002) IRAK-M is a negative regulator of Toll-like receptor signaling. Cell. 110, 191–202 90. Dekker, R. J., van Soest, S., Fontijn, R. D., Salamanca, S., de Groot, P. G., VanBavel, E., Pannekoek, H., and Horrevoets, A. J. G. (2002) Prolonged fluid shear stress induces a distinct set of endothelial cell genes, most specifically lung Krüppel-like factor (KLF2). Blood. 100, 1689–1698 91. SenBanerjee, S. (2004) KLF2 Is a Novel Transcriptional Regulator of Endothelial Proinflammatory Activation. Journal of Experimental Medicine. 199, 1305–1315 92. Conran, N., Gambero, A., Ferreira, H. H. A., Antunes, E., and de Nucci, G. (2003) Nitric oxide has a role in regulating VLA-4-integrin expression on the human neutrophil cell surface. Biochemical Pharmacology. 66, 43–50

153

93. Kuhlencordt, P. J., Gyurko, R., Han, F., Scherrer-Crosbie, M., Aretz, T. H., Hajjar, R., Picard, M. H., and Huang, P. L. (2001) Accelerated Atherosclerosis, Aortic Aneurysm Formation, and Ischemic Heart Disease in Apolipoprotein E/Endothelial Nitric Oxide Synthase Double-Knockout Mice. Circulation. 104, 448–454 94. Atkins, G. B., Wang, Y., Mahabeleshwar, G. H., Shi, H., Gao, H., Kawanami, D., Natesan, V., Lin, Z., Simon, D. I., and Jain, M. K. (2008) Hemizygous Deficiency of Krüppel-Like Factor 2 Augments Experimental Atherosclerosis. Circulation. 103, 690– 693 95. Lingrel, J. B., Pilcher-Roberts, R., Basford, J. E., Manoharan, P., Neumann, J., Konaniah, E. S., Srinivasan, R., Bogdanov, V. Y., and Hui, D. Y. (2012) Myeloid- Specific Kruppel-Like Factor 2 Inactivation Increases Macrophage and Neutrophil Adhesion and Promotes Atherosclerosis. Circulation Research. 110, 1294–1302 96. Cybulsky, M. I., Cheong, C., and Robbins, C. S. (2016) Macrophages and Dendritic Cells. Circulation Research. 118, 637–652 97. Chi, H. (2004) Interleukin-1 Receptor Signaling Mediates Atherosclerosis Associated With Bacterial Exposure and/or a High-Fat Diet in a Murine Apolipoprotein E Heterozygote Model: Pharmacotherapeutic Implications. Circulation. 110, 1678–1685 98. Lutgens, E., Lievens, D., Beckers, L., Wijnands, E., Soehnlein, O., Zernecke, A., Seijkens, T., Engel, D., Cleutjens, J., Keller, A. M., Naik, S. H., Boon, L., Oufella, H. A., Mallat, Z., Ahonen, C. L., Noelle, R. J., de Winther, M. P., Daemen, M. J., Biessen, E. A., and Weber, C. (2010) Deficient CD40-TRAF6 signaling in leukocytes prevents atherosclerosis by skewing the immune response toward an antiinflammatory profile. Journal of Experimental Medicine. 207, 391–404 99. Smith, J. D., Trogan, E., Ginsberg, M., Grigaux, C., Tian, J., and Miyata, M. (1995) Decreased atherosclerosis in mice deficient in both macrophage colony-stimulating factor (op) and apolipoprotein E. Proc. Natl. Acad. Sci. U.S.A. 92, 8264–8268 100. Stoneman, V., Braganza, D., Figg, N., Mercer, J., Lang, R., Goddard, M., and Bennett, M. (2007) Monocyte/macrophage suppression in CD11b diphtheria toxin receptor transgenic mice differentially affects atherogenesis and established plaques. Circulation Research. 100, 884–893 101. Collart, M. A., and Panasenko, O. O. (2012) The Ccr4-Not complex. Gene. 492, 42–53 102. Nahrendorf, M., Swirski, F. K., Aikawa, E., Stangenberg, L., Wurdinger, T., Figueiredo, J. L., Libby, P., Weissleder, R., and Pittet, M. J. (2007) The healing myocardium sequentially mobilizes two monocyte subsets with divergent and complementary functions. Journal of Experimental Medicine. 204, 3037–3047 103. Carlin, L. M., Stamatiades, E. G., Auffray, C., Hanna, R. N., Glover, L., Vizcay- Barrena, G., Hedrick, C. C., Cook, H. T., Diebold, S., and Geissmann, F. (2013) Nr4a1- dependent Ly6C(low) monocytes monitor endothelial cells and orchestrate their disposal. Cell. 153, 362–375 104. Yi, J., Chang, N., Liu, X., Guo, G., Xue, L., Tong, T., Gorospe, M., and Wang, W. (2010) Reduced nuclear export of HuR mRNA by HuR is linked to the loss of HuR in replicative senescence. Nucleic Acids Research. 38, 1547–1558 105. Al-Ahmadi, W., Al-Ghamdi, M., Al-Haj, L., Al-Saif, M., and Khabar, K. S. A. (2009) Alternative polyadenylation variants of the RNA binding protein, HuR: abundance, role of AU-rich elements and auto-Regulation. Nucleic Acids Research. 37, 3612–3624 106. Swirski, F. K., Libby, P., Aikawa, E., Alcaide, P., Luscinskas, F. W., Weissleder, R., and Pittet, M. J. (2007) Ly-6Chi monocytes dominate hypercholesterolemia-associated

154

monocytosis and give rise to macrophages in atheromata. J. Clin. Invest. 117, 195–205 107. Landsman, L., Bar-On, L., Zernecke, A., Kim, K. W., Krauthgamer, R., Shagdarsuren, E., Lira, S. A., Weissman, I. L., Weber, C., and Jung, S. (2009) CX3CR1 is required for monocyte homeostasis and atherogenesis by promoting cell survival. Blood. 113, 963– 972 108. Tacke, F., Alvarez, D., Kaplan, T. J., Jakubzick, C., Spanbroek, R., Llodra, J., Garin, A., Liu, J., Mack, M., van Rooijen, N., Lira, S. A., Habenicht, A. J., and Randolph, G. J. (2007) Monocyte subsets differentially employ CCR2, CCR5, and CX3CR1 to accumulate within atherosclerotic plaques. J. Clin. Invest. 117, 185–194 109. Lin, F. Y., Chen, Y. H., Lin, Y. W., Tsai, J. S., Chen, J. W., Wang, H. J., Chen, Y. L., Li, C. Y., and Lin, S. J. (2006) The role of human antigen R, an RNA-binding protein, in mediating the stabilization of toll-like receptor 4 mRNA induced by endotoxin: a novel mechanism involved in vascular inflammation. Arteriosclerosis, Thrombosis, and Vascular Biology. 26, 2622–2629 110. Potteaux, S., Gautier, E. L., hutchison, S. B., van Rooijen, N., Rader, D. J., Thomas, M. J., Sorci-Thomas, M. G., and Randolph, G. J. (2011) Suppressed monocyte recruitment drives macrophage removal from atherosclerotic plaques of Apoe-/- mice during disease regression. J. Clin. Invest. 121, 2025–2036 111. Llodra, J., Angeli, V., Liu, J., Trogan, E., Fisher, E. A., and Randolph, G. J. (2004) Emigration of monocyte-derived cells from atherosclerotic lesions characterizes regressive, but not progressive, plaques. Proc. Natl. Acad. Sci. U.S.A. 101, 11779–11784 112. van Gils, J. M., Ramkhelawon, B., Fernandes, L., Stewart, M. C., Guo, L., Seibert, T., Menezes, G. B., Cara, D. C., Chow, C., Kinane, T. B., Fisher, E. A., Balcells, M., Alvarez-Leite, J., Lacy-Hulbert, A., and Moore, K. J. (2013) Endothelial expression of guidance cues in vessel wall homeostasis dysregulation under proatherosclerotic conditions. Arteriosclerosis, Thrombosis, and Vascular Biology. 33, 911–919 113. Finney, A. C., Funk, S. D., Green, J., Yurdagul, A., Rana, M. A., Pistorius, R., Henry, M., Yurochko, A. D., Pattillo, C. B., Traylor, J. G., Chen, J., Woolard, M. D., Kevil, C. G., and Orr, A. W. (2017) EphA2 Expression Regulates Inflammation and Fibroproliferative Remodeling in Atherosclerosis. Circulation. 136, 566–582 114. van Gils, J. M., Derby, M. C., Fernandes, L. R., Ramkhelawon, B., Ray, T. D., Rayner, K. J., Parathath, S., Distel, E., Feig, J. L., Alvarez-Leite, J. I., Rayner, A. J., McDonald, T. O., O'Brien, K. D., Stuart, L. M., Fisher, E. A., Lacy-Hulbert, A., and Moore, K. J. (2012) The neuroimmune guidance cue netrin-1 promotes atherosclerosis by inhibiting the emigration of macrophages from plaques. Nature Publishing Group. 13, 136–143 115. Park, Y. M., Febbraio, M., and Silverstein, R. L. (2009) CD36 modulates migration of mouse and human macrophages in response to oxidized LDL and may contribute to macrophage trapping in the arterial intima. J. Clin. Invest. 119, 136–145 116. Feig, J. E., Pineda-Torra, I., Sanson, M., Bradley, M. N., Vengrenyuk, Y., Bogunovic, D., Gautier, E. L., Rubinstein, D., Hong, C., Liu, J., Wu, C., van Rooijen, N., Bhardwaj, N., Garabedian, M., Tontonoz, P., and Fisher, E. A. (2010) LXR promotes the maximal egress of monocyte-derived cells from mouse aortic plaques during atherosclerosis regression. J. Clin. Invest. 120, 4415–4424 117. Roufaiel, M., Gracey, E., Siu, A., Zhu, S. N., Lau, A., Ibrahim, H., Althagafi, M., Tai, K., Hyduk, S. J., Cybulsky, K. O., Ensan, S., Li, A., Besla, R., Becker, H. M., Xiao, H., Luther, S. A., Inman, R. D., Robbins, C. S., Jongstra-Bilen, J., and Cybulsky, M. I. (2016) CCL19-CCR7–dependent reverse transendothelial migration of myeloid cells

155

clears Chlamydia muridarum from the arterial intima. Nature Publishing Group. 17, 1263–1272 118. Chinetti-Gbaguidi, G., Colin, S., and Staels, B. (2014) Macrophage subsets in atherosclerosis. Nature Reviews Cardiology. 12, 10–17 119. Friedländer, M. R., Lizano, E., Houben, A. J. S., Bezdan, D., Báñez-Coronel, M., Kudla, G., Mateu-Huertas, E., Kagerbauer, B., González, J., Chen, K. C., LeProust, E. M., Martí, E., and Estivill, X. (2014) Evidence for the biogenesis of more than 1,000 novel human microRNAs. Genome Biol. 15, R57 120. Kunjathoor, V. V. (2002) Scavenger Receptors Class A-I/II and CD36 Are the Principal Receptors Responsible for the Uptake of Modified Low Density Lipoprotein Leading to Lipid Loading in Macrophages. Journal of Biological Chemistry. 277, 49982–49988 121. Moore, K. J., Kunjathoor, V. V., Koehn, S. L., Manning, J. J., Tseng, A. A., Silver, J. M., McKee, M., and Freeman, M. W. (2005) Loss of receptor-mediated lipid uptake via scavenger receptor A or CD36 pathways does not ameliorate atherosclerosis in hyperlipidemic mice. J. Clin. Invest. 115, 2192–2201 122. Manning-Tobin, J. J., Moore, K. J., and Seimon, T. A. (2009) Loss of SR-A and CD36 Activity Reduces Atherosclerotic Lesion Complexity Without Abrogating Foam Cell Formation in Hyperlipidemic Mice. Arteriosclerosis, Thrombosis, and Vascular Biology. 29, 19–26 123. Kruth, H. S., Jones, N. L., Huang, W., Zhao, B., Ishii, I., Chang, J., Combs, C. A., Malide, D., and Zhang, W. Y. (2005) Macropinocytosis is the endocytic pathway that mediates macrophage foam cell formation with native low density lipoprotein. J. Biol. Chem. 280, 2352–2360 124. Robbins, C. S., Hilgendorf, I., Weber, G. F., Theurl, I., Iwamoto, Y., Figueiredo, J. L., Gorbatov, R., Sukhova, G. K., Gerhardt, L. M., Smyth, D., Zavitz, C. C., Shikatani, E. A., Parsons, M., Rooijen, N. V., Lin, H. Y., Husain, M., Libby, P., Nahrendorf, M., Weissleder, R., and Swirski, F. K. (2013) Local proliferation dominates lesional macrophage accumulation in atherosclerosis. Nature Medicine. 19, 1166–1172 125. Kolaczkowska, E., and Kubes, P. (2013) Neutrophil recruitment and function in health and inflammation. Nat. Rev. Immunol. 13, 159–175 126. Schober, A., Nazari-Jahantigh, M., Wei, Y., Bidzhekov, K., Gremse, F., Grommes, J., Megens, R. T. A., Heyll, K., Noels, H., Hristov, M., Wang, S., Kiessling, F., Olson, E. N., and Weber, C. (2014) MicroRNA-126-5p promotes endothelial proliferation and limits atherosclerosis by suppressing Dlk1. Nature Medicine. 20, 368–376 127. Rotzius, P., Thams, S., Soehnlein, O., and Kenne, E. (2010) Distinct Infiltration of Neutrophils in Lesion Shoulders in ApoE−/− Mice. The American journal of Pathology. 177, 493–500 128. Zernecke, A., Bot, I., Djalali-Talab, Y., Shagdarsuren, E., Bidzhekov, K., Meiler, S., Krohn, R., Schober, A., Sperandio, M., Soehnlein, O., Bornemann, J., Tacke, F., Biessen, E. A., and Weber, C. (2008) Protective role of CXC receptor 4/CXC ligand 12 unveils the importance of neutrophils in atherosclerosis. Circulation Research. 102, 209–217 129. Soehnlein, O., and Lindbom, L. (2010) Phagocyte partnership during the onset and resolution of inflammation. Nat. Rev. Immunol. 10, 427–439 130. Cole, J. E., Navin, T. J., and Cross, A. J. (2011) Unexpected protective role for Toll-like receptor 3 in the arterial wall. Proc. Natl. Acad. Sci. U.S.A. 108, 2372–2377 131. McLellan, A. D., Starling, G. C., Williams, L. A., Hock, B. D., and Hart, D. N. (1995)

156

Activation of human peripheral blood dendritic cells induces the CD86 co-stimulatory molecule. Eur. J. Immunol. 25, 2064–2068 132. Buono, C., Pang, H., Uchida, Y., Libby, P., Sharpe, A. H., and Lichtman, A. H. (2004) B7-1/B7-2 costimulation regulates plaque antigen-specific T-cell responses and atherogenesis in low-density lipoprotein receptor-deficient mice. Circulation. 109, 2009–2015 133. Merad, M., Sathe, P., Helft, J., Miller, J., and Mortha, A. (2013) The dendritic cell lineage: ontogeny and function of dendritic cells and their subsets in the steady state and the inflamed setting. Annu. Rev. Immunol. 31, 563–604 134. Niessner, A., Sato, K., Chaikof, E. L., Colmegna, I., Goronzy, J. J., and Weyand, C. M. (2006) Pathogen-sensing plasmacytoid dendritic cells stimulate cytotoxic T-cell function in the atherosclerotic plaque through interferon-alpha. Circulation. 114, 2482–2489 135. Sage, A. P., Murphy, D., Maffia, P., Masters, L. M., Sabir, S. R., Baker, L. L., Cambrook, H., Finigan, A. J., Ait-Oufella, H., Grassia, G., Harrison, J. E., Ludewig, B., Reith, W., Hansson, G. K., Reizis, B., Hugues, S., and Mallat, Z. (2014) MHC Class II- restricted antigen presentation by plasmacytoid dendritic cells drives proatherogenic T cell immunity. Circulation. 130, 1363–1373 136. Liuzzo, G., Goronzy, J. J., Yang, H., Kopecky, S. L., Holmes, D. R., Frye, R. L., and Weyand, C. M. (2000) Monoclonal T-cell proliferation and plaque instability in acute coronary syndromes. Circulation. 101, 2883–2888 137. Reardon, C. A., Blachowicz, L., White, T., Cabana, V., Wang, Y., Lukens, J., Bluestone, J., and Getz, G. S. (2001) Effect of Immune Deficiency on Lipoproteins and Atherosclerosis in Male Apolipoprotein E-Deficient Mice. Arteriosclerosis, Thrombosis, and Vascular Biology. 21, 1011–1016 138. Dansky, H. M., Charlton, S. A., Harper, M. M., and Smith, J. D. (1997) T and B lymphocytes play a minor role in atherosclerotic plaque formation in the apolipoprotein E-deficient mouse. Proc. Natl. Acad. Sci. U.S.A. 94, 4642–4646 139. de Boer, O. J., van der Meer, J. J., Teeling, P., van der Loos, C. M., and van der Wal, A. C. (2007) Low numbers of FOXP3 positive regulatory T cells are present in all developmental stages of human atherosclerotic lesions. PLoS ONE. 2, e779 140. Robertson, A. K. L., Rudling, M., Zhou, X., Gorelik, L., Flavell, R. A., and Hansson, G. K. (2003) Disruption of TGF-beta signaling in T cells accelerates atherosclerosis. J. Clin. Invest. 112, 1342–1350 141. Mallat, Z., Besnard, S., Duriez, M., Deleuze, V., Emmanuel, F., Bureau, M. F., Soubrier, F., Esposito, B., Duez, H., Fievet, C., Staels, B., Duverger, N., Scherman, D., and Tedgui, A. (1999) Protective Role of Interleukin-10 in Atherosclerosis. Circulation Research. 85, e17–e24 142. Ait-Oufella, H., Salomon, B. L., Potteaux, S., Robertson, A. K. L., Gourdy, P., Zoll, J., Merval, R., Esposito, B., Cohen, J. L., Fisson, S., Flavell, R. A., Hansson, G. K., Klatzmann, D., Tedgui, A., and Mallat, Z. (2006) Natural regulatory T cells control the development of atherosclerosis in mice. Nat. Med. 12, 178–180 143. Mor, A., Planer, D., Luboshits, G., Afek, A., Metzger, S., Chajek-Shaul, T., Keren, G., and George, J. (2007) Role of naturally occurring CD4+ CD25+ regulatory T cells in experimental atherosclerosis. Arteriosclerosis, Thrombosis, and Vascular Biology. 27, 893–900 144. Ammirati, E., Cianflone, D., Vecchio, V., Banfi, M., Vermi, A. C., De Metrio, M., Grigore, L., Pellegatta, F., Pirillo, A., Garlaschelli, K., Manfredi, A. A., Catapano, A. L.,

157

Maseri, A., Palini, A. G., and Norata, G. D. (2012) Effector Memory T cells Are Associated With Atherosclerosis in Humans and Animal Models. Journal of the American Heart Association. 1, 27–41 145. Gupta, S., Pablo, A. M., Jiang, X. C., Wang, N., Tall, A. R., and Schindler, C. (1997) IFN-gamma potentiates atherosclerosis in ApoE knock-out mice. J. Clin. Invest. 99, 2752–2761 146. Whitman, S. C., Ravisankar, P., Elam, H., and Daugherty, A. (2000) Exogenous interferon-gamma enhances atherosclerosis in apolipoprotein E-/- mice. Am. J. Pathol. 157, 1819–1824 147. Elhage, R. (2003) Reduced atherosclerosis in interleukin-18 deficient apolipoprotein E- knockout mice. Cardiovasc. Res. 59, 234–240 148. Buono, C., Binder, C. J., Stavrakis, G., Witztum, J. L., Glimcher, L. H., and Lichtman, A. H. (2005) T-bet deficiency reduces atherosclerosis and alters plaque antigen-specific immune responses. Proceedings of the National Academy of Sciences. 102, 1596–1601 149. Caligiuri, G., Nicoletti, A., Poirier, B., and Hansson, G. K. (2002) Protective immunity against atherosclerosis carried by B cells of hypercholesterolemic mice. J. Clin. Invest. 109, 745–753 150. Major, A. S., Fazio, S., and Linton, M. F. (2002) B-lymphocyte deficiency increases atherosclerosis in LDL receptor-null mice. Arteriosclerosis, Thrombosis, and Vascular Biology. 22, 1892–1898 151. Binder, C. J., Hartvigsen, K., Chang, M. K., Miller, M., Broide, D., Palinski, W., Curtiss, L. K., Corr, M., and Witztum, J. L. (2004) IL-5 links adaptive and natural immunity specific for epitopes of oxidized LDL and protects from atherosclerosis. J. Clin. Invest. 114, 427–437 152. Kyaw, T., Tay, C., Khan, A., Dumouchel, V., Cao, A., To, K., Kehry, M., Dunn, R., Agrotis, A., Tipping, P., Bobik, A., and Toh, B. H. (2010) Conventional B2 B cell depletion ameliorates whereas its adoptive transfer aggravates atherosclerosis. The Journal of Immunology. 185, 4410–4419 153. McKenzie, J. L., Gan, O. I., Doedens, M., Wang, J. C. Y., and Dick, J. E. (2006) Individual stem cells with highly variable proliferation and self-renewal properties comprise the human hematopoietic stem cell compartment. Nat. Immunol. 7, 1225–1233 154. Horie, T., Baba, O., Kuwabara, Y., Chujo, Y., Watanabe, S., Kinoshita, M., Horiguchi, M., Nakamura, T., Chonabayashi, K., Hishizawa, M., Hasegawa, K., Kume, N., Yokode, M., Kita, T., Kimura, T., and Ono, K. (2012) MicroRNA-33 Deficiency Reduces the Progression of Atherosclerotic Plaque in ApoE-/- Mice. Journal of the American Heart Association. 1, e003376–e003376 155. Gomez Perdiguero, E., Klapproth, K., Schulz, C., Busch, K., Azzoni, E., Crozet, L., Garner, H., Trouillet, C., de Bruijn, M. F., Geissmann, F., and Rodewald, H.-R. (2015) Tissue-resident macrophages originate from yolk-sac-derived erythro-myeloid progenitors. Nature. 518, 547–551 156. Manesia, J. K., Xu, Z., Broekaert, D., Boon, R., van Vliet, A., Eelen, G., Vanwelden, T., Stegen, S., Van Gastel, N., Pascual-Montano, A., Fendt, S. M., Carmeliet, G., Carmeliet, P., Khurana, S., and Verfaillie, C. M. (2015) Highly proliferative primitive fetal liver hematopoietic stem cells are fueled by oxidative metabolic pathways. Stem Cell Res. 15, 715–721 157. Chen, J., Kang, J. G., Keyvanfar, K., Young, N. S., and Hwang, P. M. (2016) Long-term adaptation to hypoxia preserves hematopoietic stem cell function. Exp. Hematol. 44,

158

866–873.e4 158. Suarez-Alvarez, B., Lopez-Vazquez, A., and Lopez-Larrea, C. (2012) Mobilization and Homing of Hematopoietic Stem Cells. Advances in Experimental Medicine and Biology. 741, 152–170 159. Soehnlein, O., and Swirski, F. K. (2013) Hypercholesterolemia links hematopoiesis with atherosclerosis. Trends Endocrinol Metab. 24, 129–136 160. Taichman, R. S., and Emerson, S. G. (1994) Human osteoblasts support hematopoiesis through the production of granulocyte colony-stimulating factor. J. Exp. Med. 179, 1677–1682 161. Petzer, A. L., Zandstra, P. W., Piret, J. M., and Eaves, C. J. (1996) Differential cytokine effects on primitive (CD34+CD38-) human hematopoietic cells: novel responses to Flt3- ligand and thrombopoietin. J. Exp. Med. 183, 2551–2558 162. Sugiyama, T., Kohara, H., Noda, M., and Nagasawa, T. (2006) Maintenance of the hematopoietic stem cell pool by CXCL12-CXCR4 chemokine signaling in bone marrow stromal cell niches. Immunity. 25, 977–988 163. Hooper, A. T., Butler, J. M., Nolan, D. J., Kranz, A., Iida, K., Kobayashi, M., Kopp, H.- G., Shido, K., Petit, I., Yanger, K., James, D., Witte, L., Zhu, Z., Wu, Y., Pytowski, B., Rosenwaks, Z., Mittal, V., Sato, T. N., and Rafii, S. (2009) Engraftment and reconstitution of hematopoiesis is dependent on VEGFR2-mediated regeneration of sinusoidal endothelial cells. Cell Stem Cell. 4, 263–274 164. Salter, A. B., Meadows, S. K., Muramoto, G. G., Himburg, H., Doan, P., Daher, P., Russell, L., Chen, B., Chao, N. J., and Chute, J. P. (2009) Endothelial progenitor cell infusion induces hematopoietic stem cell reconstitution in vivo. Blood. 113, 2104–2107 165. Dutta, P., Hoyer, F. F., Grigoryeva, L. S., Sager, H. B., Leuschner, F., Courties, G., Borodovsky, A., Novobrantseva, T., Ruda, V. M., Fitzgerald, K., Iwamoto, Y., Wojtkiewicz, G., Sun, Y., Da Silva, N., Libby, P., Anderson, D. G., Swirski, F. K., Weissleder, R., and Nahrendorf, M. (2015) Macrophages retain hematopoietic stem cells in the spleen via VCAM-1. Journal of Experimental Medicine. 212, 497–512 166. Baldridge, M. T., King, K. Y., Boles, N. C., Weksberg, D. C., and Goodell, M. A. (2010) Quiescent haematopoietic stem cells are activated by IFN-gamma in response to chronic infection. Nature. 465, 793–797 167. Essers, M. A. G., Offner, S., Blanco-Bose, W. E., Waibler, Z., Kalinke, U., Duchosal, M. A., and Trumpp, A. (2009) IFNalpha activates dormant haematopoietic stem cells in vivo. Nature. 458, 904–908 168. Zhao, J. L., Ma, C., O'Connell, R. M., Mehta, A., DiLoreto, R., Heath, J. R., and Baltimore, D. (2014) Conversion of Danger Signals into Cytokine Signals by Hematopoietic Stem and Progenitor Cellsfor Regulation of Stress-Induced Hematopoiesis. Stem Cell. 14, 445–459 169. Dutta, P., Sager, H. B., Stengel, K. R., Naxerova, K., Courties, G., Saez, B., Silberstein, L., Heidt, T., Sebas, M., Sun, Y., Wojtkiewicz, G., Feruglio, P. F., King, K., Baker, J. N., van der Laan, A. M., Borodovsky, A., Fitzgerald, K., Hulsmans, M., Hoyer, F., Iwamoto, Y., Vinegoni, C., Brown, D., Di Carli, M., Libby, P., Hiebert, S. W., Scadden, D. T., Swirski, F. K., Weissleder, R., and Nahrendorf, M. (2015) Myocardial Infarction Activates CCR2(+) Hematopoietic Stem and Progenitor Cells. Cell Stem Cell. 16, 477– 487 170. Leuschner, F., Rauch, P. J., Ueno, T., Gorbatov, R., Marinelli, B., Lee, W. W., Dutta, P., Wei, Y., Robbins, C., Iwamoto, Y., Sena, B., Chudnovskiy, A., Panizzi, P., Keliher, E.,

159

Higgins, J. M., Libby, P., Moskowitz, M. A., Pittet, M. J., Swirski, F. K., Weissleder, R., and Nahrendorf, M. (2012) Rapid monocyte kinetics in acute myocardial infarction are sustained by extramedullary monocytopoiesis. Journal of Experimental Medicine. 209, 123–137 171. Murphy, A. J., Akhtari, M., Tolani, S., Pagler, T., Bijl, N., Kuo, C. L., Wang, M., Sanson, M., Abramowicz, S., Welch, C., Bochem, A. E., Kuivenhoven, J. A., Yvan- Charvet, L., and Tall, A. R. (2011) ApoE regulates hematopoietic stem cell proliferation, monocytosis, and monocyte accumulation in atherosclerotic lesions in mice. J. Clin. Invest. 121, 4138–4149 172. Ye, Y. X., Calcagno, C., Binderup, T., Courties, G., Keliher, E. J., Wojtkiewicz, G. R., Iwamoto, Y., Tang, J., Perez-Medina, C., Mani, V., Ishino, S., Johnbeck, C. B., Knigge, U., Fayad, Z. A., Libby, P., Weissleder, R., Tawakol, A., Dubey, S., Belanger, A. P., Di Carli, M. F., Swirski, F. K., Kjaer, A., Mulder, W. J., and Nahrendorf, M. (2015) Imaging Macrophage and Hematopoietic Progenitor Proliferation in Atherosclerosis. Circulation Research. 117, 835–845 173. Gao, M., Zhao, D., Schouteden, S., Sorci-Thomas, M. G., Van Veldhoven, P. P., Eggermont, K., Liu, G., Verfaillie, C. M., and Feng, Y. (2014) Regulation of high- density lipoprotein on hematopoietic stem/progenitor cells in atherosclerosis requires scavenger receptor type BI expression. Arteriosclerosis, Thrombosis, and Vascular Biology. 34, 1900–1909 174. Westerterp, M., Gourion-Arsiquaud, S., Murphy, A. J., Shih, A., Cremers, S., Levine, R. L., Tall, A. R., and Yvan-Charvet, L. (2012) Regulation of hematopoietic stem and progenitor cell mobilization by cholesterol efflux pathways. Cell Stem Cell. 11, 195–206 175. Robbins, C. S., Chudnovskiy, A., Rauch, P. J., Figueiredo, J. L., Iwamoto, Y., Gorbatov, R., Etzrodt, M., Weber, G. F., Ueno, T., van Rooijen, N., Mulligan-Kehoe, M. J., Libby, P., Nahrendorf, M., Pittet, M. J., Weissleder, R., and Swirski, F. K. (2012) Extramedullary hematopoiesis generates Ly-6C(high) monocytes that infiltrate atherosclerotic lesions. Circulation. 125, 364–374 176. Smale, S. T. (2012) Dimer-specific regulatory mechanisms within the NF-κB family of transcription factors. Immunol. Rev. 246, 193–204 177. Beg, A. A., Sha, W. C., Bronson, R. T., Ghosh, S., and Baltimore, D. (1995) Embryonic lethality and liver degeneration in mice lacking the RelA component of NF-kappa B. Nature. 376, 167–170 178. Brise o, C. G., Gargaro, M., Durai, V., Davidson, J. T., Theisen, D. J., Anderson, D. A., III, Novack, D. V., Murphy, T. L., and Murphy, K. M. (2017) Deficiency of transcription factor RelB perturbs myeloid and DC development by hematopoietic- extrinsic mechanisms. Proceedings of the National Academy of Sciences. 114, 3957– 3962 179. Hayden, M. S., and Ghosh, S. (2008) Shared Principles in NF-κB Signaling. Cell. 132, 344–362 180. Beg, A. A., Sha, W. C., Bronson, R. T., and Baltimore, D. (1995) Constitutive NF-kappa B activation, enhanced granulopoiesis, and neonatal lethality in I kappa B alpha- deficient mice. Genes & Development. 9, 2736–2746 181. Régnier, C. H., Song, H. Y., Gao, X., Goeddel, D. V., Cao, Z., and Rothe, M. (1997) Identification and Characterization of an IκB Kinase. Cell. 90, 373–383 182. Li, Z. W., Chu, W., Hu, Y., Delhase, M., Deerinck, T., Ellisman, M., Johnson, R., and Karin, M. (1999) The IKKβ Subunit of IκB Kinase (IKK) is Essential for Nuclear Factor

160

κB Activation and Prevention of Apoptosis. Journal of Experimental Medicine. 189, 1839–1845 183. Rudolph, D., Yeh, W. C., Wakeham, A., Rudolph, B., Nallainathan, D., Potter, J., Elia, A. J., and Mak, T. W. (2000) Severe liver degeneration and lack of NF-κB activation in NEMO/IKKγ-deficient mice. Genes & Development. 14, 854–862 184. Li, Q. (1999) Severe Liver Degeneration in Mice Lacking the IkappaB Kinase 2 Gene. Science. 284, 321–325 185. Doi, T. S., Marino, M. W., Takahashi, T., Yoshida, T., Sakakura, T., Old, L. J., and Obata, Y. (1999) Absence of tumor necrosis factor rescues RelA-deficient mice from embryonic lethality. Proc. Natl. Acad. Sci. U.S.A. 96, 2994–2999 186. Hu, Y. (1999) Abnormal Morphogenesis But Intact IKK Activation in Mice Lacking the IKK Subunit of IB Kinase. Science. 284, 316–320 187. Hayden, M. S., and Ghosh, S. (2012) NF-κB, the first quarter-century: remarkable progress and outstanding questions. Genes & Development. 26, 203–234 188. Albrecht, C., Preusch, M. R., Hofmann, G., Morris-Rosenfeld, S., Blessing, E., Rosenfeld, M. E., Katus, H. A., and Bea, F. (2010) Egr-1 deficiency in bone marrow- derived cells reduces atherosclerotic lesion formation in a hyperlipidaemic mouse model. Cardiovasc. Res. 86, 321–329 189. Harja, E., Bucciarelli, L. G., Lu, Y., Stern, D. M., Zou, Y. S., Schmidt, A. M., and Yan, S. F. (2004) Early Growth Response-1 Promotes Atherogenesis: Mice Deficient in Early Growth Response-1 and Apolipoprotein E Display Decreased Atherosclerosis and Vascular Inflammation. Circulation Research. 94, 333–339 190. De Caterina, R., Massaro, M., Scoditti, E., and Annunziata Carluccio, M. (2010) Pharmacological modulation of vascular inflammation in atherothrombosis. Ann N Y Acad Sci. 1207, 23–31 191. Janssens, S., Burns, K., Tschopp, J., and Beyaert, R. (2002) Regulation of interleukin-1- and lipopolysaccharide-induced NF-kappaB activation by alternative splicing of MyD88. Curr. Biol. 12, 467–471 192. Janssens, S., Burns, K., Vercammen, E., Tschopp, J., and Beyaert, R. (2003) MyD88S, a splice variant of MyD88, differentially modulates NF-kappaB- and AP-1-dependent gene expression. FEBS Letters. 548, 103–107 193. Burns, K., Janssens, S., Brissoni, B., Olivos, N., Beyaert, R., and Tschopp, J. (2003) Inhibition of interleukin 1 receptor/Toll-like receptor signaling through the alternatively spliced, short form of MyD88 is due to its failure to recruit IRAK-4. J. Exp. Med. 197, 263–268 194. Wertz, I. E., O'Rourke, K. M., Zhou, H., Eby, M., Aravind, L., Seshagiri, S., Wu, P., Wiesmann, C., Baker, R., Boone, D. L., Ma, A., Koonin, E. V., and Dixit, V. M. (2004) De-ubiquitination and ubiquitin ligase domains of A20 downregulate NF-kappaB signalling. Nature. 430, 694–699 195. Boone, D. L., Turer, E. E., Lee, E. G., Ahmad, R. C., Wheeler, M. T., Tsui, C., Hurley, P., Chien, M., Chai, S., Hitotsumatsu, O., McNally, E., Pickart, C., and Ma, A. (2004) The ubiquitin-modifying enzyme A20 is required for termination of Toll-like receptor responses. Nat. Immunol. 5, 1052–1060 196. Michelsen, K. S., Wong, M. H., Shah, P. K., Zhang, W., Yano, J., Doherty, T. M., Akira, S., Rajavashisth, T. B., and Arditi, M. (2004) Lack of Toll-like receptor 4 or myeloid differentiation factor 88 reduces atherosclerosis and alters plaque phenotype in mice deficient in apolipoprotein E. Proc. Natl. Acad. Sci. U.S.A. 101, 10679–10684

161

197. Zhao, J. L., Rao, D. S., Boldin, M. P., Taganov, K. D., O'Connell, R. M., and Baltimore, D. (2011) NF-kappaB dysregulation in microRNA-146a-deficient mice drives the development of myeloid malignancies. Proceedings of the National Academy of Sciences. 108, 9184–9189 198. Boldin, M. P., Taganov, K. D., Rao, D. S., Yang, L., Zhao, J. L., Kalwani, M., Garcia- Flores, Y., Luong, M., Devrekanli, A., Xu, J., Sun, G., Tay, J., Linsley, P. S., and Baltimore, D. (2011) miR-146a is a significant brake on autoimmunity, myeloproliferation, and cancer in mice. Journal of Experimental Medicine. 208, 1189– 1201 199. Kirii, H., Niwa, T., Yamada, Y., Wada, H., Saito, K., Iwakura, Y., Asano, M., Moriwaki, H., and Seishima, M. (2003) Lack of Interleukin-1beta Decreases the Severity of Atherosclerosis in ApoE-Deficient Mice. Arteriosclerosis, Thrombosis, and Vascular Biology. 23, 656–660 200. Wang, D., Fasciano, S., and Li, L. (2008) The interleukin-1 receptor associated kinase 1 contributes to the regulation of NFAT. Mol. Immunol. 45, 3902–3908 201. Polykratis, A., van Loo, G., Xanthoulea, S., Hellmich, M., and Pasparakis, M. (2012) Conditional Targeting of Tumor Necrosis Factor Receptor-Associated Factor 6 Reveals Opposing Functions of Toll-Like Receptor Signaling in Endothelial and Myeloid Cells in a Mouse Model of Atherosclerosis. Circulation. 126, 1739–1751 202. Wolfrum, S., Teupser, D., Tan, M., Chen, K. Y., and Breslow, J. L. (2007) The protective effect of A20 on atherosclerosis in apolipoprotein E-deficient mice is associated with reduced expression of NF-kappaB target genes. Proceedings of the National Academy of Sciences. 104, 18601–18606 203. Kanters, E., Pasparakis, M., Gijbels, M. J. J., Vergouwe, M. N., Partouns-Hendriks, I., Fijneman, R. J. A., Clausen, B. E., Förster, I., Kockx, M. M., Rajewsky, K., Kraal, G., Hofker, M. H., and de Winther, M. P. J. (2003) Inhibition of NF-kappaB activation in macrophages increases atherosclerosis in LDL receptor-deficient mice. J. Clin. Invest. 112, 1176–1185 204. Goossens, P., Vergouwe, M. N., Gijbels, M. J., Curfs, D. M., van Woezik, J. H., Hoeksema, M. A., Xanthoulea, S., Leenen, P. J., Rupec, R. A., Hofker, M. H., and de Winther, M. P. (2011) Myeloid IkappaBalpha deficiency promotes atherogenesis by enhancing leukocyte recruitment to the plaques. PLoS ONE. 6, e22327 205. Goldstrohm, A. C., Hook, B. A., and Wickens, M. (2008) Regulated Deadenylation In Vitro. Methods in enzymology. 448, 77–106 206. Arribas-Layton, M., Wu, D., Lykke-Andersen, J., and Song, H. (2013) Structural and functional control of the eukaryotic mRNA decapping machinery. Biochim. Biophys. Acta. 1829, 580–589 207. Kafasla, P., Skliris, A., and Kontoyiannis, D. L. (2014) Post-transcriptional coordination of immunological responses by RNA-binding proteins. Nature Publishing Group. 15, 492–502 208. Chen, C. Y., Gherzi, R., Ong, S. E., Chan, E. L., Raijmakers, R., Pruijn, G. J., Stoecklin, G., Moroni, C., Mann, M., and Karin, M. (2001) AU binding proteins recruit the exosome to degrade ARE-containing mRNAs. Cell. 107, 451–464 209. Brooks, S. A., and Blackshear, P. J. (2013) Tristetraprolin (TTP): interactions with mRNA and proteins, and current thoughts on mechanisms of action. Biochim. Biophys. Acta. 1829, 666–679 210. Taylor, G. A., Carballo, E., Lee, D. M., Lai, W. S., and Thompson, M. J. (1996) A

162

Pathogenetic Role for TNFα in the Syndrome of Cachexia, Arthritis, and Autoimmunity Resulting from Tristetraprolin (TTP) Deficiency. Immunity. 4, 445–454 211. Lu, J. Y., Sadri, N., and Schneider, R. J. (2006) Endotoxic shock in AUF1 knockout mice mediated by failure to degrade proinflammatory cytokine mRNAs. Genes & Development. 20, 3174–3184 212. Lin, W. J., Zheng, X., Lin, C.-C., Tsao, J., Zhu, X., Cody, J. J., Coleman, J. M., Gherzi, R., Luo, M., Townes, T. M., Parker, J. N., and Chen, C.-Y. (2011) Posttranscriptional control of type I interferon genes by KSRP in the innate immune response against viral infection. Mol. Cell. Biol. 31, 3196–3207 213. Pont, A. R., Sadri, N., Hsiao, S. J., Smith, S., and Schneider, R. J. (2012) mRNA Decay Factor AUF1 Maintains Normal Aging, Telomere Maintenance, and Suppression of Senescence by Activation of Telomerase Transcription. Molecular Cell. 10.1016/j.molcel.2012.04.019 214. Zhao, J. L., Rao, D. S., O'Connell, R. M., Garcia-Flores, Y., and Baltimore, D. (2013) MicroRNA-146a acts as a guardian of the quality and longevity of hematopoietic stem cells in mice. eLife. 2, e00537 215. Kawai, T., Lal, A., Yang, X., Galban, S., Mazan-Mamczarz, K., and Gorospe, M. (2006) Translational control of cytochrome c by RNA-binding proteins TIA-1 and HuR. Molecular and Cellular Biology. 26, 3295–3307 216. Katsanou, V., Papadaki, O., Milatos, S., Blackshear, P. J., Anderson, P., Kollias, G., and Kontoyiannis, D. L. (2005) HuR as a Negative Posttranscriptional Modulator in Inflammation. Molecular Cell. 19, 777–789 217. Bhattacharyya, S. N., Habermacher, R., and Martine, U. (2006) Relief of microRNA- Mediated Translational Repression in Human Cells Subjected to Stress. Cell. 125, 1111– 1124 218. Kim, H. H., Kuwano, Y., Srikantan, S., Lee, E. K., Martindale, J. L., and Gorospe, M. (2009) HuR recruits let-7/RISC to repress c-Myc expression. Genes & Development. 23, 1743–1748 219. Durie, D., Lewis, S. M., Liwak, U., Kisilewicz, M., Gorospe, M., and Holcik, M. (2011) RNA-binding protein HuR mediates cytoprotection through stimulation of XIAP translation. Oncogene. 30, 1460–1469 220. Yeh, C. H., Hung, L. Y., Hsu, C., Le, S. Y., and Lee, P. T. (2008) RNA-binding Protein HuR Interacts with Thrombomodulin 5′ Untranslated Region and Represses Internal Ribosome Entry Site–mediated Translation under IL-1β treatment. Molecular biology of the Cell. 19, 3812–3822 221. Kullmann, M., Göpfert, U., Siewe, B., and Hengst, L. (2002) ELAV/Hu proteins inhibit p27 translation via an IRES element in the p27 5'UTR. Genes & Development. 16, 3087–3099 222. Kang, M. J., Ryu, B. K., Lee, M. G., Han, J., Lee, J. H., and Ha, T. K. (2008) NF-κB Activates Transcription of the RNA-Binding Factor HuR, via PI3K-AKT Signaling, to Promote Gastric Tumorigenesis. Gastroenterology. 135, 2030–2042 223. Sung, S. C., Kim, K., Lee, K.-A., Choi, K.-H., Kim, S.-M., Son, Y.-H., Moon, Y.-S., Eo, S.-K., and Rhim, B.-Y. (2009) 7-Ketocholesterol upregulates interleukin-6 via mechanisms that are distinct from those of tumor necrosis factor-alpha, in vascular smooth muscle cells. J. Vasc. Res. 46, 36–44 224. Wang, J. G., Collinge, M., Ramgolam, V., Ayalon, O., Fan, X. C., Pardi, R., and Bender, J. R. (2006) LFA-1-dependent HuR nuclear export and cytokine mRNA stabilization in

163

T cell activation. J. Immunol. 176, 2105–2113 225. Zhou, H., Jarujaron, S., Gurley, E. C., Chen, L., Ding, H., Studer, E., Pandak, W. M., Hu, W., Zou, T., Wang, J. Y., and Hylemon, P. B. (2007) HIV protease inhibitors increase TNF-alpha and IL-6 expression in macrophages: involvement of the RNA- binding protein HuR. Atherosclerosis. 195, e134–43 226. Yiakouvaki, A., Dimitriou, M., Karakasiliotis, I., Eftychi, C., Theocharis, S., and Kontoyiannis, D. L. (2012) Myeloid cell expression of the RNA-binding protein HuR protects mice from pathologic inflammation and colorectal carcinogenesis. J. Clin. Invest. 122, 48–61 227. Gubin, M. M., Techasintana, P., Magee, J. D., Dahm, G. M., Calaluce, R., Martindale, J. L., Whitney, M. S., Franklin, C. L., Besch-Williford, C., Hollingsworth, J. W., Abdelmohsen, K., Gorospe, M., and Atasoy, U. (2014) Conditional knockout of the RNA-binding protein HuR in CD4⁺ T cells reveals a gene dosage effect on cytokine production. Mol. Med. 20, 93–108 228. Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., and Mello, C. C. (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806–811 229. Bartel, D. P. (2009) MicroRNAs: Target Recognition and Regulatory Functions. Cell. 136, 215–233 230. Baek, D., Villén, J., Shin, C., Camargo, F. D., Gygi, S. P., and Bartel, D. P. (2008) The impact of microRNAs on protein output. Nature. 455, 64–71 231. Fish, J. E., Santoro, M. M., Morton, S. U., Yu, S., Yeh, R. F., Wythe, J. D., Ivey, K. N., Bruneau, B. G., Stainier, D. Y. R., and Srivastava, D. (2008) miR-126 Regulates Angiogenic Signaling and Vascular Integrity. Developmental Cell. 15, 272–284 232. Fish, J. E., Wythe, J. D., Xiao, T., Bruneau, B. G., Stainier, D. Y. R., Srivastava, D., and Woo, S. (2011) A Slit/miR-218/Robo regulatory loop is required during heart tube formation in zebrafish. Development. 138, 1409–1419 233. Small, E. M., and Olson, E. N. (2011) Pervasive roles of microRNAs in cardiovascular biology. Nature. 469, 336–342 234. Concepcion, C. P., Bonetti, C., and Ventura, A. (2012) The miR-17-92 family of microRNA clusters in development and disease. Cancer journal (Sudbury 235. Najafi-Shoushtari, S. H., Kristo, F., Li, Y., Shioda, T., Cohen, D. E., Gerszten, R. E., and Näär, A. M. (2010) MicroRNA-33 and the SREBP host genes cooperate to control cholesterol homeostasis. Science. 328, 1566–1569 236. Lutter, D., Marr, C., Krumsiek, J., Lang, E. W., and Theis, F. J. (2010) Intronic microRNAs support their host genes by mediating synergistic and antagonistic regulatory effects. BMC Genomics. 11, 224 237. Bartel, D. P. (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 116, 281–297 238. Lee, Y., Ahn, C., Han, J., Choi, H., Kim, J., Yim, J., Lee, J., Provost, P., Rådmark, O., Kim, S., and Kim, V. N. (2003) The nuclear RNase III Drosha initiates microRNA processing. Nature. 425, 415–419 239. Fabian, M. R., Mathonnet, G., Sundermeier, T., Mathys, H., Zipprich, J. T., Svitkin, Y. V., Rivas, F., Jinek, M., Wohlschlegel, J., Doudna, J. A., Chen, C. Y. A., Shyu, A.-B., Yates, J. R., III, Hannon, G. J., Filipowicz, W., Duchaine, T. F., and Sonenberg, N. (2009) Mammalian miRNA RISC Recruits CAF1 and PABP to Affect PABP-Dependent Deadenylation. Molecular Cell. 35, 868–880

164

240. Newman, M. A., Thomson, J. M., and Hammond, S. M. (2008) Lin-28 interaction with the Let-7 precursor loop mediates regulated microRNA processing. RNA. 14, 1539–1549 241. Suzuki, H. I., Arase, M., Matsuyama, H., Choi, Y. L., Ueno, T., Mano, H., Sugimoto, K., and Miyazono, K. (2011) MCPIP1 Ribonuclease Antagonizes Dicer and Terminates MicroRNA Biogenesis through Precursor MicroRNA Degradation. Molecular Cell. 44, 424–436 242. Yang, J. S., and Lai, E. C. (2011) Alternative miRNA Biogenesis Pathways and the Interpretation of Core miRNA Pathway Mutants. Molecular Cell. 43, 892–903 243. Njock, M. S., Cheng, H. S., Dang, L. T., Nazari-Jahantigh, M., Lau, A. C., Boudreau, E., Roufaiel, M., Cybulsky, M. I., Schober, A., and Fish, J. E. (2015) Endothelial cells suppress monocyte activation through secretion of extracellular vesicles containing antiinflammatory microRNAs. Blood. 125, 3202–3212 244. Hergenreider, E., Heydt, S., Tréguer, K., Boettger, T., Horrevoets, A. J. G., Zeiher, A. M., Scheffer, M. P., Frangakis, A. S., Yin, X., Mayr, M., Braun, T., Urbich, C., Boon, R. A., and Dimmeler, S. (2012) Atheroprotective communication between endothelial cells and smooth muscle cells through miRNAs. Nature Cell Biology. 14, 249–256 245. Zernecke, A., Bidzhekov, K., Noels, H., Shagdarsuren, E., Gan, L., Denecke, B., Hristov, M., Koppel, T., Jahantigh, M. N., Lutgens, E., Wang, S., Olson, E. N., Schober, A., and Weber, C. (2009) Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12-Dependent Vascular Protection. Science Signaling. 2, ra81–ra81 246. Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., and Remaley, A. T. (2011) MicroRNAs are transported in plasma and delivered to recipient cells by high- density lipoproteins. Nature Cell Biology. 13, 423–433 247. Tabet, F., Vickers, K. C., Torres, L. F. C., Wiese, C. B., Shoucri, B. M., Lambert, G., Catherinet, C., Prado-Lourenco, L., Levin, M. G., Thacker, S., Sethupathy, P., Barter, P. J., Remaley, A. T., and Rye, K. A. (2014) HDL-transferred microRNA-223 regulates ICAM-1 expression in endothelial cells. Nature Communications. 5, 1–14 248. Qin, X., Wang, X., Wang, Y., Tang, Z., Cui, Q., Xi, J., Li, Y. S. J., Chien, S., and Wang, N. (2010) MicroRNA-19a mediates the suppressive effect of laminar flow on cyclin D1 expression in human umbilical vein endothelial cells. Proceedings of the National Academy of Sciences. 107, 3240–3244 249. Wang, J. G., Williams, J. C., Davis, B. K., Jacobson, K., Doerschuk, C. M., Ting, J. P. Y., and Mackman, N. (2011) Monocytic microparticles activate endothelial cells in an IL-1β-dependent manner. Blood. 118, 2366–2374 250. Weber, M., Baker, M. B., Moore, J. P., and Searles, C. D. (2010) MiR-21 is induced in endothelial cells by shear stress and modulates apoptosis and eNOS activity. Biochem. Biophys. Res. Commun. 393, 643–648 251. Fang, Y., Shi, C., Manduchi, E., Civelek, M., and Davies, P. F. (2010) MicroRNA-10a regulation of proinflammatory phenotype in athero-susceptible endothelium in vivo and in vitro. Proceedings of the National Academy of Sciences. 107, 13450–13455 252. Xue, X., Feng, T., Yao, S., Wolf, K. J., Liu, C. G., Liu, X., Elson, C. O., and Cong, Y. (2011) Microbiota Downregulates Dendritic Cell Expression of miR-10a, Which Targets IL-12/IL-23p40. The Journal of Immunology. 187, 5879–5886 253. Sato, S., Sanjo, H., Takeda, K., Ninomiya-Tsuji, J., Yamamoto, M., Kawai, T., Matsumoto, K., Takeuchi, O., and Akira, S. (2005) Essential function for the kinase TAK1 in innate and adaptive immune responses. Nat. Immunol. 6, 1087–1095 254. Yaron, A., Hatzubai, A., Davis, M., Lavon, I., Amit, S., Manning, A. M., Andersen, J.

165

S., Mann, M., Mercurio, F., and Ben-Neriah, Y. (1998) Identification of the receptor component of the IkappaBalpha-ubiquitin ligase. Nature. 396, 590–594 255. Stadthagen, G., Tehler, D., Høyland-Kroghsbo, N. M., Wen, J., Krogh, A., Jensen, K. T., Santoni-Rugiu, E., Engelholm, L. H., and Lund, A. H. (2013) Loss of miR-10a activates lpo and collaborates with activated Wnt signaling in inducing intestinal neoplasia in female mice. PLoS Genet. 9, e1003913 256. Cheng, H. S., Njock, M. S., Khyzha, N., Dang, L. T., and Fish, J. E. (2014) Noncoding RNAs regulate NF-kappaB signaling to modulate blood vessel inflammation. Front Genet. 5, 422 257. Ni, C. W., Qiu, H., and Jo, H. (2011) MicroRNA-663 upregulated by oscillatory shear stress plays a role in inflammatory response of endothelial cells. Am. J. Physiol. Heart Circ. Physiol. 300, H1762–9 258. Wu, W., Xiao, H., Laguna-Fernandez, A., Villarreal, G., Wang, K. C., Geary, G. G., Zhang, Y., Wang, W.-C., Huang, H.-D., Zhou, J., Li, Y.-S., Chien, S., Garcia-Cardena, G., and Shyy, J. Y. J. (2011) Flow-Dependent Regulation of Kruppel-Like Factor 2 Is Mediated by MicroRNA-92a. Circulation. 124, 633–641 259. Fang, Y., and Davies, P. F. (2012) Site-Specific MicroRNA-92a Regulation of Kruppel- Like Factors 4 and 2 in Atherosusceptible Endothelium. Arteriosclerosis, Thrombosis, and Vascular Biology. 32, 979–987 260. Hamik, A., Lin, Z., Kumar, A., Balcells, M., Sinha, S., Katz, J., Feinberg, M. W., Gerzsten, R. E., Edelman, E. R., and Jain, M. K. (2007) Kruppel-like factor 4 regulates endothelial inflammation. J. Biol. Chem. 282, 13769–13779 261. Zhou, G., Hamik, A., Nayak, L., Tian, H., Shi, H., Lu, Y., Sharma, N., Liao, X., Hale, A., Boerboom, L., Feaver, R. E., Gao, H., Desai, A., Schmaier, A., Gerson, S. L., Wang, Y., Atkins, G. B., Blackman, B. R., Simon, D. I., and Jain, M. K. (2012) Endothelial Kruppel-like factor 4 protects against atherothrombosis in mice. J. Clin. Invest. 122, 4727–4731 262. Loyer, X., Potteaux, S., Vion, A. C., Guerin, C. L., Boulkroun, S., Rautou, P. E., Ramkhelawon, B., Esposito, B., Dalloz, M., Paul, J. L., Julia, P., Maccario, J., Boulanger, C. M., Mallat, Z., and Tedgui, A. (2014) Inhibition of MicroRNA-92a Prevents Endothelial Dysfunction and Atherosclerosis in Mice. Circulation Research. 114, 434–443 263. Sun, X., Icli, B., Wara, A. K., Belkin, N., He, S., Kobzik, L., Hunninghake, G. M., Vera, M. P., Blackwell, T. S., Baron, R. M., and Feinberg, M. W. (2012) MicroRNA-181b regulates NF-kappaB-mediated vascular inflammation. J. Clin. Invest. 122, 1973–1990 264. Sun, X., He, S., Wara, A. K. M., Icli, B., Shvartz, E., Tesmenitsky, Y., Belkin, N., Li, D., Blackwell, T. S., Sukhova, G. K., Croce, K., and Feinberg, M. W. (2014) Systemic Delivery of MicroRNA-181b Inhibits Nuclear Factor-kappaB Activation, Vascular Inflammation, and Atherosclerosis in Apolipoprotein E-Deficient Mice. Circulation Research. 114, 32–40 265. Fagerlund, R., Kinnunen, L., Köhler, M., Julkunen, I., and Melén, K. (2005) NF- {kappa}B is transported into the nucleus by importin {alpha}3 and importin {alpha}4. J. Biol. Chem. 280, 15942–15951 266. Rodriguez, A., Vigorito, E., Clare, S., Warren, M. V., Couttet, P., Soond, D. R., van Dongen, S., Grocock, R. J., Das, P. P., Miska, E. A., Vetrie, D., Okkenhaug, K., Enright, A. J., Dougan, G., Turner, M., and Bradley, A. (2007) Requirement of bic/microRNA- 155 for normal immune function. Science. 316, 608–611

166

267. Vigorito, E., Perks, K. L., Abreu-Goodger, C., and Bunting, S. (2007) microRNA-155 Regulates the Generation of Immunoglobulin Class-Switched Plasma Cells. Immunity. 27, 847–859 268. O'Connell, R. M., Kahn, D., Gibson, W. S. J., Round, J. L., Scholz, R. L., Chaudhuri, A. A., Kahn, M. E., Rao, D. S., and Baltimore, D. (2010) MicroRNA-155 promotes autoimmune inflammation by enhancing inflammatory T cell development. Immunity. 33, 607–619 269. Nazari-Jahantigh, M., Wei, Y., Noels, H., Akhtar, S., Zhou, Z., Koenen, R. R., Heyll, K., Gremse, F., Kiessling, F., Grommes, J., Weber, C., and Schober, A. (2012) MicroRNA- 155 promotes atherosclerosis by repressing Bcl6 in macrophages. J. Clin. Invest. 122, 4190–4202 270. Tian, F. J., An, L.-N., Wang, G. K., Zhu, J.-Q., Li, Q., Zhang, Y.-Y., Zeng, A., Zou, J., Zhu, R.-F., Han, X.-S., Shen, N., Yang, H.-T., Zhao, X.-X., Huang, S., Qin, Y.-W., and Jing, Q. (2014) Elevated microRNA-155 promotes foam cell formation by targeting HBP1 in atherogenesis. Cardiovasc. Res. 103, 100–110 271. Donners, M. M. P. C., Wolfs, I. M. J., Stöger, L. J., van der Vorst, E. P. C., Pöttgens, C. C. H., Heymans, S., Schroen, B., Gijbels, M. J. J., and de Winther, M. P. J. (2012) Hematopoietic miR155 deficiency enhances atherosclerosis and decreases plaque stability in hyperlipidemic mice. PLoS ONE. 7, e35877 272. Wei, Y., Zhu, M., Corbalán-Campos, J., Heyll, K., Weber, C., and Schober, A. (2015) Regulation of Csf1r and Bcl6 in macrophages mediates the stage-specific effects of microRNA-155 on atherosclerosis. Arteriosclerosis, Thrombosis, and Vascular Biology. 35, 796–803 273. Zhu, N., Zhang, D., Chen, S., Liu, X., Lin, L., Huang, X., and Guo, Z. (2011) Endothelial enriched microRNAs regulate angiotensin II-induced endothelial inflammation and migration. Atherosclerosis. 215, 286–293 274. Wu, X., Fan, W., Fang, R., and Wu, G. (2014) Regulation of microRNA-155 in endothelial inflammation by targeting nuclear factor (NF)-κB P65. J. Cell. Biochem. 115, 1928–1936 275. Wang, L., Zhang, H., Rodriguez, S., Cao, L., Parish, J., Mumaw, C., Zollman, A., Kamoka, M. M., Mu, J., Chen, D. Z., Srour, E. F., Chitteti, B. R., HogenEsch, H., Tu, X., Bellido, T. M., Boswell, H. S., Manshouri, T., Verstovsek, S., Yoder, M. C., Kapur, R., Cardoso, A. A., and Carlesso, N. (2014) Notch-Dependent Repression of miR-155in the Bone Marrow Niche Regulates Hematopoiesis in an NF-kB-Dependent Manner. Stem Cell. 15, 51–65 276. Huang, R. S., Hu, G.-Q., Lin, B., Lin, Z.-Y., and Sun, C.-C. (2015) MicroRNA-155 Silencing Enhances Inflammatory Response and Lipid Uptake in Oxidized Low-Density Lipoprotein-Stimulated Human THP-1 Macrophages. J Investig Med. 58, 961–967 277. Ceppi, M., Pereira, P. M., Dunand-Sauthier, I., Barras, E., Reith, W., Santos, M. A., and Pierre, P. (2009) MicroRNA-155 modulates the interleukin-1 signaling pathway in activated human monocyte-derived dendritic cells. Proceedings of the National Academy of Sciences. 106, 2735–2740 278. Xiao, B., Liu, Z., Li, B. S., Tang, B., Li, W., Guo, G., Shi, Y., Wang, F., Wu, Y., Tong, W.-D., Guo, H., Mao, X.-H., and Zou, Q.-M. (2009) Induction of microRNA-155 during Helicobacter pylori infection and its negative regulatory role in the inflammatory response. J. Infect. Dis. 200, 916–925 279. Chang, J., Nicolas, E., Marks, D., Sander, C., Lerro, A., Buendia, M. A., Xu, C., Mason,

167

W. S., Moloshok, T., Bort, R., Zaret, K. S., and Taylor, J. M. (2014) miR-122, a Mammalian Liver-Specific microRNA, is Processed from hcr mRNA and MayDownregulate the High Affinity Cationic Amino Acid Transporter CAT-1. RNA Biology. 1, 106–113 280. Esau, C., Davis, S., Murray, S. F., Yu, X. X., Pandey, S. K., Pear, M., Watts, L., Booten, S. L., Graham, M., McKay, R., Subramaniam, A., Propp, S., Lollo, B. A., Freier, S., Bennett, C. F., Bhanot, S., and Monia, B. P. (2006) miR-122 regulation of lipid metabolism revealed by in vivo antisense targeting. Cell Metabolism. 3, 87–98 281. Elmén, J., Lindow, M., Schütz, S., Lawrence, M., Petri, A., Obad, S., Lindholm, M., Hedtjärn, M., Hansen, H. F., Berger, U., Gullans, S., Kearney, P., Sarnow, P., Straarup, E. M., and Kauppinen, S. (2008) LNA-mediated microRNA silencing in non-human primates. Nature. 452, 896–899 282. Krützfeldt, J., Rajewsky, N., Braich, R., Rajeev, K. G., Tuschl, T., Manoharan, M., and Stoffel, M. (2005) Silencing of microRNAs in vivo with 'antagomirs'. Nature. 438, 685– 689 283. Elm n, J., Lindow, M., Silahtaroglu, A., Bak, M., Christensen, M., Lind-Thomsen, A., Hedtj rn, M., Hansen, J. B., Hansen, H. F., Straarup, E. M., McCullagh, K., Kearney, P., and Kauppinen, S. (2007) Antagonism of microRNA-122 in mice by systemically administered LNA-antimiR leads to up-regulation of a large set of predicted target mRNAs in the liver. Nucleic Acids Research. 36, 1153–1162 284. Vickers, K. C., Shoucri, B. M., Levin, M. G., Wu, H., Pearson, D. S., Osei-Hwedieh, D., Collins, F. S., Remaley, A. T., and Sethupathy, P. (2012) MicroRNA-27b is a regulatory hub in lipid metabolism and is altered in dyslipidemia. Hepatology. 57, 533–542 285. Goedeke, L., Rotllan, N., Canfrán-Duque, A., Aranda, J. F., Ramírez, C. M., Araldi, E., Lin, C. S., Anderson, N. N., Wagschal, A., de Cabo, R., Horton, J. D., Lasunción, M. A., Näär, A. M., Suárez, Y., and Fernandez-Hernando, C. (2015) MicroRNA-148a regulates LDL receptor and ABCA1 expression to control circulating lipoprotein levels. Nature Medicine. 21, 1280–1289 286. Wagschal, A., Najafi-Shoushtari, S. H., and Wang, L. (2015) Genome-wide identification of microRNAs regulating cholesterol and triglyceride homeostasis. Nature Medicine. 21, 1290–1297 287. Feinberg, M. W., and Moore, K. J. (2016) MicroRNA Regulation of Atherosclerosis. Circulation Research. 118, 703–720 288. Rayner, K. J., Suárez, Y., Dávalos, A., Parathath, S., Fitzgerald, M. L., Tamehiro, N., Fisher, E. A., Moore, K. J., and Fernandez-Hernando, C. (2010) MiR-33 contributes to the regulation of cholesterol homeostasis. Science. 328, 1570–1573 289. Marquart, T. J., Allen, R. M., Ory, D. S., and Baldán, A. (2010) miR-33 links SREBP-2 induction to repression of sterol transporters. Proceedings of the National Academy of Sciences. 107, 12228–12232 290. Rayner, K. J., Esau, C. C., Hussain, F. N., McDaniel, A. L., Marshall, S. M., van Gils, J. M., Ray, T. D., Sheedy, F. J., Goedeke, L., Liu, X., Khatsenko, O. G., Kaimal, V., Lees, C. J., Fernandez-Hernando, C., Fisher, E. A., Temel, R. E., and Moore, K. J. (2011) Inhibition of miR-33a/b in non-human primates raises plasma HDL and lowers VLDL triglycerides. Nature. 478, 404–407 291. Rayner, K. J., Sheedy, F. J., Esau, C. C., Hussain, F. N., Temel, R. E., Parathath, S., van Gils, J. M., Rayner, A. J., Chang, A. N., Suarez, Y., Fernandez-Hernando, C., Fisher, E. A., and Moore, K. J. (2011) Antagonism of miR-33 in mice promotes reverse cholesterol

168

transport and regression of atherosclerosis. J. Clin. Invest. 121, 2921–2931 292. Rotllan, N., Ramirez, C. M., Aryal, B., Esau, C. C., and Fernandez-Hernando, C. (2013) Therapeutic Silencing of MicroRNA-33 Inhibits the Progression of Atherosclerosis in Ldlr-/- Mice. Arteriosclerosis, Thrombosis, and Vascular Biology. 33, 1973–1977 293. Marquart, T. J., Wu, J., Lusis, A. J., and Baldan, A. (2013) Anti-miR-33 Therapy Does Not Alter the Progression of Atherosclerosis in Low-Density Lipoprotein Receptor- Deficient Mice. Arteriosclerosis, Thrombosis, and Vascular Biology. 33, 455–458 294. Ouimet, M., Ediriwerra, H. N., Gundra, U. M., Sheedy, F. J., Ramkhelawon, B., hutchison, S. B., Rinehold, K., van Solingen, C., Fullerton, M. D., Cecchini, K., Rayner, K. J., Steinberg, G. R., Zamore, P. D., Fisher, E. A., Loke, P., and Moore, K. J. (2015) MicroRNA-33–dependent regulation of macrophage metabolism directs immune cell polarization in atherosclerosis. J. Clin. Invest. 125, 4334 295. Taganov, K. D., Boldin, M. P., Chang, K. J., and Baltimore, D. (2006) NF-kappaB- dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. Proceedings of the National Academy of Sciences. 103, 12481–12486 296. Cameron, J. E., Yin, Q., Fewell, C., Lacey, M., McBride, J., Wang, X., Lin, Z., Schaefer, B. C., and Flemington, E. K. (2008) Epstein-Barr Virus Latent Membrane Protein 1 Induces Cellular MicroRNA miR-146a, a Modulator of Lymphocyte Signaling Pathways. Journal of Virology. 82, 1946–1958 297. Cowan, C., Muraleedharan, C. K., O'Donnell, J. J., Singh, P. K., Lum, H., Kumar, A., and Xu, S. (2014) MicroRNA-146 inhibits thrombin-induced NF-κB activation and subsequent inflammatory responses in human retinal endothelial cells. Invest. Ophthalmol. Vis. Sci. 55, 4944–4951 298. Rau, C. S., Yang, J. C. S., Chen, Y. C., Wu, C. J., Lu, T. H., Tzeng, S. L., Wu, Y. C., and Hsieh, C. H. (2014) Lipopolysaccharide-Induced microRNA-146a Targets CARD10 and Regulates Angiogenesis in Human Umbilical Vein Endothelial Cells. Toxicol. Sci. 140, 315–326 299. Bhaumik, D., Scott, G. K., Schokrpur, S., Patil, C. K., Orjalo, A. V., Rodier, F., Lithgow, G. J., and Campisi, J. (2009) MicroRNAs miR-146a/b negatively modulate the senescence-associated inflammatory mediators IL-6 and IL-8. Aging (Albany NY). 1, 402–411 300. Kutty, R. K., Nagineni, C. N., Samuel, W., Vijayasarathy, C., Jaworski, C., Duncan, T., Cameron, J. E., Flemington, E. K., Hooks, J. J., and Redmond, T. M. (2013) Differential regulation of microRNA-146a and microRNA-146b-5p in human retinal pigment epithelial cells by interleukin-1β, tumor necrosis factor-α, and interferon-γ. Molecular vision. 19, 737 301. Vasa-Nicotera, M., Chen, H., Tucci, P., Yang, A. L., Saintigny, G., Menghini, R., Mahè, C., Agostini, M., Knight, R. A., Melino, G., and Federici, M. (2011) miR-146a is modulated in human endothelial cell with aging. Atherosclerosis. 217, 326–330 302. Olivieri, F., Lazzarini, R., Recchioni, R., Marcheselli, F., Rippo, M. R., Di Nuzzo, S., Albertini, M. C., Graciotti, L., Babini, L., Mariotti, S., Spada, G., Abbatecola, A. M., Antonicelli, R., Franceschi, C., and Procopio, A. D. (2013) MiR-146a as marker of senescence-associated pro-inflammatory status in cells involved in vascular remodelling. Age. 35, 1157–1172 303. Ma, S., Tian, X. Y., Zhang, Y., Mu, C., Shen, H., Bismuth, J., Pownall, H. J., Huang, Y., and Wong, W. T. (2016) E-selectin-targeting delivery of microRNAs by microparticles

169

ameliorates endothelial inflammation and atherosclerosis. Sci Rep. 6, 22910 304. Biswas, S. K., and Lopez-Collazo, E. (2009) Endotoxin tolerance: new mechanisms, molecules and clinical significance. Trends in Immunology. 30, 475–487 305. Nahid, M. A., Pauley, K. M., Satoh, M., and Chan, E. K. L. (2009) miR-146a is critical for endotoxin-induced tolerance: IMPLICATION IN INNATE IMMUNITY. Journal of Biological Chemistry. 284, 34590–34599 306. Banerjee, S., Meng, J., Das, S., Krishnan, A., Haworth, J., Charboneau, R., Zeng, Y., Ramakrishnan, S., and Roy, S. (2013) Morphine induced exacerbation of sepsis is mediated by tempering endotoxin tolerance through modulation of miR-146a. Sci Rep. 3, 1977 307. Yang, K., He, Y. S., Wang, X. Q., Lu, L., Chen, Q. J., Liu, J., Sun, Z., and Shen, W. F. (2011) MiR-146a inhibits oxidized low-density lipoprotein-induced lipid accumulation and inflammatory response via targeting toll-like receptor 4. FEBS Letters. 585, 854– 860 308. Etzrodt, M., Cortez-Retamozo, V., Newton, A., Zhao, J., Ng, A., Wildgruber, M., Romero, P., Wurdinger, T., Xavier, R., Geissmann, F., Meylan, E., Nahrendorf, M., Swirski, F. K., Baltimore, D., Weissleder, R., and Pittet, M. J. (2012) Regulation of Monocyte Functional Heterogeneity by miR-146a and Relb. Cell Reports. 1, 317–324 309. Yang, L., Boldin, M. P., Yu, Y., Liu, C. S., Ea, C. K., Ramakrishnan, P., Taganov, K. D., Zhao, J. L., and Baltimore, D. (2012) miR-146a controls the resolution of T cell responses in mice. Journal of Experimental Medicine. 209, 1655–1670 310. Lu, L.-F., Boldin, M. P., Chaudhry, A., Lin, L.-L., Taganov, K. D., Hanada, T., Yoshimura, A., Baltimore, D., and Rudensky, A. Y. (2010) Function of miR-146a in Controlling Treg Cell-Mediated Regulation of Th1 Responses. Cell. 142, 914–929 311. Runtsch, M. C., Hu, R., Alexander, M., Wallace, J., Kagele, D., Petersen, C., Valentine, J. F., Welker, N. C., Bronner, M. P., Chen, X., Smith, D. P., Ajami, N. J., Petrosino, J. F., Round, J. L., and O'Connell, R. M. (2015) MicroRNA-146a constrains multiple parameters of intestinal immunity and increases susceptibility to DSS colitis. Oncotarget. 6, 28556–28572 312. Raitoharju, E., Lyytikäinen, L. P., Levula, M., Oksala, N., Mennander, A., Tarkka, M., Klopp, N., Illig, T., Kähönen, M., Karhunen, P. J., Laaksonen, R., and Lehtimäki, T. (2011) miR-21, miR-210, miR-34a, and miR-146a/b are up-regulated in human atherosclerotic plaques in the Tampere Vascular Study. Atherosclerosis. 219, 211–217 313. Xiong, X. D., Cho, M., Cai, X. P., Cheng, J., Jing, X., Cen, J. M., Liu, X., Yang, X. L., and Suh, Y. (2014) A common variant in pre-miR-146 is associated with coronary artery disease risk and its mature miRNA expression. Mutat Res. 761, 15–20 314. Ramkaran, P., Khan, S., Phulukdaree, A., Moodley, D., and Chuturgoon, A. A. (2014) miR-146a polymorphism influences levels of miR-146a, IRAK-1, and TRAF-6 in young patients with coronary artery disease. Cell Biochem Biophys. 68, 259–266 315. Bao, M. H., Xiao, Y., Zhang, Q. S., Luo, H. Q., Luo, J., Zhao, J., Li, G. Y., Zeng, J., and Li, J. M. (2015) Meta-Analysis of miR-146a Polymorphisms Association with Coronary Artery Diseases and Ischemic Stroke. IJMS. 16, 14305–14317 316. He, Y., Yang, J., Kong, D., Lin, J., Xu, C., Ren, H., Ouyang, P., Ding, Y., and Wang, K. (2015) Association of miR-146a rs2910164 polymorphism with cardio-cerebrovascular diseases: A systematic review and meta-analysis. Gene. 565, 171–179 317. Jazdzewski, K., Murray, E. L., Franssila, K., Jarzab, B., Schoenberg, D. R., and La Chapelle, De, A. (2008) Common SNP in pre-miR-146a decreases mature miR

170

expression and predisposes to papillary thyroid carcinoma. Proceedings of the National Academy of Sciences. 105, 7269–7274 318. Li, K., Ching, D., Luk, F. S., and Raffai, R. L. (2015) Apolipoprotein E enhances microRNA-146a in monocytes and macrophages to suppress nuclear factor-kappaB- driven inflammation and atherosclerosis. Circulation Research. 117, e1–e11 319. Aird, W. C. (2003) The role of the endothelium in severe sepsis and multiple organ dysfunction syndrome. Blood. 101, 3765–3777 320. London, N. R., Zhu, W., Bozza, F. A., Smith, M. C., Greif, D. M., Sorensen, L. K., Chen, L., Kaminoh, Y., Chan, A. C., Passi, S. F., Day, C. W., Barnard, D. L., Zimmerman, G. A., Krasnow, M. A., and Li, D. Y. (2010) Targeting Robo4-dependent Slit signaling to survive the cytokine storm in sepsis and influenza. Science Translational Medicine. 2, 23ra19 321. Ruland, J. (2011) Return to homeostasis: downregulation of NF-kappaB responses. Nature Publishing Group. 12, 709–714 322. Ye, X., Ding, J., Zhou, X., Chen, G., and Liu, S. F. (2008) Divergent roles of endothelial NF-kappaB in multiple organ injury and bacterial clearance in mouse models of sepsis. Journal of Experimental Medicine. 205, 1303–1315 323. Hajra, L., Evans, A. I., Chen, M., Hyduk, S. J., Collins, T., and Cybulsky, M. I. (2000) The NF-kappa B signal transduction pathway in aortic endothelial cells is primed for activation in regions predisposed to atherosclerotic lesion formation. Proc. Natl. Acad. Sci. U.S.A. 97, 9052–9057 324. Shin, I. S., Kim, J. M., Kim, K. L., Jang, S. Y., Jeon, E. S., Choi, S. H., Kim, D. K., Suh, W., and Kim, Y. W. (2009) Early growth response factor-1 is associated with intraluminal thrombus formation in human abdominal aortic aneurysm. J Am Coll Cardiol. 53, 792–799 325. Wieland, G. D., Nehmann, N., Muller, D., Eibel, H., Siebenlist, U., Suhnel, J., Zipfel, P. F., and Skerka, C. (2005) Early growth response proteins EGR-4 and EGR-3 interact with immune inflammatory mediators NF-kappaB p50 and p65. J Cell Sci. 118, 3203– 3212 326. Yan, S. F., Fujita, T., Lu, J., Okada, K., Shan Zou, Y., Mackman, N., Pinsky, D. J., and Stern, D. M. (2000) Egr-1, a master switch coordinating upregulation of divergent gene families underlying ischemic stress. Nat. Med. 6, 1355–1361 327. Arenzana-Seisdedos, F., Thompson, J., Rodriguez, M. S., Bachelerie, F., Thomas, D., and Hay, R. T. (1995) Inducible nuclear expression of newly synthesized I kappa B alpha negatively regulates DNA-binding and transcriptional activities of NF-kappa B. Molecular and Cellular Biology. 15, 2689–2696 328. Kumbrink, J., Gerlinger, M., and Johnson, J. P. (2005) Egr-1 induces the expression of its corepressor nab2 by activation of the nab2 promoter thereby establishing a negative feedback loop. J. Biol. Chem. 280, 42785–42793 329. Bhaumik, D., Scott, G. K., Schokrpur, S., Patil, C. K., Campisi, J., and Benz, C. C. (2008) Expression of microRNA-146 suppresses NF-kappaB activity with reduction of metastatic potential in breast cancer cells. Oncogene. 27, 5643–5647 330. Hou, J., Wang, P., Lin, L., Liu, X., Ma, F., An, H., Wang, Z., and Cao, X. (2009) MicroRNA-146a Feedback Inhibits RIG-I-Dependent Type I IFN Production in Macrophages by Targeting TRAF6, IRAK1, and IRAK2. The Journal of Immunology. 183, 2150–2158 331. Kubes, P., Suzuki, M., and Granger, D. N. (1991) Nitric oxide: an endogenous

171

modulator of leukocyte adhesion. Proc. Natl. Acad. Sci. U.S.A. 88, 4651–4655 332. Fish, J. E., Yan, M. S., Matouk, C. C., St Bernard, R., Ho, J. J., Gavryushova, A., Srivastava, D., and Marsden, P. A. (2010) Hypoxic repression of endothelial nitric-oxide synthase transcription is coupled with eviction of promoter histones. Journal of Biological Chemistry. 285, 810–826 333. Delgado-Olguin, P., Huang, Y., Li, X., Christodoulou, D., Seidman, C. E., Seidman, J. G., Tarakhovsky, A., and Bruneau, B. G. (2012) Epigenetic repression of cardiac progenitor gene expression by Ezh2 is required for postnatal cardiac homeostasis. Nat Genet. 44, 343–347 334. Anderson, H. D., Rahmutula, D., and Gardner, D. G. (2004) Tumor necrosis factor-alpha inhibits endothelial nitric-oxide synthase gene promoter activity in bovine aortic endothelial cells. J. Biol. Chem. 279, 963–969 335. Yoshizumi, M., Perrella, M. A., Burnett, J. C. J., and Lee, M. E. (1993) Tumor necrosis factor downregulates an endothelial nitric oxide synthase mRNA by shortening its half- life. Circ Res. 73, 205–209 336. Saleem, A., Yuan, Z. M., Taneja, N., Rubin, E., Kufe, D. W., and Kharbanda, S. M. (1995) Activation of serine/threonine protein kinases and early growth response 1 gene expression by tumor necrosis factor in human myeloid leukemia cells. J. Immunol. 154, 4150–4156 337. Perry, M. M., Williams, A. E., Tsitsiou, E., Larner-Svensson, H. M., and Lindsay, M. A. (2009) Divergent intracellular pathways regulate interleukin-1beta-induced miR-146a and miR-146b expression and chemokine release in human alveolar epithelial cells. FEBS Letters. 583, 3349–3355 338. Rhee, W. J., Ni, C. W., Zheng, Z., Chang, K., Jo, H., and Bao, G. (2010) HuR regulates the expression of stress-sensitive genes and mediates inflammatory response in human umbilical vein endothelial cells. Proceedings of the National Academy of Sciences. 107, 6858–6863 339. Fan, X. C., and Steitz, J. A. (1998) Overexpression of HuR, a nuclear-cytoplasmic shuttling protein, increases the in vivo stability of ARE-containing mRNAs. EMBO J. 17, 3448–3460 340. Pober, J. S., Bevilacqua, M. P., Mendrick, D. L., Lapierre, L. A., Fiers, W., and Gimbrone, M. A., Jr (1986) Two distinct monokines, interleukin 1 and tumor necrosis factor, each independently induce biosynthesis and transient expression of the same antigen on the surface of cultured human vascular endothelial cells. J. Immunol. 136, 1680–1687 341. Pober, J. S., Lapierre, L. A., Stolpen, A. H., Brock, T. A., Springer, T. A., Fiers, W., Bevilacqua, M. P., Mendrick, D. L., and Gimbrone, M. A. J. (1987) Activation of cultured human endothelial cells by recombinant lymphotoxin: comparison with tumor necrosis factor and interleukin 1 species. J. Immunol. 138, 3319–3324 342. Nahid, M. A., Satoh, M., and Chan, E. K. L. (2011) Mechanistic Role of MicroRNA- 146a in Endotoxin-Induced Differential Cross-Regulation of TLR Signaling. The Journal of Immunology. 186, 1723–1734 343. Dekker, den, W. K., Cheng, C., Pasterkamp, G., and Duckers, H. J. (2010) Toll like receptor 4 in atherosclerosis and plaque destabilization. Atherosclerosis. 209, 314–320 344. Knowles, J. W., Reddick, R. L., Jennette, J. C., Shesely, E. G., Smithies, O., and Maeda, N. (2000) Enhanced atherosclerosis and kidney dysfunction in eNOS(-/-)Apoe(-/-) mice are ameliorated by enalapril treatment. J. Clin. Invest. 105, 451–458

172

345. Oemar, B. S., Tschudi, M. R., Godoy, N., Brovkovich, V., Malinski, T., and Luscher, T. F. (1998) Reduced endothelial nitric oxide synthase expression and production in human atherosclerosis. Circulation. 97, 2494–2498 346. Fish, J. E., and Cybulsky, M. I. (2012) Taming endothelial activation with a microRNA. J. Clin. Invest. 122, 1967–1970 347. Suarez, Y., Wang, C., Manes, T. D., and Pober, J. S. (2009) Cutting Edge: TNF-Induced MicroRNAs Regulate TNF-Induced Expression of E-Selectin and Intercellular Adhesion Molecule-1 on Human Endothelial Cells: Feedback Control of Inflammation. The Journal of Immunology. 184, 21–25 348. Gruber, A. R., Fallmann, J., Kratochvill, F., Kovarik, P., and Hofacker, I. L. (2011) AREsite: a database for the comprehensive investigation of AU-rich elements. Nucleic Acids Research. 39, D66–9 349. Cheng, H. S., Sivachandran, N., Lau, A., Boudreau, E., Zhao, J. L., Baltimore, D., Delgado-Olguin, P., Cybulsky, M. I., and Fish, J. E. (2013) MicroRNA-146 represses endothelial activation by inhibiting pro-inflammatory pathways. EMBO Mol Med. 5, 1017–1034 350. Brand, K., Page, S., Rogler, G., Bartsch, A., Brandl, R., Knuechel, R., Page, M., Kaltschmidt, C., Baeuerle, P. A., and Neumeier, D. (1996) Activated transcription factor nuclear factor-kappa B is present in the atherosclerotic lesion. J. Clin. Invest. 97, 1715– 1722 351. Carr, T. P., Andresen, C. J., and Rudel, L. L. (1993) Enzymatic determination of triglyceride, free cholesterol, and total cholesterol in tissue lipid extracts. Clin Biochem. 26, 39–42 352. MacParland, S. A., Ma, X. Z., Chen, L., Khattar, R., Cherepanov, V., Selzner, M., Feld, J. J., Selzner, N., and McGilvray, I. D. (2016) Lipopolysaccharide and Tumor Necrosis Factor Alpha Inhibit Interferon Signaling in Hepatocytes by Increasing Ubiquitin-Like Protease 18 (USP18) Expression. J. Virol. 90, 5549–5560 353. MacParland, S. A., Tsoi, K. M., Ouyang, B., Ma, X. Z., Manuel, J., Fawaz, A., Ostrowski, M. A., Alman, B. A., Zilman, A., Chan, W. C., and McGilvray, I. D. (2017) Phenotype Determines Nanoparticle Uptake by Human Macrophages from Liver and Blood. ACS Nano. 11, 2428–2443 354. Karunakaran, D., Thrush, A. B., Nguyen, M.-A., Richards, L., Geoffrion, M., Singaravelu, R., Ramphos, E., Shangari, P., Ouimet, M., Pezacki, J. P., Moore, K. J., Perisic, L., Maegdefessel, L., Hedin, U., Harper, M.-E., and Rayner, K. J. (2015) Macrophage Mitochondrial Energy Status Regulates Cholesterol Efflux and Is Enhanced by Anti-miR33 in Atherosclerosis. Circulation Research. 117, 266–278 355. Thüsen, Von Der, J. H., Kuiper, J., Fekkes, M. L., De Vos, P., Van Berkel, T. J., and Biessen, E. A. (2001) Attenuation of atherogenesis by systemic and local adenovirus- mediated gene transfer of interleukin-10 in LDLr -/- Mice. The FASEB Journal. 15, 2730–2732 356. Hashizume, M., Yoshida, H., Koike, N., Suzuki, M., and Mihara, M. (2010) Overproduced interleukin 6 decreases blood lipid levels via upregulation of very-low- density lipoprotein receptor. Ann Rheum Dis. 69, 741–746 357. Lehtimaki, T., Ojala, P., Rontu, R., Goebeler, S., Karhunen, P. J., Jylha, M., Mattila, K., Metso, S., Jokela, H., Nikkila, M., Wuolijoki, E., Hervonen, A., and Hurme, M. (2005) Interleukin-6 modulates plasma cholesterol and C-reactive protein concentrations in nonagenarians. J Am Geriatr Soc. 53, 1552–1558

173

358. Musunuru, K., Strong, A., Frank-Kamenetsky, M., Lee, N. E., Ahfeldt, T., Sachs, K. V., Li, X., Li, H., Kuperwasser, N., Ruda, V. M., Pirruccello, J. P., Muchmore, B., Prokunina-Olsson, L., Hall, J. L., Schadt, E. E., Morales, C. R., Lund-Katz, S., Phillips, M. C., Wong, J., Cantley, W., Racie, T., Ejebe, K. G., Orho-Melander, M., Melander, O., Koteliansky, V., Fitzgerald, K., Krauss, R. M., Cowan, C. A., Kathiresan, S., and Rader, D. J. (2010) From noncoding variant to phenotype via SORT1 at the 1p13 cholesterol locus. Nature. 466, 714–719 359. Mortensen, M. B., Kjolby, M., Gunnersen, S., Larsen, J. V., Palmfeldt, J., Falk. E., Nykjaer, A., and Bentzon, J. F. (2014) Targeting sortilin in immune cells reduces proinflammatory cytokines and atherosclerosis. J. Clin. Invest. 124, 5317–5322 360. Aviram, M., Brook, J. G., Tatarsky, I., Levy, Y., and Carter, A. (1986) Increased low- density lipoprotein levels after splenectomy: a role for the spleen in cholesterol metabolism in myeloproliferative disorders. Am J Med Sci. 291, 25–28 361. Rezzoug, F., Huang, Y., Tanner, M. K., Wysoczynski, M., Schanie, C. L., Chilton, P. M., Ratajczak, M. Z., Fugier-Vivier, I. J., and Ildstad, S. T. (2008) TNF-alpha is critical to facilitate hemopoietic stem cell engraftment and function. J. Immunol. 180, 49–57 362. Baldridge, M. T., King, K. Y., and Goodell, M. A. (2011) Inflammatory signals regulate hematopoietic stem cells. Trends in Immunology. 32, 57–65 363. Ma, X., and Feng, Y. (2016) Hypercholesterolemia Tunes Hematopoietic Stem/Progenitor Cells for Inflammation and Atherosclerosis. IJMS. 17, 1162 364. Murphy, A. J., and Tall, A. R. (2016) Disordered haematopoiesis and athero-thrombosis. Eur. Heart J. 37, 1113–1121 365. Feng, Y., Schouteden, S., Geenens, R., Van Duppen, V., Herijgers, P., Holvoet, P., Van Veldhoven, P. P., and Verfaillie, C. M. (2012) Hematopoietic stem/progenitor cell proliferation and differentiation is differentially regulated by high-density and low- density lipoproteins in mice. PLoS ONE. 7, e47286 366. Tie, G., Messina, K. E., Yan, J., Messina, J. A., and Messina, L. M. (2013) Hypercholesterolemia Induces Oxidant Stress That Accelerates the Ageing of Hematopoietic Stem Cells. Journal of the American Heart Association. 3, e000241– e000241 367. Park, E. J., Lee, J. H., Yu, G. Y., He, G., Ali, S. R., Holzer, R. G., Osterreicher, C. H., Takahashi, H., and Karin, M. (2010) Dietary and genetic obesity promote liver inflammation and tumorigenesis by enhancing IL-6 and TNF expression. Cell. 140, 197– 208 368. Glund, S., and Krook, A. (2008) Role of interleukin-6 signalling in glucose and lipid metabolism. Acta Physiol (Oxf). 192, 37–48 369. Murthy, S., Mathur, S., Bishop, W. P., and Field, E. J. (1997) Inhibition of apolipoprotein B secretion by IL-6 is mediated by EGF or an EGF-like molecule in CaCo-2 cells. The Journal of Lipid Research. 38, 206–216 370. Westerterp, M., and Tall, A. R. (2015) SORTILIN: many headed hydra. Circulation Research. 116, 764–766 371. Strong, A., Ding, Q., Edmondson, A. C., Millar, J. S., Sachs, K. V., Li, X., Kumaravel, A., Wang, M. Y., Ai, D., Guo, L., Alexander, E. T., Nguyen, D., Lund-Katz, S., Phillips, M. C., Morales, C. R., Tall, A. R., Kathiresan, S., Fisher, E. A., Musunuru, K., and Rader, D. J. (2012) Hepatic sortilin regulates both apolipoprotein B secretion and LDL catabolism. J. Clin. Invest. 122, 2807–2816 372. Kjolby, M., Andersen, O. M., Breiderhoff, T., Fjorback, A. W., Pedersen, K. M.,

174

Madsen, P., Jansen, P., Heeren, J., Willnow, T. E., and Nykjaer, A. (2010) Sort1, encoded by the cardiovascular risk locus 1p13.3, is a regulator of hepatic lipoprotein export. Cell Metabolism. 12, 213–223 373. Patel, K. M., Strong, A., Tohyama, J., Jin, X., Morales, C. R., Billheimer, J., Millar, J., Kruth, H., and Rader, D. J. (2015) Macrophage sortilin promotes LDL uptake, foam cell formation, and atherosclerosis. Circulation Research. 116, 789–796 374. Myocardial Infarction Genetics Consortium, Kathiresan, S., Voight, B. F., Purcell, S., Musunuru, K., Ardissino, D., Mannucci, P. M., Anand, S., Engert, J. C., Samani, N. J., Schunkert, H., Erdmann, J., Reilly, M. P., Rader, D. J., Morgan, T., Spertus, J. A., Stoll, M., Girelli, D., McKeown, P. P., Patterson, C. C., Siscovick, D. S., O'Donnell, C. J., Elosua, R., Peltonen, L., Salomaa, V., Schwartz, S. M., Melander, O., Altshuler, D., Ardissino, D., Merlini, P. A., Berzuini, C., Bernardinelli, L., Peyvandi, F., Tubaro, M., Celli, P., Ferrario, M., Fetiveau, R., Marziliano, N., Casari, G., Galli, M., Ribichini, F., Rossi, M., Bernardi, F., Zonzin, P., Piazza, A., Mannucci, P. M., Schwartz, S. M., Siscovick, D. S., Yee, J., Friedlander, Y., Elosua, R., Marrugat, J., Lucas, G., Subirana, I., Sala, J., Ramos, R., Kathiresan, S., Meigs, J. B., Williams, G., Nathan, D. M., MacRae, C. A., O'Donnell, C. J., Salomaa, V., Havulinna, A. S., Peltonen, L., Melander, O., Berglund, G., Voight, B. F., Kathiresan, S., Hirschhorn, J. N., Asselta, R., Duga, S., Spreafico, M., Musunuru, K., Daly, M. J., Purcell, S., Voight, B. F., Purcell, S., Nemesh, J., Korn, J. M., McCarroll, S. A., Schwartz, S. M., Yee, J., Kathiresan, S., Lucas, G., Subirana, I., Elosua, R., Surti, A., Guiducci, C., Gianniny, L., Mirel, D., Parkin, M., Burtt, N., Gabriel, S. B., Samani, N. J., Thompson, J. R., Braund, P. S., Wright, B. J., Balmforth, A. J., Ball, S. G., Hall, A. S., Wellcome Trust Case Control Consortium, Schunkert, H., Erdmann, J., Linsel-Nitschke, P., Lieb, W., Ziegler, A., König, I., Hengstenberg, C., Fischer, M., Stark, K., Grosshennig, A., Preuss, M., Wichmann, H.- E., Schreiber, S., Schunkert, H., Samani, N. J., Erdmann, J., Ouwehand, W., Hengstenberg, C., Deloukas, P., Scholz, M., Cambien, F., Reilly, M. P., Li, M., Chen, Z., Wilensky, R., Matthai, W., Qasim, A., Hakonarson, H. H., Devaney, J., Burnett, M.- S., Pichard, A. D., Kent, K. M., Satler, L., Lindsay, J. M., Waksman, R., Knouff, C. W., Waterworth, D. M., Walker, M. C., Mooser, V., Epstein, S. E., Rader, D. J., Scheffold, T., Berger, K., Stoll, M., Huge, A., Girelli, D., Martinelli, N., Olivieri, O., Corrocher, R., Morgan, T., Spertus, J. A., McKeown, P., Patterson, C. C., Schunkert, H., Erdmann, E., Linsel-Nitschke, P., Lieb, W., Ziegler, A., König, I. R., Hengstenberg, C., Fischer, M., Stark, K., Grosshennig, A., Preuss, M., Wichmann, H.-E., Schreiber, S., Hólm, H., Thorleifsson, G., Thorsteinsdottir, U., Stefansson, K., Engert, J. C., Do, R., Xie, C., Anand, S., Kathiresan, S., Ardissino, D., Mannucci, P. M., Siscovick, D., O'Donnell, C. J., Samani, N. J., Melander, O., Elosua, R., Peltonen, L., Salomaa, V., Schwartz, S. M., and Altshuler, D. (2009) Genome-wide association of early-onset myocardial infarction with single nucleotide polymorphisms and copy number variants. Nat Genet. 41, 334– 341 375. Kang, Y. J., Yang, S. J., Park, G., Cho, B., Min, C. K., Kim, T. Y., Lee, J. S., and Oh, I. H. (2007) A novel function of interleukin-10 promoting self-renewal of hematopoietic stem cells. Stem Cells. 25, 1814–1822 376. Du, J., Niu, X., Wang, Y., Kong, L., Wang, R., Zhang, Y., Zhao, S., and Nan, Y. (2015) MiR-146a-5p suppresses activation and proliferation of hepatic stellate cells in nonalcoholic fibrosing steatohepatitis through directly targeting Wnt1 and Wnt5a. Sci Rep. 5, 16163

175

377. Bandiera, S., Pernot, S., Saghire, El, H., Durand, S. C., Thumann, C., Crouchet, E., Ye, T., Fofana, I., Oudot, M. A., Barths, J., Schuster, C., Pessaux, P., Heim, M. H., Baumert, T. F., and Zeisel, M. B. (2016) HCV-induced up-regulation of miR-146a-5p in hepatocytes promotes viral infection and deregulates metabolic pathways associated with liver disease pathogenesis. J. Virol. 90, 6387–6400 378. Labbaye, C., Spinello, I., Quaranta, M. T., Pelosi, E., Pasquini, L., Petrucci, E., Biffoni, M., Nuzzolo, E. R., Billi, M., Foà, R., Brunetti, E., Grignani, F., Testa, U., and Peschle, C. (2008) A three-step pathway comprising PLZF/miR-146a/CXCR4 controls megakaryopoiesis. Nature Cell Biology. 10, 788–801 379. Labbaye, C., Quaranta, M. T., Pagliuca, A., Militi, S., Licht, J. D., Testa, U., and Peschle, C. (2002) PLZF induces megakaryocytic development, activates Tpo receptor expression and interacts with GATA1 protein. Oncogene. 21, 6669–6679 380. Spinello, I., Quaranta, M. T., Paolillo, R., Pelosi, E., Cerio, A. M., Saulle, E., Coco, F. L., Testa, U., and Labbaye, C. (2015) Differential hypoxic regulation of the microRNA- 146a/CXCR4 pathway in normal and leukemic monocytic cells: impact on response to chemotherapy. Haematologica. 100, 1160–1171 381. Bala, S., Csak, T., Momen-Heravi, F., Lippai, D., Kodys, K., Catalano, D., Satishchandran, A., Ambros, V., and Szabo, G. (2015) Biodistribution and function of extracellular miRNA-155 in mice. Sci Rep. 5, 10721 382. Dahlman, J. E., Barnes, C., Khan, O. F., Thiriot, A., Jhunjunwala, S., Shaw, T. E., Xing, Y., Sager, H. B., Sahay, G., Speciner, L., Bader, A., Bogorad, R. L., Yin, H., Racie, T., Dong, Y., Jiang, S., Seedorf, D., Dave, A., Singh Sandhu, K., Webber, M. J., Novobrantseva, T., Ruda, V. M., Lytton-Jean, A. K. R., Levins, C. G., Kalish, B., Mudge, D. K., Perez, M., Abezgauz, L., Dutta, P., Smith, L., Charisse, K., Kieran, M. W., Fitzgerald, K., Nahrendorf, M., Danino, D., Tuder, R. M., Andrian, von, U. H., Akinc, A., Panigrahy, D., Schroeder, A., Koteliansky, V., Langer, R., and Anderson, D. G. (2014) In vivo endothelial siRNA delivery using polymeric nanoparticles with low molecular weight. Nat Nanotechnol. 9, 648–655 383. Udomsakdi, C., Lansdorp, P. M., Hogge, D. E., Reid, D. S., Eaves, A. C., and Eaves, C. J. (1992) Characterization of primitive hematopoietic cells in normal human peripheral blood. Blood. 80, 2513–2521 384. McKinney-Freeman, S., and Goodell, M. A. (2004) Circulating hematopoietic stem cells do not efficiently home to bone marrow during homeostasis. Exp. Hematol. 32, 868–876 385. Starczynowski, D. T., Kuchenbauer, F., Wegrzyn, J., Rouhi, A., Petriv, O., Hansen, C. L., Humphries, R. K., and Karsan, A. (2011) MicroRNA-146a disrupts hematopoietic differentiation and survival. Exp. Hematol. 39, 167–178 e4 386. Cheng, H. S., Besla, R., Li, A., Chen, Z., Shikatani, E. A., Nazari-Jahantigh, M., Hammoutène, A., Nguyen, M. A., Geoffrion, M., Cai, L., Khyzha, N., Li, T., MacParland, S. A., Husain, M., Cybulsky, M. I., Boulanger, C. M., Temel, R. E., Schober, A., Rayner, K. J., Robbins, C. S., and Fish, J. E. (2017) Paradoxical Suppression of Atherosclerosis in the Absence of microRNA-146a. Circulation Research. 121, 354–367