INFORMATION TO USERS
This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer.
The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction.
In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.
Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps. Each original is also photographed in one exposure and is included in reduced form at the back of the book.
Photographs included in the original manuscript have been reproduced xerographicaliy in this copy. Higher quality 6” x 9” black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order. UMI' Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, Ml 48106-1346 USA 800-521-0600
PARTIAL CHAEIACTERIZATION OF A CUCUMBER MOSAIC VIRUS ISOLATE, AND ITS ASSOCIATED SATELLITE RNA, FROM AJUGA REPTANS
DISSERTATION
Presented in Partial Fulfillment of the Requirements for
the Degree Doctor of Philosophy in the Graduate
School of the Ohio State University
By
John R. Fisher, B.S., M.S.
'k'k'k 'k 'k
The Ohio State University 1999
Dissertation Committee: Approved by
Dr. Stephen T. Nameth, Adviser
Dr. Donald T. Gordon
Dr. Terrence L. Graham Adviser
Dr. Keith R. Davis Plant Pathology Graduate Program UMI Number: 9941324
UMI Microform 9941324 Copyright 1999, by UMI Company. All rights reserved.
This microform edition is protected against unauthorized copying under Title 17, United States Code.
UMI 300 North Zeeb Road Ann Arbor, MI 48103 ABSTRACT
Ajuga reptans L. is a perennial mint commonly grown in borders and as a groundcover. 356 A. reptans sample were
surveyed for cucumber mosaic cucumovirus (CMV) , alfalfa mosaic virus (AMV) , tobacco streak ilarvirus (TSV) ^ tomato
aspermy cucumovirus (TAV) , tomato spotted wilt tospovirus
(TSWV), impatiens necrotic spot tospovirus (INSV) , tobacco mosaic tabamovirus (TMV), potato virus X potexvirus (PVX), and a potyvirus screen for 80 potyviruses by enzyme-linked immunosorbent assay (ELISA) . No incidences of TAV, TSWV,
INSV, TMV, PVX, or potyviruses were detected. 11% were positive for CMV, 22.2% for AMV, 3.7% for TSV, and 1.1% for a mixed infection by CMV and AMV. Sixteen 'Royalty' seedlings grown from seed from CMV-infected A. reptans
'Royalty' were all ELISA positive for CMV, and 2 of 16 were also positive for AMV, suggesting seed transmission of CMV and AMV in this host.
Viral associated double-stranded RNA analysis (dsRNA) of A. reptans 'Royalty' and 'Rainbow' produced a CMV-like dsRNA profile, including a putative satellite RNA (satRNA).
ii The identity of the putative satRNA was confirmed by
northern hybridization to a digoxigenin (DIG) labeled
(S}CARNA- 5 cDNA probe.
CMV was transmitted from A. reptans 'Royalty^ to
tobacco by the melon aphid {Aphis gossypii) . Purified CMV-
Royalty produced a single light-scattering band in 10-40%
sucrose density gradients. Transmission electron microscopy
(TEM) revealed spherical particles similar in size to
subgroup I strain CMV-Fny. SDS-PAGE produced a major protein band that coelectrophoresed with the major band produced by CMV-Fny. Western blot analysis of CMV-Royalty
showed the major protein band reacted to CMV subgroup I antibodies but not subgroup II antibodies.
Host range studies showed that CMV-Royalty infected squash Black Beauty', cucumber, pumpkin, and tomato
'Rutgers' systemically but not bean, cowpea, or tomato 'Peto
596' or 'Nema 1401'.
The CMV-Royalty satRNA was cloned and a 338 nucleotide sequence obtained. The lack of 5' homology to the necrogenic D-satRNA, the absence of a 3' 3-base deletion found in necrogenic satRNAs, the lack of necrosis on tomato
'Rutgers', and the mild symptoms on N. tabacum 'Glurk' and
'Samsun', support the observation that the CMV-Royalty satRNA is a non-necrosis inducing, ameliorative satRNA.
XXI ACKNOWLEDGMENTS
I wish to thank my advisor,. Steve Nameth, for allowing me the latitude to develop and personalize this project. I learned more from my mistakes than I would have if he had held my hand throughout the process.
I am indebted to Doris Majerczak for teaching me the various molecular techniques used in this project, and tolerating all my questions. And thanks to Dr. David Coplin for allowing me to work with Doris in his lab.
I thank Dr. Donald Gordon for his stimulating seminar topics, and input into this project. And for spending so much time helping edit my thesis.
I also wish to thank Maria-Claudia Sanchez-Cuevas for our dialogues regarding our respective projects.
Lastly, I would like to thank my committee and the department of Plant Pathology for giving me this opportunity. I feel I have grown significantly as a scholar over the last several years and I owe that growth to the people I worked with in the department.
XV VITA
July 9/- 1966 ...... Born-Mansfield, Ohio
1989 ...... B.S. Horticulture, The Ohio State University
1995 ...... M.S. Plant Pathology, The Ohio State University
1995-1996 ...... Graduate Teaching Associate, Department of Introductory Biology, The Ohio State University, Columbus, Ohio
1996-199 8 ...... Graduate Research Associate, Department of Plant Pathology, The Ohio State University, Columbus, Ohio.
1999 ...... Graduate Teaching Associate, Department of Introductory Biology, The Ohio State University, Columbus, Ohio
PUBLICATIONS
Research Publication
Fisher, J.R. and S.T. Nameth. 1994. Cucumber mosaic virus (CARNA-5) associated with ringspot and mosaic disease of Ajuga reptans (abstr.). Phytopatholocrv 84: 1155.
Fisher, J.R. and S.T. Nameth. 1997. Cucumber Mosaic Virus, Tobacco Streak Virus, and Cucumber Mosaic Virus Satellite RNA Associated With Mosaic and Ringspot Symptoms in Ajuga reptans in Ohio. Plant Dis. 81, No. 10: 1214.
Fisher, J.R., Sanchez-Cuevas, M. C ., Nameth, S. T., Woods, V. L., and Ellett, C. W. 1997. First report of cucumber mosaic virus in Eryngium amethystlnum, Canna x generalis, and Aquilegla hybrids in Ohio. Plant Dis. 81: 1331.
V FIELDS OF STUDY
Major Field: Plant Pathology
Studies in diagnostic and molecular plant virology.
VI TABLE OF CONTENTS
Page Abstract ...... ii
Acknowledgments ...... iv
Vita ...... V
List of Figures ...... ix
List of Tables ...... xvi
Chapters :
1. Literature Review...... 1
2. Virus Survey of Ajuga reptans Cultivars ...... 18
2.1 Introduction...... 18 2.2 Materials and methods ...... 20 2.3 Results ...... 47 2.4 Discussion ...... 55
3. Partial Characterization of a Cucumber Mosaic Virus(CMV)Isolate From Ajuga reptans 'Royalty'... 62
3.1 Materials and methods ...... 62 3.2 Results ...... 82 3.3 Discussion ...... 131
4. Satisfying Koch's Postulates for CMV-Royalty and Ajuga reptans and Evidence for Cultivar-Specific Accumulation of Double-Stranded Satellite RNA ... 149
4.1 Materials and methods ...... 150 4.2 Results ...... 151 4.3 Discussion ...... 153
List of References ...... 156
vxi Appendices ...... 163
Appendix A: ELISA Buffers...... 163
Appendix B: potyviruses detected by Agdia Inc. test kit...... 165
Appendix C: SDS-PAGE and western transfer solutions...... 166
vxix LIST OF FIGURES
Figure Page
1. RT-PCR primers designed using ten previously published CMV satRNA sequences. Nucleotides appearing in bold type indicate differences at that position, and a star indicates a deletion. Primers 1 and 3 hybridize to the 3' end of minus-sense satRNA and primers 2 and 4 to the 3' end of positive-sense satRNA...... 40
2. RT-PCR primers designed using sequences obtained from The National Center for Biotechnology Information website. Primer 5 hybridizes to the 3' end of minus sense satRNA, primer 7 to the 5' end of positive sense satRNA. Primer 6 hybridizes to the 3' end of positive sense satRNA and primer 8 to the 5' end of minus sense satRNA. Bold type indicates a difference at that position and a * indicates a deletion...... 41
3. Virus symptoms observed on A. reptans cultivars. A. 'Bronze Beauty' showing ringspots, mosaic and oakleaf patterns; B. 'Burgundy Glow' showing mosaic and yellow streaks/oakleaf pattern; C. 'Royalty' showing a concentric ringspot; D. 'Rainbow' showing mosaic and ringspots...... 48
4. 5% polyacrylamide gel electrophoresis analysis of dsRNA obtained from the CMV-WL isolate in N. benthemiana (lane 1), A. reptans 'Royalty' plant (lane 2), and the TMV common strain in N. tabacum 'Turk' (lane 3). Approximate dsRNA molecular weight markers indicated next to lane 1 (1.5, 2.0 X 10®). Arrow indicates apparent ds satRNA...... 51
IX 5. Northern, blot analysis of heat-denatured dsRNA purified from A. reptans 'Royalty' plants using DIG-labeled (S)CARNA-5 cDNA probe. Lane 1: TMV RNA (negative control). Lane 2: unlabeled (S)CARNA-5 cDNA (positive control). Lanes 3-8: A. reptans 'Royalty' samples. Arrow indicates satRNA band...... 52
6. Reverse transcription polymerase chain reaction (RT-PCR) analysis of A. reptans 'Royalty' seedling samples using primers specific for cucumber mosaic virus (CMV) satellite RNAs. Lanes 1-2: A. reptans 'Royalty' seedling samples. Lane 3: CMV isolate from A. reptans 'Royalty' in N. tabacum 'Glurk' (positive control), Lane 4: double-distilled water (negative control). Lane 5: (S)CARNA-5 cDNA marker (faint band between 0.3 and 0.4 Kb marker) digested from pSP65 plasmid (3.0 Kb band) with EcoRI, and Lane 6: 1 Kb Plus DNA markers. Arrow indicates PCR product between 0.3 and 0.4 Kb marker...... 54
7. Symptoms on N. rustica approximately five weeks after aphid-inoculation with CMV from A. reptans 'Royalty' using the melon aphid. A: mild vein- clearing symptom on younger leaves followed by B: leaf puckering and mosaic symptom...... 83
8. Mild mosaic and mild veinal chlorosis appearing on youngest M. tabacum 'Glurk' leaves approximately five weeks following aphid-inoculation with CMV from A- reptans 'Royalty'...... 84
9. Mild mosaic (left) and mild vein clearing (right) symptoms on N. tabacum 'Glurk' aphid-inoculated with CMV from A. reptans 'Royalty'...... 85
10. N. tabacum 'Samsun' mechanically inoculated with CMV-Royalty, showing mosaic and veinal chlorosis symptoms...... 87
11. Buffer mock-inoculation (left) and chlorotic spots (right) on 'Black Beauty' squash 10 days after inoculation with the CMV-Royalty isolate 8 8
X 12. Chlorotic spots on 'Black Beauty' squash 10 days after inoculation with the CMV-Royalty isolate 89
13. Symptoms on 'Black Beauty' squash 14 days after inoculation with the CMV-Royalty isolate...... 90
14. Mosaic and vein clearing symptoms on 'Black Beauty' squash 28 days after inoculation with the CMV- Royalty isolate. Leaf in upper left corner is a control plant...... 91
15. Mosaic and vein clearing symptoms on 'Black Beauty' squash 28 days after inoculation with the CMV- Royalty isolate...... 92
16. Cucumber 10 days after buffer mock-inoculâtion (left) and inoculation with the CMV-Royalty isolate (right)...... 93
17. Buffer mock-inoculâtion (left) and mild symptoms on cucumber 14 days after inoculation with the CMV-Royalty isolate (right)...... 94
18. Symptoms on cucumber 28 days after inoculation with the CMV-Royalty isolate...... 95
19. Asymptomatic tomato 'Rutgers' 30 days after inoculation with the CMV-Royalty isolate (right), positive for CMV as confirmed by ELISA. Buffer mock-inoculated control is on the left...... 99
20. Tomato 'Rutgers' leaflets showing mild distortion approximately 50 days after inoculation with the CMV-Royalty isolate. Presence of CMV confirmed by ELISA...... 100
21. Nicotiana clevelandii showing very mild mosaic symptom 14 days after inoculation with the CMV- Royalty isolate...... 101
22. 10% polyacrylamide gel electrophoresis of dsRNA extracted from host range samples. Lane 1: asymptomatic tomato 'Peto 696’; lane 2 r symptomatic cucumber; lane 3: symptomatic squash 'Black Beauty'; and lane 4 : CMV-Royalty isolate in N. tabacum 'Glurk'. Arrow indicates double stranded satRNA band...... 103
XI 23. Tomato 'Rutgers' inoculated with the CMV-Royalty isolate, from which dsRNA was extracted- A: sample T-215-4 (asymptomatic), B: sample T-215-6 (asymptomatic), C: sample T-215-8 (mild mosaic and leaf distortion),and D: sample T-215-BR (buffer mock-inoculation)...... 104
24. dsRNA analysis of L. esculentum 'Rutgers' inoculated with CMV-Royalty isolate. Lane 1: CMV-Royalty dsRNA extracted from N. tabacum 'Glurk' used as a marker. Lane 2: 'Rutgers' sample T215-4 from asymptomatic plant. Lane 3: 'Rutgers' sample T215-6 from asymptomatic plant. Lane 4: 'Rutgers' sample T215-8 from plant showing mild mosaic and mild leaf distortion, and Lane 5: 'Rutgers' buffer mock-inoculated negative control. Arrow indicates ds satRNA band...... 105
25. Purified CMV-Royalty isolate in 10-40% sucrose density gradient ultracentrifuged at 130,000 X g (26,000 rpm in SW28.1 rotor) for 90 minutes. Arrow indicates light-scattering band...... 107
26. Transmission electron micrograph (187,500 X magnification) of purified CMV-Royalty (spherical particles). Rod-shaped particles are purified TMV (common strain) included as a size reference (ca. 18 nm wide). Particles were negatively stained with 2% (w/v) uranyl.acetate...... 109
27. Transmission electron micrograph (250,000 X magnification) of purified CMV-Royalty (spherical particles). Rod-shaped particles are purified TMV (common strain) included as a size reference (ca. 18 nm wide). Particles were negatively stained with 2% (w/v) uranyl acetate...... 110
28. Transmission electron micrograph (250,000 X magnification) of a mixture of purified CMV- Royalty and CMV-Fny. Particles were negatively stained with 2% (w/v) uranyl acetate...... Ill
XIX 29. 10% SDS-PAGE gel stained with Coomassie brilliant blue. Lanes 1 and 5: purified TMV common strain; lanes 2 and 4: purified CMV-Royalty; lane 3: Benchmark Protein Ladder. Apparent molecular weight of pink band is 69 kDa. 29 kOa and 23 kDa markers are indicated by arrows. Bold arrow in lane 2 indicates coat protein of CMV-Royalty...... 112
30. 10% SDS-PAGE gel stained with Coomassie brilliant blue. Lanes 1 and 5: purified CMV-Royalty; lanes 2 and 4: purified CMV-Fny; lane 3: Benchmark Protein Ladder. Apparent molecular weight of pink band is 69 kDa. 23 kDa and 29 kDa markers are indicated by arrows. Bold arrow next to lane 1 indicates coat protein...... 114
31. Western blot of SDS-PAGE gel shown in Fig. 30. Lanes 1 and 5: purified CMV-Royalty; lanes 2 and 4 : purified CMV-Fny; lane 3 : Benchmark Protein Ladder (apparent molecular weight of pink band is 69 kDa) . The left half of the membrane (lanes 1,2 and half of 3) was treated with CMV subgroup I antibodies, and the right half (half of lane 3, lanes 4 and 5) treated with CMV subgroup II antibodies. Bold arrow to the left of lane 1 indicates the coat protein...... 115
32. Putative PCR-based clones of the CMV-Royalty satRNA. Lane 1: 1Kb Plus DNA marker; lane 2: (S)CARNA-5 digested from pSP65 plasmid with EcoRI; lanes 3-7: plasmid mini-preps digested with HindiII and Xbal. Putative insert appears between 0.3 and 0.4 Kb markers...... 117
33. Southern blot analysis of putative PCR-based clones of the CMV-Royalty satRNA using DIG- labeled (S)CARNA-5 cDNA probe. Lane 1: Lambda DNA markers; lane 2: (S)CARNA-5 digested from pSP65 plasmid with EcoRI; lanes 3-8 contain pBluescript plasmid mini-preps digested with HindiII and Xbal. Lane 3: clone p39; lane 4: clone p27; lane 5: clone p45; lane 6: clone p3-l; lane 7: clone p3-2; lane 8: clone p3-3. Arrow indicates putative inserts. These are not all the same clones shown in Figure 32...... 118
XXXI 34. Small scale plasmid mini-preparations of transformant colonies from the second cloning experiment. pBluescript was digested with HindiII and Xbal to reveal putative inserts of interest. Lane 1: 1Kb Plus DNA markers. Lane 2: (S)CARNA-5 marker digested from pSP65 plasmid with EcoRI, Lane 3: sample 5261-24, Lane 4: 5261-26, Lane 5: 5261-27, Lane 6: 5261-29, Lane 7: 5261-31, Lane 8: 5261-32, Lane 9: 5261-33, Lane 10: 5261-34, Lane 11: 5261-35, Lane 12: 5261-36. Samples 5261-24, 26, 27, 29, 33, 34, 35 and 36 were among those sequenced...... 120
35. CLUSTAL W(1.4) multiple sequence alignment of clones of the CMV-Royalty satRNA. Clones p37 and p45 are from the PCR-based cloning experiment. Clones designated p5261 or p5262 followed by a number are from the cDNA-based cloning experiment. Sequence differences are indicated in bold. A - at a given position indicates a missing base. A * beneath a given position indicates a conserved base at that position with respect to other clones. The additional bases at the 3 ’ end of clone p39 are the 3' primer sequence. Nucleotide positions 127, 148 and 149 are indicated in bold as published (Sleat and Palukaitis, 1992)...... 121
36. CLUSTAL W(1.4) multiple sequence alignment of CMV-Royalty satRNA (roysat) sequence with ten published CMV satRNA sequences. A - at a given position indicates a deletion with respect to other satRNAs and a * at a given position indicates a conserved base with respect to other satRNAs. Nucleotide positions 127, 148, 149 and 153 are indicated in bold relative to the sequence published for this region of the molecule (Sleat and Palukaitis, 1992)...... 123
XIV 37. CLUSTAL W (1.74) multiple sequence alignment of CMV-Royalty satRNA (roysat) cloned sequence with CMV satRNA sequences obtained from a BLASTN search of the DNA database. The sequences obtained from the database are indicated by accession number. A * beneath a particular position indicates a conserved base at that position. A - at a particular position indicates a deletion with respect to other sequences. Nucleotides 127, 148 and 149 are indicated by bold numbers, relative to their published positions (Sleat and Palukaitis, 1992). Nucleotides unique to Royalty satRNA, relative to the other sequences, are indicated in bold...... 127
38. Phylogenetic tree generated from CLUSTALW alignment of CMV-Royalty satRNA sequence (roysat) with 21 CMV satRNA sequences. 1000 bootstap trials were performed and the tree created using Treeview 32 for Windows. Bootstrap values for the branches are in bold. 0Y2 satRNA was used as the outgroup and the tree was rooted with the outgroup...... 130
39. CLUSTAL W (1.74) sequence alignment of CMV-Royalty satRNA (roysat) and the necrogenic CMV-D satRNA (dsat). A * beneath a given position indicates a conserved base. A - at a given position indicates a base deletion with respect to the other satRNA. Nucleotide positions 127, 148, 149 and the deletion (T missing between C and T) at 153 are indicated in bold, as published (Sleat and Palukaitis, 1992)...... 140
40. 10% polyacrylamide gel electrophoresis of dsRNA extracted from A. reptans seedling inoculated with CMV-Royalty, ELISA positive for CMV subgroup I. Lane 1: 150 ng CMV-Royalty dsRNA purified from N. tabacum 'Glurk'; lane 2: dsRNA purified from A. reptans seedling inoculated with CMV-Royalty; lane 3: dsRNA purified from N. rustica aphid- inoculated with CMV from A. reptans 'Royalty' . Arrows indicate ds satRNA band...... 152
XV LIST OF TABLES
Table Page
1. Summary of symptomatic and asymptomatic A. reptans cultivars tested for CMV, AMV and TSV by ELISA...... 4 9
2. Summary of host range results and ELISA results of host range plants tested for cucumber mosaic (CMV), alfalfa mosaic (AMV) , and tobacco streak (TSV) viruses...... 97
3. Comparison of percent identity between the CMV- Royalty satRNA (roysat) nucleotide sequence and ten previously published satRNA sequences determined by pairwise alignments using DNA Strider l.SfS (single block method). Differences between the number of nucleotides in column two and the total number of nucleotide positions in column three are due to deletions in one of the satRNA sequences with respect to the other, causing a shift in the total number of positions to make the alignment...... 125
4. Comparison of percent identity between the CMV- Royalty satRNA (roysat) nucleotide sequence and the eleven satRNA sequences obtained from a BLASTN database search with the highest homology to Royalty satRNA. Percent identity determined by pairwise alignments using DNA Strider 1.3f3 (single block method). Differences between the number of nucleotides in column two and the total number of nucleotide positions in column three are due to deletions in one of the satRNA sequences with respect to the other, causing a shift in the total number of positions to make the alignment. The satRNA sequences obtained from the DNA database are indicated by accession number...... 129
xvx CHAPTER 1
LITERATURE REVIEW
Ajuga reptans L. is a perennial ornamental mint
(Lamlaceae) commonly grown for its foliage in borders and as
a groundcover. A. reptans cultivars include 'Bronze
Beauty^, 'Burgundy Glow', 'Royalty', 'Rainbow', 'Silver
Beauty', and 'Gatlin's Giant', and are commonly propagated
vegetatively and by seed. Among viruses reported infecting
A. reptans cultivars are cucumber mosaic virus (CMV),
alfalfa mosaic virus (AMV) , tobacco streak virus (TSV) and broad bean wilt virus (BBWV) in Australia (Shukla and Gough,
1983), CMV in Denmark (Kristensen, 1956), and AMV in the
United States (Schroeder and Prowidenti, 1972) . Recently
CMV, AMV and TSV were reported in A. reptans cultivars in
Ohio, and a satRNA was also found to be associated with CMV-
infected A. reptans 'Royalty' plants (Fisher and Nameth,
1997) .
Cucumber mosaic virus
Cucumber mosaic virus (CMV) is the type species of the genus Cucumovirus of the family Bromoviridae of plant
1 viruses, which also includes tomato aspermy (TAV) and peanut stunt viruses (PSV) (Francki at al., 1979). CMV is distributed world-wide and has a very wide host range, infecting hosts in at least 40 plant families (Francki at al.f 1979). The virus is transmitted mechanically, through seed, by dodder {Cuscuta sp.), and by at least 60 aphid species in the non-persistent manner (Francki at ai.,
1979) . Virus can be acquired by all aphid instars within 5-
10 seconds, but their ability to transmit declines after about 2 minutes and is usually lost within 2 hours (Francki at al.f 1979) . Seed transmission occurs in at least 19 species and the virus is transmitted by at least 10 dodder species (Francki at ai., 1979).
CMV particles are spherical, ca. 29 nm in diameter, and encapsidate four functional segments of single-stranded (ss)
RNA. RNAs 1 and 2 are encapsidated separately and RNAs 3 and 4 are encapsidated within the same particle. Both types of virus particles have similar buoyant densities and sediment together as a single component with a sedimentation rate of approximately 99S (Francki, 1985; Francki et ai.,
1979). Only RNAs 1, 2, and 3 are required for infectivity, and neither the coat protein nor sub genomic RNA 4, which contains a copy of the coat protein gene that is also present in RNA 3, are required for infectivity (Francki et al., 1979; Lot et al., 1974) . The genomic segments have molecular weights of 1.27 X 10° (RNA 1), 1.13 X 10® (RNA 2), and 0.82 X 10® (RNA 3), and the subgenomic RNA containing the coat protein gene 0.35 X 10® (RNA 4) (Francki et al.,
197 9). Additional RNA components have been detected in some cucumovirus isolates with molecular weights ca. 0.26 X 10®
(RNA 4a) , 0.11 X 10® (RNA 5), 0.1-0.05 X 10® (RNA 6), and
0.5 X 10® (RNA X ) . RNA 5 has been shown to be of two types: a mixture of cleavage products of RNA 1-3, and satellite RNA
(satRNA)(Francki, 1985).
A number of symptom and host range variants of CMV have been identified and characterized. CMV-Y infects cowpea
{Vigna unguiculata) systemically, whereas most other isolates induce brown local lesions on inoculated cotyledons
(Francki et al., 1979). CMV-L2 infects Lactuca sallgna L.
(Plant Introduction 261653), a lettuce breeding line resistant to most CMV isolates, but does not infect beans
(Phaseolus spp.) or most other legumes (Prowidenti et al.,
1980). CMV-B is able to infect P. vulgaris cultivars systemically but CMV-C is not. CMV-C, however, is capable of systemically infecting nine other Phaseolus species
(Prowidenti, 1976) .
Symptoms incited on tobacco (Nicotiana spp.) by CMV strains range from symptomless infections to very mild mosaic, to severe chlorosis, or to mosaic, rugosity and
green islands. CMV-WL, U, SB, 2A, and LS induce a very mild
mosaic on tobacco, while CMV-Fny, Pf, and Uh induce mosaic,
rugosity, and dark-green islands. CMV-M causes a severe
chlorosis, and CMV-Q infects tobacco asymptomatically (Sleat
and Palukaitis, 1990a). Symptoms observed on other
diagnostic hosts include mosaic with narrowing of the leaf
laminae (fern-leaf) on tomato (Lycopersicon
esculentum) (Francki et al., 1979; Gonsalves at ai., 1982),
and systemic mosaic and stunting on cucumber {Cucumls
satiirus) (Francki et al., 1979).
Strains of CMV have been classified into two subgroups
based on the ability of the total nucleic acid of any given
strain to hybridize to cDNAs of either CMV-Fny, a subgroup I
strain, or CMV-WL, a subgroup II strain. Strains assigned
to subgroup I by this method include CMV-D, Ml, M2, G3, Pf,
Sny, T, WT, and B, and strains assigned to subgroup II
include CMV-Q, S, L2, and WL (Owen and Palukaitis, 198 8) .
This classification is supported by the observation of two distinct CMV serological subgroups, and by competitive rehybridizaton of double-stranded (ds) CMV RNAs (Sleat and
Palukaitis, 1990). Limited digestion of the coat proteins of several CMV strains with V8 protease, chymotrypsin, and papain produced two distinct banding patterns, further supporting the observation of two distinct subgroups. Coat protein banding patterns of CMV-B, F, Cl and C2 are indistinguishable from each other, but different from L2,
L3, and WL which are indistinguishable from each other
(Edwards and Gonsalves, 1983).
CMV Satellite RNAs
Plant virus satellites have been defined as viruses or nucleic acids that are unable to replicate in cells without the assistance of a 'helper'^ virus. In addition, viral satellites have little nucleotide sequence homology with the helper virus, and are not required by the helper virus for its replication. Satellite viruses differ from satellite
RNAs in that they encode and are encaps idated within their own coat protein. Satellite RNAs do not code for a coat protein and, hence, are dependent upon the helper virus coat protein for encapsidation (Collmer and Howell, 1992) . This definition distinguishes satellite RNAs from RNAs that 1) form part of a divided genome, as in the small RNA genomes of the tobraviruses, comoviruses, nepoviruses, bromoviruses, cucumoviruses, ilarviruses, and AMV which cannot replicate without the larger genomic RNAs but which carry the cistron for the coat protein; 2) subgenomic RNA fragments generated during normal virus replication, as in the bromoviruses, cucumoviruses, ilarviruses, and AMV of the family Bromoviridae; and 3) 'defective'’ virus nucleic acids such as the RNA of the TMV mutants PMl and PM2,- which can replicate independently, but encode a defective coat protein and can only be encapsidated within normal TMV coat protein (Murant and Mayo, 1982).
SatRNAs often influence the symptoms induced by the helper virus. This influence can range from symptom amelioration to symptom exacerbation, and even induction of new symptoms not associated with the helper virus. Examples of the latter include brilliant yellowing of tobacco, lethal necrosis of tomato, and severe chlorosis of tomato caused by
CMV satRNAs (Collmer and Howell, 1992) .
Symptoms induced by a particular CMV satRNA are not only influenced by the satRNA itself, but also the helper virus strain and host plant. Different CMV satRNAs can produce symptoms on tomato ranging from lethal necrosis
(Kaper and Waterworth, 1977), to white chlorosis (Gonsalves et al., 1982), to disease attenuation (Mossop and Francki,
1979). White chlorosis, or tomato white leaf, is a syndrome caused by a particular satRNA (WL-satRNA) in association with the CMV-WL helper strain. However, WL-satRNA in association with CMV-C also produces the tomato white leaf syndrome. In the absence of the WL-satRNA both helper strains induce the typical fern leaf symptom on tomato. On tobacco, the CMV-WL strain alone induces a severe chlorosis, but the addition of the WL-satRNA results in a symptomless infection (Gonsalves at al., 1982). Likewise, CMV satRNAs induce variable symptoms when associated with different strains of TAV. For example, G-satRNA associated with TAV-1 helper strain induces mild stunting, fernleaf, and mild mosaic on tomato, but the same satRNA induces severe mosaic with TAV-V. On tobacco, G-satRNA with TAV-1 causes mosaic and oak-leaf patterns but G-satRNA with TAV-V causes mild mottle and ringspot (Moriones at ai., 1992).
Cucumovirus satellite RNAs range in size from 333-393 nucleotides. Most CMV satRNAs are 333-342 nucleotides long, with the exception of some Japanese satRNAs which are 369-
38 6 nucleotides (Collmer and Howell, 1992). The additional
30-40 nucleotides found in the Japanese satRNAs are not inserted as a single block, but rather are interspersed between nucleotide positions 110 and 160 (Hidaka at ai.,
1988; Roossinck at ai., 1992). The satRNAs of PSV are 391-
393 nucleotides long (Collmer and Howell, 1992). Like the helper virus, CMV satRNAs are capped at their 5’ terminus by a M^ Gppp structure, and have a hydroxyl group at the 3' end. They are highly conserved at the 5' and 3' ends and appear to have the same ten residues at their 5' termini, and six at their 3' termini (Francki, 1985). CMV satRNAs have one or more open reading frames, and
the S-satRNA and F-satRNA have been translated in vitro to
produce small protein products (Avila-Rincon et al., 1986;
Hidaka at al., 1990). S-satRNA purified from, virions and a
full length S-satRNA cDNA have been shown to direct in vitro
synthesis of two small proteins of molecular weight 2700 and
3900 Da. The proteins produced by the cDNA transcripts comigrated with the proteins produced by S-satRNA purified
from virions. Additionally, positive-sense strands purified from the ds S-satRNA directed the synthesis of two proteins electrophoretically indistinguishable from those produced by
S-satRNA purified from virions (Avila-Rincon at al., 198 6) .
F-satRNA contains a single ORF near its 5' terminus and has been shown to direct the in vitro synthesis of a single major peptide of molecular weight 2800 Da (Hidaka at al.,
1990) . This peptide comigrates with one of the two major Y- satRNA translation products (Hidaka at al., 1988) . Y-satRNA directs the in vitro synthesis of peptides of molecular weights 3600, 2800, and 2000 Da, and E-satRNA the synthesis of peptides of molecular weights 3700, 3300, and 2700 Da
(Hidaka at al., 1988). E-sat, Y-sat, and 0Y2— satRNAs have also been shown to bind 80S ribosomes in vitro (Hidaka at al., 1990; Hidaka at al., 1988). The ORFs of CMV satRNAs are not conserved among
different isolates and there is no strong evidence for In
vivo activity of these ORF products (Roossinck et al.,
1992). Elimination of the initiation codon by site-directed
mutagenesis of a D-satRNA infectious clone inducing lethal
necrosis of tomato did not alter the disease phenotype of
that satRNA (Collmer and Kaper, 1988). Likewise, a
frameshift mutation of the ORF spanning the necrogenic
domain of Y-satRNA did not alter its ability to induce
lethal necrosis on tomato (Devic et al., 1990) .
Except for two sharply defined domains of variability,
the nucleotide sequences of necrogenic satRNAs are
essentially conserved, whereas the non-necrogenic satRNAs have at least nine additional hypervariable regions (Kaper
et al., 1988). Except for several seemingly incidental substitutions, necrogenic satRNA variants are identical at positions 1-223. The equivalent region in non-necrogenic variants contains at least five highly variable sequence domains. Similarly, the 3' one-third of the molecule contains two domains of variability, for both necrogenic and non-necrogenic variants, at positions 224-226 and 324-327.
There are also four additional highly variable domains in this region in non-necrogenic satRNA variants (Kaper et al.,
1988). There appears to be a distinct sequence domain specifying necrosis on tomato^ which is outside a domain
specifying induction of chlorosis on tomato (Palukaitis,
1988). The necrosis domain of D-satRNA has been localized
within the 3' 150 n .cleotides of the molecule, and the
chlorosis domain of B-satRNA within the 5' 185 nucleotides
(Kurath and PaiuJcaitis, 1989) .
Y-satRNA has a unique sequence domain extending from
nucleotides 101-220 that the shorter satellite RNAs lack
(Masuta and Takanami, 1989) . The Y-satRNA domain
responsible for chlorosis on tobacco is within the 5' 219
nucleotides (Devic et al., 1989), and the active necrosis
domain of Y-satRNA requires at least one of the following;
G at position 318, U at position 323 and/or C at position
325 (Devic et al., 1990) . A point mutation at position 325
from C to U destroys the necrogenic phenotype on tomato but
does not affect yellow chlorosis on tobacco, and a mutation
at position 318 from G to A destroys the biological activity altogether. Deletion of 16 bases from position 150-165,
intended to alter the secondary structure of the molecule, destroyed the biological activity of the mutant. However,
Y-satRNA can tolerate minor insertions and still retain infectivity (Masuta and Takanami, 1989).
The greatest number of nucleotide sequence differences between necrogenic and ameliorative satRNAs are located
10 between nucleotides 286-310, within which no ameliorative
satRNAs contain the same sequence as their necrogenic
counterparts. The ameliorative WLl satRNA contains only
three nucleotide changes within this region relative to
necrogenic satRNAs. Positions 293, 299, and 304 are an A,
G, and U, respectively, in ameliorative satRNAs and a G, U,
and C, respectively in necrogenic satRNAs. Additionally,
necrogenic satRNAs have a three-base deletion relative to
their non-necrogenic counterparts. In D-satRNA this
deletion is between nucleotides 300-302. Non-necrogenic
satRNAs may also have at least one nucleotide insertion in
the equivalent position of this triple deletion (Sleat and
Palukaitis, 1990).
A number of nucleotide positions are unique to
chlorosis-inducing satRNAs within the 120-160 region, and
several key positions have been implicated in the induction
of severe chlorosis on tobacco or tomato. Mutation of nucleotide 149 from a U to a C residue alters host
specificity of chlorosis induction from tomato to tobacco.
Several other positions which may be involved in the
induction of chlorosis in either tomato or tobacco are nucleotide 127, which is a G in all non-chlorosis-inducing satRNAs and an A in chlorosis-inducing satRNAs; position
14 8, which is a G in all chlorosis-inducing satRNAs and an A in all other satRNAs; and position 153, which is a U in all
11 ciilorosis-inducing satRNAs and is deleted in all other satRNAs. Deletion of nucleotide 153 eliminates chlorosis on both tobacco and tomato plants without affecting satRNA replication (Sleat and Palukaitis,. 1992) .
Induction of severe chlorosis on tobacco by satRNAs is also influenced by the helper strain of CMV. CMV subgroup I strains Fny, Pf, and Uh induce a mild mosaic when coinoculated with B2 satRNA and WL3 satRNA. In contrast,-
CMV subgroup II strains LS, SB, U, WL, Q, and 2A induce severe chlorosis when coinoculated with B2 satRNA and WL3 satRNA (Sleat and Palukaitis, 1990a). Further, the specificity of satRNA replication occurs at the level of both the helper virus and the host plant.
Most CMV satRNAs are replicated efficiently by the closely related TAV (Moriones at al., 1992; Roossinck at al., 1992), but not by the serologically distantly related
PSV (Kaper at al., 1978; Roossinck at al., 1992).
Generally, satRNA replication in squash {Cucurblta pepo) is poor, while replication is very efficient in tobacco
(Roossinck at al., 1992). An exception is the WLl satRNA which replicates efficiently in both solanaceous and cucurbit host plants with most CMV helper strains
(Palukaitis, 1988) . However, although CMV-Fny and CMV-Sny can replicate the WLl satRNA in tobacco, CMV-Sny cannot
12 efficiently support replication of WLl satRNA in zucchini
squash (C, pepo 'Black Beauty'). The poor replication of
WLl satRNA in squash maps to RNA 1 of the CMV-Sny helper
virus genome (Roossinck and Palukaitis, 1991). The
inability of CMV-Sny to replicate WLl satRNA in squash was
further mapped to a single amino acid at residue 978 in the
la protein, adjacent to the conserved helicase domains. It
has been suggested that the helper virus, along with unknown
host factors, may be unable to efficiently unwind the
secondary structure of the satRNA for replication (Roossinck
et ai., 1997) .
In general, CMV satellite RNAs often interfere with the replication of their helper virus (Collmer and Howell,
1992). The amount of satRNA in preparations of CMV is highly variable and depends on the CMV helper strain, as well as the host plant species (Francki, 1985). When propagated in squash (C. pepo), satRNA relative to viral RNA accounts for a very low proportion of viral and satRNA encapsidated by CMV. However, the proportion of satRNA increases when the virus is transferred to tobacco (Francki,
1985) . This change of hosts is also accompeinied by a decrease in the proportion of CMV genomic RNAs 1, 2 and 4 relative to RNA 3. It is also accompanied by decreased infectivity and capsid protein production (Francki, 1985;
13 Murant and Mayo, 1982). Accumulation of CMV-Fny RNAs in
tobacco is suppressed by the presence of satRNA, with a more marked suppression of RNAs 1 and 2 than RNAs 3 and 4.
However, the presence of the same satRNA has little effect on the accumulation of CMV-Sny RNAs (Gal-On at al., 1995).
Accumulation of CMV-Fny RNAs 1 and 2, relative to 3 and 4,
is also suppressed by satRNA in squash (Gal-On at al.,
1995). In contrast, CMV-Sny does not support satRNA replication in squash (Roossinck and Palukaitis, 1991) so accumulation of CMV-Sny RNAs is not affected (Gal-On at al.,
1995).
Satellite RNA also affects the accumulation of proteins encoded by the helper virus RNAs (Gal-On at al., 1995). The reduction of CMV-Fny proteins encoded by RNAs 1 and 2 is greater than the reduction of proteins encoded by RNAs 3 and
4 seven days after inoculation onto tobacco. However, after
14 days there is also an effect on the accumulation of proteins encoded by RNAs 3 and 4. Similarly, at 14 days after inoculation satRNA has a considerable effect on the accumulation of CMV-Sny-encoded la and 2a proteins, but unlike with CMV-Fny, little or no effect on the 3a protein and the coat protein (Gal-On et ai.,1995).
SatRNA also affects the accumulation of virions when associated with a particular helper strain or host plant.
14 In tobacco, satPHA. associated with CMV-Fny results in a 90%
reduction and CMV-Sny a 60% reduction in the accumulation of
virus particles, as compared to helper virus alone. In
squash, satRNA associated with CMV-Fny results in a 50%
reduction in the accumulation of virus particles as compared
to helper virus alone (Gal-On at al., 1995),
The dssatRNA has been shown to accumulate in
asymptomatic, systemically infected tobacco tissue while
virions accumulate in symptomatic tissues. The accumulation
of dssatRNA also occurs more often in older leaves, while
virus accumulation occurs in younger, actively growing
tissue. It has been proposed that the dssatRNA plays some
role in the disease modulating effects of satRNAs (Habili
and Kaper, 1981) . The amount of ds satRNA that accumulates
in infected plants is higher than would be expected from its possible template role in the production of sssatRNA. Much of the accumulation of the dssatRNA occurs after the biological activities of the helper virus and sssatRNA has peaked (Dodds at al., 1984).
It has been shown that incorporation of into both ss and dssatRNA increases much faster relative to incorporation into the helper virus RNAs. It has therefore been proposed that satRNAs out compete the helper virus for replication enzymes, leading to a diminished viral titre and
15 symptoms. An increasing rate of (-) strand satRNA synthesis has been observed, suggesting that initially the (-) satRNA serves as template for the replication of (+) strand satRNA that becomes encapsidated. Later in the infection the (-) strands serve to sequester (+) strand satRNAs that can no longer be encapsidated (Piazzolla et al., 1982.).
A proposed mechanism (Kaper, 1982) by which viral pathogenesis is influenced by satRNAs includes the following: 1) accumulation of free satRNA (+) strands due to an out competed and, therefore, diminished viral transcription and coat protein translation process; 2) accumulation of (+) strands increasingly causing the enzymatic mechanism to switch toward the synthesis of satRNA
(-) strands with (+) strands in the template role; and 3) sequestration of the complementary satRNA strands providing a way for their removal from the system as dssatRNA, which appears to be biologically inactive. Such a removal would prevent both product inhibition of the enzyme by free (-) and (+) satRNA strands, and bring the enzyme's synthetic activity into better balance toward production of both types of strands; 4) the more balanced synthesis of satRNA molecules of both polarities proceeding until viral RNA synthesis is out competed and virtually arrested (Kaper,
1982; Piazzolla at ai., 1982).
16 The trilateral nature of the interaction between satRNA, helper virus, and host plant is very complex. Much of the recent research has focused on the satRNAs; their nucleotide sequences, secondary structures, and protein coding capacities. However, the role of the host plant cannot be ignored. It has been reported that the bright yellow symptom induced by CMV and Y-satRNA on tobacco is regulated by a single incompletely dominant gene in
Nicotiana spp. (Masuta at al., 1993). As work progresses on all three facets of this interaction, the overall picture will certainly become clearer.
17 CHAPTER 2
VIRUS SURVEY OF AJUGA REPTANS CULTIVARS
Introduction
Ajuga reptans L. is a perennial ornamental mint
[Lamiaceae) grown in borders or as a groundcover. A. reptans cultivars include 'Bronze Beauty', 'Burgundy Glow',
'Royalty'^ 'Rainbow', 'Silver Beauty', and 'Gatlin's Giant', and are commonly propagated vegetatively and by seed.
Viruses reported infecting A. reptans cultivars are cucumber mosaic virus (CMV), alfalfa mosaic virus (AMV) , tobacco streak virus (TSV), and broad bean wilt virus (BBWV) in Australia (Shukla and Gough, 1983), CMV in Denmark
(Kristensen, 1956), and AMV in the United States (Schroeder and Prowidenti, 1972) . Recently CMV, AMV and TSV were reported infecting A. reptans cultivars in Ohio, and a satRNA was also found associated with CMV-infected A. reptans 'Royalty' plants (Fisher and Nameth, 1997).
CMV, TSV, and AMV are ssRNA viruses belonging to the
Bromovlridae family. All three contain three major genome segments, and have very wide host ranges (Francki et al.,
18 1979; Fulton, 1985; Jaspars and Bos, 1980). AMV, a
bacilliform virus with particles of varying lengths (30, 35,
43, 56 X 18 nm) , is transmitted mechanically, through seed,
by dodder {Cuscuta spp.), and by at least fourteen species
of aphids in the non-persistent manner (Jaspars and Bos,
1980). TSV, an isometric virus with particles of three major sizes (27, 30, 35 nm diameter) , is transmitted mechanically, through seed, and by at least two thrips
species {Frankliniella occidentalis and Thrips
tabaci) (Fulton, 1985). CMV, an isometric virus with particles approximately 28-29 nm in diameter, is transmitted mechanically, through seed, and by at least ten dodder species and more than sixty aphid species in the non- persistent manner (Francki at al., 1979). Many CMV isolates also have a satellite RNA (satRNA) associated with them.
This satRNA is dependent upon the helper virus for replication, is encapsidated along with the CMV genomic
RNAs, but is not required by the helper virus for replication. The satRNA lacks significant nucleotide sequence homology with the helper virus, often interferes with the replication of the helper virus, and affects symptoms induced by the helper virus.
The purpose of this portion of the project was to survey A. reptans cultivars, obtained from growers in the
19 States of Ohio, Michigan, Iowa, and Washington, for CMV,
AMV, TSV, tomato aspermy virus (TAV) , tomato spotted wilt
virus (TSWV), impatiens necrotic spot virus (INSV) , tobacco
mosaic virus (TMV) , potato virus X virus (PVX), and 75
potyviruses. TAV was included in the survey because it can
act as the helper virus for CMV satRNAs (Moriones et al.,
1992). TSWV, INSV and the potyviruses were included because
of their economic importance, and TMV because it is commonly
found in greenhouses. PVX was included simply as a
curiosity. BBWV was not included in the survey because no
commercially or privately produced antibodies were
available.
Materials and Methods
Plant Material and General Methods
A. reptans samples were obtained from growers in the
states of Washington, Michigan, Iowa, and Ohio.
Additionally, samples were collected from several established plantings in Ohio. A total of 356 samples were tested for all nine viruses. Live plants were transplanted and maintained in the greenhouse for the duration of this project and symptoms were noted prior to testing by enzyme- linked immunosorbent assay (ELISA) . Established plantings were surveyed for virus-like symptoms such as mosaic and
20 ringspots, and samples of the symptomatic plants were collected- If no symptoms were evident, then asymptomatic tissue was collected. Freshly collected tissue was prepared immediately for direct antibody sandwich (DAS) ELISA and the remainder frozen at -20°C. Nicotiana rustica and N. tabacum
'Glurk', 'Turk', and 'Samsun' were rub-inoculated using one of the symptomatic 'Royalty' and 'Rainbow' plants as the source of inoculum. Tissue was ground at a 1:10 ratio in
0.02 M sodium phosphate buffer (pH 7.0) containing 0.1%
(w/v) thioglycollic acid. Five plants of each variety were inoculated, and one plant of each variety rubbed with only buffer as a negative control. The inoculum or buffer was rinsed off the inoculated leaves after 5 minutes to avoid phytotoxicity. The plants were kept in the greenhouse and observed for symptoms over the next 90 days. ELISA was used to test symptomatic plants for CMV, AMV and TSV.
Direct Antibody Sandwich (DAS) ELISA
The following protocol is a variation of one previously published (Clark & Adams, 1977), and was used for antibodies produced against CMV, AMV, TSV, TMV, PVX, TSWV, INSV, TAV, tobacco ringspot virus (TRSV), and tomato ringspot virus
(TomRSV) (AGDIA Inc., Elkhart, IN.). 100 pi coating antibody solution [1 pi coating antibody (0.4 mg/ml) in 200 pi coating buffer (Appendix A)] was dispensed into
21 polystyrene microtitre plate wells (Nunc. Microwell Module;
Maxisorp F8; Thomas Scientific, Swedesboro, NJ) and incubated at room temperature (25°C) in a humid box for 4 hours. The coating solution was discarded and the excess coating antibody washed away with 3-4 washings of IX PBST buffer (Appendix A ) . Samples were prepared by grinding leaf tissue in extraction buffer (Appendix A) at a 1:10 dilution.
A 100 pi sample was dispensed into each well and incubated in a humid box overnight at 4°C. The extract was discarded and the wells washed 3-4 times with IX PBST buffer. The enzyme conjugate solution was prepared by diluting the alkaline phosphatase conjugated antibody (0.4 mg/ml) 1:200 in ECI buffer (Appendix A) . The enzyme conjugated antibodies of CMV, TAV and TSV were compound conjugated antibodies. The conjugate solution was prepared by diluting equal volumes of a mouse monoclonal antibody against CMV,
TAV or TSV, and the enzyme-conjugated rabbit anti-mouse antibody in ECI buffer. 100 pi of enzyme conjugate was dispensed into each well and the plates incubated at room temperature in a humid box for 2 hours. The enzyme conjugate solution was discarded and the wells washed 3-4 times with IX PBST buffer. Substrate solution was prepared by dissolving p-nitrophenyl phosphate (pNP) in substrate buffer (Appendix A) to a concentration of 1 mg/ml immediately prior to use. 100 pi of substrate solution was
22 dispensed into each well and the plates gently agitated by
hand until a color change was observed in the positive
control wells. The reaction was stopped by the addition of
50 p.1 3 M sodium hydroxideand the plates evaluated on a
microtitre plate reader (EAR 400 SF Plus EIA plate reader;
SLT Lab instruments; Hillsborough,- NC) at an absorbance of
405 nm. Apparently healthy A. reptans 'Bronze Beauty''
tissue from a planting on The Ohio State University,
Columbus campus, was used as a negative control for Ajuga.
Nicotiana sp. tissue, grown from seed, was used as negative
control when testing tobacco. Positive controls were prepared by grinding tissue, as previously described, known
to be positive for the various viruses. Two wells were
loaded with each sample, the positive and negative controls,
and an extraction buffer negative control. A sample was considered positive if the average absorbance of both wells was twice that of the healthy tissue control. A plate was considered valid only if the positive controls reacted.
Indirect ELISA
The following protocol was used for a potyvirus antiserum (AGDIA, Inc.) prepared against 75 potyviruses
(Appendix B). Samples were prepared as above by grinding infected tissue in DAS-ELISA extraction buffer at a 1:10 ratio. 90 ^1 of indirect extraction buffer (Appendix A) was
23 dispensed into each well followed by 10 p.1 of prepared
sample. The sample was thoroughly mixed with the pipette
tip used to dispense the sample, and the plate incubated in
a humid box at room temperature (25°C) for 1 hour. The
plate was washed 3-4 times with IX PBST buffer. Primary
antibody solution was prepared by diluting the antiserum in
ECI buffer at a 1:200 ratio, 100 pi dispensed into each
well, and the plate incubated in a humid box for 2 hours at
room temperature or overnight at 4°C. The plate was washed
3-4 times with IX PBST buffer. Alkaline phosphatase-
conjugated antibody solution was prepared by diluting the
antibody in ECI buffer at a 1:200 ratio, 100 pi dispensed
into each well, and the plate incubated in a humid box for 1
hour at room temperature. The plate was washed as above,
substrate solution prepared as above, and 100 pi dispensed
into each well. The plates were gently agitated by hand or
on a plate shaker until color developed in the positive
control wells. Reactions were stopped by the addition of 50
pi 3 M sodium hydroxide to each well. Plates were then evaluated on a microtitre plate reader at 405 nm as above.
Each sample, the positive, and negative controls were dispensed into two wells and the average absorbance of the two wells used to evaluate each sample. A sample was considered positive if its absorbance was twice that of the healthy tissue/buffer control. A plate was considered valid
24 only if there was a reaction in the positive control wells.
DsRNA Analysis
The following protocols for viral-associated double- stranded ribonucleic acid analysis (dsRNA) extraction and purification (column method and mini-prep method) are adaptations of the original dsRNA protocol developed by
Morris and Dodds (Morris and Dodds, 1979) .
Column Method
DsRNA Extraction
Five to 7 gram samples of plant tissue were frozen in liquid nitrogen and ground with a mortar and pestle. The resulting powder was transferred to a 50 ml centrifuge tube.
Fourteen ml single strength (IX) STE buffer (0.1 M NaCl,
0.05 M Tris, 0.001 M Na^EDTA; pH 6.8), 18 ml STE-saturated phenol, and 2 ml 10% (w/v) sodium dodecyl sulfate (SDS) added. The tubes were capped and agitated on an orbital shaker (Model 3520, Lab-Line Instruments, Melrose Park, XL.) for 20-25 minutes (150 rpm) at room temperature (25°C) , followed by centrifugation at 7740 X g (8 K rpm in a SS-34 rotor; Sorvall Superspeed RC5C Automatic Refrigerated
Centrifuge, DuPont, Wilmington, DE) for 15 minutes at 4°C.
The aqueous phase was collected and the volume adjusted to
20 ml with IX STE buffer. The sample was adjusted to a
16.5% ethanol concentration by the addition of 4.2 ml 95% ethanol.
25 DsRNA Purification
A small chromatographic column was prepared using a 30 ml disposable syringe barrel plugged with a disk of
Miracloth (Calbiochem, La Jolla, CA) and packed with 2.5 g
CF-11 cellulose powder (Whatman Biosystems Ltd., Maidstone,
Kent, England) in 30 ml IX STE-16.5% ethanol. The sample was passed through the column, the column washed with 75 ml
IX STE-16.5% ethanol, and the purified dsRNA eluted from the column with 15 ml IX STE buffer added in 5 ml aliquots.
Only the second and third fractions of eluate were collected. Alternatively, the cellulose chromatography step was done in a centrifuge tube. 2.5 g of CF-11 cellulose was prepared as previously described, but added to a 50 ml centrifuge tube. The tube was centrifuged at 13,000 rpm
(SS-34 rotor) for 3 minutes to pellet the cellulose. The
STE-16.5% ethanol was poured off and the sample added to the
CF-11 pellet. The sample was incubated on an orbital shaker for 20 minutes at room temperature, followed by centrifugation at 13 K rpm for 3 minutes. The supernatant fraction was poured off and the pellet washed with 25 ml
STE-16.5% ethanol buffer, followed by centrifugation at 13 K rpm for 3 minutes. The wash step was repeated twice more, and the pellet eluted with 10 ml IX STE buffer. Following elution the sample was centrifuged at 10 K rpm and the supernatant fraction collected in a clean 50 ml centrifuge
26 tube using a serological pipette. The purified dsRNA was precipitated by adding l/20th volume (0.5 ml) 3 M sodium acetate (pH 5.5) and 27 ml 95% ethanol. The samples were chilled over night in a freezer (-20°C) , or alternatively, dipped in liquid nitrogen before centrifugation at 30,600 X g (16 K rpm) for 15 minutes to pellet the purified dsRNA.
The supernatant fraction was discarded and the pellets washed with 30 ml 75% ethanol for 5 minutes, followed by centrifugation at 16 K rpm (SS-34 rotor) for 5 minutes. The ethanol was discarded and the pellets air dried prior to resuspension in 100-300 p.1 IX TAE buffer (0.04 M Tris, 0.02
M sodium acetate trihydrate, 0.001 M Na,EDTA; pH 7.8) containing 20% (v/v) glycerol, 0.1% (w/v) sodium azide and
0.1% (w/v) bromthymol blue. Alternatively, the pellets were resuspended in IX TE buffer (0.01 M Tris, 0.001 M EDTA; pH
8 .0) .
Electrophoretic dsRNA Analysis
Samples of purified dsRNA (35-45 pi) were electrophoresed on 5% or 10% polyacrylamide vertical mini gels (Mini-Protean II, Bio-Rad, Richmond, CA) at 120-130 volts for 1-2 hours. Alternatively, 20-30 pi samples were electrophoresed on 0.8% or 1% agarose gels at 55 V for 1-2 hours. The dsRNA was visualized by staining the gel with ethidium bromide [50 pi (1 mg/ml) in 200 ml ddH.O] in a glass baking dish for 5 minutes under constant agitation.
27 The gel was then destained for 5 minutes in ddH,0, and
photographed over ultraviolet light (302 nm) using Polaroid
Type 667 film (Polaroid Corporation, Cambridge, MA) .
Mini-Prep Method
DsRNA Extraction
The following protocol was used for 0.25 and 0,5 g
samples, and is a modification of one previously published
(Di et ai., 1984). Plant tissue was ground with a mortar
and pestle and the resulting powder transferred to a 3 ml
glass tube. For 0.25 g samples, 0.65 ml IX STE, 0.35 ml
STE-saturated phenol and 40 p.1 10% SDS were added. For 0.5
g samples 1.3 ml STE, 0.7 ml STE-saturated phenol and 80 pi
10% SDS were added. The tubes were capped with parafilm-
covered corks and agitated on an orbital shaker for 20-25 minutes (150 rpm), followed by centrifugation at 2450 X g
(4500 rpm in SS-34 rotor) for 15 minutes. The aqueous phase was collected with a 10-100 pi pipette and placed in a 1.5 ml microcentrifuge tube. The sample volume was adjusted to
1 ml with IX STE, and the ethanol concentration adjusted to
16.5% by the addition of 0.21 ml 95% ethanol. The contents were then mixed thoroughly by shaking or vortexing.
DsRNA Purification
A slurry of 50 mg CF-11 cellulose powder per 1 ml IX
STE-16.5% ethanol (1 g CF-11/ 20 ml STE-16.5% ethanol) was
28 prepared and 1 ml of the suspension placed in a 1.5 ml microfuge tube. The CF-11 was pelleted by centrifugation in
a benchtop microcentrifuge (HBI Microcentrifuge, Haake
Buchler Instruments Inc., Saddle Brook, NJ) at 5500 rpm for
2.5 minutes and the supernatant discarded. The sample was added to the CF-11 pellet and incubated at room temperature
(2b°C) for 15 minutes, vortexing at 5 minute intervals. It was then centrifuged at 6500 rpm for 2.5 minutes, the supernatant fraction discarded, and the pellet washed with 1 ml STE-16.5% ethanol by vortexing. The CF-11 was repelleted by centrifugation at 6500 rpm for 2.5 minutes, the supernantant fraction discarded, and the wash step repeated twice more. To elute the dsRNA 0.5 ml IX STE buffer was added to the CF-11 pellet from the final wash, the sample was vortex mixed followed by centrifugation at 6500 rpm for
5 minutes. The supernatant fraction was collected and saved in a new 1.5 ml microfuge tube. To precipitate the purified dsRNA, 0.05 ml 3 M sodium acetate (pH 5.5) was mixed with the eluate followed by 1 ml 95% ethanol. To pellet the purified dsRNA the sample was chilled in the freezer (-20°C) over night or dipped briefly in liquid nitrogen, followed by centrifugation at 30,600 X g (16 K rpm in SS34 rotor) for 15 minutes. The supernatant fraction was discarded and the pellet resuspended in 40 p.1 IX TAE containing 20% glycerol,
0.1% sodium azide and 0.1% bromthymol blue or IX TE buffer.
29 Twenty to 40 of dsRNA sample was analyzed on 5 or 10%
polyacrylamide or 0.8 or 1% agarose gels, and visualized as
described above.
Preparation of Diaoxiaenin-labeled (S)-CARNA5 cDNA Probe.
Molecularly cloned (S)CARNA5(-) satRNA in a pSP65
plasmid vector in E. coll (ATCC 45124) was labeled with
digoxygenin (DIG) as per the following protocol.
Lyophilized E. coll was allowed to rehydrate in ca. 0.5 ml
LB broth (2.5 g NaCl; 5.0 g tryptone; 2.5 g yeast extract;
500 ml ddHjO) for 1 hour at room temperature. The
rehydrated bacteria was streaked on LB-agar plates
containing 200 pg/ml ampicillin and incubated at 37°C overnight. Colonies were selected, restreaked on new LB- agar plates, and incubated overnight. LB broth containing ampicillin was inoculated with a loopful of culture from the
LB-agar plate and allowed to shake (200 rpm) at 37°C overnight.
Large Scale Plasmid Isolation. An overnight culture was divided into two 250 ml centrifuge bottles and centrifuged at 7000 rpm (GSA rotor) for 10 minutes. The supernatant was discarded and each pellet resuspended in 9 ml lysis buffer (50 mM glucose, 10 itiM EDTA, 25 mM Tris; pH
8.0) by gently pipetting in and out until completely resuspended. The suspension was recombined and allowed to
30 incubate at room temperature for at least 5 minutes and up to 30 minutes. 35 ml 0.2 N NaOH containing 1% (w/v) SDS was added to the suspension, the bottle shaken vigorously, and the mixture allowed to stand at room temperature for 5 minutes. 26.5 ml 3 M potassium acetate was added, the mixture shaken vigorously until 'chunky^, and allowed to stand for 5 minutes. The preparation was centrifuged at
7000 rpm (GSA rotor) for 15 minutes and the supernatant fraction expressed through two layers of cheesecloth into a clean 250 ml centrifuge bottle. 50 ml isopropanol was added, the preparation placed at -20°C for 20 minutes, and centrifuged at 9000 rpm (GSA rotor) for 15 minutes. The supernatant fraction was discarded, and the pellet air-dried for 30 minutes and resuspended in 2 ml TE buffer (10 mM
Tris, 1 mM EDTA; pH 8.0) by gently swirling until completely dissolved. 3.3 g cesium chloride was dissolved in the preparation and 100 pi ethidium bromide (10 mg/ml) added in the dark. The preparation was added to an ultracentrifuge tube using an 18 gauge hypodermic needle/syringe as a funnel, the tube sealed and centrifuged at 95,000 rpm (Beckman T-lOO benchtop ultracentrifuge) overnight (5-24 hours) at room temperature under vacuum.
The DNA band was drawn off in the dark under ultraviolet light by puncturing the tube with an 18 gauge hypodermic needle/syringe. The preparation was transferred to a 1.5 ml
31 microfuge tube, an equal volume of SEC butanol added, and
the tube gently shaken. The upper phase was removed and the
SEC butanol wash step repeated until no pink color (ethidium
bromide) remained. Two volumes of ddEgO and 6 volumes of
95% ethanol were added to the DNA, the preparation placed at
-20'^C for 20 minutes, and centrifuged at 15, 000 rpm (SS34
rotor) for 15 minutes. The pellet was washed in 0.5 ml 70%
ethanol for 5 minutes, recentrifuged at 15,000 rpm for 10 minutes, and air dried. Pellet(s) were resuspended in 30 pi sterile ddHjO and recombined into a single tube.
Quantification of DNA. The DNA preparation was quantified spectrophotometrically at 260/280 nm (Shimadzu
UV-160) by diluting 4 pi DNA in 996 pi ddH^O. The 260 nm value was multiplied by a factor of 50 (O.D. of 1=50 pg/ml) and that value multiplied by a dilution factor of 250 to determine the quantity of DNA. The purity of the DNA preparation was determined by dividing the 2 60 nm value by the 280 nm value, 1.6-1.9 being desirable, above 2.0 indicating RNA contamination, and below 1.6 indicating protein contamination.
Excision of (S)CARNA5 insert from plasmid. The DNA was diluted to 0.1-0.2 pg/pl with sterile ddH^O. 1 pi DNA of the preparation was mixed with 1 pi lOX EcoRI buffer (50 mM
Tris-HCl, pH 8.0; 10 mM MgCl?; 100 mM NaCl) and 8 pi ddH^O.
0.5 pi (5 units) EcoRI was added and thoroughly mixed, and
32 the mixture incubated at 37°C for 1 hour in a water bath.
The digested DNA was mixed with 5 p.1 of "blue juice" (20 ml
100% glycerol, 20 ml IX TA buffer, pH 8.0; 5 ml 1% w/v bromphenol blue, 50 ml final volume) and the digestion
assessed by electrophoresis on a 1% agarose gel [0.3 g agarose in 30 ml IX TA (40 mM Tris; 2 mM EDTA; pH 8.0) buffer; 1 pi 10 mg/ml ethidium bromide] at 75 volts for 45 minutes. For band-isolation of the CARNA5 fragment and the plasmid vector a second EcoRI digestion was done using undiluted DNA in a larger volume (ca. 80 pg/pl DNA in 100 pi volume). A 1% agarose gel was prepared as above, with several of the gel-comb wells taped together to create one large well. A quantity of digested DNA was electrophoresed in the gel for approximately 1 hour, the gel placed on a transilluminator (302 nm) and the position of the CARNA5 fragment and the plasmid marked with two toothpicks. A new well was carefully cut from the gel just below the DNA fragments using a scalpel, the gel returned to the gel tray, and the buffer pipetted out of the newly cut well. The wells were refilled with IX TA buffer containing 15% (w/v) polyethylene glycol (PEG) 8000, the power source turned on to 300 volts, and the migration monitored under UV irradiation. The buffer was removed from the wells, saved in 1.5 ml microfuge tubes and replaced with another volume.
This was repeated three times to ensure that the fragments
33 were recovered. Alternatively, the DNA bands were cut directly from the gel with a glass coverslip, placed in a
GenElute (Supelco Inc., Supelco Park, Bellefonte, PA.) agarose spin-through column in a 1.5 ml microfuge tube and centrifuged at 13,000 rpm in a benchtop microcentrifuge for
10 minutes. The DNA was extracted with an equal volume of
1:1 phenol: chloroform, an equal volume of chloroform, and precipitated with 0.1 volume 3 M sodium acetate and 2-3 volumes 95% ethanol as described above. The pellets were washed with 70% ethanol as described, air dried, and resuspended in 30 ill TE buffer. 2 ill band-isolated DNA was mixed with 8 pi ddHjO and 3 ill "blue juice", or 2 pi DNA was mixed with 5 y.1 "blue juice", and electrophoresed on a 1% agarose gel for 1 hour. The quantity of the isolated DNA band was visually estimated.
DNA Labeling Procedure. Approximately 125 ng of DNA was used in the labeling reaction based on visual estimation of 0.1 volume of the isolated DNA band in an agarose gel.
Template DNA was diluted to a total volume of 15 iil in sterile ddHzO, denatured by boiling in a water bath for 10 minutes, and quick chilled on ice. 2 pi lOX random hexanucleotide primers, 2 pi lOX dNTP'’s (1 mM dATP; 1 mM dCTP; 1 mM dGTP; 0.65 mM dTTP; 0.35 mM DlG-dUTP) , and 1 pi
Klenow enzyme (2 U/pi) added and mixed thoroughly. The reaction was incubated at 37°C in a water bath for
34 approximately 20 hours and stopped by the addition of 2 y.1
0-2 M EDTA, pH 8.0. Labeled DNA was precipitated by adding
2.5 ^1 4 M LiCl, 75 ^1 absolute ethanol, placed at -70°C for
30 minutes, and centrifuged at 16,000 rpm (SS34 rotor) for
20 minutes. Pellets were washed with 70% ethanol as described, air dried and resuspended in 50 y.1 IX TE buffer
(Genius II DIG-DNA Labeling Kit, Boehringer Mannheim).
Quantification of DIG-labeled DNA. An aliquot of labeled (S)CARNA5, pSP65 plasmid and DIG-labeled control DNA was diluted to 1 y.g/ml. The starting concentration of the labeled (S)CARNA5 and pSP65 DNA was assumed to be 5.2 pg/ml since 100 ng of template DNA should have yielded 2 60 ng labeled DNA when incubated for 20 hours (Table 1 in Genius
II manual), and the DNA was in a 50 pi volume. The labeled
DNA was diluted to 1 pg/ml based on this assumption.
Dilutions were then prepared at 1:10, 1:100 and 1:1000 ratios (100 pg/pl, 10 pg/pl and 1 pg/pl, respectively) by diluting the DNA in DNA dilution buffer (50 pg/ml herring sperm DNA in 10 mM Tris-HCl, 1 mM EDTA, pH 8.0). 1 pi drops of each dilution series were spotted onto a dry, positively charged nylon membrane, the membrane baked at 100°C for 1 hour, and the labeled DNA detected with an anti-DIG antibody
(see immunological detection of DIG-labeled probe). The amount of labeled DNA was estimated by comparing the (S)
CARNA5 and pSP65 spot intensities to that of the DIG-labeled
35 control DNA. A test hybridization was done by
electrophoresing 1 pi unlabeled (S)CARNA5 cDNA (ca. 1 pg/ml)
on a 1% agarose gel, blotting, and probing using the DIG-
labeled (S)CARNA5 cDNA as described below.
Northern Hybridization Using DIG-Labeled (S)CARNA5 cDNA
Probe.
DsRNA to be probed was extracted and purified as previously described, denatured by boiling in a water bath,
immediately iced, and "blue juice" added just prior to
electrophoresis in 0.8 or 1% agarose gels. All buffers used
for gel preparation, electrophoresis, hybridization, and detection were prepared with diethylpyrocarbonate (DEPC) treated water (2 ml DEPC/liter of water followed by autoclaving) in baked glassware, and all gel apparati treated with RNAse Away (GibcorBRL, Gaithersburg, MD.).
Capillary Transfer of Nucleic Acids. Nucleic acids were transferred to a positively charged nylon membrane
(Boehringer Mannheim) as described by Sambrook et al., 1989.
A support was constructed from several pieces of Plexiglass, placed in a glass baking dish and a piece of filter paper placed on the support such that it acted as a wick. The dish was filled with 2OX SSC buffer (0.3 M sodium citrate;
3.0 M NaCl; pH 7.0) and the wick wet completely. Following electrophoresis the gel was inverted and placed on the wick.
36 a piece of 2OX SSC-soaked nylon membrane positioned on the
gel, 2 pieces of 2X SSC-soaked filter paper positioned on
the membrane, and a 8 cm stack of paper towels positioned on
the filter paper. The stack was weighted with a 500 g flask
of water, the setup enclosed with plastic wrap, and
capillary transfer allowed to proceed overnight (ca. 16
hours) at room temperature. The membrane was soaked in 6X
SSC for 5 minutes at room temperature, blotted dry and baked
for 2 hours at 100°C in a glass dish between two pieces of
filter paper to fix the nucleic acid to the membrane.
Hybridization. The membrane was pre-hybridized for 2 hours at 68°C in pre-warmed hybridization buffer {5X SSC
(0.075 M sodium citrate, 0.75 M NaCl, pH 7.0); 0.1% (w/v) N-
lauroylsarcosine; 0.02% (w/v) SDS; 0.1 volume lOX blocking solution (10% blocking reagent dissolved in maleic acid buffer)} , the prehybridization solution discarded and pre warmed DIG-labeled (S)CARNA5 hybridization solution (ca. 100 ng/ml probe concentration) added. Hybridization was allowed to proceed overnight at 68°C.
Stringency Washes. Following hybridization the hybridization solution was saved in a 50 ml centrifuge tube for reuse. The membrane was washed two times in 2X SSC buffer containing 0.1% (w/v) SDS for 5 minutes at room temperature, and two times in prewarmed O.IX SSC buffer containing 0.1% (w/v) SDS for 15 minutes at 68°C under
37 constant gentle agitation.
Iirununoloaical Detection of DIG-Labeled Probe. The membrane was rinsed for 5 minutes in maleic acid buffer (0.1
M maleic acid, 0.15 M NaCl, pH 7.5 with solid NaOH), and incubated for 30 minutes in IX blocking solution (lOX stock diluted in maleic acid buffer) at room temperature. Anti-
DIG antibody was diluted to 1:10,000 (75 mU/ml) in IX blocking buffer and incubated for 30 minutes at room temperature. Antibody solution was saved in a 50 ml centrifuge tube for reuse. The membrane was washed with maleic acid buffer two times for 15 minutes, and equilibrated for 5 minutes in 30 ml of detection buffer (0.1
M Tris-HCl, 0.1 M NaCl, 25 mM MgClg, pH 9.5). Color substrate solution was prepared by diluting 135 y.1 nitro
Blue tétrazolium (NET) solution (75 mg/ml nitro blue tétrazolium in 70% w/v dimethylformamide) and 105 pi 5- bromo-4 chloro 3-indolyl phosphate (50 mg/ml in dimethyl formamide) solution in 30 ml detection buffer and mixing thoroughly. The membrane was incubated in the color solution, in the dark, for 3-16 hours until color developed in the positive control lane. The reaction was stopped by rinsing the membrane in distilled water for 5-10 minutes and the membrane stored in ddHgO at 4°C. Results were documented by using a flatbed scanner to scan the membrane.
38 Reverse Transcription Polvmerase Chain Reaction (RT-PCR)
Primer Design. Four pairs of primers were designed for
use in RT-PCR experiments. For the first two pairs,
designated 1+2 and 3+4, the 5' and 3' ends of 10 published
satellite RNA. sequences were examined for conserved regions,
and consensus sequences used. The published satRNA
sequences used were G-satRNA, B1-satRNA, B2-satRNA, B3-
satRNA, WLl-satRNA, WL2-satRNA (Garcia-Arenal et ai., 1987),
E-satRNA, OY-satRNA (Hidaka et ai., 1988), Y-satRNA (Hidaka
et ai., 1984) and D-satRNA (Kurath and Palukaitis, 1987),
and are shown in Figure 1.
For the second two pairs of primers, designated 5+6 and
7+8, the 5' and 3' ends of fourteen CMV satRNA sequences obtained from the internet (The National Center for
Biotechnology Information— http://www.ncbi.nlm.nih.gov) were compared, and are shown in Figure 2. In cases where a nucleotide varied at a particular site (indicated in bold type), the nucleotide that occurred most frequently was used. In cases where a nucleotide varied between a G/C or
A/T, the G or C was used preferentially to keep the primer melting temperature higher. Generally, it was attempted to keep primer GC content at 50% or above, and primer melting temperature at 50°C or above. Primers were 15-24 nucleotides in length, and the sequences checked for hairpin
39 1234567890123456789012345678901 G-satRNA 5 ' -GUUUUGUUUGUUAGAGAAÜUGCGUAGAGGGG Bl-satRNA 5 ' -GUUUUGUUUGUUAGAGAAUUGCGUAGAGGGG B2-satRNA 5 ' -GUUUUGUUUGUUAGAGAAUUGCGUAGAGGGG B3-satRNA 5 ' -GUUUUGUUUGUUAGAGAAUUGCGUAGAGGGG WLl-satRNA 5 ' -GUUUUGUUUGAUGGAGAAUUGCGUAGAGGGG WL2-satRNA 5 ' -GUUUUGUUUGUUAGAGAAUUGCGUAGAGGGG E-satRNA 5 ' -GUUUUGUUUGAUGGAGAACUGCGUGGAGGGG OY-satRNA 5 ' -GUUUUGUUUGUUGGAGACCCGCGCGGAGGGG Y-satRNA 5 ' -GUUUUGUUUGAUGGAGAAUUGCGUAGAGGGG D-satRNA 5 ' -GUUUUGUUUGAUGGAGAAUUGCGCAGAGGGG
Primer 1 5 '------GTTTGATGGAGAACTGCGTAGAG--- Primer 3 5'-GTTTTGTTTGTTAGAGAACTG------
G-satRNA - CUCCUUGGAUGUUUAU* CAUUCC * CUACCAGGACCC - 3 ' Bl-satRNA -CUCCGUGAAUGUCUACACAUUCCUCUAC*AGGACCC- 3 ' B2-satRNA -CUCCGUGAAUGUCUACACAUUCCUCUAC*AGGACCC- 3 ' B3-satRNA -CUCCGUGGAUGUUUAU*CAUUCC*CUACC*GGACCC- 3 ' WLl-satRNA -CUCCGÜGAAUGUCUACACAUUCCUCUAC*AGGACCC-3 ' WL2-satRNA -CUCCGUGAAUGUCUACACAÜUCCUCUAC*AGGACCC- 3 ’ E-satRNA -CUCCGCGUAUGUUUA*ACA*UACCUUAACAGGACCC- 3 ' OY-satRNA - CUCCAUGGAUGUCUACACAUUCCUCUAC * AGGACCC - 3 ' Y-satRNA - CUCCGUGAAUGUCUAUACAUUCCUCUAC * AGGACCC - 3 ' D-satRNA -CUCCGUGAAUGUCUAU*CAUÜCCUCUGC*AGGACCC-3 '
Primer 2 -CAGATGTGTAAGGAGATGGTC 3 ' Primer 4 ------GGAGATGGTCCTGGG-3'
Figure 1. RT-PCR primers designed using ten previously published CMV satRNA sequences. Nucleotides appearing in bold type indicate differences at that position, and a star indicates a deletion. Primers 1 and 3 hybridize to the 3' end of minus-sense satRNA and primers 2 and 4 to the 3' end of positive-sense satRNA.
40 1234567890123456789012345678 1. (NID; gl009716) 5' -GTTTTGTTTGTTGGAGACCCGCGCGGAG 2. (NID: gl009715) 5 ’-GTTTTGTTTGTTGGAGAATCGCGCGGAG 3. (NID: g331711) 5' -GTTTTGTTTGTTAGAGAATTGCGTAGAG 4. (NID: gll03549) 5' -GTTTTGTTTGTTGGAGAATTGCGTGGAG 5. (NID: g509102) 5' -GTTT*GTTTGTTGGAGAATTGCGCGGAG 6. (NID: gll03551) 5' -GTTTTGTTTGTTAGAGAATTGCGCGGAG 7. (NID: gll03553) 5' -GTTTTGTTTGTTGGAGAATTGCGCAGAG 8. (NID: g222045) 5' -GTTTTGTTTGATGGAGAATTGCGCGGAG 9. (NID: g59034) 5' -GTTTTGTTTGTTAGAGAATTGCGTAGAG 10. (NID: gll03555) 5' -GTTTTGTTTGTTGGAGAATTGCGCAGAG 11. (NID: gll03554) 5' -GTTTTGTTTGATGGAGAATTGCGTAGAG 12. (NID: g222048) 5' -GTTTTGTTTGTTAGAGAATTGCGTAGAG 13. (NID: g222046) 5' -GTTTTGTTTGATGGAGAATTACGCGGAG 14. (NID: gl429325) 5' -GTTTTGTTTGTTAGAGAATTGCGTAGAG
Primer 5 5'-GTTTTGTTTGTTGGAGACCCGC- Primer 7 5'-CAAAACAAACAACCTCTGGG--
1. (NID: gl009716) -CGCGTATGTCTATCATACCTTAACAGGACCC- 3' 2. (NID: gl009715) -CGTGAATGTCTGACATTCCTCTACAGGACCC- 3' 3. (NID: g331711) -CGTGGATGTTTATCATTCCCTACCAGGACCC- 3' 4. (NID: gll03549) -CATGAATGTCTATCATT*CCTACCAGGACCC- 3' 5. (NID: g509102) -CGTGAATGTCTAACATTCCCTA*CAGGACCC- 3' 6. (NID: gll03551) -CGTGAATGTCTATCATTCCTTA+CAGGACCC- 3' 7. (NID: gll03553) -CGTGAATGTCTATCATTCCTCTACAGGACCC- 3' 8. (NID: g222045) -CGTGAATGTCTAACATTCCTCTACAGGACCC- 3' 9. (NID: g59034) - CGTGAAT GTCTAACAT TCC TCTACAGGACCC- 3' 10. (NID: gll03555) -CGTGAATGTCTATCATTCCTCTACAGGACCC- 3' 11. (NID: gll03554) -CGTGAATGTCTATCATTCCTCTACAGGACCC- 3' 12 .(NID: g222048) -CGTGAATGTCTA*CATTCCTCCACAGGACCC- 3' 13 .(NID: g222046) -CGTGGATGT * TA* CATTCCT * CACAGGACCC- 3' 14. (NID: gl429325) -CGTGAATGTCTATCATTCCTCCACAGGACCC- 3 '
Primer 6 -CAGATTGTATGGAATTGTCCTGGG-3' Primer 8 -GTCTATCATACCTTAACAGGACCC- 3 '
Figure 2. RT-PCR primers designed using sequences obtained from The National Center for Biotechnology Information website. Primer 5 hybridizes to the 3' end of minus sense satRNA^ primer 7 to the 5' end of positive sense satRNA. Primer 6 hybridizes to the 3' end of positive sense satRNA and primer 8 to the 5' end of minus sense satRNA. Bold type indicates a difference at that position and a * indicates a deletion.
41 structures, self-dimers, and melting temperature using the
CPRIMER program (G. Bristol and R.D. Anderson, U.C.L.A.,
CA.) prior to synthesis. DNA Strider 1.3f3 (Registered
trademark of CEA, France) was also used to check for
multiple primer annealing sites along a representative
satRNA sequence.
Following synthesis (DNAgency, Malvern, PA.) the
lyophilized oligonucleotide pellets were dissolved in 250 pi
sterile ddHzO for 20 minutes and gently agitated. The
primer concentration was quantified spectrophotometrically
at 260 nm and the stock solutions stored at 4°C or -20°C.
Sample Preparation. Infected tissue and controls were
ground in IX TEST buffer (0.025 M Tris ;pH 8.0, 0.015 M
NaCl, 0.05% v/v Tween-20) at a 1:4 (w/v) dilution in ELISA
grinding pouches. The macerate was transferred to
microcentrifuge tubes and centrifuged at 13,000 rpm in a
benchtop microcentrifuge for 10 minutes. The supernatant
fraction was collected in a new microfuge tube and a
dilution series of 1:8, 1:16 and 1:32 prepared using TEST.
Five pi of 1:16 and 1:32 sample diluent was mixed with 35 pi
sterile HPLC water, the samples incubated at 94°C for 5 minutes and placed on ice. The remaining supernatant
fraction was stored at -20°C for future assays.
One-Step RT-PCR. A master mix was prepared on a per-
tube basis containing 5 pi lOX RT-PCR buffer (200 mM Tris-
42 KClr pH 8.4; 500 itiM KCl; 25 inM MgCl,) , 1 ]ll dNTP" s (1.0 mM) ,
1 pi 3' primer (0.35 pg/pl), 1 pi 5' primer (0.35 pg/pl), 1
pi 0.1 M dithiothreitol (DTT), 0.5 pi Superscript II (Gibco-
BRL; Life Technologies, Inc., Gaithersburg, MD.) reverse
transcriptase (200 U/pl), and 0.5 pi Taq DNA polymerase (5
U/pl)(Gibco-BRL; Life Technologies, Inc., Gaithersburg,
MD.). 10 pi master mix was added to each denatured sample
(50 pi final volume in a 0.5 ml microfuge tube) and loaded
into a thermal cycler (PTC-100 Programmable Thermal
Controller, M.J. Research Inc., Watertown, MA.) programmed
as follows : 42°C (40 min.), 94°C (2 min.), 92% (40 sec.),
primer annealing step (1 min.), 72°C (1.5 min.), 29 times to
step 3, 72°C (5 min.). The primer annealing temperature was
varied from 45%, 47%, 50% and 56%, and the MgClj
concentration in the RT-PCR buffer was titrated from 0-10 mM
to optimize the conditions for the primer pairs. PCR products were extracted with an equal volume of phenol: chloroform (1:1), vortexed, centrifuged for 1 minute
(13,000 rpm) in a benchtop microcentrifuge, and the aqueous phase collected and extracted with an equal volume of chloroform. The mixture was vortexed, centrifuged as previously described, and the supernatant collected in a 1.5 ml microfuge tube. The PCR products were precipitated with
0.1 volume 3 M sodium acetate, pH 5.5, and 2-3 volumes 95%
43 ethanol, chilled at -2Q°C for 30 minutes, or dipped in
liquid nitrogen, and centrifuged at 16,000 rpm in SS34 rotor
for 20 minutes. The pellets were washed in 70% ethanol for
5 minutes at room temperature, microcentrifuged at 13,000 rpm for 5 minutes, and air dried. The final pellets were resuspended in 20 pi IX TE buffer(10 mM Tris-HCl; 1 mM EDTA, pH 8.0), or 10 mM Tris-HCl, pH 6.5.
Two-Step RT-PCR (First-Strand Synthesis). Reactions were performed in sterile 0.5 ml microfuge tubes. A reaction was performed using each of the 4 primer pairs. 1 pi 3' primer (0.1 pg/pl), 1 pi 5' primer (0.1 pg/pl), and 1 pi sample extract (1:16 and 1:32 dilutions) were mixed with
9 pi HPLC water, heated in a thermal cycler to 94% (2 min.), 70°C (5 min.), 58°C (5 min.), and chilled on ice. 4 pi 5X first-strand buffer (250 mM Tris-HCl, pH 8.3; 375 mM
KCl; 15 mM MgCl,) , 2 pi 0.1 M DTT, and 1 pi ImM dNTPs mixed thoroughly. The mixture was incubated at 4 2 % (2 min.) and
1 pi (200 U/pl) Superscript II mixed thoroughly for a 20 pi final volume. The reaction was incubated in a thermal cycler for 1 hour at 42%, heated to 70% (15 min.), and chilled to 4%. 0.1 volume of the RT reaction product was used directly in the PCR reaction. Alternatively, the RT reactions were treated with 2 units of RNAse-H (Gibco:BRL) by incubation at 37% for 20 minutes prior to use in PCR reactions.
44 Two-Step RT-PCR (PCR Reaction). Reactions were
prepared in 0.5 ml microfuge tubes to a 50 pi final volume.
5 pi lOX PCR buffer (200 mM Tris-HCl, pH 8.4; 500 mM KCl),
4 pi 50 mM MgClz (4 mM final cone. ) , 5 pi 1 mM dNTP's (100
pM final cone.), 1 pi 3' primer (0.1 pg/pl), 1 pi 5 ’ primer
(0.1 pg/pl) and 2 pi RT reaction product mixed with 31.5 pi
sterile HPLC water. 0.5 pi Taq DMA. polymerase (5 U/pl) was
mixed into each tube immediately prior to cycling.
Alternatively, a hot-start procedure was done by heating the
mixture to 94°C for 1 minute prior to the addition of the
Tag polymerase. Control reactions using (S)CARNA5 cDNA +
pSP65 plasmid digested with EcoRI were prepared exactly as
above, except 1 pi DNA was used as template and 32.5 pi HPLC
water used. Alternatively, cDNA prepared from an RT
reaction using sap extract from CMV-Royalty-infected N.
tabacum 'Glurk' was used as positive control in the PCR
reaction. For multiple reactions under the same conditions
a master mix cocktail was prepared on a per-tube basis. The
reaction mixtures were placed in a thermal cycler programmed
as follows: 94°C (3 min.), 92°C (40 sec.), primer annealing temperature— 56°C or 58°C (1 min.), 72°C (1.5 min.), 29 times to step 2, 72°C (5 min.), 4°C (48 hours). Alternatively, the cycler was programmed for a step-wise increase in the primer annealing temperature, covering a range inclusive of
45 the melting temperatures of all the primer pairs used, as follows: 94°C (3 min.), 92°C (40 sec.), 48°C (1 min.), 72°C
(1.5 min.), 4 times to step 2, 92°C (40 sec.), 56°C (1 min.), 12°C (1.5 min.), 4 times to step 6, 92°C (40 sec.),
60°C (1 min.), 12°C (1.5 min.), 4 times to step 10, 92% (40 sec.), 56% (1 min.), 72% (1.5 min.), 20 times to step 14,
72% (5 min.), 4% (48 hours) . PCR products were extracted with phenol: chloroform and precipitated as previously described. The final pellets were resuspended in 20 p.1 10 mM Tris-HCl, pH 6.5.
Evaluation of RT-PCR Products. An aliquot of PCR product ranging from 2-20 pi was mixed with an aliquot of blue juice, loaded onto a 0.8, 1.0, or 1.5% agarose gel containing ethidium bromide, and electrophoresed at 40-55 volts for 1-2 hours. The gel was then photographed with
Polaroid type 667 film.
46 Symptoms observed on A. reptans plants were similar to
the viral symptoms previously described (Shukla and Gough,
1983) . Symptoms on 'Bronze Beauty'' included red and yellow
spots, ringspots, mosaic, and oakleaf patterns (Fig, 3A) .
Symptoms on 'Burgundy Glow', which normally has pink, green
and white variegated leaves, included yellow streaks, mosaic
and oakleaf-like patterns (Fig, 3B). Several samples of the
cultivar 'Rainbow' showed severe mosaic and ringspots (Fig.
3D), and several 'Royalty' samples displayed red, orange or
yellow spots, and ringspots (Fig, 3C), but the majority of
'Royalty' plants were asymptomatic.
None of the 356 A. reptans plants were positive for
TAV, TMV, TSWV, INSV, PVX or the potyviruses as determined by ELISA. Thirty-nine samples were positive for CMV (11%),
13 for TSV (3,7%), 79 for AMV (22.2%), and four samples
(1.1%) were positive for a mixed infection by CMV and AMV
(Table 1), No incidences of a mixed infection by AMV and
TSV or CMV and TSV were detected. In some cases positive results were obtained from asymptomatic plants and in some instances samples collected from plants showing mosaic or ringspot symptoms were negative for all viruses (Table 1) ,
CMV-infected 'Royalty' plants were allowed to produce seed and the resulting seedlings tested for CMV, AMV and TSV by
47 % ' .?» ' m h’IîîiïP'SeiHlBB
Figure 3. Virus symptoms observed on A. reptans cultivars. A. 'Bronze Beauty' showing ringspots, mosaic and oakleaf patterns; B. 'Burgundy Glow' showing mosaic and yellow streaks/oakleaf pattern; C. 'Royalty' showing a concentric ringspot; D. 'Rainbow' showing mosaic and ringspots.
48 Cclfclv f With 017+ AK7+ 0(7 fi TS7+ S o Ho Ho With. ar Taat (%) <%) AK7+ (%) myoptom» synptcns synptccBs ^fnptoDs «d. * (%) (*) OC7+ TSV+ nogativ* (%) (%) (%) for all®
BE 189 88 0 22 0 10 0 11 (5.8%) 8 (4.2%) 32 (17%) C46.5%i (11.6 (5.3 ) %)
3G 27 5 0 22 3 0 0 20 0 0 (18.5%J (81.5 (11%) (74.1%) %)
ROY 36 6 (17%) 35 0 0 0 29 0 0 0 (97.2 (80.5%) %)
?£ 2 : 0 0 0 0 0 0 c (100% )
GR 35 : 0 22 0 3 0 20 (57%) 3 (8.6%) 0 (62.8 (6.6 %J %}
GTY 24 0 0 0 1 (4.2%) 5 (21%) 0 0 (4.2% (20.8 ) %}
SQ 24 0 I 7 1 0 0 6 (25%) 0 0 (4.2% (29%) (4.2% J
SB 6 0 0 0 0 0 0 0 0 0
CG 7 4 0 1 0 0 0 0 0 4 (14.3 (57.1%; %J
MCR 4 0 0 0 0 0 0 0 0 0
AG 2 0 0 0 0 0 0 0 0 0
WSRL 356 1C7 39 79 4 13 30 62 11 36 (30.1%) (11%) (22.2 (1.1% (3.7 (8.4%) (17.4%) (3.1%) (10.1%) %} } %)
Table 1. Summary of symptomatic and asymptomatic A. reptans cultivars tested for CMV, AMV and TSV by ELISA.
33: Bronze Beauty RB : Rainbow SQ: Silver Queen MCR: Mini Crispa Red 3G: Burgundy Glow GR: Green SB: Silver Beauty AG: Arboretum Giant ROY: Royalty GTY: Gaeity CG: Catlin'3 Giant
Mosaic; red, yellow spots; ringspots; oakleaf pattern Negative for all viruses screened
49 ELISA. Sixteen seedlings at the four-leaf stage were
screened and 100% were positive for CMV. Additionally,- two of 16 (11.8%) were positive for a mixed infection by CMV and
AMV, and none of the seedlings were positive for TSV. Only two of the 16 seedlings showed a slight mosaic symptom at the time the plants were tested. One of the symptomatic seedlings was positive for CMV and the other was positive for CMV and AMV. All of the others remained symptomless.
DsRNA analysis of symptomatic and asymptomatic A. reptans 'Royalty^ tissue, and symptomatic A. reptans
'Rainbow' tissue produced a banding pattern consistent with that of CMV and an associated satRNA (Fig. 4)(Dodds et al.,
1984; Valverde et al., 1990). The apparent satRNA was present in all 3 6 'Royalty' samples tested and both
'Rainbow' samples. In addition, dssatRNA was detected in two of the three A. reptans 'Burgundy Glow' samples with a mixed infection by CMV and AMV. To confirm the identity of the apparent satRNA in A. reptans 'Royalty' the purified dsRNA was heat denatured, blorted and probed with DIG- labeled (S)CARNA-5 cDNA. Twenty-nine of the 36 'Royalty' samples were probed and all 29 hybridized to the (S)CARNA-5 probe (Fig. 5). One of the 'Burgundy Glow' samples, positive for dssatRNA, was probed and it reacted faintly
(data not shown). The two A. reptans 'Rainbow' samples were
50 Figure 4. 5% polyacrylamide gel electrophoresis analysis of dsRNA obtained from the CMV-WL isolate in N. henthemiana (lane 1), A. reptans 'Royalty' plant (lane 2), and the TMV common strain in N. tabacum 'Turk' (lane 3). Approximate dsRNA molecular weight markers indicated next to lane 1 (1.5, 2.0 X 10®). Arrow indicates apparent ds satRNA.
51 1 2 3 4 5 6 7 8
Figure 5. Northern blot analysis of heat-denatured dsRNA purified from A. reptans 'Royalty' plants using DIG-labeled (S)CARNA-5 cDNA probe. Lane 1: TMV RNA (negative control). Lane 2: unlabeled (S)CARNA-5 cDNA (positive control). Lanes 3-8: A. reptans 'Royalty' samples. Arrow indicates satRNA band.
52 not probed. Ali 16 A. reptans 'Royalty' seedlings which
were ELISA-positive for CMV were assayed for the presence of
satRNA using RT-PCR. A PCR product corresponding to the
satRNA was detected for all 16 samples. Representative
results are shown in Fig. 6.
N. rustics mechanically inoculated with sap from one
each of A. reptans 'Royalty' and 'Rainbow' never developed
symptoms. N. tabacum 'Glurk', 'Turk', and 'Samsun'
inoculated with 'Royalty' sap developed similar symptoms
ranging from mild mosaic to ringspots to oakleaf to a
systemic line pattern. The line pattern and ringspots were more prevalent on older leaves and often disappeared, while
the mosaic and oakleaf was more prevalent on younger leaves.
N. tabacum 'Glurk', 'Turk', and 'Samsun' inoculated with A.
reptans 'Rainbow' sap developed symptoms similar to those on
the plants inoculated with A. reptans 'Royalty' sap. When
tested for CMV, AMV and TSV by ELISA, several symptomatic N.
tabacum 'Turk' plants inoculated with A. reptans 'Royalty' sap, and several N. tabacum 'Samsun' inoculated with A. reptans 'Rainbow' sap were positive for CMV. However, the majority of tobacco plants showing symptoms were negative for all three viruses. DsRNA analysis of one N. tabacum
'Glurk' inoculated with A. reptans 'Rainbow' sap and showing line pattern symptoms produced several faint bands. DsRNA
53 \ , ■ » .
Figure 6. Reverse transcription polymerase chain reaction (RT-PCR) analysis of A. reptans 'Royalty' seedling samples using primers specific for cucumber mosaic virus (CMV) satellite RNAs. Lanes 1-2: A. reptans 'Royalty' seedling samples. Lane 3: CMV isolate from A. reptans 'Royalty' in N. tabacum 'Glurk' (positive control). Lane 4: double-distilled water (negative control). Lane 5: (S)CARNA-5 cDNA marker (faint band between 0,3 and 0.4 Kb marker) digested from pSP65 plasmid (3,0 Kb band) with EcoRI, and Lane 6: 1 Kb Plus DNA markers. Arrow indicates PCR product between 0,3 and 0,4 Kb marker,
54 analysis of N. tabacum 'Samsun' inoculated with A. reptans
'Rainbow' sap, also with line pattern, produced a CMV-like banding pattern including dssatRNA similar to that shown in
Fig. 4. AN. tabacum 'Turk' inoculated with A. reptans
'Royalty' sap, with systemic line pattern/ringspots, was used to inoculate a series of N. tabacum 'Glurk' plants.
The latter developed systemic line pattern and ringspot symptoms. The symptomatic tissue was tested for CMV and
AMV. Because of the ringspot symptom, the tissue was also tested for TomRSV and TRSV by ELISA. All samples were positive for AMV, but negative for the other three viruses.
The A. reptans 'Royalty' and 'Rainbow' plants used as the inoculum source for this experiment were ELISA-positive for
CMV but negative for AMV.
Discussion
The ELISA results showed that only three of the eight viruses plus the potyvirus screen, tested in this study were detected in the sampled A. reptans cultivars. CMV was found in 11.0%, AMV in 22.2%, TSV in 3.7%, and a mixture of CMV and AMV in 1.1% of the samples. When sorted by cultivar, the results showed that CMV was more prevalent in A. reptans
'Royalty' and 'Rainbow'; AMV in 'Bronze Beauty', 'Burgundy
Glow', and 'Green', and TSV in 'Bronze Beauty' and 'Green'
55 (Table 1).
It has been reported that tobacco plants infected with
AMV often recover from the symptomsand AMV often causes a
symptomless infection in many of its hosts (Jaspars and Bos,
1980). It has also been reported that in tobacco AMV titre
quickly reaches a peak, but then falls off to a very low
level. This low level coincides with recovery from symptoms
(Jaspars and Bos, 1980; Ross, 1940). It is very likely that
a similar phenomenon is occurring in A. reptans as well.
Thus, the number of samples infected with AMV may have been
greater then recorded.
Most of the samples positive for AMV (78.5%), CMV
(77.0%), and TSV (85.0%) were asymptomatic (Table 1). In
contrast, 17% of the 'Bronze Beauty' and 57% of the
'Gatlin's Giant' samples were symptomatic but negative for
all viruses (Table 1) while 17% of the 'Bronze Beauty'
ScLmples showed some sort of symptoms but were negative for
AMV. Possible explanations for these results could be that
the virus titre was too low to detect or that there was an
infection by another, still unidentified, virus.
The situation may be very different in A. reptans
'Royalty', where 30 of 36 (83%) plants were asymptomatic but
35 of 36 (97.2%) were positive for CMV. There are two possible explanations for the number of positive, but
56 asymptomatic, samples. As indicated, a satRNA was found
associated with CMV in A. reptans 'Royalty' and 'Rainbow'
samples. One possible explanation for the high number of
symptomless CMV infections in 'Royalty' could be due to a
symptom moderating effect by the satRNA. It is generally
accepted that there are two main satRNA phenotypes, i.e.,
symptoms induced by the helper virus are either attenuated
or exacerbated by the satRNA (Collmer and Howell, 1992). A
proposed mechanism by which disease attenuation occurs is
that the dssatRNA accumulates to an amount much higher than
would be expected if it was just acting as a template. It
has been proposed that satRNA competes with the helper virus
RNAs for replicases, leading to diminution of virus
replication and disease attenuation (Kaper, 1982). DssatRNA has been shown to accumulate in asymptomatic, systemically
infected tobacco tissue while virions accumulate in
symptomatic tissues. The accumulation of dssatRNA also occurs more often in older leaves while virus accumulation occurs in younger, actively growing tissue, and the presence of ds satRNA in asymptomatic tissue is inversely correlated with the presence of virus particles (Dodds at ai., 1984;
Habili and Kaper, 1981). It is possible that this accumulation of viral and satellite dsRNA, and reduction of infectious particles is what occurred in asymptomatic
57 'Royalty' plants. We have observed that dssatRNA accumulates to high levels in CMV-infected A. reptans
'Royalty' (Fig. 4) and is always recoverable from symptomless tissue, but mechanical transmission of CMV from asymptomatic tissue is difficult, if not impossible. Only
RNAs 1, 2, and 3 of the CMV genome are required for infectivity (Lot et ai., 1974). If the non-infectious double-stranded form (Dodds et ai., 1984) of the CMV genome, along with dssatRNA, is accumulating at the expense of the infectious single-stranded form it could explain the difficulty in transmission, as well as the symptomless infections, as investigators in Australia reported no difficulty in transmitting CMV from Ajuga to indicator hosts
(Shukla and Gough, 1983).
Interestingly, none of the samples tested were positive for TAV, which can also act as the helper virus for CMV satRNAs (Collmer and Howell, 1992). In the case of the two
'Burgundy Glow' plants with a mixed infection by CMV and
AMV, ds satRNA was detected for the first time in this cultivar. Previously we detected CMV genomic dsRNAs, but never dssatRNA in A. reptans 'Burgundy Glow'(Fisher and
Nameth, unpublished).
The results of the mechanical inoculations of tobacco using A. reptans 'Royalty' and 'Rainbow' as inoculum sources
58 indicate that AMV may also be prevalent in those cultivars.
The failure to detect AMV directly in mature 'Royalty' or
'Rainbow' tissue is likely due to low AMV titre (Francki et
al., 1979). The low AMV titre makes it more difficult to
detect AMV without using one or more secondary hosts to
build up the virus titre to detectable levels.
The ELISA results obtained from A. reptans 'Royalty'
seedlings grown from the seed of CMV-infected 'Royalty'
plants suggest that CMV and AMV may be seed transmitted in
this host. Although the plants from which the seeds were
collected were ELISA-positive for CMV and negative for AMV,
several seedlings tested positive for AMV. A more detailed
study will need to be done to determine if seed transmission
is the result of surface-contamination or embryo infection.
Interestingly, the mixed infection by CMV and AMV in two of
the 16 'Royalty' seedlings is the first instance we have
observed of these two viruses being detected together
directly from 'Royalty' tissue. A possible explanation for
these two viruses being detected together could be that the
young collected tissue was actively growing, which
facilitated AMV replication. It has been reported that AMV
titre in tobacco peaks 4-12 days after inoculation and then
rapidly decreases. In older plants (48 days) most of the virus is located in the upper leaves, but the infectivity of
59 sap from these leaves may be as little as 1% of the 4-12 day
infected leaves (Ross, 1940) . The detection of AMV in
'Royalty' seedlings may have been facilitated by the growth
stage of the seedlings.
The RT-PCR results confirmed that the satRNA was also
present in all 16 CMV-infected A. reptans 'Royalty'
seedlings. RT-PCR was an excellent tool for detection of
satRNA in the seedlings because of its sensitivity where
there was very little tissue because of the small size of
the plants.
These results have several implications for the commercial perennial plant grower. First, since A. reptans is an herbaceous perennial, it can serve as a reservoir for
CMV and its satRNA, AMV, and TSV. A. reptans as a virus reservoir becomes even more important when one takes into consideration how many asymptomatic A. reptans samples were positive for CMV, AMV or TSV (Table 1). Since all three of these viruses have an insect vector, the possibility exists of virus spread from asymptomatic A. reptans plants or plantings to nearby perennial stock of the same and other species. Without symptoms to draw the grower's attention, it may appear that all is well. The second implication for the grower is that since A. reptans is propagated largely vegetatively, infected, but asymptomatic, stock plants are
60 possibly being propagated. Propagation of infected stock plants seems possible since we have been unable to locate any source of A. reptans 'Royalty'’ that is "virus-free". It even seems likely that some growers may be propagating cultivars for their striking coloration due to virus infection. Yet a third implication is that the CMV satRNA associated with A. reptans 'Royalty'’, although not causing severe disease in A. reptans, may cause very different symptoms in other hosts. As mentioned previously,- the CMV-
WL helper strain and satRNA together can cause a white leaf syndrome in tomato, but a symptomless infection in tobacco
(Gonsalves et al., 1982). A CMV satRNA is also responsible for a lethal necrosis of tomato (Kaper and Waterworth,
1977). Thus, it is important to be aware of potential sources and reservoirs of CMV and satRNA.
61 CHAPTER 3
PARTIAL CHARACTERIZATION OF A CUCUMBER MOSAIC VIRUS (CMV)
ISOLATE FROM AJUGA REPTANS 'ROYALTY''
Introduction
Since a number of host range and biological variants of
CMV have already been characterized, it was of interest to determine the biological nature of the CMV-Royalty isolate.
Further, since CMV-Royalty has an associated satellite RNA, it was also of interest to determine the disease phenotype of the CMV-Royalty isolate and satRNA.
Materials and Methods
Plant Material
Host Range. Nicotiana rustica, Nlcotlana clevelandil,
Nicotiana tabacum 'Glurk'' and 'Samsun', Vlgna unguiculata
(cowpea), Phaseolus vulgaris (French bean), Cucurhita pepo
'Black Beauty' (squash), Cucurhita pepo (pumpkin), Cucumis sativis (cucumber), and Lycopersicon esculentum 'Peto 696’,
'Nema 1401', and 'Rutgers' (tomato) were used in host range studies of the CMV-Royalty isolate from A. reptans. Squash,
62 pumpkin;- cucumber, French bean and cowpea seeds were sown directly into four inch pots containing sterile soilless growing media (Metro Mix 250, W.R. Grace & Co., Cambridge,
MA) . For each host range study a set of seven pots containing three seeds of each species was planted. The pots were placed in a mist bed and kept for approximately one week until emergence of the cotyledons and one true leaf. Lycopersicon esculentum 'Peto 696' seedlings were kindly provided by Dr. R.M. Riedel (Dept, of Plant
Pathology, The Ohio State University, Columbus, CH.), and were transplanted into eight inch pots containing sterile soilless media one week prior to inoculation. Tomato cultivar 'Nema 1401' and 'Rutgers' seed was sown directly into six-cell packets containing soilless mix, germinated under mist, and transplanted into 4 inch pots prior to inoculation. Nicotiana spp. seed was sown directly into 4 inch pots containing sterile soilless media. Individual seedlings were transplanted into 4 inch pots and grown under mist to the 3-4 leaf stage prior to inoculation.
Inoculum was prepared by grinding symptomatic N. tabacum 'Glurk' or 'Samsun' tissue infected with the CMV-
Royalty isolate in 0.02 M sodium phosphate buffer containing
0.1% (w/v) thioglycollic acid, pH 7.0 at a ratio of 1:10 in
ELISA sample maceration pouches (Agdia Inc., Elkhart, IN) .
63 Alternatively, tissue was ground in 0.03 M sodium phosphate buffer without thioglycollic acid. The inoculum was transferred to a sterile weighing boat and mixed with a small amount of celite (ca. 1% w/v). Squash, pumpkin, cucumber, cowpea, and French bean seedlings were inoculated by dipping small squares of cheesecloth in the inoculum and rubbing it onto the cotyledons. Tomato was inoculated by rubbing inoculum on the cotyledons and true leaves and tobacco by rubbing the inoculum directly onto the true leaves. The inoculum was rinsed from the leaves/cotyledons with ddHzO after approximately 10 minutes to avoid phytotoxicity. For each host range study six plants of each species were inoculated with the CMV-Royalty isolate and one plant mock-inoculated with sodium'phosphate buffer as a negative control. In the case of 'Rutgers^ tomato, ten plants were inoculated with CMV-Royalty plus two buffer mock inoculations. Symptomatic N. tabacum 'Glurk', containing the CMV-Royalty isolate, was ground in 0.03 M sodium phosphate buffer (pH 7.0) and the tomato seedlings inoculated as described above. Following inoculation, the seedlings were placed in a growth chamber (18°C; 12 hour day/night) and observed for symptoms over a 2-4 week period.
The host range study was repeated three times. The
'Rutgers' tomato study was repeated three times with 10
64 plants each, and a fourth replication with 55 seedlings
inoculated with CMV-Royalty plus six buffer controls was
also performed.
Mechanical inoculation of M. clevelandil was repeated
twice. The first replication was done with three plants
inoculated with CMV-Royalty plus one buffer control, and the
second with six inoculated plants plus one buffer control.
At the end of each host range study, tissue samples
from each plant were collected and tested for the presence of CMV by ELISA. Selected symptomatic or ELISA-positive samples were also tested for the presence of viral- associated double-stranded RNA (dsRNA).
Aphid-Transmission
A colony of Aphis gossypll (melon aphid) on pumpkin was kindly provided by Karen Magnuson and Dr. Celeste Welty
(Dept, of Entomology, The Ohio State University, Columbus,
OH.). Three groups of 25 aphids were separated into three petri plates containing a moist piece of filter paper. The aphids were starved for three hours prior to a one minute acquisition feeding period on a symptomatic A. reptans
'Royalty' leaf. The aphids were then transferred to three week old Nicotiana tabacum 'Glurk', N. benthamlana, N. rustica, and N. clevelandil seedlings. Nine seedlings of each species (three seedlings per four-inch pot) were
65 inoculated with at least two, and up to three aphids per
seedling. Three seedlings of each species were mock-
inoculated with aphids that were starved prior to feeding
but had no acquisition feed. Aphid instars were used since
CMV is transmissible by all instars (Francki et al., 1979).
The seedlings were placed in a mist bed and reinoculated the
next day following the same procedure. Approximately 30
days after inoculation seedlings were transplanted into
individual four inch pots and observations made over the
next several months. ELISA was used to test for CMV, AMV,
TSV and TAV. Nicotiana tabacum 'Samsun'' and N. tabacum
'Glurk' were aphid-inoculated as above using a second A. reptans 'Royalty' plant as inoculum. Three groups of five aphids each were acquisition fed on three different Royalty leaves. Two plants of each cultivar, approximately 6-8 inches tall, were inoculated with a total of 15 aphids, five each from each of the three leaves. One N. tabacum 'Glurk' was mock aphid-inoculated. The aphids were allowed to feed on the tobacco for 30 minutes before the plants were transferred to the mist bed. Observations were made over the next several months.
Virus Isolates
The tomato white leaf isolate (CMV-WL) used for comparison of dsRNA profiles was kindly provided by Dr.
66 Dennis Gonsalves, Cornell University. Lyophilized tobacco
tissue containing CMV-Fny and CMV-Q was kindly provided by
Dr. Keith Perry, Purdue University.
Virus Purification
CKV was purified using a modification of the protocol
of Lot at al. (Lot et al., 1972).
Extraction. Each 100 g of symptomatic leaf tissue was
extracted in a blender with 100 ml cold citrate buffer (0.5
M sodium citrate, 5.0 mM EDTA, 0.5% (w/v) thioglycollic
acid, pH 6.5). The extract was emulsified in the blender with an equal volume (w/v) of cold chloroform and the
emulsion transferred to sterile 250 ml centrifuge bottles.
The emulsion was centrifuged at 12 X g (8890 rpm in SLA 1500 rotor; Sorvall Superspeed RC5C Automatic Refrigerated
Centrifuge, DuPont, Wilmington, DE) for 10 minutes, the supernatant collected using a sterile serological pipette, and placed in a sterile beaker. Polyethylene glycol (PEG, mol. wt. 8,000) was added to 10% (w/v) to the buffer phase and the mixture stirred gently for 40 minutes by placing a stir plate in the refrigerator (4°C) . The preparation was centrifuged at 12 X g for 10 minutes and the pellet resuspended overnight in 40 ml borate buffer (5.0 mM sodium tetraborate, 0.5 M EDTA, pH 9.0) on a stir plate at 4°C.
Triton-X 100 was added to 2% (v/v) and the preparation
67 stirred for 30 minutes.
Clarification. The preparation was clarified by-
centrifugation at 19,000 X g (11,190 rpm in SLA 1500 rotor)
for 15 minutes. The supernatant fraction was centrifuged at
75,000 X g (29,000 rpm in 75Ti rotor; Beckman L8-M
ultracentrifuge) for 2.5 hours. Pellets were resuspended
over night on a stir plate (4°C) in 1 ml borate buffer,
combined into a single bottle, and subjected to a low speed
centrifugation at ca. 5000 X g (7000 rpm in 75TI rotor) for
10 minutes. The supernatant fraction was collected and
centrifuged as above (2.5 hours at 75,000 X g) or alternatively 50,000 rpm (2 hours at 223,160 X g). The
final pellet was resuspended overnight on a stir plate (4°C)
in 1 ml borate buffer.
Sucrose gradient centrifugation. The virus was further purified by layering the entire 1 ml preparation on a 10-40% sucrose gradient. Gradients were prepared by dissolving the sucrose in borate buffer and layering the solutions in centrifuge tubes (Beckman 1 X 3,5" tubes, 25 X
89 mm, Beckman Inc., Palo Alto, CA. ) using a hypodermic needle and syringe. The gradients were centrifuged for 90 minutes at 130,000 X g (26,000 rpm in SW28.1 rotor) and the virus band visualized under oblique light. The virus was removed from the gradient by puncturing the wall of the tube with a sterile hypodermic needle/syringe and drawing out the
68 light-scattering band. The solution was placed in an
ultracentrifuge tube, diluted to greater than 1:5 with
borate buffer, and centrifuged for 2 hours at 50,000 rpm in
75Ti rotor to pellet the virus. The final pellet was
resuspended in 0.5-1.0 ml borate buffer overnight on a stir plate (4°C) .
Transmission Electron Microscopy
A five pi drop of purified virus preparation was pipetted onto a formvar-coated copper EM grid and incubated
for 1-2 minutes at room temperature. The virus was then drawn off with a wedge of filter paper and the preparation negatively stained with five pi uranyl acetate (2% w/v) for one minute. The stain was drawn off as described and the virus observed using a transmission electron microscope
(TEM) (EM 300 Transmission Electron Microscope (60 kV) ;
Philips Electronics Instruments ; New Jersey) .
Protein Analysis
Sample Dénaturation. Virus was denatured by mixing 40 pi of purified virus preparation with an equal volume of sample dénaturation buffer (Appendix C), boiled at 100°C in a water bath for 3 minutes and chilled on ice. Tracking dye
(Appendix C) was added to 10% (v/v) and thoroughly mixed.
SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) . Five to 20 pi of denatured protein sample were loaded on discontinuous SDS-PAGE mini-gels (5%
69 stacking/10% resolving; Appendix C) and electrophoresed at
100-125 volts for 1-2 hours. The gels were stained with
Coomassie Brilliant Blue fixing/staining solution (Appendix
C) for 1-4 hours on an orbital shaker, destained overnight
in destaining solution (Appendix C ), and placed in gel
drying solution (Appendix C) for 15 minutes. Cellophane
sheets were equilibrated in drying solution, or ddHoO, and
the gel sandwiched between two sheets and mounted in a gel-
drying frame (Biodesigns Inc. of New York; Carmel, NY.).
The gels were allowed to dry at room temperature (25°C) for at least two days.
Western Transfer and Immunological Detection. Protein samples were denatured and electrophoresed on discontinuous
SDS-polyacrylamide gels as previously described. The stacking gel was cut off using a razor blade and the resolving gel soaked in wetting buffer [50 mM Tris-HCl, pH
7.5, 1% (w/v) SDS] for one hour. Six pieces of filter paper and a piece of 0.2 pm nitrocellulose membrane were cut to the same size as the gel. The filter paper, nitrocellulose, gel, and 4 fiber pads were soaked in transfer buffer [25 mM
Tris-HCl, 192 mM glycine, 20% (v/v) methanol] for 15 minutes. One fiber pad was placed in the transfer cassette
(Bio-Rad Mini Trans-Blot electrophoretic transfer cell) followed by three filter papers, the gel, the nitrocellulose membrane, three filter papers, and the second fiber pad.
70 The cassettes were closed and loaded into the transfer cell
such that the gel was closest to the negative electrode and
the membrane closest to the positive electrode. The cell was placed in the buffer tank,, the tank filled with transfer buffer,, and electrophoretic transfer allowed to proceed overnight at ca. 30 volts (ca. 4 0 mA) at 4°C with constant
stirring. The membrane was blocked for one hour at room temperature in blocking buffer [20 mM Tris, 500 mM NaCl, pH
7.5 (TBS), 5% w/v non-fat dry milk, 0.02% w/v sodium azide), washed three times for five minutes in washing buffer (TBS,
0.1% w/v non-fat dry milk, 0.02% w/v sodium azide], and incubated for two hours at room temperature with mouse anti-
CMV subgroup I or subgroup II monoclonal antibodies (Agdia,
Inc.) diluted 1:200 in antibody dilution buffer (TBS, 0.05% v/v Tween-20, 1% w/v non-fat dry milk, 0.02% w/v sodium azide). The membrane was washed three times as described, and incubated for one hour at room temperature in rabbit anti-mouse alkaline phosphatase-conjugated antibodies
(Agdia, Inc.) diluted 1:200. Enzyme substrate solution was prepared by mixing 1 ml NBT (30 mg nitro blue tétrazolium in
1 ml 70% v/v N,N dimethyl-formamide) with 1 ml BCP (15 mg 5- bromo-4-chloro-3-indolyl-l-phosphate in 1 ml N,N dimethyl- formamide) in 100 ml alkaline buffer (100 mM Tris-HCl, pH
8.8, 20 mM MgClg) just prior to use. Following three washes, the membrane was incubated in substrate solution in
71 the dark under gentle agitation until bands developed. The
reaction was stopped by washing several times in ddH^O and
results documented by scanning the membrane.
Reverse Transcription Polymerase Chain Reaction (RT-PCR)
RT-PCR was carried out as described in Chapter 2 except that purified dsRNA was used as template in RT-PCR reactionsr and the PCR products were then used for cloning.
DsRNA was extracted and purified as previously described.
The final dsRNA pellet was resuspended in 10 mM Tris-HCl, pH
7.35 and quantified spectrophotometrically at 260 nm. 2 pi dsRNA (ca. 150 ng) was used as template for first strand synthesis. The two-step RT and PCR reactions were carried out as described in Chapter 2.
Cloning of RT-PCR Products
Competent Cell Preparation. A five ml culture of E. coll strains DH5a or HBlOl was grown in LB broth without ampicillin at 37°C overnight on a shaker. Two ml of overnight culture was subcultured into 100 ml of LB broth without ampicillin and grown for approximately three hours at 37*^C on an orbital shaker until the ODgoo was approximately 0.4. The cells were iced for one hour, centrifuged at 1500 rpm in an SS34 rotor for 15 minutes, and gently resuspended in 25 ml cold 100 mM MgSO^, 50 mM Tris
(pH 7.3)on ice. The cells were again centrifuged at 1500
72 rpm for 15 minutes and gently resuspended in 2.5 ml cold 100 mM CaCl2 /- 50 mM Tris, 20% (v/v) glycerol (pH 7.3) . The cells were placed on ice overnight, divided into 200 pi aliquots and stored at -70°C. The competency of the cells was tested by transforming a 200 pi aliquot with undigested
Bluescript plasmid DNA, and plating out the cells on LB agar containing ampicillin.
Preparation of Bluescript Plasmid for Blunt-End
Ligation. Plasmid was isolated from E. coli using the large scale plasmid isolation protocol described in Chapter 2,
Ten pi of plasmid DNA (ca. 10 pg) was mixed with five pi lOX
Smal buffer (33 mM Tris acetate, 66 mM potassium acetate, 10 mM magnesium acetate, 0.5 mM DTT; pH 7.0), 33 pi sterile ddHjO, and two pi (10 U/pl) Smal restriction endonuclease to give a 50 pi final volume. The reaction was incubated at
30°C for two hours in a water bath, extracted with an equal volume of phenol: chloroform, extracted with an equal volume of chloroform, and precipitated with 0.1 volume 3 M sodium acetate (pH 5.5) and 2-3 volumes of 95% ethanol as previously described. The final pellet was resuspended in
20 pi IX TE buffer, 0.1 volume electrophoresed on a 1% agarose gel to evaluate the preparation, and the DNA quantified at À260. A dilution series of 1:10, 1:50, and
1:100 was also prepared by diluting the plasmid DNA in ddHzO
73 and evaluating the preparations on a 0.8% agarose gel. The plasmid was not dephosphorylated since it was to be used for blunt-end ligations.
Preparation of PCR Products for Ligation. PCR products were purified from primers, nucleotides and enzyme using a
QIAquick PCR purification kit (QiaGen Inc., Santa Clarita,
CA.) as per the manufacturers instructions. Thirty |il of
PCR product (pH <6.5) was mixed with five volumes of buffer
PB, placed in a QIAquick spin column and centrifuged at
13,000 rpm in a benchtop microcentrifuge for one minute.
The spin-through was discarded, the column washed with 750 y.1 buffer PE by centrifugation at 13,000 rpm for one minute, and the spin-through discarded. The column was eluted by the addition of 50 pi 10 mM Tris-HCl (pH 8.75) by centrifugation as described, and the eluate collected in a new 1.5 ml microfuge tube. The fill-in reaction using the
Klenow fragment of E. coli DNA polymerase I to obtain blunt ends was done in a 0.5 ml microfuge tube. Forty pi PCR product was mixed with six pi REACT2 buffer (50 mM Tris-HCl; pH 8.0, 10 mM MgCl?, 50 mM NaCl; Gibco : BRL Inc.), 10 pi sterile ddH^O, two pi 0.5 mM dNTP mix, and two pi Klenow enzyme [diluted to 0.5 U/pl in Klenow dilution buffer (50 mM potassium phosphate; pH 7.0, 100 mM KCl, 1 mM dithiothreitol, 50% w/v glycerol)] in a 60 pi volume. The
74 reaction was incubated on ice for 30 minutes, extracted with
phenol:chlorofoma, precipitated as previously described, and
the final pellet resuspended in 30 ul 10 itiM Tris-HCl, pH
7.35. Five pi of fill-in reaction product was evaluated on
a 0.8 or 1.0 % agarose gel to visually estimate the quantity
of DNA.
Ligation of PCR Product into Bluescript Plasmid. Insert
DNA was mixed with plasmid DNA at a molar ratio of 3:1 such
that 21 pi PCR product was mixed with 1.5 pi Bluescript,
three pi 5 mM ATP, three pi lOX ligation buffer [1 M Tris, pH 7.6; 1 M MgClj, 1 M DTT, 10 mg/ml bovine serum albumin
(ESA), 0.15 M hexamine cobalt chloride], and 1.5 pi high
concentration T4 DNA ligase (diluted to 200 U/pl in 50 mM
Tris-HCl, pH 7.8; 10 mM MgCl,, 10 mM DTT, 1 mM ATP, 50 pg/ml
ESA) (New England Eiolabs, Beverly, MA. ) in a 30 pi volume.
Control ligations were also performed using only plasmid DNA digested with Smal. The reaction was placed in the thermal cycler and incubated at 15°C overnight. The T4 ligase was not heat-inactivated following the reaction incubation and the ligation reaction products were used directly to transform competent cells.
Transformation Procedure. Ten pi of ligation reaction
DNA was added to 200 pi competent E. coli HElOl or DH5a cells on ice. The cells were iced for 30 minutes and
75 placed in a 42'^C water bath for two minutes. Eight hundred
y.1 LB broth/, without ampicillin^ was added to the cells and
the mixture incubated at 37°C for 1.5 to 2 hours on an
orbital shaker. Two hundred pi aliquots were plated out on
LB-agar + ampicillin + Xgal, and the plates incubated at
37"^C overnight. White colonies were evaluated using the
small scale plasmid isolation procedure below.
Small Scale Plasmid Isolation. Overnight cultures of
transformed cells were grown in liquid LB containing
ampicillin, and 1.5 ml of the culture centrifuged at 13,000
rpm in a benchtop microcentrifuge to pellet the cells. The pellets were resuspended in 100 pi lysis buffer (50 mM glucose, 10 mM EDTA, 25 mM Tris; pH 8.0) by vortexing, and incubated for five minutes at room temperature. Two hundred pi of 0.2 M NaOH and 1% (w/v) SDS were added, the tube contents gently mixed until clear, and the tubes placed on ice for five minutes. One hundred-fifty pi of cold 3M potassium acetate was added, and the tube contents gently mixed until "chunky". The tubes were placed on ice for five minutes, centrifuged at 13,000 rpm for five minutes, and the supernatant fraction removed and placed in a clean 1.5 ml centrifuge tube. The DNA was extracted by adding an equal volume of phenol: chloroform (1:1), vortexing briefly, centrifuging briefly, and removing the supernatant fraction to a clean 1.5 ml tube. An equal volume of chloroform was
76 added, the mixture vortexed and centrifuged briefly, and the supernatant fraction transferred to a clean 1.5 ml tube. To pellet the DNA, one ml cold 95% ethanol was added to the supernatant and the mixture centrifuged at 13,000 rpm for 15 minutes in a benchtop microcentrifuge. The pellets were air-dried and resuspended in 30-40 ^l IX TE buffer containing 40 y.g/ml RNAse A, and 2.5 p.1 plasmid DNA digested with HindiII and Xbal restriction endonucleases.
Digestion of oBluescript Plasmid With Hindlll and Xbal
Restriction Endonucleases
To a sterile 0.5 ml PCR tube 5.5 pi sterile ddHjO, 1.0 pi lOX REACT2 buffer (50 mM Tris-HCl; pH 8.0, 10 mM MgCl,,
50 mM NaCl; Gibco:BRL Inc.), 2.5 pi mini-prep plasmid DNA,
0.5 pi HindiII and 0.5 pi Xbal (10 U/pl) were combined and mixed for a 10 pi final volume. The mixture was incubated in a water bath for one hour at 37°C, 5 pi "blue juice" mixed, and the entire volume evaluated by electrophoresis in a 1% agarose gel (55 volts for one hour).
Cloning of cDNAs Synthesized From Gel-Purified CMV-Royalty
ds satRNA Template
CMV-Royalty dsRNA was purified from N. tahacum 'Glurk' as previously described. DsRNA was electrophoresed in a
0.8% agarose gel for one hour, the dssatRNA band cut from
77 the gel,^ and the agarose fragment processed through an agarose spin-through column (Supelco Inc.) in a benchtop microcentrifuge for 10 minutes at top speed (13,000 rpm).
The ds satRNA band isolate was precipitated in a 1.5 ml microfuge tube with 1/20 volume 3 M sodium acetate (pH 5.5) and 1 ml 95% ethanol, placed at -20°C for 15 minutes, and repelleted by centrifugation at 16,000 rpm in a SS34 rotor for 20 min. The pellet was washed in 70% ethanol for 5 minutes, air dried, and resuspended in 25 y.1 10 mM Tris-HCl, pH 7.35. One fifth volume of band isolated ds satRNA was electrophoresed in a 1% agarose gel to visually estimate the concentration.
New primers were synthesized (Integrated DNA
Technologies; Coralville, lA) , the lyophilized DNA resuspended in 2 00 p.1 sterile ddH^O as described in Chapter
2 and the working solutions further diluted to 100 ng/pi in ddHgO. The primer sequences used were the same as those used for the reverse transcription reaction described in
Chapter 2 (primers 3+4) .
First-Strand Synthesis. Three 0.5 ml PCR tubes were each prepared with 9 pi (ca. 675 ng) ds satRNA template, 1 pi (0.1 pg/pl) forward primer (primer 3), 1 pi (0.1 pg/pl) reverse primer (primer 4), and 1 pi random hexamers. The tubes were placed in a thermal cycler and the mixtures heated to 94°C (4 min.), 50°C (5 min.), 42°C (5 min.), and
78 held at 4^C. Four 5X first strand buffer, and 1 pi 10 mM
dNTP stock were added to the reaction mixtures, the mixtures heated to 42°C (2 min.), and 1 ul (200 units) Superscript II reverse transcriptase added. The completed reaction mixtures (20 pi volumes) were then incubated at 42°C in the thermal cycler for one hour.
Second-Strand Synthesis. 92 pi DEPC treated ddHjO, 32 pi 5X second strand buffer [94 mM tris-HCl; pH 9.6, 453 mM
KCl, 23 mM MgCl,, 750 mM p-NAD, 50 mM (NHJ gSOJ , 3 pi 10 mM dNTP, 6 pi 0.1 M DTT, 2 pi E. coli DNA ligase (7.5 U/pl), 4 pi E. coll DNA polymerase I (10 U/pl), and 1 pi E. coll
RNase-H (2 U/pl) were added directly to the first strand reactions and thoroughly mixed. The mixtures were incubated at 16°C for two hours in the thermal cycler, 2 pi (5 U/pl)
T4 DNA polymerase added, and the reactions incubated at 16°C for an additional 10 min. 2 pi RNase-A (1 mg/ml) were added to the reactions and the mixtures incubated at 37°C for two min. The three reaction mixtures were combined into a single tube, extracted twice with an equal volume of 1:1 phenol: chloroform, extracted with an equal volume of chloroform, and precipitated with 0.1 volume 3M sodium acetate (pH 5.5) and 1 ml 95% ethanol as previously described. The cDNA was pelleted by centrifugation, washed with 7 0% ethanol as described, and resuspended in 25 pi 10
79 itiM Tris-HCl, pH 6.4. The cDNA was purified from nucleotides
and primers using the QiaQuik PCR cleanup kit as described
previously, and 0.1 volume evaluated on a 1% agarose gel.
Ligation of cDNA into Bluescript Plasmid. pBluescript
was prepared for blunt-end ligation as previously described.
Ligations, including controls, were performed essentially as
described above except they were done in 20 p.1 volumes. An
approximate 1:1 molar ratio was used such that 13 pi cDNA
was mixed with 2 pi vector, 2 pi 5 mM ATP, 2 pi lOX ligation
buffer, and 1 pi 1:10 high concentration T4 DNA ligase as
described above. Ligations were performed at 15°C for 16
hours in a thermal cycler and the ligation products used
directly to transform competent E. coll DH5a as described
above. 10 pi of ligation product were used per 200 pi of
cells. The transformed cells were plated on LB agar
containing ampicillin and Xgal and white colonies screened
for putative inserts using the small scale plasmid isolation
procedure described above. Clones with putative inserts of
interest were prepared for sequencing using the Promega
WizardPlus Mini Prep DNA Purification kit (Promega Corp.,
Madison, WI) as per the manufacturers instructions, and the
DNA purity and quantity assessed spectrophotometrically at
■ ^ 260/280 •
80 Southern Hybridization Using DIG-Labeled (S)CARNA5 cDNA
Probe.
DIG-labeled (S)CARNA-5 cDNA probe was prepared as
described in Chapter 2. Following electrophoresis in 1 or
1.5% agarose gels, RT-PCR products or cDNA inserts excised
from plasmids were chemically denatured by soaking the gel
for 45 minutes in several volumes of 1.5 M NaCl, 0.5 N NaOH
with gentle agitation. The gel was rinsed in ddH^O,
neutralized in several volumes of 1 M Tris (pH 7.4), 1.5 M
NaCl for 30 minutes under constant agitation, the solution
changed, and the gel soaked for 15 minutes longer (Sambrook
et ai., 1989). Capillary transfer of the nucleic acids to a
nylon membrane, hybridization, and immunological detection
were performed as described in Chapter 2.
DAS-ELTSA
Tissue was prepared for ELISA testing, and ELISA
carried out as described in Chapter 2. In the case of
Nicotiana sp., Phaseolus sp., Vigna sp., Cucumis sp.,
Cucurhita spp., and L. esculentum cultivars, healthy tissue controls were prepared as previously described using plant material grown from seed.
DsRNA Analysis
DsRNA extraction, purification and analysis was carried out as described in Chapter 2.
81 Results
Aphid Transmission
Mild mosaic symptoms first appeared on Nicotians
rustics and N. tsbacum 'Glurk' approximately five weeks
after aphid-inoculation by the melon aphid {Aphis gossypll).
As the plants developed, the symptoms developed into more
severe mosaic and leaf puckering on younger N. rustics
leaves (Fig. 7), and vein clearing and mild mosaic on
younger N. tsbscum 'Glurk' leaves (Figs. 8,9). N.
benthsmlsns seedlings were stunted compared to the mock-
inoculated controls, but showed no other symptoms, and no
symptoms developed on N. clevelsndll seedlings. Tissue from each of the three seedlings in each of the three pots of
inoculated tobacco {N. tsbscum 'Glurk', N. rustics, N.
clevelsndll) was collected, and the composite samples from each pot tested for CMV and TMV by ELISA. All plants were screened for TMV as a precaution because of its presence in the greenhouse. CMV was detected in all three N. rustics composite samples, and two of three N. tsbscum 'Glurk' composite samples. CMV was not detected in any of the N. clevelsndll samples, and TMV was not detected in any of the samples. The N. benthsmlsns were too small to test. No symptoms developed on any of the mock-inoculated negative control plants. The individual seedlings from each pot of
82 -s:::
Figure 7. Symptoms on N. rustica approximately five weeks after aphid-inoculation with CMV from A. reptans 'Royalty'’ using the melon aphid. A: mild vein-clearing symptom on younger leaves followed by B: leaf puckering and mosaic symptom.
83 Figure 8. Mild mosaic and mild veinal chlorosis appearing on youngest N. tahacum 'Glurk'' leaves approximately five weeks following aphid-inoculâtion with CMV from A. reptans 'Royalty' .
84 N. tabacum Glurk CMV (Royalty-1 isolate)
Figure 9. Mild mosaic (left) and mild vein clearing (right) symptoms on N. tabacum 'Glurk'' aphid-inoculated with CMV from A. reptans 'Royalty'.
85 N. rustica and N. tahacum 'Glurk' were transplanted into
separate pots and each individual plant retested for CMV,
AMV, TSV, and TAV by ELISA. Seven of nine N. rustica and
two of nine N. tabacum 'Glurk' plants were positive for CMV,
and all plants were negative for AMV, TSV and TAV.
Symptomatic W. rustica tissue was collected and used for
virus purification. CMV-Royalty was maintained in tobacco
'Glurk' and 'Samsun' . Symptoms on N. tabacum 'Samsun' were
similar to those observed on 'Glurk' (Fig. 10).
Host Range
Symptoms on 'Black Beauty' squash began to develop
approximately seven days post-inoculation and began as
chlorotic spots and veinal chlorosis at the base of the leaf
near the petiole (Figs. 11,12). The symptoms varied in
severity from leaf to leaf, and became progressively more
severe over a 28 day period but did not kill the plants
(Figs. 13,14,15). Symptoms on cucumber were similar to
those observed on 'Black Beauty' squash, but were milder and
took longer to develop. The first symptoms appeared at
approximately 10-12 days post-inoculâtion, and began as a
very mild mosaic, followed by vein clearing where the leaf meets the petiole (Figs. 16,17,18).
86 N. tabacum 'Samsun’ CMV-Royalty Isolate
Figure 10. N. tabacum 'Samsun' mechanically inoculated with CMV-Royalty, showing mosaic and veinal chlorosis symptoms.
87 Squash ‘Black Beauty’ Squash ‘Black Beauty’ B u ffe r R u b CMV (Royalty-1 isolate) 10 days
Figure 11. Buffer mock-inoculâtion (left) and chlorotic spots (right) on 'Black Beauty' squash 10 days after inoculation with the CMV-Royalty isolate.
88 eauty’ CMV isolate) 10 days
Figure 12. Chlorotic spots on 'Black Beauty^ squash 10 days after inoculation with the CMV-Royalty isolate.
89 Squash Black Beauty Squash Black Beauty' CMV (Royalty-1 isolate) Buffer Rub 14 days
Figure 13. Symptoms on 'Black Beauty'' squash 14 days after inoculation with the CMV-Royalty isolate.
90 si
fash ‘Black Beau! CMV (Royalty-1 isolate)’ 28 days
Figure 14. Mosaic and vein clearing symptoms on 'Black Beauty' squash 28 days after inoculation with the CMV- Royalty isolate. Leaf in upper left corner is a control plant.
91 Figure 15, Mosaic and vein clearing symptoms on 'Black Beauty'' squash 28 days after inoculation with the CMV- Royalty isolate.
92 C u c u m b e r C u c u m b e r B u ffe r R ub CMV (Royalty-1isolate) 10 days
Figure 16. Cucumber 10 days after buffer mock-inoculation (left) and inoculation with the CMV-Royalty isolate (right)
93 Cucumber Cl Buffer Rub CMV (Royal 14 days
Figure 17, Buffer mock-inoculation (left) and mild symptoms on cucumber 14 days after inoculation with the CMV-Royalty isolate (right).
94 Cucumber CMV (Royalty-1 isolate) 28 days
Figure 18. Symptoms on cucumber 28 days after inoculation with the CMV-Royalty isolate.
95 Symptoms on pumpkin developed approximately 13-14 days post
inoculation. The symptoms were similar to those observed on
cucumber, but were milder. The symptoms on 'Black Beauty''
squash were the most severe, milder on cucumber, and still
milder on pumpkin.
Very few, if any, local lesions developed on inoculated
cowpea cotyledons, and no systemic infections developed. No
symptoms were observed on French bean or 'Peto 696' and
'Nema 1401' tomato. ELISA confirmed the presence of CMV in
symptomatic squash, cucumber, and pumpkin plants. ELISA
also showed that none of the asymptomatic cowpea, French bean, or 'Peto 696' or 'Nema 1401' tomato plants were
systemically infected with CMV. The results of three
replications of the host range study were similar and a summary is presented in Table 2.
A host range experiment using 'Rutgers' tomato was performed as for the other two tomato cultivars, and several asymptomatic 'Rutgers' plants tested positive for CMV subgroup I by ELISA. Five of 10 inoculated plants tested positive for CMV in the first replication, but none tested positive in the second replication. All of the plants in the second replication were retested one week after the initial ELISA and the previous negative results were confirmed. One of ten inoculated plants from the third replication tested positive for CMV by ELISA. All five of
96 Host 7 days lOdays 14 days 21 days CMV* TSV*
'Black CS:MM MK—MDM: MDM: VC SM + -- Beauty' CS Squash
Cucumber MS MM MM: mild MDM -- VC
Pumpkin MS MS MM: mild MM + - - VC
Co’rfpea possible NC NC NC -- - LL (very few)
Bench NS MSMS MS - - - bean
Tomato, MS MSMS MS CVS'Peto 696', 'Nema 1401 '
Tcmato NSMS NS MS - NT NT 'Rutgers'
MSMSMMMM -t NT NT clevelandii
Table 2. Summary of host range results and ELISA results of host range plants tested for cucumber mosaic (CMV) ,• alfalfa mosaic (AMV), and tobacco streak (TSV) viruses.
MM: mild mosaic MDM: moderate mosaic SM: severe mosaic CS: coalescing chlorotic spots VC: vein clearing/ veinal chlorosis LL: local lesions NS: no symptoms NC: no change NT: not tested
ELISA results for CMV, AMV, and TSV.
97 the CMV-positive 'Rutgers'" plants from the first
replication, and the one plant from the third replication
initially appeared asymptomatic (Fig. 19) . After
approximately 45 days one plant ELISA-positive for CMV
developed a very mild mosaic symptom and was slightly paler
in color than the controls. After approximately 50-52 days
the new leaflets on this plant began to show a slight
distortion (Fig. 20). The other four CMV-positive 'Rutgers' plants from the first host range experiment, and one from
the third experiment, remained symptomless. A fourth
replication was done with 55 'Rutgers' tomato seedlings at
the cotyledon stage inoculated with CMV-Royalty, and six buffer mock inoculations. The plants were grown under mist
for 30 days and tested for CMV by ELISA. Forty eight of the
55 plants tested positive for CMV. One CMV-positive plant showed a slight leaf distortion similar to that shown in
Figure 20. All others were asymptomatic.
N. clevelandii mechanically inoculated with CMV-Royalty developed a very mild mosaic symptom approximately 14 days post-inoculâtion (Fig. 21). The symptom either remained very mild or disappeared after 28 days. The presence of CMV was confirmed by ELISA in all three plants from the first replication and five of six plants from the second replication.
98 A
Lycopersicon esculentum ’R utgers' Lycopersiconesculentum R u tg ers’ Buffer control CMV-Royalty isolate 30 days
Figure 19. Asymptomatic tomato 'Rutgers'’ 30 days after inoculation with the CMV-Royalty isolate (right), positive for CMV as confirmed by ELISA. Buffer mock-inoculated control is on the left.
99 Figure 20. Tomato 'Rutgers' leaflets showing mild distortion approximately 50 days after inoculation with the CMV-Royalty isolate. Presence of CMV confirmed by ELISA-
100 Nicotiana clevelandii CMV-Royalty isolate 14 days
Figure 21. Nicotiana clevelandii showing very mild mosaic (right) symptom 14 days after inoculation with the CMV- Royalty isolate. Buffer control (left).
101 DsRNA analysis of selected symptomatic squash and
cucumber samples from the host range studies revealed a
dsRNA banding pattern consistent with that of CMV and an
associated satellite RNA (Dodds et al., 1984; Valverde et
al., 1990). The dssatRNA accumulated to a higher level in
'Black Beauty' squash than in cucumber (Fig, 22) .
No evidence of dsRNAs was obtained from asymptomatic
'Peto 696' and 'Nema 1401' tomato samples (Fig. 22). All
six 'Rutgers' tomato plants from the first three
inoculations which were ELISA-positive for CMV were analyzed
for the presence of dsRNA. Five of the six plants produced a dsRNA banding pattern consistent with that reported for
CMV and an associated satRNA (Dodds et al., 1984; Valverde at al., 1990). The sixth plant produced a banding pattern that lacked the dssatRNA. The five plants which produced the dsRNA banding pattern that included the dssatRNA were all asymptomatic. The plant that produced the dsRNA banding pattern lacking the dssatRNA showed mild mosaic and slight leaf distortion of the young leaflets (Fig. 20). The plants from which the dsRNA was purified are shown in Figure 23, and the dsRNA profiles obtained from those plants shown in
Figure 24. CMV-positive plants from the fourth 'Rutgers' host range replication were not analyzed for dsRNA.
102 Figure 22. 10% polyacrylamide gel electrophoresis of dsRNA extracted from host range samples. Lane 1: asymptomatic 'Peto 696' tomato; lane 2: symptomatic cucumber; lane 3: symptomatic 'Black Beauty' squash; lane 4: CMV-Royalty isolate in W. tabacum 'Glurk'. Arrow indicates double-stranded satRNA band.
103 D
Figure 23, Tomato 'Rutgers' inoculated with the CMV-Royalty isolate, from which dsRNA was extracted. A: sample T-215-4 (asymptomatic), B: sample T-215-6 (asymptomatic), C: sample T-215-8 (mild mosaic and leaf distortion),and D: sample T- 215-BR (buffer mock-inoculation).
104 Figure 24. dsRNA analysis of L. esculentum 'Rutgers' inoculated with CMV-Royalty isolate. Lane 1: CMV-Royalty dsRNA extracted from N. tahacum 'Glurk' used as a marker. Lane 2: 'Rutgers' sample T215-4 from asymptomatic plant. Lane 3: 'Rutgers' sample T215-6 from asymptomatic plant. Lane 4: 'Rutgers' sample T215-8 from plant showing mild mosaic and mild leaf distortion, and Lane 5: 'Rutgers' buffer mock-inoculated negative control. Arrow indicates dssatRNA band.
105 Virus Purification
Purification of the CMV-Royalty isolate from aphid- inoculated N. rustica produced a single light-scattering band in 10-40% sucrose density gradients (Fig. 25). The light-scattering band was removed from the gradient, high speed centrifuged, and the resuspended pellet used to inoculate N. tabacum 'Glurk^. The CMV-Royalty isolate was maintained in N. tahacum 'Glurk' which has the N-gene from
N. glutinosa conferring resistance to TMV, and N. tahacum
'Samsun'. Infected 'Glurk' was used as the source for further purifications of CMV-Royalty and purification of
CMV-Fny and CMV-Q, 'Glurk' was used as the host. ELISA showed the purified preparations of CMV-Royalty were free of
AMV and TSV.
The 260/280 nm absorbance ratio of the semi-purified
CMV-Royalty was 1.45 (uncorrected for light scattering), and of CMV-Fny 1.53 (uncorrected) . The published Agao/A^ao for
CMV is ca. 1.7 (corrected for light scattering)(Francki et al., 1979). The semi-purified preparations were then used for electron microscopy, SDS-PAGE, and Western blot analysis.
106 Figure 25. Purified CMV-Royalty isolate in 10-40% sucrose density gradient ultracentrifuged at 130,000 X g (26,000 rpm in SW28.1 rotor) for 90 minutes. Arrow indicates light- scattering band.
107 Transmission Electron Microscopy
TEM using CMV-Royalty purified from N. tabacum 'Glurk'’
revealed spherical particles (Figs. 26^27). Particles of
CMV-Fny purified from 'Glurk'' appeared similar, and the
particles of the two isolates were indistinguishable when
mixed together (Fig. 28). To estimate the size of the CMV-
Royalty particles, the diameter of 100 CMV-Royalty and width
of 50 TMV (ATCC common strain) particles were measured from
micrographs of purified virus (187,500 X magnification).
The means and standard deviations were determined and the
units converted to nanometers. Using the reported width of
TMV particles (ca. 18 nm) as a reference (Zaitlin and
Israel, 1975), the diameter of CMV-Royalty particles was
estimated to be 27.43 nm ±1.53 nm.
SDS-PAGE
When electrophoresed on discontinuous SDS polyacrylamide gels, denatured semi-purified CMV-Royalty produced a major band with an apparent molecular weight between 23-29 kDa. The major protein banded at the position of the 29 kDa marker. Several other minor bands with
apparent molecular weights between 43-69 kDa were
consistently visible (Fig. 29). Semi-purified CMV-Fny produced a banding pattern similar to that of CMV-Royalty
108 ^ m
Figure 26. Transmission electron micrograph (187,500 X magnification) of purified CMV-Royalty (spherical particles). Rod-shaped particles are purified TMV (common strain) included as a size reference (ca. 18 nm wide). Particles were negatively stained with 2% (w/v) uranyl acetate.
109 Figure 27. Transmission electron micrograph (250,000 X magnification) of purified CMV-Royalty (spherical particles). Rod-shaped particles are purified TMV (common strain) included as a size reference (ca. 18 nm wide). Particles were negatively stained with 2% (w/v) uranyl acetate.
110 »-
wmmmÊm,
Figure 28. Transmission electron micrograph (250,000 X magnification) of a mixture of purified CMV-Royalty and CMV- Fny. Particles were negatively stained with 2% (w/v) uranyl acetate.
Ill Figure 29. 10% SDS-PAGE gel stained with Coomassie brilliant blue. Lanes 1 and 5: purified TMV common strain; lanes 2 and 4: purified CMV-Royalty; lane 3: Benchmark Protein Ladder. Apparent molecular weight of pink band is 69 kDa. 29 kDa and 23 kDa markers are indicated by arrows. Bold arrow in lane 2 indicates coat protein of CMV-Royalty.
1 1 2 with a major band between 23-29 kDa (Fig. 30). Several
higher molecular weight bands were also visible (Fig. 30).
Western Blot Analysis
CMV-Royalty and CMV-Fny proteins were electroblotted
onto nitrocellulose membranes and detected with monoclonal
antibodies prepared against CMV subgroup I and subgroup II
strains (Agdia, Inc.). Protein bands from CMV-Royalty and
CMV-Fny reacted positively with subgroup I antibodies, but
not subgroup II antibodies (Fig. 31) . For both isolates a major band was detected corresponding to the coat protein.
In addition, several higher molecular weight bands,
corresponding to the bands visible in the SDS-PAGE gel (Fig.
30), also reacted with the subgroup I antibodies (Fig. 31).
Northern Hybridization to DIG-labeled (S)CARNA-5 cDNA
DsRNA was extracted and purified from virus-infected
A. reptans 'Royalty'' plants. Total viral dsRNA was heat denatured, electrophoresed, blotted onto nylon membranes, and probed with DIG-labeled (S)CARNA-5 cDNA. The probe hybridized to the putative satRNA, but not to any of the CMV genomic RNAs or TMV RNA used as negative control, under high stringency conditions (Fig. 5 of Chapter 2) .
113 Mg m#
Figure 30. 10% SDS-PAGE gel stained with Coomassie brilliant blue. Lanes 1 and 5: purified CMV-Royalty; lanes 2 and 4: purified CMV-Fny; lane 3: Benchmark Protein Ladder. Apparent molecular weight of pink band is 69 kDa. 23 kDa and 2 9 kDa markers are indicated by arrows. Bold arrow next to lane 1 indicates coat protein.
114 Figure 31. Western blot of SDS-PAGE gel shown in Fig. 30. Lanes 1 and 5: purified CMV-Royalty; lanes 2 and 4: purified CMV-Fny; lane 3: Benchmark Protein Ladder (apparent molecular weight of pink band is 69 kDa). The left half of the membrane (lanes 1,2 and half of 3) was treated with CMV subgroup I antibodies, and the right half (half of lane 3, lanes 4 and 5) treated with CMV subgroup II antibodies. Bold arrow to the left of lane 1 indicates the coat protein.
115 Cloning of CMV-Royaltv satellite RNA
Blunt-end ligation of RT-PCR amplification product of
CMV-Royalty satRNA. into pBluescript K- phagemid and transformation of E. coll DH5a produced several transformant colonies. Twenty nine colonies were screened for an insert of molecular weight similar to (S)CARNA5 by digesting the plasmid DNA with HindiII and Xbal, and analysis on agarose gels (Fig. 32). Putative clones were further screened by hybridization to the DIG-labeled (S)CARNA5 probe (Fig. 33), and several inserts that hybridized to the probe were sequenced. Both strands were sequenced using primers specific for the T7 and T3 promoter regions in pBluescript phagemid. DNA Strider version 1.3f3 (Registered trademark of CEA, France) was used to compare the complementary sequences. The sequences of the two strands were entirely complementary.
Sequencing results of several PCR-based clones of the
CMV-Royalty satRNA showed a 331 nucleotide sequence.
However, because of the primers used for PCR amplification, five bases were absent from the 5' end of the sequence and one apparently from the 3' end. To obtain the missing 5' and 3' bases, and to confirm the sequence obtained from the first cloning experiment, the satRNA was recloned using forward and reverse primers that should yield full-length
116 0.4 Kb 0.3 Kb 0.2 Kb 0.1 Kb
Figure 32. Putative PCR-based clones of the CMV-Royalty satRNA. Lane 1: 1Kb Plus DNA marker; lane 2: (S)CARNA-5 digested from pSP65 plasmid with EcoRI; lanes 3-7: plasmid mini-preps digested with Hindlll and Xbal. Putative insert appears between 0.3 and 0.4 Kb markers.
117 1234 567 8
Figure 33. Southern blot analysis of putative PCR-based clones of the CMV-Royalty satRNA using DIG-labeled (S)CARNA- 5 cDNA probe. Lane 1: Lambda DNA markers; lane 2: (S)CARNA- 5 digested from pSP65 plasmid with EcoRI; lanes 3-8 contain pBluescript plasmid mini-preps digested with Hindlll and Xbal. Lane 3: clone p39; lane 4: clone p27; lane 5: clone p45; lane 6: clone p3-l; lane 7: clone p3-2; lane 8: clone p3-3. Arrow indicates putative inserts. These are not all the same clones shown in Figure 32.
118 cDNAs from a cDNA synthesis reaction without a PCR step.
Seventy four colonies were screened for inserts similar in size to (S)CARNA-5 (Fig. 34) and 43 of those sequenced. The putative clones were not further screened by hybridization to the DIG-labeled (S) CARNA-5 cDNA probe. CLUSTAL-W
(version 1.4) was used to align the clone sequences and a comparison of the sequences obtained from the first and second cloning experiments is shown in Figure 35.
From the data obtained from the two cloning experiments the CMV-Royalty satRNA sequence was determined and that sequence was compared to the nucleotide sequences of ten CMV satRNAs by using CLUSTAL-W to do multiple sequence alignments. This comparison is shown in Figure 36.
DNA Strider (version 1.3f3) was used to determine the number or nucleotides present in the CMV-Royalty satRNA sequencemake pairwise alignments and comparisons of the
Royalty satRNA sequence with the sequences of the ten CMV satRNAs used to design the primers used for the experiments.
A 338 base sequence was obtained from the Royalty-satRNA clones. The comparison of the percent identity of the CMV-
Royalty satRNA sequence to ten other satRNAs is presented in
Table 3.
A BLASTN (gapped BLASTN with Repeat Masker; Baylor
College of Medicine website) search of the DNA database was
119 zzzrz • ww n ff ■ ' ' wwiiiiii
Figure 34. Small scale plasmid mini-preparations of transformant colonies from the second cloning experiment. pBluescript was digested with Hindlll and Xbal to reveal putative inserts of interest. Lane 1: 1Kb Plus DNA markers. Lane 2: (S)CARNA-5 marker digested from pSP65 plasmid with EcoRI, Lane 3: sample 5261-24, Lane 4: 5261-26, Lane 5: 5261-27, Lane 6: 5261-29, Lane 7: 5261-31, Lane 8: 5261-32, Lane 9: 5261-33, Lane 10: 5261-34, Lane 11: 5261-35, Lane 12: 5261-36. Samples 5261-24, 26, 27, 29, 33, 34, 35 and 36 were among those sequenced.
120 1 p39/T"7 ------GTTTGATGGAGAACTGCGTAGAGGGGTTGTATCTACGTGAGGATCTGTCACTCG p45/T7 ------TGGA3AACTGCGTAGAGGGGTTGTATCTACGTGAGGATCTGTCACTCG p5261-20--3 -GTTTTGTTTGTTAGAGAACTGCGTAGAGGGGTTGTATCTACGTGAGGATCTGTCACTCG p5262-16-c7 ------GTTTGTTAGAGAACTGCGTAGAGGGGTTGTATCTA.CGTGAGGATCTGTCACTCG p5262-20-c7 ------GTTAGAJGAACTGCGTAGAGGGGTTGTATCTACGTGAGaATCTGTCACTCG p5262-43-t3 ------AGAGAACTGCGTAGAGGGGTTGTA.TCTACGTGAGGATCTGTCACTCG p526i-4 -t3 ------TCTTAGAGAACTGCGTAGAGGGGTTGTATCTAC-TGAGGATCTGTCACTCG p5261-13-t7 ------GAGAA.CTGCGTAGAGGGGTTGTATCTACGTGAGGATCTGTCACTCG p5262-34b-c3 ------ACTGCGTAGAGGGGTTGTATCTACGTGAGGATCTGTCACTCG p5262-32-t3 ------CGTAGAGGGGTTGTATCTACGTGAGGATCTGTCACTCG p5262-22-t3 ------GCGTAGAGGGGTTGTATCTACGTGAGGATCTGTCACTCG p52 Si-19-t3 ------CGTAGAGGGGTTGTATCTACGTGAGGATCTGTCACTCG p5262-4S-t7 ------AGGGGTTGTATCTACGTGAGGATCTGTCACTCG p5262-26-t3 ------GTTGTATCTACGTGAGGATCTGTCACTCG p 5262-9-r7 ------CGTGAGQATCTGTCACTCG p5262-44-t7 ------
p 3 9 / T7 GCGGTGTGGGTTACCTCCCTGCTACGGCGGGTTGAG-TGACGCACCTCGGACTGGGGACC p 4 5 / T7 GCGGTGTGGGTTACCTCCCTGCTACGGCGGGTTGAG-TGACGCACCTCGGACTGGGGACC p5261-20-t3 GCGGTQTGGGTTACCTCCCTGCTACGGCGGGTTGAGTTGACGCACCTCGGACTGGGGACC p5262-I6-t7 GCGGTGTGGGTTACCTCCCTGCTACGGCGGGTTGAGTTGACGCACCTCGGACTGGGGACC P5262-20-Ü7 GCGGTGTGGGTTACCTCCCTGCTACGGCGGGTTGAGTTGA.CGGACCTCGGA.CTGGGGACC p5262-4 3-t3 GCGGTGTGGGTTA.CCTCCCTGCTACGGCGGGTTGAGTTGACGCACCTCGGAC7GGGGACC p52cl-4-t:3 GCGGTGTGGGTTACCTCCCTGCTACGGCGGGTTGAGTTGACGCA.CCTCGaACTGGGGACC p3261-13-c7 GCGGTGTGGGTTA.CCTCCCTGCTACGGCGGGTTGAGTTGACGCACCTCGG.ACTGGGGACC p52S2-34b-c3 GCGGTGTGGGTTACCTCCCTGCTACGGCGGGTTGAGTTGACGCACCTCGGACTGGGGACC p5262-32-t3 GCGGTGTGGGTTACCTCCCTGCTACGGCGGGTTGA.GTTGACGCP.CCTCGGACTGGGGACC p5262-22-t3 GCGGTGTGGGT7ACCTCCCTGCTACGGCGGGTTGAGTTGACGCACCTCGGACTGGGGA.ee p5261-19-C3 GCGGTGTGGGTTA.CCTCCCTGCTACGGCGGGTTGAGTTGACGC.ACCTCGGACTGGGGACC p52S2-4S-r7 GCGGTGTGGQTTACCTCCCTGCTACGGCGGGTTGAGTTGACGCACCTCGGACTGGGGACC p52S2-2S-c3 GCGGTGTGGGTT.ACCTCCCTGCTACGGCGGGTTGAGTTGA.CGCACCTCGGACTGGGGACC p5262-9-t7 GCGGTGTGGGTTACCTCCCTGCTACGGCGGGTTGAGTTGACGCACCTCGGACTGGGGACC p5262-4 4-t7------ACC
127i 14811149 p3 9/T7 GCTGGCTTGCGAGCT.ATGTCCGCTACTCTCAGCACTACGCACTCATTTGAGCCCCCGCTC P4 5/T7 GCTGGCTTGCGAGCTATGTCCGCTACTCTCAGCACTACGCACTCA.TTTGAGCCCCCGCTC p526i-20-c3 GCTGGCTTGCGAGCT.ATGTCCGCTACTCTCA.GCACTACGCACTCATTTGAGCCCCCGCTC p5262-16-c7 GCTGGCTTGCGAGCTA.TGTCCGCTACTCTCAGC.ACTACGCACTCATTTGAGCCCCCGCTC p5262-20-c7 GCTGGCTTGCGAGCTATGTCCGCT.ACTCTCAGCACT.ACGCACTCATTTGAG------p5262-43-c3 GCTGGCTTGCG.AGCTATGTCCGCTACTCTCAGCACTACGCACTCATTTGAGCCCCCGCTC p52Sl-4-r3 GCTGGCTTGCGA.GCTATGTCCGCTACTCTCA£CACTACGCACTCA.TTTGAGCCCCCGCTC p52Sl-i3-p7 GCTGGCTTGCGA.G-CTATGTCCGCTACTCTCAGCACTACGCACTCA.TTTGAGCCCCCGCTC p5262-34b-t3 GCTGGCTTGCGAGCTATGTCCGCTACTCTCAGCACTACGCACTCATTTGAGCCCCCGCTC p5262-32-t3 GCTGGCTTGCGAGCTATGTCCGCT.ACTCTCAGCACTACGCACTCATTTGAGCCCCCGCTC p5262-22-c3 GCTGGCTTGCGAGCT.ATGTCCGCTACTCTCAGCACTACGCACTCATTTGAGCCCCCGCTC p5261-19-t3 GCTGGCTTGCGAGCTATGTCCGCTACTCTCA.GCACTACGCACTCATTTG.AGCCCCCGCTC p5262-48-c7 GCTGGCTTGCG.AGCT.ATGTCCGCTACTCTCAGCACTACGCACTCATTTGA.GCCCCCGCTC p5262-26-c3 GCTGGCTTGCGAGCT.ATGTCCGCTACTCTCAGCACTACGCACTCATTTGAGCCCCCGCTC p5262-9-t7 GCTGGCTTGCGAGCT.ATGTCCGCTA.CTCTCAGCACT.ACGCACTCATTTG.AGCCCCCGCTC p5262-44-r7 GCTGGCTTGCGAGCT.ATGTCCGCTACTCTCAGCACTACGCA.CTCATTTG.AGCCCCCGCTC (Continued)
Figure 35. CLUSTAL W(1.4) multiple sequence alignment of clones of the CMV-Royalty satRNA. Clones p37 and p45 are from the PCR-based cloning experiment. Clones designated p5261 or p5262 followed by a number are from the cDNA-based cloning experiment. Sequence differences are indicated in bold. A - at a given position indicates a missing base. A * beneath a given position indicates a conserved base at that position with respect to other clones. The additional bases at the 3' end of clone p39 are the 3' primer sequence. Nucleotide positions 127, 148 and 149 are indicated in bold as published (Sleat and Palukaitis, 1992).
121 Figure 35. (Continued).
p39/T7 AGTTTGCTAGCAA.0iACCCGGCCa\TGGTTTGCCGTTACCGTGGACTTTCGAAAi3AAACAC p 4 5 / T7 AGTTTGCTAGCAAAACCCGGCCCATGGTTTGCCGTTACCGTGGAAAXTCGAAAGAAACAC p5261-20-t3 AGTTTGCTAGCAAAACCCGGCCCATGGTTTGCCGTTACCGTGGA.CTTTCGAAAGAAACAC p5262-16-t7 AGTTTGCTAGCAAOACCCGGCCCATGGTTTGC------p5262-20-t7 ------p5262-4 3-t3 AGTTTGCTAGCAAAACCCGGCCCATGGTTTGCCGTTACCGTGGACTTTCGPAAGAAACAC p526i-4 -C3 AGTTTGCTAGCAAAACCCGGCCCATGGTTTGCCGTTACCGTGGACTTTCGAflAGAAACAC p5261-i3-t7 AGTTTGCTAGCAAAACCCGGCCCATGGTTTGCCGTTACCGTGGACTTTCGAAAGAAACAC p5262-34b-t:3 AGTTTGCTAGC4AAACCCGGCCCATGGTTTGCCGTTACCGTGGACTTTCGAAAGAAA.CAC p5262-32-t3 AGTTTGCTAGCAAaACCCGGCCCATGGTTTGCCGTTACCGTGGACTTTCGAAAGAAACAC p5262-22--3 AGTTTGCTAGCAAAACCCGGCCCATGGTTTGCCGTTACCGTGGACTTTCGAAAGAA=iCAC p5261-l 9-c3 AGTTTGCTA.GCAAAACCCGGCCCATGGTTTGCCGTTACCGTGGACTTTCGAAAGAAACAC 05262-4 8-t7 AGTTTGCTAGCAAAACCCGGCCCATGGTTTGCCGTTACCGTGGACTTTCGAAAGAAA--- p5262-26-t3 AGTTTGTTAGCAAAACCCGGCCCATGGTTTGCCGTTACCGTGGACTT7CGAAAGAAACAC p5262- 9-c7 AGTTTGCTAGCAfiA^'.CCCGGCCCATGGTTTGCCGTTACCGTGGACTTTCGAAAGAAACAC p5262-44-t7 AGTTTGCTAGCAAAACCCGGCCCATGGTTTGCCGTTACCGTGGACTTTCGAAAGAAACAC p39/?7 TCTGT7AGGTGGTATTGTGGATGACGCACACAGGGAGAGGCTAAAACCTATATGGTCATG p45/T7 TCTGTTA.GGTGGTATCGTGGATGACGCACACAGGGAGAGGCTAAAACCTA.TATGGTCATG p5261-20-û3 TCTGTTAGGTGGTATCGTGGATGACGCACACAGGGAaAGGCTAAAACCTATATGGTC--- p5262-16-c7 p5262-20--7 p5262-43--3 TCTGTTAGGTGGTATCGTGGATGACGCACACAGGGAQAGGCTAAAACCTATA7GGTCP.TG p5261-4-c3 7C7G77AGG7GG7A7CG7GGATGACGCACACAGGGAGAGGCTAAAACC7A7A7GG7CA.7G p5261-13-t7 7C7G7TAGG7GG7A7CG7GGA7GACGCACACA------p5262-34b-c3 7C7G77AGGTGG7A7CG7GGA7GACGCACACAGGGAGAGGC7AAAACC7ATA7GGTCATG p5262-32-t3 7C7G77AGG7GG7A7CG7GGA7GACGCACACAGGGAGAGGCTAAAACCTA7A7GG7CA7G p5262-22-c3 7C7GT7AGG7GGTA7CG7GGA7Gf.CGCACACAGGGf.GAGGCTAAAACC7A7A7GG7CA7G p5261-19-t3 TC7G77AGGTGGTATCG7GGA7Gf.CGCACACAGGGAGAGGCTAAAACCTA7ATGG7CA7G p5262-48-c7 p5252-26-c3 7C7G77A.GG7GGTA7CGTGGA7GACGCACACAGGGAGAGGC7AAAACCTA7A7GG7CA7G p5262-9-t7 7C7GT7AJ3GTQG7A7CG7GGA7GACGCACACAGGGAGAGGCTAAZ\ACC7A7A7GG7CA7G o5262-44-c7 7C7G77AGGTGG7A7CG7GGA7GACGCACACAGGGAGAGGC7AAAACC7A7A7GG7CA.7G p39/77 C7GATCTCCGCG7A7G7ACA7CA7ACCT7CACAGaACCATG7CC77ACACA7C7G p45/77 C7GA7CTCCGCG7A7G7ACA7CA7ACC77CACAGaACCA------05261- 0--C3 p5262 16-C7 p5262- 20-C7 p5262 43-C3 C7G.A7CTCCGCGT------p5261 4-t3 C7GA7CTCCGC------p5261- 13-t7 p5262-,34b-c3 C7GATCTCCGCGTA7G7ACA7CATACC77------p5262- 32-03 C7 GATCTCCGCG7A7G7ACA7 CATACCT 7AGOAGCACCC------□5262- 22-C3 C7GA7CTCCGCG7A7G7ACATCA7ACC77ACCAGGACCC------□5261- 19-03 C7GATCTCCGCGTA7G7ACATCA7ACC77 AGG-CCC------□5262- 48-07 p525 26-03 CTGA7CTCCGCG7A7G7ACA7CA7ACC77GACAGGACCC------□5262- 9-07 CTGA7CTCCGCG7A7G7ACA-TCA7ACCT7----- GACCC------□5262- 4 4-c7 C7GATCTCCGCG------
122 roysat GTTTTGTTTGTTAGAGAACTGCGTAGA.GGGGTTGTATCTACGTGAGGATCTGTCACTC— gsat GTTTTGTTTGTTAGAGAATTGCGTAGAGGGGTTGTATCTACGTGAGGATCTATCACTC— dsat GTTTTGTTTGATGGAGAATTGCGCAGAGGGGTTATATCTGCGTGAGGATCTGTCACTC— es at GTTTTGTTTGATGGAGAACTGCGTGGAGGGGTTGTATCTGCGTGGGGAICTGTCATCTCG bis at GTTTTGTTTGTTAGAGAATTGCGTAGAGGGGTTAIATCTACGTGAGGATCTATCACTC— b2sat GTTTTGTTTGTTAGAGAATTGCGTAGAGGGGTTATATCTATGTGAGGATCTATCACTC— bSsat GTTTTGTTTGTTAGAGAAITGCGTAGAGGGGTTAIATCTATGTGAGGATCTATCACTC— wllsat GTTTTGTTTGATGGAGAATTGCGTAGAGGGGTTAIATCTACGTGAGGATCCGTCACTC— wl2sat GTTTTGTTTGATGGAGAATTGCGTAGAGGGGTTATATCTACGTGAGGAICTATCACTC— ysat GTTTTGTTTGATGGAGAATTGCGTAGAGGGGTTAIATCTGCGTGAGGATCCATCACTC— oy2sat GTTTTGTTTGTTGGAGACCCGCGCGGAGGGGATAIATTCGTGCGGTGATCCTTCACTC— ********** * **** ****** * *** roysat GGCGGTGTGGGTTACCTCCCTGCTACGGCGGGTTGAGT------TGACG-CACCTCGGA gsat GGCGGTGTGGGTTACCTCCCTGCTACGGCGGGTTGAG------TGACG-CACCTCGGA dsat GGCGGTGTGGGATACCTCCCTGCTAAGGCGGGTTGAG------TGATGTTCCCTCGGA es at GGCGGTGTGGGATACCTCCCTGCTAAGGCGGGTTGAGA------TGACG-TATCTCGGA bis at GGCGGTGTGGGATACCTCCCTGCTAAGGCGGGTTGAG------TGACG-CACCTCGGA b2sat GGCGGTGTGGGATACCTCCCTGCTACGGCGGGATGAG------TGACG-CACCTCGGA bSsat GGCGGTGTGGGATACCTCCCTGCTACGGCGGGATGAG------TGACG-CACCTCGGA wllsat GGCGGTGTGGGTTACCTCCCTGCTACGGCGGGTTGAGT------TGACG-CACCTCGGA wl2sat GGCGGTGTGGGATACCTCCCTGCTAAGGCGGGTTGAGT------TGACGGCACCTCGGA ysat GGCGGTGTGGGATACCTCCCTGCTAAGGCGGGTTGAG------AGTG-TATCTCGGA oy2sat GGCGGTGTGGGTTAACTCCCTGCTAAGGCGGGTTGGAGACTGCGCCCGAGACAGGCCGGA *********** ** ********** ****** ** * **** 127 I 1481 1149 roysat CT GGGGACCGCT-GGCTTGCGAGCTATGTCCGCTACTC------gsat CT GGGGACCGCT-GGC CGAGCTATGTC-GCTACTC------dsat CT GGGGACCGCT-GGCTTGCGAGCTATGTCCGCTACTC------esat CT GGGGACCGCT-GGCTTGCGAGCTATGTCCGCTACTC------blsat CT GGGGACCGCT-GACTTGCGAGCTAXGTC-GCTGTTC------b2sat CT GGGGACCGCT-GACTTGCGAGCTATGTCCGCTGCTC------b3sat CT GGGGACCGCT-GACTTGCGAGCTATGTCCGCTGTTC------wllsat CTC—GGGGACCGCTTGGTTTGCGAGTATCGTCCGC-ATTC------wl2sat CT GGGGACCGCT-GACTTGCGAGTATCGTCCGCTGCTC------ysat CTG— GAGGCGGGATGTCTGCGGGTGTTCCGTCTGCTGCCCACGATGGTGGGAGCCACCC oy2sat CCTTGGGGGAGCCCACGAGCCGCGTGGGAACGTAGCGGTTTCCGGTTGAACTGGCGCCGG * * ** * * **
(continued)
Figure 36. CLUSTAL W(1.4) multiple sequence alignment of CMV-Royalty satRNA (roysat) sequence with ten published CMV satRNA sequences. A - at a given position indicates a deletion with respect to other satRNAs and a * at a given position indicates a conserved base with respect to other satRNAs. Nucleotide positions 127, 148, 149 and 153 are indicated in bold relative to the sequence published for this region of the molecule (Sleat and Palukaitis, 1992).
123 Figure 36. Continued.
1531 roysat ------T-CAGCACTACGCA--- CTCATTTGAGCCCCCGC-TCAGTTTGCTA gsat ------T-CAGCACTACGCA--- CTCAATTGAGCCCCCGC-TCAGTTCGCTA dsat ------T-CAGTACTACACT--- CTCATTTGAGCCCCCGC-TCAGTTTGCTA esat ------T-CAGCACTGCGCT----CTCATTTGAGCCCCCGC-TCAGTTTGCTA blsat ------T-CAGCACTACGCA--- CTCAATTGAGCCCCCGC-TCAGTTCGCTA b2sat ------TTCAGCACCACGCA--- CTCATTTGAGCCCCCGC-TCAGTTCGCTA bSsat ------TTCAGCACCACGCA--- CTCATTTGAGCCCCCGC-TTAGTTCGCCA wllsat ------TTTAGCACTACGCG--- CCAATTTGAGCCCCCGC-CTAGTTTGCCA wl2sat ------TTCAGCACTACGCA--- TCAATTTGAGCCCCCGCCTCAGTTTGCTA ysat CAGGGGCGACTTTTTCAGCTCTGCATTT CTCATTTGAGCCCCCGC-TCAGTTTGCTA oy2sat AGGCCTCCAGCGGCCTGTTTCGCCGCTTCCCTCCATTTGAGCCCCCGC-CCAGTTTGCTA* * * ************ **** ** * roysat GCAAAACCCGGCCCATGGTTTGCCGTTACCGTGGAC-TTTCGAAAGAAACACTCTGTTAG gsat GCAAAACCCGGCCCGTGGTTTGCCGTTACCGCGGAA-TTTCGAAAGAAACACTCTGTTAG dsat GCAGAACCCGGCACAIGGTTCGCCGATACTATGGAT-TTTCTAAAGAAACACTCTGTTAG esat ACAGAACCCGGCCCGTGGTTTGCCGTTACCGCGGAAATTTCGAAAGAAACACTCTGTTAG blsat GCAAAACCCGGCCCGTGGTTTGCCGTTACCGCGGAA-TTTCGAAAGAAACACTCTGTTAG b2sat GCAAAACCCGGCCCGTGGTTTGCCGTTACCGCGGAAATTTCGAAAGAAACACTCTGTTAG b3sat GCAAAACCCGGCCCGTGGTTTGCCGTTACCGCGGAA-TTTCGAAAGAAACACTCTGTTAG wllsat GCAGCACACG-CTCATGGTTTGCCGTTACCGATGGAATTTCGAAAGAAACACTCTGTTAG wl2sat GCAAAACCCGGCCCGTGGTATGCCGTTACCATGGAA-TTTCGAAAGAAACACTCTGTTAG ysat GCAAAACCCG-GACATGGTTCGCCGTTACTATGGAT—TTCGAAAGAAACACTCTGTTAG oy2sat GCAAGACCCGGCACATGGTTCGCCGTTACTATGGAAAITTCGAAAGAAACACTCTGTTAG**** *** roysat GTGGTATCGTGGATGACGCACACAGGGAGAGGCTAAAACCTATATGGTCATGCTGATCTC gsat GTGGTATCAGTGATGACGCACGCAGGGAGAGGCTAAAACCTATACGGTCATGCTGATCTC ds at GTGGTATGAGTCATGACGCACGCAGGGAGAGGCTAAGGCTTAT GCTATGCTGATCTC esat GTGGTATCAGTGACGACGCACGCAGGGAGAGGCTAAAACCTATAIGGTCATGCTGATCTC blsat GTGGTATCAGTGACGACGCACGCAGGGAGAGGCTAAAACCTATAAGGTCATGCTGATCTC b2sat GTGGTATCAGTGACGACGCACGCAGGGAGAGGCTAAAACCTATAAGGTCATGCTGATCTC b3sat GTGGTATCAGTGAIGACGCACGCAGGGAGAGGCTAAAACCTATAIGGTCATGCTGATCTC wllsat GTGGTATCGTGGATGACGCACGCAGGGAGAGGCTTAGACTTA GGTTATGCTGATCTC wl2sat GTGGTATCAGTGACGACGCACGCAGGGAGAGGCTAAAACCTATACGGTCATGCTGATCTC ysat GTGGTATCGTGGATGACGCACGCAGGGAGAAGCTAAGGCTTAT GCTATGCTGATCTC oy2sat GTGGTACCGTGGATGACGCACACAGGGAGAGGCTAAGGCTTA GGCTATGCTGATCTC ★ ******* ******** * * * * *********** roysat CGCGTATGTACAT -CATACCTTACCAGGACCC gsat CTTGGATGTTTAT-CATTCCCTACCAGGACCC ds at CGTGAATGTCTAT-CATTCCTCTGCAGGACCC esat CGCGTATGTTTAA-CAIACCTTAACAGGACCC blsat CGTGAATGTCTAC-CATTCCTCTACAGGACCC b2sat CGTGAATGTCTAC-CAITCCTCTACAGGACCC bSsat CGTGGATGTTTAT-CAITCC-CTACCGGACCC wllsat CGTGAATGTCTA— CAITCCTCTACAGGACCC wl2sat CGTGAATGTCTA— CATTCCTCTACAGGACCC ysat CGTGAATGTCTATACAITCCTCTACAGGACCC oy2sat CATGGATGTCTACACAITCCTCTACAGGACCC
124 Satellite RNA No. nucleotides No. conserved % Identity nucleotide with CMV- positions Royalty satRNA roy satRNA 338 nt NA 100 g satRNA 333 nt 314/338 92.9 e satRNA 341 nt 312/341 91.5 bl satRNA 336 nt 308/338 91.1 b2 satRNA 339 nt 309/340 90.9 b3 satRNA 337 nt 310/339 90.5 wl2 satRNA 340 nt 303/341 88.9 wll satRNA 336 nt 294/341 86.2 d satRNA 335 nt 292/338 86.4 y satRNA 368 nt 289/373 77.5 oy satRNA 386 nt 280/389 72.0
Table 3. Comparison of percent identity between the CMV- Royalty satRNA (roysat) nucleotide sequence and ten previously published satRNA sequences determined by pairwise alignments using DNA Strider 1.3f3 (single block method). Differences between the number of nucleotides in column two and the total number of nucleotide positions in column three are due to deletions in one of the satRNA sequences with respect to the other, causing a shift in the total number of positions to make the alignment.
125 performed to locate other CMV satRNA sequences with homology to Royalty satRNA greater than the ones shown in Table 3.
The 11 sequences with the greatest homology to Royalty satRNA were downloaded and CLUSTAL W was used to do multiple sequence alignments. These results are shown in Figure 37.
DNA Strider was used to make pairwise alignments between
Royalty satRNA and the 11 sequences obtained from the database, and to determine the percent identity. These results are shown in Table 4.
A phylogenetic tree was constructed using CLUSTALW to perform 1000 bootstrap trials of the alignment of Royalty satRNA with 21 CMV satRNA sequences, and Treeview 32 used to create the tree (Fig. 38).
126 1 10 20 30 40 50 60 roysat GTTTTGTTÏGTTAGAGAACTGCGTAGAGGGGTTGTATCTACGTGA.GGATCTGTCP'.CTCGG Z75882 GTTTTGTTTGTTAGAGAATTGCGTAGAGGGGTTATATCTACGTGAGGATCTATCACTCGG Z 75873 GTTTTGTTTGTTAGAGAATTGCGTAa=iGGGGTTATATCTACGTGAGGATCTATCACTCGG Z75S76 GTTTTGTTTGTTA.GAGAATTGCGTAGAGGGGTTATATCTACGTGAGGATCTATCACTCGG Z75871 GTTTTGTTTGTTAGAGAATTGCGTAGAGGGGTTATATCTACGTGAGGATCTATCACTCGG Z75870 GTTTTGTTTGTTAGAGAATTGCGTAGAGGGGTTATATCTACGTGAGGATCTAJrCACTCGG Z75872 GTT7TGTTTGTTAGAGAATTGCGTAGAGGGGTTATATCTACGTGAGGATCTGTCACTCGG X53534 GTTTTGTTTGTTAGAGAATTGCGTAjGAGGGGTTATATCTACGTGAGGATCTATCACTCGG X63136 GTTTTGTTTGTTAGAGAATTGCGTGGAGGGGTTA.TATTCACGTGAGGATCTATCACTCGG X86408 GTTTTGTTTGATGGAGAATTGCGTAGAGGGGTTATATTCACGTGAGaATCTACCACTCGG j 02060 GTTTTGTTTGTTAGAGAA.TTGCGTAGAGGGGT7GTATCTACGTGAGGATCTATCACTCGG nil4 934s£at GTTTTGTTTGTTAaaaaATTGCGTAGAGGGGTTATA-TCTACGTAAGGATCTATCACTCGG
70 80 90 100 110 120 roysat CGGTGTGGGTTACCTCCCTGCTACGGCGGGTTGAGTTaACGCA.CCTCGGACTGGGGACCG Z75882 CGGTGTGGGTTACCTCCCTGCTACGGCGGGTTGAGTTG?.CGCACCTCGGACTGGGGACCG z75673 CGGTGTGGGTTACCTCCCTGCTACGGCGGGTTGGGTTGACGCACCTCGGACTGGGGACCG Z75876 CGGTGTGGGTTACCTCCCTGCTACGGCGGGTTGAGTTGACGCACCTCGGACTGGGGACCG Z75871 CGGTGTGGGTTACCTCCCTGCTACGGCGGGTTGAGTTGACGCACCTCGGACTGGGGACCG z75870 CGGTGTGGGTTACCTCCCTGCTACGGCGGGTTGAGTTGACGCACCTCGGACTGGGGACCG Z75872 CGGTGTGGGTTACCTCCCTGCTACGGCGGGTTGAGTTGACGCACCTCGGACTGGGGACCG X53534 CGGTGTGGGTTACCTCCCTTCTACGGCGGGTTGAGTTGACGCATCTCGGACTGGGGACCG X69136 CGGTGTGGGTTACCTCCCTGCTACGGCGGGTT®\GTTGACGCACCTGCGACTGGGGACCG X8 64 08 CGGTGTGGGATACCTCCCTGCTACGGCGGGTTGAGTTGACGCACCTCGGACTGGGGACCG j02060 CGGTGTGGGTTACCTCCCTGCTACGGCGGGTTGAGT-GACGCACCTCGGACTGGGGACCG ml4 934ssat CGGTGTGGGTTACCTCCCTGCTACGGCGGGTTGAGTTGACGCGCCTCGGACTGGGGACCG
1 2 7i 130 140148 11149 160 170 180 roysat CTGGCTTGCGP'-GCTATGTCCGCTACTCTCAGCACTACGCACTCATTTGAGCCCCCGCTCA Z7S8S2 CTGGCTTGCGAGCTATGTCCGCTACTCTCAGCACTACGCACTCAiTTGAGCCCCCGCTCA Z75873 CTGGCTTGCGh GCTAJGTCCGCTACTCTCAGCACTACGCACTCA.TTTGAGCCCCCGCTCA Z75376 CTGGCTTGCGAGCTA.TG7CC&CTACTCTCAGCA.CTACGCAC7CATTTGAGCCCCCGCTCA Z73S71 ctggcttgcga .gctatgtccgcta .c t c t c a .gcactacgcactca .tttgagcccccgctca Z75870 C7GGCTTGCGAGCTATGTCCGCTACTCTCAGCACTACGCACTCATTTGAGCCCCCGCTCA Z75872 CTGGCTTGCGAGCTATGTCCGCTACTCTCAGCACTA.CGCACTCATTTGA.GCCCCCGCTCA X53534 CTGGCTTGCGAGCT.ATGTCCGCTACTCTCAGCACTGCGCACTCATTTGAGCCCCCGCTCA X69136 ■G7GGCCTGCGAGCTATGTCCGCTACTCTCAGCACTACGCACTCATTTGAGCCCCCGCTCA x364 08 CTGGCTTGCa=iGCTA7GTCCGCTACTC7CAGCACTACGCACTCATTTGAGCCCCCGCTCA 102060 CTGGCCTGCGAGCTATGTC-GCTACTCTCAGCACTACGCA.CTCATTTGia.GCCCCCGCTCA ml 4934ssat CTGGCTTGCGAGCTATGTCCGCTACTCTCAGCACCA.CGCACTCATTTGAGCCCCCGCTCA
(Continued)
Figure 37. CLUSTAL W (1.74) multiple sequence alignment of CMV-Royalty satRNA (roysat) cloned sequence with CMV satRNA sequences obtained from a BLASTN search of the DNA database. The sequences obtained from the database are indicated by accession number. A * beneath a particular position indicates a conserved base at that position. A - at a particular position indicates a deletion with respect to other sequences. Nucleotides 127, 148 and 149 are indicated by bold numbers, relative to their published positions (Sleat and Palukaitis, 1992). Nucleotides unique to Royalty satRNA, relative to the other sequences, are indicated in bold.
127 Figure 37. (Continued).
190 200 210 220 230 240 roysat GTTTGCTAGCAAAACCCGGCCCATGGTTTGCCGTTACCGTGGA-CTTTCGAAAGAAACAC 275882 GTTTGCTAGCAA=ACCCGGCACATGGTTCGCCGTTACTATGGA-TTTTCGAAAGAAACAC 275873 GTTTGCTAGCAAAACCCGGCACATGGTTCGCCGATACTATGGA-TTTTCGflAAGAAACAC 275876 GTTTGCTAGCAAAACCCGGCACATGGTTCGCCGTTACCATGGA-TTTTCGiiAAGAAACAC 275871 GTTTGCTAGCAAA2lCCCGGCACATGGTTCGCCGTTACCATGGA-CAATCGSAAGAAACAC 275870 GTTTGCTAGCAAAACCCGGCACATGGTTCGCCGTTACCATGSyVTTTTCGAAAGAAACAC 275872 GTTTGCTAGCAAAACCCGGCACATGGT-CGCCGTTACTATGGAAATTTCGflAAGAAACAC X53534 GTTTGCTAGGAAAACCCGGCCCGTGGTATGCCGTGACCGCGGA-ACTTCGAAAGAAACAC X69136 GTTTGCTAGCAAAACCCGGCACGTGGTTTGCCGTTACCACGGA-ACTTCGAAAGAAACAC X8640S GTTTGCTAACAAAACCCGGCCCGTGGTTTGCCGTTACCGCGGAAATTTCGA=AGAAACAC 102060 GTTCGCTAGCAAAACCCGGCCCGTGGTTTGCCGTTACCGCGGAA-TTTCGAAAa=>AACAC ml4934ssa2 GTTTGCTAGCAaAACCCGGCCCGTGGTTTGCCGTTACCGCGaAAATTTCGAAAGAAACAC
250 260 270 280 290 300 roysat TCTGTTAGGTGGTATCGTGGATGACGCACACAGGGAGAGGCTAAAACCTATATGGTCATG 275882 TCTGTTAGGTGGTATCGTGGATGACGCACGCAGGGAGAGGCTAA=ACCTATAAGGTCATG 275873 TCTGTTAGGTGGTATCGTGGATGACGCACAC=iGGGAGAGGCTAAAP..CCTATAAGGTCATG 275876 TCTGTTAGGTGGTATCGTGGATGACGCACACAGGGAGAGGCTAAAACCTATA=iGGTCATG 275871 TCTGTTAGGTGGTATCGTGGATGACG-CACA.C?.GGGAGAGGCTAAAACCTAT?AGGTCATG 275870 TCTGTTAGGTGGTATCGTGGATGACGCACACAGGGAGAGGCTAAAACCTATfAGGTCATG 275872 TCTGTTAGGTGGTATCGTG'SATGf.CGCACGGAGGGAGf.GGCTAAAA.CCTATfAGGTCATG X53534 TCTGTTAGGTGGTATCGTGGATGACGCACGCAGGGAGAGGCTAAA=lCCTATAAGGTCATG X69136 TCTGTTAGGTGGTATCGTGGATGACGGACAGAGGGAGAGGCTAAAf.CCTATACGGTCATG xS64 08 TCTGTTAGGTGGTATCGTGGATGACGGACACAGGGAGA.GGCTAAAACCTATACGGTCA.TG 102060 TCTGTTAGGTGGTATCAGTGATGACGCACGCAGGGAGAGGC7AAAACCTATACGGTCATG .■nl4 934ssat TCTGTAAGGTGGTATCAGTGP'.TGACGCACGCAGGGAGAAGCTAAAACCTATAAGGTCATG
310 320 330 340 roysat CTGATCTCCGCGTATG—TACATCATACCTTACCAGGP.CCC 275882 CTGATCTCCGTGAATGTCTACA-CATTCCTCTACAGG?.CCC 275873 CTGATCTCCGTGfATGTCTACA-CATTCCTCTACAGG;^.CCC 275876 CTGA.TCTCCGTGAATGTC7A.CA-CATTCCT'G7ACAGGACCC 275071 C7GATC7CCG7GAA7GTC7ACA.-CA.77CC7C7ACAGGACCC 275870 C7GA7CTCCG7aoA7G7C7ACA-CA77CC7CCP.CP.GGACCC 275672 CTGA7C7CCG7GAA7GTC7ACA-CAT7CC7A7ACAGGACCC X53534 C7GA7C7CCG7GAA7G7C7A.CA-CA77CC7C7ACAGGACCC XÔ9136 C7G.=i7C7CCGTGAA7G7C7ACA-CAT7CC7C7ACAGGACCC X56408 C7GA7C7CCG7G3.AG7GC7ACA-CAGGCC7A7CCA'3GACCC 102060 C7G;^_7C7CCG7GGA7G— 7T7A.7CA77CCC7ACCAGGACCC ml4 934ssa* CCGA7C7CCG7GAA7G— 7C7AACA77CCA7TACAGGACCC
128 Satellite No. nucleotides No. conserved % Identity RNA/ accession nucleotide with CMV- number positions Royalty satRNA roy satRNA 338 nt NA 100 Z75876 339 nt 321/339 94.7 Z75871 339 nt 320/339 94.4 Z75870 340 nt 321/340 94.4 Z75882 339 nt 319/339 94.1 j02060 336 nt 318/338 94.1 Z75872 339 nt 319/340 93.8 Z75873 339 nt 318/339 93.8 X86408 340 nt 317/341 93.0 X53534 339 nt 315/339 92.9 X69136 339 nt 313/339 92.3 ml4934 ssatRNA 339 nt 312/339 92.0
Table 4. Comparison of percent identity between the CMV- Royalty satRNA (roysat) nucleotide sequence and the eleven satRNA sequences obtained from a BLASTN database search with the highest homology to Royalty satRNA. Percent identity determined by pairwise alignments using DNA Strider 1.3f3 (single block method). Differences between the number of nucleotides in column two and the total number of nucleotide positions in column three are due to deletions in one of the satRNA sequences with respect to the other, causing a shift in the total number of positions to make the alignment. The satRNA sequences obtained from the DNA database are indicated by accession number.
129 PHYUP 1 -oy2sat
908 -dsat -ysat 443 -wllsat 713 wl2sat
X53534
roysat 2 0 . 52 215 gsat 443 999 146 j02060
-m14934ssat 197 80 -blsat 731 blsat 669 -b3sat 2SL 281 -X86408 -X69136
Z75872
7L7 rz7 5 8 8 2 31B — Z75873 ^-z75871 ■^5870 483 Z75876 01
Figure 38. Phylogenetic tree generated from CLUSTALW alignment of CMV-Royalty satRNA sequence (roysat) with 21 CMV satRNA sequences. 1000 bootstap trials were performed and the tree created using Treeview 32 for Windows. Bootstrap values for the branches are in bold. 0Y2 satRNA was used as the outgroup and the tree was rooted with the outgroup.
130 Discussion
Since a number of biological and host range variants of
CMV have been described and A. reptans is a perennial host which can potentially serve as a reservoir for CMV, it was of interest to partially characterize the CMV isolate from
A. reptans 'Royalty' . This CMV isolate was of additional interest because of the apparent satellite RNA associated with it.
Mechanical transmission of CMV from A. reptans directly to other hosts, specifically tobacco, was generally unsuccessful and may be explained by low virus titer in the asymptomatic plant used as inoculum. Although the plant tested positive for CMV by ELISA, asymptomatic tissue can be inversely correlated with the presence of infectious virus particles (Habili and Kaper, 1981) . Another explanation is the accumulation of non-infectious viral dsRNA and dssatRNA
(Dodds et al., 1984) leading to diminution of infectious particles and poor transmission. Other investigators have not reported difficulty in transmitting CMV from Ajuga to other hosts (Shukla and Gough, 1983). Once CMV was transmitted to N. tabacum by Aphis gossypii the virus was then easily mechanically transmissible to tobacco, squash, cucumber, pumpkin, and tomato 'Rutgers' using symptomatic N. tabacum 'Glurk' or 'Samsun' as inoculum.
131 The CMV-Royalty isolate was transmissible by the aphid species Aphis gossypii to N. rustics and N. tabacum 'Glurk', where it induced mosaic and leaf puckering and mild mosaic and mild vein-clearing, respectively (Figs. 7,8,9).
Nlcotlana henthamlana aphid-inoculated with CMV-Royalty was stunted relative to the mock-inoculated controls and the plants remained so small that it was impossible to collect enough tissue for ELISA to confirm the presence or absence of CMV. Aphid-inoculated N. clevelandll never developed symptoms and ELISA results confirmed that none of the N. clevelandll plants were infected with CMV. However, N. clevelandll mechanically inoculated using CMV-Royalty- infected N. tabacum 'Samsun'' as inoculum developed a very mild mosaic symptom (Fig. 21) , and the presence of CMV was confirmed by ELISA. Thus we can conclude that N. clevelandll is a host for this CMV isolate. Further aphid transmission to N. clevelandll or N. benthamlana was not attempted, since the purpose of this aphid transmission experiment was to infect tobacco so that the virus could be purified for further characterization.
CMV-Royalty purified from aphid-inoculated N. rustics was initially used for TEM and to inoculate N. tabacum
'Glurk'. TEM revealed several rod shaped particles mixed with spherical particles in the virus preparation from N.
132 rustics. The CMV-Royalty preparation was tested by ELISA
for TM\^, since TMV was also being studied in the greenhouse
and lab and thus presented a contamination risk. ELISA
showed TMV contamination of the purified CMV-Royalty
preparation. All of the N. rustics plants that were aphid-
inoculated with CMV-Royalty were retested for TMV by ELISA,
and all plants were negative. The purified CMV-Royalty
preparation was used to inoculate N. tshscum 'Glurk'', which
has the N gene for local lesion resistance to TMV. No local
lesions appeared on any of the inoculated plants, and there
was no further TEM or ELISA evidence for a TMV contamination
of CMV-Royalty later purified from these plants. It,
therefore, seems likely that the TMV came from contaminated
centrifuge bottles or tubes used in the lab.
CMV-Royalty purified from N. tshscum 'Glurk''
consistently produced a single light-scattering band in
centrifuged 10-40% sucrose density gradients (Fig. 25) .
CMV-Fny purified from 'Glurk' also produced a single light-
scattering band in centrifuged sucrose gradients. These
results were not unexpected since CMV sediments as a single particle (Francki et si., 1979). When the two purified preparations were mixed and viewed under the TEM the particles were indistinguishable (Fig. 28). It seems likely
that CMV-Royalty and CMV-Fny particles are identical in
133 size. CM'Z-Royalty particles were estimated to be
approximately 27.43 nm (±1.53 nm.) in diameter. Considering
the standard deviation, this size estimation falls within
the 28-30 nm range reported for CMV (Francki et al., 1979).
Initial SDS-PAGE analysis of denatured purified CMV-Royalty
showed a major protein band with an apparent molecular
weight of 29 kDa (Fig. 29). This estimate is more than the
reported molecular weight of the CMV coat protein, which is
24.5 kDa (Francki et al., 1979). Several higher molecular weight bands, with apparent molecular weights between 43-69
kDa, were also consistently visible in purified CMV-Royalty preparations (Figs. 29,30). When purified CMV-Royalty and
CMV-Fny proteins were coelectrophoresed by SDS-PAGE, the two protein banding patterns were indistinguishable. The CMV-
Fny preparation also contained the additional higher molecular weight bands seen in the CMV-Royalty preparation
(Fig. 30). A possible explanation is the bands are aggregations of coat protein.
Western blot analysis of purified CMV-Royalty and CMV-
Fny proteins, using monoclonal antibodies specific to CMV subgroup I and CMV subgroup II strains, clearly showed that the subgroup I antibodies were reacting with both CMV-
Royalty and CMV-Fny, but the subgroup II antibodies were not
(Fig. 31). This result was confirmed by having 'Glurk'
134 tissue samples containing CMV-Royalty commercially tested
(Agdia Inc.) for CMV-1 and CMV-II by ELISA. ELISA results
confirmed reactivity to CMV-I antibodies but not CMV-II
antibodiesf eliminating the possibility of a mixture of the
two subgroups. These results clearly show that CMV-Royalty,
like CMV-Fny, belongs to the CMV serological subgroup I
(Owen and Palukaitis, 1988; Sleat and Palukaitis, 1990). M.
tabacum 'Glurk^ was inoculated with the subgroup II strain,
CMV-Q, and the tissue subjected to the virus purification
scheme. No virus was recovered, as confirmed by ELISA, so a
reciprocal experiment using CMV-Royalty and CMV-Q for
western blots was not possible.
To confirm that the low molecular weight band observed
in dsRNA preparations was a satRNA, DIG-labeled (S)CARNA5
cDNA was used in hybridization assays. The labeled probe
clearly hybridized to the low molecular weight RNA
associated with CMV-Royalty (Fig. 5 of Chapter 2). These
results are in agreement with the reported high conservancy
among CMV satRNA sequences (Kaper at ai., 1988) .
A 331 nucleotide sequence was obtained from PCR-based cDNA clones of the CMV-Royalty satRNA. Due to the primers used for cDNA synthesis and PCR amplification of the cDNA prior to cloning, five bases were apparently absent from the
5' end and one from the 3' end of the sequence obtained from
135 the PCR-based cloning experiment. To obtain the apparently missing bases the cloning experiment was repeated using primers specific for the full-length sequence, and without the PCR amplification step. No completely full-length clones were obtained, but the complete sequence was obtained by aligning the cloned segments- A 338 nucleotide sequence was obtained from the clones (Fig. 35) . Only one clone
(p5261-20-t3; Fig. 35) had the 5' bases of interest, but they were consistent with those of other published sequences
(Francki, 1985; Garcia-Arenal et al., 1987; Hidaka et ai.,
1988; Hidaka et ai., 1984; Kurath and Palukaitis, 1987).
Several clones had the 3' end of the molecule, but there was apparent variation. However, clone p5262-22-t3 (Fig. 35) and clone 5261-24-t7 (not shown) have the same ten 3' bases (5'-
ACCAGGACCC-3'), so it seems likely that this sequence is correct.
Of the ten satRNA sequences used to design the primers used for the cloning experiments, G-satRNA has the highest percent identity to Royalty satRNA (92.9%), followed by E- satRNA (91.5%), Bl-satRNA (91.1%), B2-satRNA (90.9%) and B3- satRNA (90.5%). The others have less than 90% identity to
Royalty satRNA (Table 3). Of the 11 satRNA sequences obtained from the BLASTN database search having the greatest homology to Royalty satRNA, accession number z75876 had the
136 greatest percent identity (94.7%). The other ten ranged
from 92% to 94.4% homologous (Table 4). A bootstrapped
phylogenetic tree composed of Royalty satRNA and the 21 CMV
satRNAs used in Figs. 36 and 37 showed that Royalty satRNA
is most closely related to E-satRNA, G-satRNA and j02060
(Fig. 38). However, the bootstrap values for the branches
where Royalty satRNA splits from E-satRNA and G-satRNA are
very low (<500), indicating low reliability for these
branches.
Several nucleotides at key positions have been
implicated in a severe chlorosis disease phenotype induced
by CMV satRNAs on either tobacco or tomato. A nucleotide
change at position 149 from a U (T in cDNA sequences in
Figs. 35,36,37) to a C alters host specificity of chlorosis
induction from tomato to tobacco (Sleat and Palukaitis,
1992). The nucleotide at position 149 is a C in the CMV-
Royalty satRNA sequence (Fig. 35), which suggests the
chlorosis phenotype should be induced in tobacco by this
satRNA. However, several other nucleotide positions also play a role in the chlorosis phenotype. Nucleotide 127 is
reported to be a G in non-chlorosis inducing satRNAs and an
A in chlorosis-inducing satRNAs; nucleotide 148 is a G in
chlorosis-inducing satRNAs and an A in non-chlorosis
inducing satRNAs; and nucleotide 153 is a U (T in cDNA
sequence) in all chlorosis-inducing satRNAs and deleted in
137 all others (Sleat and Palukaitis, 1992). In the CMV-Royalty
satRNA sequence nucleotide 127 is a G, 148 is an A, and 153
is deleted, and these four positions were conserved among
the various Royalty satRNA clones (Fig. 35). The deletion
at position 153 is shown in Figure 36. These results suggest
that the CMV-Royalty satRNA is a non-chlorosis inducing
satRNA, even though the nucleotide at position 149 indicates
induction of chlorosis on tobacco. Indeed, these results
are consistent with the mild mosaic symptom on N.
clevelandii (Fig. 21), and symptoms observed on N. tabacum
'Glurk' and 'Samsun' (Figs. 8,9,10), which include mild mosaic and vein clearing, but not the brilliant chlorosis
described for chlorosis-inducing satRNAs (Sleat and
Palukaitis, 1992). However, it has also been reported that
induction of severe chlorosis on tobacco is influenced by
the helper strain of CMV. CMV subgroup I strains Fny, Pf,
and Uh induce a mild mosaic when associated with B2 and WL3
satRNA, but CMV subgroup II strains LS, SB, U, WL, Q, and 2A
induce severe chlorosis when associated with these satRNAs
(Sleat and Palukaitis, 1990a). Since CMV-Royalty is a subgroup I helper strain, one might expect the symptoms induced by the satRNA on tobacco to be milder if the satRNA were chlorosis-inducing. The results may have been different with a subgroup II helper strain. The nucleotides
138 at positions 127, 148, 149, and 153 are consistent with the
CMV-Royalty satRNA being a non-chlorosis inducing satellite, and the symptoms on tobacco are in agreement.
Except for two sharply defined regions of variability, nucleotide sequences of necrogenic satRNA variants are reported to be essentially conserved with the 5* 223 bases being identical. In contrast, non-necrogenic satRNA variants have at least nine variable regions, five of which are in the 5' two thirds of the molecule (Kaper at al.,
1988) . When aligned with the necrogenic D-satRNA, the CMV-
Royalty satRNA differs from D-satRNA in no less than 14 nucleotide positions in the 5' 220 bases of the molecule
(Fig. 39) . It has also been reported that the greatest number of nucleotide differences between necrogenic and ameliorative satRNAs are located in the 3' one third of the molecule between nucleotides 28 6-310, within which no ameliorative satRNAs contain the same sequence as their necrogenic counterparts (Sleat and Palukaitis, 1990).
Necrogenic satRNAs also have a three base deletion relative to their non-necrogenic counterparts. In D-satRNA this deletion is between nucleotides 300-302 (Sleat and
Palukaitis, 1990). The CMV-Royalty satRNA appears not to have the three-base deletion present in D-satRNA, as shown in Figure 39, in the region of nucleotide 290.
139 1 10 20 30 40 50 60 roysat GTTTTGTTTGTTAGAGAACTGCGTAGAGGGGTTGTATCTACGTGA.GGAICTGTCACTCGG dsat GTTTTGTTTGATGGAGAATTGCGCAGAGGGGTTATATCTGCGTGAGGATCTGTCACTCGG
70 80 90 100 110 120 roysat CGGTGTGGGTTACCTCCCTGCTACGGCGGGTIGAGTTGACGCACCTCGGACTGGGGACCG dsat CGGTGTGGGATACCTCCCTGCIAAGGCGGGTTGAGTGATGTTCCCTCGGACTGGGGACCG ***************** 149 1271 130 14014811 1153 160 170 180 roysat CTGGCTTGCGAGCTATGTCCGCTACTCTCAGCACTACGCACTCATTTGAGCCCCCGCTCA dsat CTGGCTTGCGAGCTATGTCCGCTACTCTCAGTACTACACTCTCATTTGAGCCCCCGCTCA
190 200 210 220 230 240 roysat GTTTGCTAGCAAAACCCGGCCCATGGTTTGCCGTTACCGTGGACTTTCGAAAGAAACACT dsat GTTTGCTAGCAGAACCCGGCACATGGTTCGCCGATACTATGGATTTTCTAAAGAAACACT
250 260 270 280 290 300 roysat CTGTTAGGTGGTATCGTGGATGACGCACACAGGGAGAGGCTAAAACCTATATGGTCATGC dsat CTGTTAGGTGGTAXGAGTCATGACGCACGCAGGGAGAGGCTAAGGCTTAT GCTATGC ************** ********* **************
310 320 330 roysat TGATCTCCGCGTATGTACATCATACCTTACCAGGACCC 3 ' dsat TGATCTCCGTGAATGTCTATCATTCCTCTGCAGGACCC
Figure 39. CLUSTAL W (1.74) sequence alignment of CMV- Royalty satRNA (roysat) and the necrogenic CMV-D satRNA (dsat). A * beneath a given position indicates a conserved base. A - at a given position indicates a base deletion with respect to the other satRNA. Nucleotide positions 127, 148, 149 and the deletion (T missing between C and T) at 153 are indicated in bold, as published (Sleat and Palukaitis, 1992).
140 There are also four other regions of variability between
nucleotides 280-320 in D-satRNA relative to Royalty satRNA
(Fig. 39). These differences indicate that Royalty satRNA
is a non-necrogenic satRNA.
'Rutgers' tomato plants/ commonly used as an assay host
for necrogenic CMV satRNAs (Collmer and Kaper, 1988; White
and Kaper, 1987), were either asymptomatic or developed very
mild mosaic and leaf distortion when inoculated with CMV-
Royalty (Figs. 19,20). There was no evidence of lethal
necrosis in any of the tomato plants after more than 45
days. It has been reported that contamination of a non- necrogenic satRNA isolate by as little as 0.5% of a necrogenic satRNA can cause the tomato necrosis death of
100% of the test plants (Kaper et al., 1988). The mild
symptoms observed on tobacco and the asymptomatically
infected 'Rutgers' tomato, along with the sequence data, demonstrate that CMV-Royalty satRNA is an ameliorative and not a necrogenic satRNA. Further, since tomato necrosis was not observed in any of the test plants it seems unlikely that the CMV-Royalty satRNA is a mixed population of ameliorative and necrogenic variants.
Host range results showed that the CMV-Royalty isolate induces the most severe symptoms on 'Black Beauty' squash, with symptoms being milder on cucumber, and even milder on
141 pumpkin. Additionally, the symptoms on squash 'Black
Beauty' developed more rapidly than on cucumber, and the
symptoms on cucumber developed more rapidly than on pumpkin.
No local lesions developed on squash cultivars 'Black
Beauty', 'Black Zucchini', and 'Spaghetti', cucumber or pumpkin cotyledons inoculated with CMV-Royalty. However,
'Spaghetti' squash cotyledons inoculated with CMV-Fny developed chlorotic local lesions followed by systemic mosaic, and symptoms on 'Black Zucchini' squash included curling of true leaves and transparent leaf laminae.
Therefore it is likely that CMV-Royalty is not the same strain as CMV-Fny.
Cowpea, which is a local lesion host for CMV (Francki et al., 1979), never developed definitive chocolate-brown local lesions on CMV-Royalty-inoculated cotyledons in any of the three replications. There were a few instances where a few suspect spots appeared, but none were obvious. CMV-Y infects cowpea systemically (Francki et al., 1979), but
ELISA confirmed that there was no systemic infection by the
CMV-Royalty isolate. It may be that the latter is unable to induce local lesions or systemic infection in cowpea.
French bean, likewise, was not infected locally or systemically by CMV-Royalty in any of the host range replications. It seems likely that this CMV isolate is
142 unable to infect this host, and it is not unprecedented for
certain strains not to infect Phaseolus spp. For example,
CMV-C is not able to infect P. vulgaris cultivars
systemically but CMV-B is (Prowidenti, 1976) .
Neither 'Peto 696' nor 'Nema 1401* tomatoes, two
processing cultivars, were systemically infected by CMV-
Royalty, as judged by the absence of symptoms and confirmed
by ELISA. No virions were observed in a purified
preparation, as confirmed by TEM and ELISA. Likewise, no
evidence of the CMV coat protein was observed when the
purified preparation was subjected to SDS-PAGE. CMV-
Royalty- infected 'Rutgers' tomato, confirmed by ELISA,
showed either a very mild mosaic or no symptoms more than 45
days following inoculation. Several explanations for these
results are possible. First, there may be a CMV resistance
gene present in 'Peto 696' and 'Nema 1401' tomatoes that is
preventing infection by CMV-Royalty. The inability of CMV-D
and associated necrogenic D-satRNA to induce necrosis in L.
hlrsutum, L. cheesemanii, L. parvlflorum, and L. peruvianum
accessions has been reported (White and Kaper, 1987). It has also been reported that 96 tomato cultivars all reacted necrotically to CMV-D and D-satRNA (White and Kaper, 1987) .
More recently, resistance to CMV has been identified in i.
chilense, and again in L. peruvianum and L. hlrsutum lines
143 ( s tamo va et al.,- 1990; Gebre-Selassie et al., 1990;
Stoiiaenova and Sotirova, 1991), but there does not appear to be CMV resistance bred into tomato cultivars at this time.
The latter does not rule out the possibility that 'Peto 696' and 'Nema 1401' do not have resistance genes to CMV. The infection of 'Rutgers' tomato by CMV-Royalty demonstrates that this isolate is capable of infecting tomato, suggesting that there may be CMV resistance genes in the other two cultivars. Another explanation could be that the seedlings were inoculated at too late a growth stage.
DsRNA analysis of symptomatic cucumber and 'Black
Beauty' squash plants inoculated with CRPZ-Royalty showed a dsRNA banding pattern consistent with that of CMV and an associated satRNA (Dodds et al., 1984; Valverde et al.,
1990). However, the dsRNAs appeared reduced, especially the apparent dssatRNA, in cucumber relative to 'Black Beauty' squash and M. tabacum 'Glurk' (Fig. 22). These results are consistent with reports that satRNA replication in cucurbits is generally poor, while replication in solanaceous hosts, such as tobacco, is more efficient (Roossinck et al., 1992).
It has also been reported that efficient replication of the
WLl satRNA in 'Black Beauty' squash is helper strain- dependent. CMV-Fny replicates the WLl satRNA efficiently in all hosts, including 'Black Beauty' squash. CMV-Sny,
144 however, is incapable of efficiently replicating the WLl
satRNA in this squash cultivar, and this inability to
support efficient satRNA replication maps to RNA 1 of the
helper virus genome (Roossinck and Palukaitis, 1991). The
dsRNA data seem to indicate that CMV-Royalty is capable of
efficiently replicating its satRNA in tobacco and 'Black
Beauty' squash, but replication is not as efficient in
cucumber based on the accumulation of dssatRNA (Fig. 22).
DsRNA analysis of 'Rutgers' tomato infected with CMV-
Royalty produced a CMV-like banding pattern, including dssatRNA, in 5 of 6 plants tested. The profile from the sixth plant lacked dssatRNA, but clearly showed genomic dsRNAs (Fig. 24). Several explanations for these results are possible. First, the plant in which no dssatRNA was evident may represent a case where the satRNA was not transmitted to the host along with the genomic RNAs.
Interestingly, the plant where no dssatRNA was evident also showed a mild mosaic symptom and slight distortion of the leaflets. The other five plants in which dssatPJSLA was evident all remained asymptomatic (Fig. 23). It has been proposed that dssatRNA plays a role in the disease modulating effects of satRNAs (Habili and Kaper, 1981), and the synthesis of dssatRNA is a way of sequestering free (+) and (-) satRNA strands to better bring the replicase enzyme's synthetic activity into balance with respect to
145 synthesis of both types of strands (Ka p e r 1982) . The more
balanced synthesis of satRNA molecules of both polarities
proceeds until viral RNA synthesis is out competed and
virtually arrested (Kaper, 1982). Clearly, the dssatRNA
accumulated to high levels in the five 'Rutgers' plants
(Fig. 24) . Interestingly, there is also another dsRNA band,
possibly a subgenomic RNA, evident in samples expressing
dssatRNA that is not visible in the sample not showing
dssatRNA (Fig. 24), but this could be coincidental.
A second explanation for the accumulation of dssatRNA
in five of the six CMV-Royalty-infected 'Rutgers' plants may
have to do with the host plant. Since these plants were
grown from seed and there is the potential for genetic
variability, the possibility exists that an unknown host
factor, which plays a role in a satRNA's ability to
replicate in a particular host, may be absent from the plant
not expressing dssatRNA.
Clearly CMV-Royalty belongs to the serological subgroup
I group of CMV strains, and supports a satRNA which is 338 nucleotides long. CMV-Royalty appears to be able to efficiently support satRNA replication in 'Black Beauty'
squash, which differs from subgroup I strain CMV-Sny, but is similar to subgroup I strain CMV-Fny (Roossinck and
Palukaitis, 1991). Its support of satRNA replication in cucumber appears to be not as efficient as in 'Black Beauty'
146 squash or N. tabacum 'Glurk'. The host range results show
that CMV-Royalty is not able to infect P. vnlgaxis, V.
unguiculatar and L. esculentum 'Peto 696' or 'Nema 1401',
but can infect L. esculentum 'Rutgers' . Based on the
symptoms observed on tobacco, 'Rutgers' tomato, and the
nucleotide sequence data, the CMV-Royalty satRNA appears to be a non-chlorosis inducing satRNA. Further, the symptoms on 'Rutgers' tomato and the nucleotide sequence data demonstrate this satRNA is non-necrogenic and more likely ameliorative.
Due to the quasi-species nature of RNA virus genome populations (Domingo et al., 1985; Steinhauer and Holland,
1987) the possibility existed that the initial cloned sequence obtained for the CMV-Royalty satRNA did not represent the master sequence of this satRNA due to a random selection event during cloning. Heterogeneity within natural populations of CMV satRNAs has been reported, and sites of nucleotide sequence microheterogeneity in natural populations of 81 and D-satRNA, but not WL-1 satRNA, have been identified (Kurath and Palukaitis, 1989a).
The possibility of sequence errors introduced into the clones by reverse transcriptase or Tag polymerase also exists. Tag DNA polymerase infidelity has been estimated to be 2.1 X 10"“* errors per base per amplification cycle, with
147 mutations predominating at transitions from A or T to G or
C, respectively (Keohavong et al., 1989). For those two reasons the Royalty satRNA was recloned without a PCR amplification step to eliminate the possiblity of errors introduced by Taq polymerase. Independent cDNA clones were sequenced to confirm the previously obtained sequence. The nucleotide sequence data from both cloning experiments, indicating a non-chlorosis inducing phenotype (nucleotide positions 127, 148, 149, 153), were in complete agreement.
Likewise, the sequences indicating a non-necrogenic phenotype were in agreement and correlate well with the ameliorative phenotype of the CMV-Royalty satRNA, as shown by symptoms observed on tobacco and 'Rutgers' tomato.
However, the Royalty satRNA is 338 nucleotides long instead of the expected 337 nucleotides. This is explained by an additional T residue near the 5' end of the molecule that was apparently deleted in the PCR-based clones (Fig. 35).
148 CHAPTER 4
SATISFYING KOCH'’S POSTULATES FOR CMV-ROYALTY AND AJUGA
REPTANS AND EVIDENCE FOR CULTIVAR-SPECIFIC ACCUMULATION OF
DOUBLE-STRANDED SATELLITE RNA
Introduction
To attempt to satisfy Koch's postulates with respect to
symptoms induced by CMV-Royalty on A. reptans 'Royalty' was
impossible because of our inability to locate or produce virus-free plants. As an alternative approach, A. reptans plants were grown from commercially produced seed and used as the host for CMV-Royalty.
A hypothesis for the accumulation of dssatRNA was that dssatRNA accumulated in A. reptans in a cultivar-specific manner since dssatRNA was observed in the cultivars
'Royalty' and 'Rainbow' but never 'Bronze Beauty' . To test this hypothesis A. reptans 'Bronze Beauty' and A. reptans grown from seed were inoculated with CMV-Royalty.
149 Materials and Methods
Ajuga reptans seed was obtained from a commercial
grower (Jelitto Perennial Seeds, Louisville, KY.) and the
seed sown in a half-gallon pot containing Metro Mix 250
soilless media. The seed was germinated under mist and the
resulting seedlings transplanted into four inch pots
containing soilless media. The plants were grown in a
greenhouse for approximately 60 days, and tested for CMV and
AMV by ELISA prior to inoculation with the CMV-Royalty
isolate. Commercially grown A. reptans 'Bronze Beauty''
plants were tested for CMV, AMV, TSV, TAV, TSWV, INSV, TMV,
PVX and the 7 5 potyviruses prior to inoculation.
Groups of ten A. reptans seedlings were inoculated with
either semi-purified CMV-Royalty or crude sap prepared by
grinding CMV-Royalty infected N. tabacum 'Glurk' in 0.02 M
sodium phosphate buffer (pH 7.0) containing 0.1%
thioglycollic acid, and rubbing the inoculum on celite- dusted leaves, or slash-inoculating the plants by dragging a
sterile razor blade through the inoculum and then cutting off A. reptans leaves. Ten 'Bronze Beauty' plants were also
slash-inoculated using CMV-Royalty sap prepared in 0.03 M sodium phosphate buffer (pH 7.0) containing 0.1% thioglycollic acid. In all experiments one or two plants were mock-inoculated with buffer as a negative control.
150 Four A. reptans grown from seed and four A. reptans 'Bronze
Beauty' were aphid-inoculated as previously described, and one plant mock-inoculated as a control. The inoculated plants were kept in the greenhouse or a growth chamber (12 hour day/night; 18°C) and observed for symptoms. All inoculated plants were tested for CMV by ELISA.
Results
Fifty-eight A. reptans seedlings grown from commercially produced seed were tested for CMV and AMV by
ELISA prior to inoculation with CMV-Royalty. All were negative for both viruses. Leaf-rub inoculation with semi purified CMV-Royalty or crude sap failed to infect any A. reptans seedlings, as did aphid-inoculation. Slash- inoculation of A. reptans grown from seed and commercially grown A. reptans 'Bronze Beauty' produced a single infected plant, which was one grown from seed. The plant showed a mild mosaic on several older leaves. The presence of CMV was confirmed by ELISA. DsRNA analysis of the plant revealed two faint bands in the gel near RNAs 1, 2 and 3 of
CMV-Royalty (Fig. 40) , but no dssatRNA was evident. An attempt to back-inoculate CMV-Royalty from the infected A. reptans seedling to N. tabacum 'Glurk' failed.
151 Figure 40. 10% polyacrylamide gel electrophoresis of dsRNA extracted from A. reptans seedling inoculated with CMV-Royalty, ELISA positive for CMV subgroup I. Lane 1: 150 ng CMV-Royalty dsRNA purified from N. tabacum 'Glurk'; lane 2: dsRNA purified from A. reptans seedling inoculated with CMV-Royalty; lane 3: dsRNA purified from N. rustica aphid-inoculated with CMV from A. reptans 'Royalty' . Arrows indicate dssatRNA band
152 Discussion
One hypothesis we had was that the CMV satRNA was
replicated in A. reptans in a cultivar-specific manner. We
suspected this scenario because of our observation of
dssatRNA in the CMV-infected cultivars 'Royalty' and
'Rainbow', but never 'Bronze Beauty'. We initially included
'Burgundy Glow' as a cultivar in which dssatRNA did not
accumulate, until several samples showing evidence of satRNA were obtained. To test the hypothesis we inoculated 'Bronze
Beauty', a cultivar suspected of not supporting satRNA
replication, with the CMV-Royalty isolate which was isolated
from a cultivar which expressed high levels of dssatRNA.
The apparent difficulty in mechanically transmitting this
CMV isolate could be a characteristic of the isolate itself or there could be inhibitors in A. reptans that made transmission difficult. The single seedling that was infected with the CMV-Royalty isolate showed no evidence of dssatRNA accumulation, but there was evidence of double stranded genomic RNAs. Several explanations are possible for this observation. First, the satRNA was not transmitted to the A. reptans plant along with the CMV genomic RNAs.
This result may be a similar phenomenon to the host range results described in Chapter 3 for 'Rutgers' tomato, where one CMV-Royalty-infected plant did not express dssatRNA but
153 five others did. Second, this observation could be viewed as
evidence that efficient satRNA replication may be host
cultivar-specific with respect to A, reptans. It has been
reported that, generally, satRNA replication in cucurbits is poor while replication in solanaceous hosts is good
(Roossinck et ai., 1992). It has also been reported that efficient satRNA replication in 'Black Beauty'' squash is influenced by the CMV helper strain (Roossinck and
Palukaitis, 1991) . Back-inoculation from the infected A. reptans plant to N. tabacum 'Glurk', to see if dssatRNA accumulated, was unsuccessful as determined by ELISA.
Back-inoculâtion of CMV-Royalty into A. reptans
'Royalty' to satisfy Koch's postulates was impossible due to our inability to locate commercially grown, virus-free plants and our failure to obtain virus-free plants grown from seed collected from CMV-infected 'Royalty'. The mild symptoms observed on the CMV-Royalty-infected A. reptans plant grown from seed were unlike the ringspots and mosaic observed on CMV-infected 'Royalty' . These results are not surprising, since the commercially produced seed was of an unnamed cultivar or variety, so there is bound to be genetic variability in the plants grown from that seed. Genetic variation between A. reptans cultivars could play a role in a particular cultivar's ability to support satRNA
154 replication and the symptoms induced on that cultivar by a particular virus.
155 LIST OF REFERENCES
Avila-Rincon, M.J., Collmer, C.W., and J.M. Kaper. 1986. In vitro translation of cucumoviral satellites. II. CARNA5 from cucumber mosic virus strain S and SP6 transcript of cloned (S)CARNA 5 cDNA produce electrophoretically comigrating protein products. Virology 152: 455-458.
Clark, M.F. and A.N. Adams. 1977. Chracteristics of the microplate method of enzyme-linked immunosorbent assay for detection of plant viruses. J.Gen. Virol. 34: 475-83.
Collmer, C.W. and S.H. Howell. 1992. Role of Satellite RNA in the Expression of Symptoms Caused by Plant Viruses. Ann. Rev. Phytopathol 30: 419-442.
Collmer, C.W., and J.M. Kaper. 1988. Site-directed mutagenesis of potential protein coding regions in expressible cloned cDNAs of cucumber mosaic viral satellites. Viroloav 163: 293-298.
Devic, M., Jaegle, M. , and D. Baulcomb. 1990. Cucumber mosaic virus satellite RNA (strain Y): analysis of sequences which affect systemic necrosis on tomato. J. Gen. Virol. 71: 1443-1449.
Devic, M., Jaegle, M ., and D. Baulcombe. 1989. Symptom Production on Tobacco and Tomato is Determined by Two Distinct Domains of the Satellite RNA of Cucumber Mosaic Virus (Strain Y). J. Gen. Virol. 70: 2765-2774.
Di, R., Hill, J.H., and A.H. Epstein. 1984. Double Stranded RNA Associated with Rose Rosette Disease of Multiflora Rose. Plant Dis. 74: 56-58.
Dodds, J.A., Morris, T.J., and R.L. Jordan. 1984. Plant Viral Double-Stranded RNA. Ann. Rev. Phytopathol. 22: 151- 168 .
156 Domingo, E., Martinez-Salas, E., Sobrino, F., de la Torre, J.C., Portela, A., Ortin, J., Lopez-Galindez, C ., Perez- Brena, P., Villanueva, N., Najera, R., VandePol, S., Steinhauer, D., DePolo, N., and J. Holland. 1985. The Quasispecies (extremely heterogeneous) Nature of Viral RNA Genome Populations: Biological Relevance-A Review. Gene : 1474. 1-8.
Edwards, M.C. and D. Gonsalves. 1983. Grouping of Seven Biologically Defined Isolates of Cucumber Mosaic Virus by Peptide Mapping. Phytopathology 73: 1117-1120.
Fisher, J.R. and S.T. Nameth. 1997. Cucumber Mosaic Virus, Tobacco Streak Virus, and Cucumber Mosaic Virus Satellite RNA Associated With Mosaic and Ringspot Symptoms in Ajuga reptans in Ohio. Plant Dis. 81, No. 10: 1214.
Francki, R.I.B. 1985. Plant Virus Satellites. Ann. Rev. Microbiol. 39: 151-74.
Francki, R.I.B., Mossop, D.W. and T. Hatta. 1979. Cucumber Mosaic Virus. No. 213 (No. 1 revised) in CMI/AAB Descriptions of Plant Viruses. Commonw. Mycol. Inst., Assoc. Applied Biologists, Kew, Surrey, England, pp. 1-5.
Fulton, R.W. 1985. Tobacco Streak Virus. No. 307 (Nos. 44 and 106 revised) in CMI/AAB Descriptions of Plant Viruses. Commonw. Mycol. Inst., Assoc. Applied Biologists, Kew, Surrey, England. Pp. 1-4.
Gal-On, A., Kaplan, I., and P. Palukaitis. 1995. Differential Effects of Satellite RNA on the Accumulation of Cucumber Mosaic Virus RNAs and Their Encoded Proteins in Tobacco vs Zucchini Squash with Two Strains of CMV Helper Virus. Virology 208: 58-66.
Garcia-Arenal, F., Zaitlin, M., and P. Palukaitis. 1987. Nucleotide Sequence Analysis of Six Satellite RNAs of Cucumber Mosaic Virus : Primary Sequence and Secondary Structure Alterations Do Not Correlate With Differences in Pathogenicity. Virology 158: 339-347.
Gebre-Selassie, K., Laterrot, H., Marchoux, G., Ragozzino, A., and F. Sacchardo. 1990. Resistance to Potato Virus Y and Cucumber Mosaic Virus in Lycoperslcon hirsutum. Tomato Genet. C o o p . Rpt. 40: 12-13.
157 Gonsalves, D., Prowidenti, R. and M.C. Edwards. 1982. Tomato White Leaf: The Relation of an Apparent Satellite RMA and Cucumber Mosaic Virus. Phytopathology 72: 1533-1538.
Habili, N. , and J.M. Kaper. 1981. Cucumber Mosaic Virus- Associated RNA 5: VII. Double-Stranded Form Accumulation and Disease Attenuation in Tobacco. Virology 112: 250-261.
Hidaka, S., Hanada, K., and K. Ishikawa. 1990. In vitro messenger properties of a satellite RNA of cucumber mosaic virus. J. Gen. Virol. 71: 439-442.
Hidaka, S., Hanada, K., Ishikawa, K., and K. Miura. 1988. Complete nucleotide sequence of two new satellite RNAs associated with cucumber mosaic virus. Virology 164: 326- 333.
Hidaka, S., Ishikawa, K., Takanami, Y., Kubo, S. and K.I. Miura. 1984. Complete nucleotide sequence of RNA 5 from cucumber mosaic virus (strain Y). FEBS Letters, vol. 174, number 1. 38-42.
Jaegle, M . , Devic, M., Longstaff, M., and D. Baulcombe. 1990. Cucumber mosiac virus satellite RNA (Y strain): analysis of sequences which affect yellow mosaic symptoms on tobacco. J. Gen. Virol. 71: 1905-1912.
Jaspars, E.M.J. and L. Bos. 1980. Alfalfa Mosaic Virus. No. 229 (No. 4 6 revised) in CMI/AAB Descriptions of Plant Viruses. Commonw. Mycol. Inst., Assoc. Applied Biologists, Kew, Surrey, England. Pp. 1-4.
Kaper, J.M., Tousignant, M.E., and M.T. Steen. 1988. Cucumber Mosaic Virus-Associated RNA 5. XI. Comparison of 14 CARNA-5 Variants Relates Ability to Induce Tomato Necrosis to a Conserved Nucleotide Sequence. Virology 163: 284-292.
Kaper, J.M. 1982. Rapid Synthesis of Double-Stranded Cucumber Mosaic Virus RNA 5: Mechanism Controlling Viral Pathogenesis? Biochem. Bioohys. Res. Commun. 105: 1014-1022.
Kaper, J.M., Tousignant, M.E., Diaz-Ruiz, J.R., and S.A. Tolin. 197 8. Peanut Stunt Virus-Associated RNA 5: Second Tripartite Genome Virus with an Associated Satellite-like Replicating RNA. Virology 88: 166-170.
158 Kaper, J.M. and H.E. Waterworth. 1977. Cucumber Mosaic Virus Associated RNA 5: Causal Agent for Tomato Necrosis. Science 196: 429-431.
Keohavong, P., and W.G. Thilly. 1989. Fidelity of DNA Polymerases in DNA Amplification. Proc. Natl. Acad. Sci. USA. 86: 9253-9257.
Kristensen, H.R. 1956. Virus Diseases of Cucumber in Denmark. Horticultura 10: 161-172.
Kura th.. G., and P. Palukaitis. 1989. Satellite RNAs of Cucumber Mosaic Virus : Recombinants Constructed in vitro Reveal Independent Functional Domains for Chlorosis and Necrosis in Tomato. Molecular-Plant Microbe Interactions. Vol. 2, No. 3: 91-96.
Kurath, G . and P. Palukaitis. 198 9a. PHA Sequence Heterogeneity in Natural Populations of Three Satellite RNAs of Cucumber Mosaic Virus. Virology 173, 231-240.
Kurath, G . and P. Palukaitis. 1987. Biological Activity of T7 Transcripts of a Prototype Clone and a Sequence Variant Clone of a Satellite RNA of Cucumber Mosaic Virus. Virology 159, 199-208.
Lot, H., Marchoux. G., Marrou, J., Kaper, J.M., West, C.K., Van Vloten-Doting, L ., and R . Hull. 1974. Evidence for Three Functional RNA Species in Several Strains of Cucumber Mosaic Virus. J. Gen. Virol. 22: 81-93.
Lot, J.M., Marrou, J., Quiot, J.B, and C. Esvan. 1972. Contribution A L'Etude Du Virus De La Mosaique Du Concombre (CMV). Ann. Phytopathol. 4(1): 25-38.
Masuta, C ., Suzuki, M., Kuwata, S., Takanami, Y., A. Koiwai. 1993. Yellow Mosaic Symptoms Induced by Y Satellite RNA of Cucumber Mosaic Virus is Regulated by a Single Incompletely Dominant Gene in Wild Nicotiana Species. Phytopathology 83: 411-413 .
Masuta, C. and Y. Takanami. 1989. Determination of Sequence and Structural Requirements for Pathogenicity of a Cucumber Mosaic Virus Satellite RNA (Y-satRNA) . The Plant Cell, vol. 1: 1165-1173.
159 Moriones, E., Diaz, I,, Rodriguez-Cerezo, E ., Fraile, A., and F. Garcia-Arenal. 1992. Differential Interactions among Strains of Tomato Aspermy Virus and Satellite RNAs of Cucumber Mosaic Virus. Virology 18 6: 475-480.
Mossop, D.W. and R.I.B. Francki. 1979. Comparative Studies on Two Satellite RNAs of Cucumber Mosaic Virus. Virology 95: 395-404.
Morris, T.J. and J.A. Dodds. 1979. Isolation and analysis of double stranded RNA from virus-infected plant and fungal tissue. Phytopathology 69: 854-858.
Murant, A. F. and M.A. Mayo. 1982. Satellites of Plant Viruses. Ann. Rev. Phytopathol 20: 49-70.
Owen, J. and P. Palukaitis. 1988. Characterization of Cucumber Mosaic Virus I. Molecular Heterogeneity Mapping of RNA 3 in Eight CMV Strains. Virology 166: 495-502.
Palukaitis, P. 1988. Pathogenicity Regulation by Satellite RNAs of Cucumber Mosaic Virus : Minor Nucleotide Sequence Changes Alter Host Responses. Molecular Plant-Microbe Interactions, vol.l. No. 4: 175-181.
Piazzolla, P., Tousignant, M.E., and J.M. Kaper. 1982. Cucumber Mosaic Virus-Associated RNA 5: IX. The Overtaking of Viral RNA Synthesis by CARNA5 and dsCARNA5 in Tobacco. Virology 122: 147-157.
Prowidenti, R., Robinson, R.W. and J.W. Shail. 1980. A Source of Resistance to Cucumber Mosaic Virus in Lactuca saligna L. for Lettuce (L. sativa L.) . HortScience 15: 582- 589.
Prowidenti, R. 1976. Reaction of Phaseolus and Macroptilum Species to a Strain of Cucumber Mosaic Virus. Plant Disease Reporter, vol. 60, No. 4: 289-293.
Roossinck, M.J., Kaplan, I., and P. Palukaitis. 1997. Support of a Cucumber Mosaic Virus Satellite RNA Maps to a Single Amino Acid Proximal to the Helicase Domain of the Helper Virus. Journal of Virology, vol. 71: 608-612.
Roossinck, M.J., Sleat, D., and P. Palukaitis. 1992. Satellite RNAs of Plant Viruses : Structures and Biological Effects. Microbiol. Rev., vol. 56, No. 2: 265-279.
160 Roossinck,- M.J., and P. Palukaitis. 1991. Differential Replication in Zucchini Squash of a Cucumber Mosaic Virus Satellite RNA Maps to RNA 1 of the Helper Virus. Virology 181: 371-373.
Ross, A.F. 1940. The Concentration of Alfalfa Mosaic Virus in Tobacco Plants at Different Periods of Time After Inoculation. Phytopathology 31: 410-420.
Schroeder, W.T. and R. Prowidenti. 1972. Alfalfa Mosaic Virus in Ajuga reptans. Plant Disease Reporter 56: p. 285.
Shukla, D.D. and K.H. Gough. 1983. Tobacco Streak, Broad Bean Wilt, Cucumber Mosaic, and Alfalfa Mosaic Viruses Associated with Ring Spot of Ajuga reptans in Australia. Plant Dis. 67: 221-23.
Sleat, D.E. and P. Palukaitis. 1990. Site-Directed Mutagenesis of a Plant Viral Satellite RNA Changes i f s Phenotype from Ameliorative to Necrogenic. Proc. Natl. Acad. Sci. USA, vol. 87: 2946-2950.
Sleat, D.E. and P. Palukaitis. 1990a. Induction of Tobacco Chlorosis by Certain Cucumber Mosaic Virus Satellite RNAs is Specific to Subgroup II Helper Strains. Virology 17 6: 292- 295.
Sleat, D.E. and P. Palukaitis. 1992. A Single Nucleotide Change Within A Plant Virus Satellite RNA Alters the Host Specificity of Disease Induction. The Plant Journal 2: 43- 49.
Stamova, L., Christova, D ., and M. Yordanov. 1990. Resistance to Cucumber Mosaic Virus (CMV). Tomato Genet. Coop. Rpt. 40: 33-34.
Steinhauer, D.A., and J.J. Holland. 1987. Rapid Evolution of RNA Viruses. Ann. Rev. Microbiol. 41: 409-433.
Stoimenova, E ., and V. Sotirova. 1991. Resistance of Tomato Lines From the Three-Genome Hybrid Lycoperslcon esculentum- L. chilense-L. peruvianum var. humifusm to the Cucumber Mosaic Virus (CMV). Tomato Genet. Coop. Rpt. 41: 54-55.
Valverde, R.A., Nameth, S.T. and R.L. Jordan. 1990. Analysis of Double-Stranded RNA for Plant Virus Diagnosis. Plant Dis. 74: 255-258.
161 White, J.L. and J.M. Kaper. 1987. Absence of Lethal Stem. Necrosis in Select Lycoperslcon spp. Infected by Cucumber Mosaic Virus Strain D and Its Necrogenic Satellite CARNA5. Phytopathology 77: 808-811.
Zaitlin, M. and H.W. Israel. 1975. Tobacco Mosaic Virus (type strain). No. 151 in CMI/AAB Descriptions of Plant Viruses. Commonw. Mycol. Inst., Assoc. Applied Biologists, Kew, Surrey, England.
162 APPENDIX A
ELISA Buffers
POST Buffer (wash buffer)
Dissolve in distilled water to 1000 m l .:
Sodium chloride 8.0 g Sodium phosphate dibasic (anhydrous) 1.15 g Potassium phosphate monobasic (anhydrous) 0.2 g Potassium chloride 0.2 g Tween-20 0.5 g
Adjust pH to 7.4
Coating Buffer
Dissolve in distilled water to 1000 ml.:
Sodium carbonate (anhydrous) 1.59 g Sodium bicarbonate 2.93 g Sodiura azide 0.2 g
Adjust pH to 9.6. Store at 4°C
DAS Extraction Buffer
Dissolve in 1000 ml. IX PBST:
Sodium sulfite (anhydrous) 1.3 g Polyvinylpyrrolidone (PVP) (MW 24-40,-000) 20.0 g Sodium azide 0.2 g Powdered egg (chicken) albumin, Grade II 2.0 g Tween-20 20.0 g
Adjust pH to 7.4. Store at 4°C.
163 Indirect Extraction Buffer
Dissolve in distilled water to 1000 ml.
Sodium carbonate (anhydrous) 1.59 g Sodium bicarbonate 2.93 g Sodium azide 0.2 g PVP (MW 24-40,000) 20.0 g
Adjust pH to 9.6. Store at 4°C.
ECI Buffer
Add to 1000 ml. IX PBST:
Bovine serum albumin 2.0 g PVP (MW 24-40,000) 20.0 g Sodium azide 0.2 g
Adjust pH to 7.4. Store at 4°C.
PNP Buffer (Substrate Buffer)
Dissolve in 800 ml. distilled water:
Magnesium chloride 0.1 g Sodium azide 0.2 g Diethanolamine 97 . 0 ml
Adjust pH to 9.8 with HCl. Adjust final volume to 1000 ml. with distilled water. Store at 4°C.
164 APPENDIX B
Potyviruses detected by the potyvirus antibody kit (Agdia Inc.)
Alstroeiaeria mosaic virus Narcissus degeneration virus Amaranthus leaf mottle virus Narcissus yellow stripe virus Araujia mosaic virus Onion yellow dwarf virus Asparagus virus I Ornithogalum mosaic virus Bean common mosaic virus Papaya ringspot virus-P Bean yellow mosaic virus Papaya ringspot virus-W Bearded iris mosaic virus (Watermelon mosaic virus I) Beet mosaic virus Parsnip mosaic virus Bidens mottle virus Passionfruit woodiness virus Blackeye cowpea mosaic virus Pea mosaic virus Cardamom mosaic virus Pea seed-borne mosaic virus Carnation vein mottle virus Peanut mottle virus Carrot thin leaf virus Peanut stripe virus Celery mosaic virus Pepper mottle virus Clover yellow vein virus Pepper severe mosaic virus Cocksfoot streak virus Pepper veinal mottle virus Colombian datura virus Plum pox virus Commelina mosaic virus Pokeweed mosaic virus Cowpea aphid-borne mosaic Potato virus A Daphne Y virus Potato virus V Dasheen mosaic virus Potato virus Y Datura shoestring virus Soybean mosaic virus Freesia mosaic virus Statice virus Y Garlic mosaic virus Sugarcane mosaic virus Gloriosa stripe mosaic Sweet potato feathery mottle Groundnut eyespot virus Sweet potato latent virus Guinea grass mosaic virus Tamarillo mosaic virus Helenium Y virus Tobacco etch virus Henbane mosaic virus Tobacco vein mottling virus Hippeastrum mosaic virus Tulip breaking virus Hyacinth mosaic virus Tulip chlorotic blotch virus Iris fulva mosaic virus Turnip mosaic virus Iris mild mosaic virus Watermelon mosaic virus II Iris severe mosaic virus White lupin mosaic virus Leek yellow stripe virus Wisteria vein mosaic virus Lettuce mosaic virus Yarn mosaic virus Maize dwarf mosaic virus Zucchini yellow fleck virus Malva vein clearing virus Zucchini yellow mosaic virus
165 APPENDIX C
SDS-PAGE and Western Transfer Solutions
A. Polyacrylamide gel electrophoresis
Separating gel (10%)
acrylamide/bis-acrylamide, 30% stock 3.32 ml separating buffer 2.00 ml ddHgO 4.63 ml ammonium persulfate (10%) 50 y.1 TEMED 8 pi
Stacking gel (5%)
acrylamide/bis-acrylamide, 30% stock 0.83 ml stacking buffer 1.25 ml ddH.O 2.89 ml ammonium persulfate (10%) 25 pi TEMED 8 pi
Separating buffer
1.875 M Tris-HCl, pH 8.8; 0.5% (w/v) SDS
Stacking buffer
0.5 M Tris-HCl, pH 6.8; 0.4% (w/v) SDS
30% acrylamide/bis-acrylamide stock
acrylamide 60.0 g N'N'’-bis-methylene acrylamide 1.6 g
Adjust volume to 200 ml with ddH,0. Filter sterilize and store at 4°C in a brown bottle.
166 Water-saturated n-butanol
n-butanol 50.0 ml ddH,0 5.0 ml
Combine in a bottle^ shake well and use upper phase to overlay gels. Store at room temp.
Protein dénaturation buffer
stacking buffer 10.0 ml glycerol 1.4 ml 2 -3 -mercaptoethanol 1.0 ml 10% (w/v) SDS 7.6 ml
Coomassie Blue stain
Coomassie Brilliant Blue (R-250) 2.5 g Dissolved in 1 liter destaining solution
Destaining solution
9% (v/v) acetic acid 40% (v/v) methanol
Drying solution
methanol 450 ml ddHnO 100 ml glycerol 50 ml
Adjust final volume to 1 liter
Tracking dye: 0.05% (w/v) bromophenol blue
B. Western transfer solutions
Tank buffer:(0.025 M Tris,0.192 M glycine,0.1% SDS, pH 8.3)
Tris 30.28 g glycine 144.13 g SDS 10.0 g ddHjO to 10 liters
Not necessary to adjust pH. Store room temp.
167 Wetting buffer:(50 mM Tris-HCl, pH 7.5; 1% SDS)
ddHzO 400.0 ml Tris 3.03 g
Adjust pH to 7.5 with HCl
SDS 5.00 g
Adjust final volume to 500 ml with water
Transfer buffer: (25 mM Tris-HCl, 192 mM glycine,20% methanol]
Tris 3.94 g glycine 14.40 g methanol 200.00 ml
Adjust volume to 1 liter with ddHjO
TBS: (20 mM Tris, 500 mM NaCl, pH 7.5)
Tris 2.42 g NaCl 29.42 g
Adjust pH to 7.5 with HCl. Adjust final volume to 1 liter with ddH^O.
TBS-T: (TBS, 0.05% v/v Tween-20)
TBS 1 liter Tween-20 550 pi
Blocking buffer : (TBS, NFDM, 0.02% sodium azide)
TBS 90.0 ml NFDM (non-fat dry milk) 5.0 g sodium azide 0.02 g
Adjust volume to 100 ml with ddHzO. Prepare fresh.
Wash buffer : (TBS, 0.1% NFDM, 0.02% sodium azide)
TBS 1000 ml NFDM 1.0 g sodium azide 0.2 g
168 Antibody dilution buffer:(TBS-T, 1% NFDM, 0.02% sodium azide)
TBS-T 40.0 ml NFDM 0.5 g sodium azide 0.01 g
Adjust volume to 50 ml with TBS-T. Add antibody at optimal dilution. Store at 4°C for reuse.
C. BCP/NBT Alkaline Phosphatase Color Substrate Solutions
Alkaline buffer:(100 mM Tris-HCl, pH 8.8; 20 mM MgClj)
Tris 12.11 g
Adjust pH to 8.8 with HCl
MgCl? 4.07 g
Solution A : (30 mg NBT in 1.0 ml 70% DMF)
nitro blue tétrazolium (NBT) 0.30 g 70% N,N-dimethyl-formamide (DMF) 10.00 ml
Store at -20°C in the dark. Do not expose to light for prolonged periods while mixing substrate solution.
Solution B : (15 mg BCP in 1.0 ml DMF)
BCP’ 0.15 g N,N-dimethyl-formamide 10.00 ml
Store at -20°C. * 5-bromo-4chloro-3-indolyl-l-phosphate
169