Supplemental material to this article can be found at: http://dmd.aspetjournals.org/content/suppl/2019/10/28/dmd.119.088526.DC1

1521-009X/47/12/1425–1432$35.00 https://doi.org/10.1124/dmd.119.088526 DRUG METABOLISM AND DISPOSITION Drug Metab Dispos 47:1425–1432, December 2019 Copyright ª 2019 by The American Society for Pharmacology and Experimental Therapeutics CYP2D1 Knockout Reduces the Metabolism and Efficacy of Venlafaxine in s

Hongqiu Zhou, Li Yang, Changsuo Wang, Zhiqiang Li, Zhen Ouyang, Mangting Shan, Jun Gu, and Yuan Wei

School of Pharmacy, Jiangsu University, Zhenjiang, Jiangsu, China (H.Z., L.Y., C.W., Z.L., Z.O., Y.W.); MtC BioPharma Co. Ltd., Nanjing, Jiangsu, China (M.S.); and Wadsworth Center, New York State Department of Health, and School of Public Health, State University of New York at Albany, Albany, New York (J.G.)

Received June 28, 2019; accepted October 9, 2019

ABSTRACT Downloaded from CYP2D1 has been considered as an ortholog of human CYP2D6. start of administration to the theoretical extrapolation, and Cmax To assess the role of CYP2D1 in physiologic processes and drug (increased by ∼64%, ∼59%, and ∼26% in males and ∼43%, ∼35%, metabolism, a CYP2D1-null rat model was generated with and ∼15% in females, respectively). In addition, O-desmethyl a CRISPR/Cas9 method. Seven base pairs were deleted from exon venlafaxine formation was reduced as well in CYP2D1-null rats 4ofCYP2D1 of Sprague-Dawley wild-type (WT) rats. The CYP2D1- compared with that in WT rats. Rat depression models were null rats were viable and showed no abnormalities in general developed with CYP2D1-null and WT rats by feeding them separately appearance and behavior. The metabolism of venlafaxine (VLF) and exposing them to chronic mild stimulation. VLF showed better dmd.aspetjournals.org was further studied in CYP2D1-null rats. The Vmax and intrinsic efficacy in the WT depression rats compared with that in the clearance of the liver microsomes in vitro from CYP2D1-null rats CYP2D1-null rats. In conclusion, a CYP2D1-null rat model was were decreased (by ∼46% and ∼57% in males and ∼47% and successfully generated, and CYP2D1 was found to play a certain ∼58% in females, respectively), while the Michaelis constant was role in the metabolism and efficacy of venlafaxine. increased (by ∼24% in males and ∼25% in females) compared with SIGNIFICANCE STATEMENT WT rats. In the pharmacokinetic studies, compared with WT rats, CYP2D1 CYP2D1 VLF in -null rats had significantly lower apparent total A novel -null rat model was generated using CRISPR/Cas9 at ASPET Journals on September 26, 2021 clearance and apparent volume of distribution (decreased by technology, and it was found to be a valuable tool in the study of the ∼36% and ∼48% in males and ∼23% and ∼25% in females, in vivo function of human CYP2D6. Moreover, our data suggest that respectively), significantly increased area under the curve (AUC) the reduced O-desmethyl venlafaxine formation was associated from the time of administration to the last time point, AUC from the with a lower VLF efficacy in rats.

Introduction Substrates of CYP2D6 include a variety of antiarrhythmics, antipsy- Cytochrome P450 enzymes are part of an extended family of chotics, and second-generation and tricyclic antidepressants (Zanger and hemoproteins and are an important family of oxidases in the microsomal Schwab, 2013). It has been reported that the frequency of the CYP2D6 2 mixed-function oxidase system (Yamazaki, 2014). To date, a total of 57 allele varies by racial/ethnic groups; about 6% 10% of Caucasians and cytochrome P450 isoforms have been identified in humans, which are only 2% of Asians are CYP2D6 poor metabolizers (PMs) (Meyer grouped into 18 families and 44 subfamilies by their sequence similarity et al., 1990; Bradford, 2002). If the amount of drug administered to (Zanger et al., 2008). Among them, the CYP1, CYP2, and CYP3 CYP2D6 PMs is the same as that administered to normal individuals, subfamilies are responsible for the biotransformation of most foreign serious adverse reactions are more likely to occur in PMs because substances including 70%280% of clinically used drugs (Guengerich, the metabolism of the drug is often unpredictable in PMs (de Leon 2008; Zhou et al., 2012). et al., 2005; Hertz et al., 2015). Further research is needed to improve Although being only 4% of the total cytochrome P450 enzyme in the the efficacy of drugs, reduce the incidence of adverse reactions, and human liver, CYP2D6 is associated with biotransformation of approx- achieve individualized drug therapies. imately 30% of commonly used drugs (Teh and Bertilsson, 2012). Venlafaxine (VLF) is an antidepressant of selective serotonin and norepinephrine (NE) reuptake inhibitors (Bymaster et al., 2001). In humans, VLF was metabolized to O-desmethyl venlafaxine (ODV) by CYP2D6 (;89%), CYP2C19 (;10%),andCYP2C9(;1%), and This study was supported by the National Natural Science Foundation of China [Grants 81102522, 81373480, and 81573529], and the Natural Science venlafaxine is also metabolized by CYP3A4 to N-desmethyl venlafax- Foundation of Jiangsu Province [Grant BK2011473]. ine (Magalhães et al., 2014). ODV is the main metabolite of VLF to exert https://doi.org/10.1124/dmd.119.088526. pharmacological activity (Wellington and Perry, 2001). For the rat s This article has supplemental material available at dmd.aspetjournals.org. CYP2D subfamily, it was reported that six members (CYP2D1, -2D2,

ABBREVIATIONS: AUC0–t, area under the curve from the time of administration to the last time point; AUC0–‘, area under the curve from the start of administration to the theoretical extrapolation; bp, base pair; CL/F, apparent total clearance; CMS, chronic mild stimulation; NE, norepinephrine; ODV, O-desmethyl venlafaxine; PCR, polymerase chain reaction; PM, poor metabolizer; sgRNA, single guide RNA; VLF, venlafaxine; WT, wild type.

1425 1426 Zhou et al.

1/2 -2D3, -2D4, -2D5, and -2D18) have been identified by genomic analysis DNA sequencing to select the heterozygous CYP2D1 rats (F1). The F1 and CYP2D1 was considered as an ortholog of human CYP2D6 generation rats were inbred (1 male: 2 females) to produce F2 generation rats, and 2/2 (;83% homology) (Nelson et al., 1996; Martignoni et al., 2006). then the homozygous CYP2D rats were screened out from the F2 generation 2/2 A variety of cytochrome P450 mouse models and rats by the same method. The homozygous CYP2D rats were transferred from cytochrome P450–humanized mouse models have been reported to the Model Animal Research Center at Nanjing University to the Laboratory Animal Center at Jiangsu University for further breeding and animal experiments. illustrate the function of cytochrome P450 isoforms on drug The animal facilities at Nanjing University and Jiangsu University have passed the metabolism, toxicity, and carcinogenicity (Scheer et al., 2012, certification of the Association for Assessment and Accreditation of Laboratory 2014; Bissig et al., 2018). However, the mouse model may have Animal Care. All animal breeding and experimental procedures were performed some limitations. For example, the small volume of blood samples in accordance with the Guide for the Care and Use of Laboratory Animals and collected from mice increases the difficulty of pharmacokinetic were approved by the Institutional Animal Care and Use Committees at Nanjing studies. Moreover, the mouse model is poorly tolerated in some University and Jiangsu University. experiments, such as in bacterial infection and chronic heart failure Off-Target Analysis. The sgRNA3 sequence (CTAGTTTCACCATCCTGA experiments (Robinson et al., 1968; Li et al., 2004; Handa et al., TG) was submitted to TagScan (http://ccg.vital-it.ch/tagger) to predict the 2009). Compared with the mouse model, the rat model could be possible off-target sites. The detailed sequences around the potential off-target more suitable for certain experiments. sites were obtained from the University of California at Santa Cruz database (http://genome.ucsc.edu/). The corresponding primers were designed for the In 2013, a knockout rat model was generated using the CRISPR/Cas9 potential off-target sites and PCR was performed. The PCR products were then method (Li et al., 2013), and since then knockout rats have become an sequenced by Sangon Biotech Co. Ltd. (Shanghai, China) and compared with Downloaded from accessible tool for studying human cytochrome P450 functions. It has those from the University of California at Santa Cruz database. been reported that the metabolism of chlorzoxazone is significantly General Characterization of CYP2D1-Null Rats. The appearance, fertility, reduced in CYP2E1 knockout rats (Wang et al., 2016), while the and general behavior of CYP2D1-null rats were observed. CYP2D1-null rats at metabolism of nifedipine and midazolam were reduced as well in 12 weeks of age (six rats per group, male and female) were sacrificed by exposure CYP3A1/2 double knockout rats (Lu et al., 2017). A CYP2C11 to an ascending concentration of CO2 and dissected for further study. The viscera knockout rat model was successfully generated by our group and indices (defined as the ratio of tissue weight to body weight) were calculated and was used to study the metabolism of tolbutamide and warfarin (Wei compared with those of WT rats. dmd.aspetjournals.org et al., 2018; Ye et al., 2019). Analysis of the Expression Levels of Major Cytochrome P450s. The rat liver microsomes were prepared by differential centrifugation using a previously To better understand the role of human CYP2D6 in drug metabolism, described method (Egorin et al., 1997). The concentration of liver microsomes in this study, a unique CYP2D1-null rat model was generated using the was determined using the Enhanced Bicinchoninic Acid Protein Assay Kit CRISPR/Cas9 technology. The general were characterized (Beyotime, Nantong, China) and the expression of major subtypes of cytochrome and the hepatic expression of major cytochrome P450s was determined P450 in the CYP2D1-null and WT rats were determined by western blotting. in the knockout rat model. Venlafaxine, an inhibitor of serotonin- The common loading controls such as glyceraldehyde-3-phosphate dehydro- norepinephrine reuptake and a substrate of human CYP2D6, was used as genase and b-actin could not be used in the experiment since most of them had at ASPET Journals on September 26, 2021 a probe drug to study the metabolism and efficacy function of CYP2D1 been removed during microsomal preparation. Therefore, we used Ponceau S in rats. stain on the duplicate gel to guarantee that the loading amount of protein per lane (5 mg/lane) was consistent (Gu et al., 2003). The blots were incubated with CYP1A2 (sc-53241, mouse monoclonal IgG1; Santa Cruz Biotechnol- Materials and Methods ogy, CA), CYP2A (PAB19502, rabbit polyclonal; Abnova, Taipei, Taiwan, Chemicals and Reagents. NADPH (.98% purity) was purchased from China), CYP3A (sc-25845, rabbit polyclonal; Santa Cruz ), Aladdin Industrial Co. Ltd. (Shanghai, China). Carvedilol (.99% purity) was CYP2B (sc-73546, mouse monoclonal IgG1; Santa Cruz Biotechnology), purchased from Aladdin Bio-Chem Technology Co. Ltd. (Shanghai, China). CYP2C11 (PA3-034, rabbit polyclonal; Thermo Fisher Scientific, Waltham, Venlafaxine hydrochloride and O-desmethyl venlafaxine (.98% purity) were MA), CYP2D1 (AB1271, rabbit polyclonal; EMD Millipore Corporation, purchased from Sam Chemical Technology Co., Ltd. (Shanghai, China). Temecula, CA), CYP2E1 (BML-CR3271-0100, rabbit polyclonal; Enzo, Acetonitrile and methanol, as well as all other reagents, were purchased from NY), and NADPH-cytochrome P450 oxidoreductase (sc-55477, mouse Sinopharm Chemical Reagent Co. Ltd. (Shanghai, China). monoclonal; Santa Cruz Biotechnology) antibodies, respectively, at room Generation of CYP2D1-Null Rats by CRISPR/Cas9. Three specific single temperature for 2 hours, followed by incubation with the corresponding guide RNA (sgRNA) target sequences were selected from the target site in exon 4 secondary antibodies for 1 hour. Chemiluminescence solution was added to of the rat CYP2D1 gene (Gene ID: 266684) using Gene Knock-Out with Cas9 the blot and the ChemiDoc XRS imaging system (BioRad, Hercules, CA) was software from Xunqi Biotechnology Co. Ltd. (Nanjing, China). Three pairs of used to visualize the images. guiding primers were designed: sgRNA1 (forward primer: 59-GCAGCATGG mRNA Analysis of CYP2D . Total RNA was isolated from livers of CCTTGGGATTGA-39, reverse primer: 59-TCAATCCCAAGGCCATGCTG-39), WT and CYP2D1-null rats using Trizol reagent (CW0580S; CWBIO, Beijing, sgRNA2 (forward primer: 59-AGACCCTTACCTCATCAGGA-39, reverse primer: China) according to the manufacturer’s instructions. To detect selected cyto- 59-TCCTGATGAGGTAAGGGTCT-39), and sgRNA3 (forward primer: 59-CTA chrome P450 expression in mRNA level, cDNA was prepared from total RNA GTTTCACCATCCTGATG-39, reverse primer: 59-CATCAGGATGGTGAAACT using the RevertAid First Strand cDNA Synthesis Kit (K1622; Thermo AG-39). The sgRNAs were transcribed in vitro using the T7 Quick High Yield RNA Fisher Scientific). b-Actin was set as the internal reference. Selected genes Synthesis Kit, recovered by phenol-chloroform extraction and alcohol precipitation, for quantification in livers of WT and CYP2D1-null rats were CYP2D1, 2D2, and finally dissolved in nuclease-free water. The pST1374-cas9 vector was 2D3, 2D4/18,and2D5, and the primers designed for quantification are listed linearized by Agel (New England Bioscience, Ipswich, MA), transcribed into in Supplemental Table 2. Cas9 mRNA, and purified with the RNeasy Mini Kit (Qiagen, Valencia, CA). The VLF Metabolism in CYP2D1-Null Rats. Liver microsomes (1 mg/ml) and constructed Cas9 mRNA was coinjected with sgRNA1, sgRNA2, and sgRNA3 various concentrations of VLF (7.5, 10, 15, 20, or 25 mM) were mixed and (Cas9 mRNA: 50 ng/ml; sgRNA1: 100 ng/ml; sgRNA2: 100 ng/ml; and sgRNA3: preincubated at 37C in a water bath for 5 minutes, followed by adding b-NADPH 100 ng/ml) into zebrafish zygotes to determine their activities, respectively. (1 mM) and MgCl2 (5 mM) to initiate the reaction in a total volume of 200 ml, and The sgRNA3 set primer (30 ng/ml) was injected into wild-type (WT) Sprague- then incubated at 37C in a water bath for 50 minutes. The reaction was then Dawley rat monocytic embryos with Cas9 mRNA (50 ng/ml) since sgRNA3 stopped with 800 ml of ice-cold ethyl acetate containing 50 mg/ml carvedilol, showed the highest activity in zebrafish (Supplemental Table 1). The obtained which was used as an internal standard solution. The upper organic phase was 1/2 CYP2D1 rat (F0, 1 female) was hybridized with a WT rat (1 male) and the pups collected by vigorous vortexing for 3 minutes and centrifugation at 9600g for were subjected to polymerase chain reaction (PCR) amplification and genomic 10 minutes at 4C. Then, 400 ml of ethyl acetate was used to extract the precipitate CYP2D1-Knockout Rat Model 1427 for the second time. The combined organic phase was dried with nitrogen and Results reconstituted with 100 ml acetonitrile for high-performance liquid chromatogra- Generation of CYP2D1-Null Rats. Two rat founders with different phy analysis. For determination of the pharmacokinetic parameters, CYP2D1-null and WT genotypes, 7-base pair (bp) (ACCTCAT) deletion, or 1-bp (A) rats were divided into four groups (six rats per group, 12 week olds, male and insertion in exon 4 were generated. Due to the infertility of the other female). The rats were fasted for 12 hours before the experiment but were one (with 1-bp insertion), only the founder with 7-bp deletion was provided water. After administration of a single dose of VLF (20 mg/kg, used for further studies. The generation scheme of the CYP2D1-null intragastric administration), approximately 0.3 ml blood was collected from the rat model is shown in Fig. 1A. The PCR amplification results of the orbital vein at different time points (0.25, 0.5, 1, 2, 4, 8, 12, 24, and 36 hours) in CYP2D1-null and WT rats are shown in Fig. 1B. The DNA fragments both CYP2D1-null and WT rats. The blood samples were centrifuged at show bright bands around 586 bp. The homozygous CYP2D1-null 1500g for 10 minutes to obtain plasma. Next, 50 ml of 1.0 M hydrochloric rats lacked the 7 bp (ACCTCAT) at 270–280 bp compared with the m m acid solution and 10 lof50 g/ml carvedilol (internal standard) were WT rats, and the heterozygous CYP2D1-null rats presented mixed m m added into 100 l plasma and thoroughly mixed, and then 200 lofethyl peaks in the corresponding area (Fig. 1C). Based on the genotyping acetate was added and vortexed for 3 minutes. The supernatant was collected results, CYP2D1-null rats were successfully generated and the by centrifugation at 9600g for 10 minutes. The precipitate was re-extracted with 200 ml ethyl acetate. The combined supernatant was dried with nitrogen genotype-stable offspring were obtained. and redissolved in 100 ml acetonitrile for high-performance liquid chroma- Off-Target Analysis. Nine potential off-target sites of sgRNA3 tography analysis. (Supplemental Table 4) were predicted using the off-target detection

An Agilent Eclipse Plus C18 (5 mm, 4.6 Â 250 mm; Agilent Technologies, software and the corresponding primers (Supplemental Table 5). The Downloaded from Santa Clara, CA) column was used at room temperature. The flow rate was 0.8 ml/ sequencing results showed that these potential off-target sites were not min and the wavelength for detection was set at 228 nm. The mobile phase mutated in the CYP2D1-null rats. consisted of 60% acetonitrile and 40% 0.01 mol/l ammonium acetate buffer (pH General Characterization of CYP2D1-Null Rats. There were no m 4.8), and the injection volume was 20 l. significant differences in the appearance, fertility, and general behavior Development of the Rat Model of Depression. The development of the between the CYP2D1-null and WT rats, in either males or females depression model was based on previous literature and in accordance with our (Supplemental Tables 6 and 7). The data obtained for viscera indices are laboratory conditions (Pucilowski et al., 1993; Zhao et al., 2008). Briefly, the dmd.aspetjournals.org depression models in WT and CYP2D1-null rats were developed by feeding them given in Table 1. The viscera indices of CYP2D1-null rats also showed separately and exposing them to chronic mild stimulation (CMS). In the first and no significant difference compared with those of WT rats. second week, the CMS groups were given eight kinds of stimulations, including Hepatic Expression Levels of Major Cytochrome P450s. The tail suspension for 5 minutes, rat cage tilting at 45, humid padding, over- hepatic expression levels of major cytochrome P450s in CYP2D1-null crowding, electric shock (36 V, 2 times/min), forced swimming, alternated light and WT rats are shown as Fig. 2. CYP2D1 protein was only detected and dark, and fasting and water deprivation for 24 hours. From day 15 to day 20, in the WT rats, but not in the CYP2D1-null rats. The expression levels of ice water (4C, 5 minutes) was added in the bath coupled with heat stress (45C, the other cytochrome P450s showed no significant differences, except 5 minutes). The same kind of stimulation was intermittently used to prevent the for the expression of CYP2A, which was significantly higher in the at ASPET Journals on September 26, 2021 rats from anticipating the upcoming stimulation (Supplemental Table 3). During the development of the rat model of depression, all CMS rats were fed with one rat per cage except in the overcrowding stimulation experiment. The control groups were bred normally with five rats per cage. Body Weight Test. The effects of depression on body weight in rats were investigated with reference to previous literature (Liu et al., 2011). Rats in each group were weighed at 9:00 AM on day 21 of the depression modeling. Locomotor Activity Test. The experiment was performed following the method used in a previous report (Zhao et al., 2008). On day 21 of depression modeling, rats were individually placed in an open box of 80 Â 80 Â 50 cm. A TSE Systems multifunction conditioning system (Thuringia, Germany) was used to automatically record the trajectory of the movement within 8 minutes and calculate the total distance of locomotor activity. The 1% Sucrose Water Consumption Test. The experiment was performed following a previous study (Kim et al., 2003). After 4 hours of locomotor activity test, the rats were fasted with no food or water for 24 hours, and then 1% sucrose water was provided to rats for another 24 hours. The 1% sucrose water consumption for 24 hours was determined with the ratio of intake volume (milliliters) to rat body weight (100 g). Efficacy of Venlafaxine Hydrochloride in the Rat Model of Depression. After CMS modeling, the rats (five rats per group, 12 weeks old, male and female) were administered with venlafaxine hydrochloride (CMS 1 VLF groups, 20 mg/kg, intragastrical administration) or 2 ml 0.9% saline (CMS 1 saline groups) every day for 14 days. Then, body weight, locomotor activity, and 1% sucrose water consumption were also evaluated. After these analyses, approximately 1.0 ml of blood was taken from the orbital vein of each rat, and plasma was prepared by 1500g centrifugation for 20 minutes. The levels of NE and 5-hydroxytryptamine in plasma were determined by an ELISA kit (SenBeiJia, Nanjing, China). The rats were sacrificed by CO2 after blood sampling. Fig. 1. Confirmation of in CYP2D1-null rats. (A) Schematic of the exon structure of the CYP2D1 gene in rats. Exons are shown as black boxes. Seven Statistical Analyses. The experimental data were analyzed using Prism 5.0 base pairs (ACCTCAT) were deleted in exon 4. (B) Fragments of approximately statistical software (GraphPad, La Jolla, CA). The experimental data are presented 586 bp were amplified from 10 F2 pups (n 5 10). (C) Genotyping results for as mean 6 S.D. One-way ANOVA was performed and a value of P , 0.05 was CYP2D12/2, CYP2D11/2 and WT rats; 7 bp were deleted in exon 4 of CYP2D1 in considered statistically significant. the knockout alleles. 1428 Zhou et al.

TABLE 1 Viscera indices in CYP2D1-null and wild-type rats All values are shown as mean 6 S.D., n 5 6.

Viscera Index Null-M WT-M Null-F WT-F

% Kidney 0.9321 6 0.0838 0.8779 6 0.0121 0.7357 6 0.0203 0.9419 6 0.0550 Liver 4.537 6 0.3352 4.700 6 0.4461 3.915 6 0.3302 4.108 6 0.0110 Heart 0.3659 6 0.0255 0.3646 6 0.0271 0.4032 6 0.0041 0.4140 6 0.0113 Testis 0.9323 6 0.0840 0.9521 6 0.0372 N/A N/A Spleen 0.2208 6 0.0290 0.2518 6 0.0091 0.1880 6 0.0061 0.2446 6 0.0324 Brain 0.6345 6 0.0202 0.5511 6 0.0460 0.7624 6 0.0650 0.8546 6 0.0452 Lungs 0.6309 6 0.0588 0.5602 6 0.0711 0.6343 6 0.0649 0.7862 6 0.0951

Null-F, CYP2D1-null female rats; Null-M, CYP2D1-null male rats; WT-F, wild-type female rats; WT-M, wild-type male rats. N/A, not applicable.

CYP2D1-null rats compared with that in the WT rats, for both males and In the pharmacokinetic study, the plasma levels of VLF in the females. Notably, CYP2C11 was not detected in either the WT females CYP2D1-null rats were significantly higher than those in the WT rats (at or CYP2D1-null females. marked time points, see Fig. 3, A and B), while the levels of ODV were Downloaded from mRNA Expression Levels of CYP2D Genes. A greatly reduced significantly lower than those in the WT rats (at marked time points, see mRNA level of the targeted CYP2D1 gene was detected in the livers of Fig. 3, C and D). Compared with the WT males, VLF in the CYP2D1- CYP2D1-null rats (Supplemental Fig. 1). Among the mRNA expression null males had significantly lower apparent total clearance (CL/F) of other CYP2D genes, CYP2D2 and CYP2D3 were upregulated and (decreased by ;36%, P , 0.05) and apparent volume of distribution CYP2D4/18 and CYP2D5 were downregulated (Supplemental Fig. 2). (decreased by ;48%, P , 0.05), and significantly increased area under

Venlafaxine Hydrochloride Metabolism in CYP2D1-Null Rats. the curve from the time of administration to the last time point (AUC0–t) dmd.aspetjournals.org The VLF in vitro activities were determined with liver microsomes (increased by ;64%, P , 0.05), area under the curve from the start of from both WT and CYP2D1-null rats. The kinetic parameters of the administration to the theoretical extrapolation (AUC0–‘) (increased Michaelis constant, maximum velocity (Vmax), and intrinsic clearance by ;59%, P , 0.05), and Cmax (increased by ;26%, P , 0.05). VLF were calculated and are given in Table 2. There was no sex difference in in the CYP2D1-null females also had significantly lower CL/F the model, and the Vmax and intrinsic clearance of CYP2D1-null males (decreased by ;23%, P , 0.05) and apparent volume of distribution decreased by 46% (P , 0.05) and 57% (P , 0.05), respectively, while (decreased by ;25%, P , 0.05), and had significantly higher AUC0–t the Michaelis constant increased by 24% (P , 0.05) compared with WT (increased by ;43%, P , 0.05), AUC –‘ (increased by ;35%, P , 0.05), 0 at ASPET Journals on September 26, 2021 males. The Vmax and intrinsic clearance of the CYP2D1-null females and Cmax (increased by ;15%, P , 0.05) compared with WT rats (Table 3). decreased by 47% (P , 0.05) and 58% (P , 0.05), respectively, while Body Weight, 1% Sucrose Water Consumption, and Locomotor the Michaelis constant increased by 25% compared with WT females. Activity after Depression Modeling. There were significant differ- ences (P , 0.05) in body weight, 1% sucrose water consumption, and locomotor activity in the CMS groups compared with the control groups (Table 4). These results suggested that the depression modeling in both strains was successful. Efficacy of Venlafaxine Hydrochloride in the Rat Depression Model. After 14 days of administration of VLF, three depression indicators (e.g., body weight, 1% sucrose water consumption, and locomotor activity) were recorded and the results are given in Table 5. All of the three indicators in the VLF-treated groups (CMS 1 VLF groups) were significantly increased compared with the saline-treated groups (CMS 1 saline groups) for WT rats (P , 0.05). These indicators were slightly improved (P . 0.05) in the VLF-treated CYP2D1-null rats compared with the saline-treated groups, except for the 1% sucrose water

TABLE 2 Kinetics of venlafaxine hydrochloride metabolism in liver microsomes from CYP2D1-null and wild-type rats All values are shown as mean 6 S.D., n 5 3.

Rat Vmax Km CLint

nmol21·min21/mg potein21 mmol·l21 ml·mg21/min21 Fig. 2. Western blotting analyses of several cytochrome P450 isoforms (CYP2D1, WT-M 156.7 6 14.7 94.7 6 8.9 1655 6 165 CYP1A2, CYP2B, CYP2A, CYP2C11, and CYP2E1) in the livers of CYP2D1-null Null-M 84.6 6 5.5* 117.9 6 16.6* 717 6 33* and WT rats. Each lane represents the pooled microsomes of the livers of WT or WT-F 125.1 6 18.8 144.4 6 8.7 866 6 216 CYP2D1-null rats. CYP2D1 was not detected in the liver microsomes of CYP2D1- Null-F 66.2 6 9.1* 181.1 6 15.9* 365 6 57* null rats. The expression of CYP1A2, CYP2B, CYP2C11, and CYP2E1 in CYP2D1-null rats showed no marked difference, while the expression of CYP2A CLint, intrinsic clearance; Km, Michaelis constant (substrate concentration at half-maximum showed higher levels compared with that of WT rats. CYP2C11 protein was not reaction rate); Null-F, CYP2D1-null female rats; Null-M, CYP2D1-null male rats; WT-F, wild- expressed in female rats. Null (F), CYP2D1-null female rats; Null (M), CYP2D1-null type female rats; WT-M, wild-type male rats. male rats; WT (F), wild-type female rats; WT (M), wild-type male rats. *P , 0.05, compared with that of WT rats of the same sex. CYP2D1-Knockout Rat Model 1429

Fig. 3. Mean plasma concentration-time curves of venlafaxine hydrochloride and O-desmethyl venlafaxine after intragastrical administra- tion at a dose of 20 mg/kg in WT Sprague- Dawley and CYP2D1-null rats. (A) Mean plasma concentration-time curves of VLF hydrochloride in male rats. (B) Mean plasma concentration-time curves of VLF hydrochloride in female rats. (C) Mean plasma concentration-time curves of ODV in male rats. (D) Mean plasma concentration- time curves of ODV in female rats. Null-F, CYP2D1-null female rats; Null-M, CYP2D1-null male rats; WT-F, wild-type female rats; WT-M, Downloaded from wild-type male rats. All values are shown as mean 6 S.D., n 5 6. *P , 0.05, compared with that of WT rats of the same sex. dmd.aspetjournals.org

consumption in CYP2D1-null females. With VLF treatments, these 2004). In the liver of rats, CYP2A1 and CYP2A2 were dominantly indicators in WT rats were significantly higher (P . 0.05) than in the expressed in females and males, respectively (Haduch et al., 2005).

CYP2D1-null rats. Furthermore, with VLF treatments, the plasma NE CYP2A1 is responsible for the 7a-hydroxylation of testosterone, at ASPET Journals on September 26, 2021 and 5-hydroxytryptamine levels in WT rats were significantly higher while CYP2A2 catalyzes the 15a-and7a-hydroxylation of testosterone than in the CYP2D1-null rats in both males and females (Fig. 4). (Martignoni et al., 2006). The induction mechanism of CYP2A genes is still not very clear. To the best of our knowledge, very few endogenous substances have been identified to regulate the expression of CYP2A Discussion genes in rats, except that sexually dimorphic growth hormone has been Rat and human CYP2D isoforms share a good homology (.70%), reported to upregulate the expression of CYP2A1 and CYP2A2 and rat CYP2D1 (;83% homology) is known as an ortholog of human (Waxman et al., 1995; Thangavel et al., 2004). Since the expression CYP2D6 (Venhorst et al., 2003; Martignoni et al., 2006). Rat CYP2D1 pattern of CYP2C11 was not changed in the CYP2D1-null rat model, shares high homology with other CYP2D genes (e.g., CYP2D2, ;82%; it was unlikely that the induction of CYP2A was caused by growth CYP2D3, ;85%; CYP2D4, ;80%; CYP2D5, ;98%; and CYP2D18, hormone. Foreign compounds, including phenobarbital, dexa- ;80%), which makes it difficult to develop a CYP2D1 knockout model methasone, and 3-methylcholanthrene, were found to upregulate in rats. In this study, exon 4 was found to be a suitable target for the CYP2A1 (Ryan and Levin, 1990), and pregnane X, constitutive CRISPR/Cas9 technology. We analyzed the coding sequence of the androstane, and aryl hydrocarbon receptors could also be involved CYP2D1 gene and found that the deletion of ACCTCAT would lead to in the regulation of CYP2As (Wallace and Redinbo, 2013). The truncated protein with only 213 amino acids, while the WT CYP2D1 specific roles of these nuclear receptors in CYP2D1-null rats need had 511 amino acids. to be further studied. Previous studies using CRISPR/Cas9 have reported that off-target effects may occur in the sgRNAs of mice and rats, which could also be inherited by the offspring (Tan et al., 2015; Anderson et al., 2018). TABLE 3 We used TagScan to predict the potential off-target sites of sgRNA3 Plasma pharmacokinetic parameters in CYP2D1-null rats and wild-type rats after sequences in the CYP2D1-null rats and confirmed there were no treatment with venlafaxine hydrochloride at 20 mg/kg 6 5 mutations in these potential off-target sites. Whether the mutation of All values are shown as mean S.D., n 6. CRISPR/Cas9occurredinnonpredictedsiteswasnecessaryfor Parameter WT-M Null-M WT-F Null-F further study due to various factors. 21 21 AUC0–t (mg·ml /h ) 12.4 6 3.3 20.3 6 2.5* 13.6 6 1.7 19.4 6 1.3* 21 21 In this study, the expression of CYP2C11 protein was detected only in AUC0–‘ (mg·ml /h ) 15.0 6 2.6 23.8 6 4.2* 15.3 6 2.1 20.7 6 1.5* m 21 6 6 6 6 male CYP2D1-null rats (the same as in WT rats), thus the knockout of Cmax ( g·ml ) 1.9 0.1 2.4 0.1* 2.6 0.1 3.0 0.1* Â 3 21 6 6 6 6 CYP2D1 had little effect on the male-specific expression of CYP2C11. Vd/F ( 10 ml·kg ) 25.2 7.2 13.1 3.4* 15.4 1.4 11.5 2.5* CL/F (Â103 1.4 6 0.3 0.9 6 0.2* 1.3 6 0.2 1.0 6 0.1* There was no significant difference in the expression levels of other ml·h21/kg21) cytochrome P450s, except that the expression levels of CYP2As were Null-F, CYP2D1-null female rats; Null-M, CYP2D1-null male rats; Vd/F, apparent volume of higher in the CYP2D1-null rats compared with the WT rats. The rat distribution; WT-F, wild-type female rats; WT-M, wild-type male rats. CYP2A family consisted of CYP2A1, 2A2, and 2A3 (Su and Ding, *P , 0.05, compared with that of WT rats. 1430 Zhou et al.

TABLE 4 Body weight, 1% sucrose water consumption, and locomotor activity of CYP2D1-null and wild-type rats after depression modeling All values are shown as mean 6 SD, n 5 5.

Parameter WT-M Null-M WT-F Null-F Body weight (g) Ctrl 217.9 6 17.2 214.3 6 12.0 210.5 6 9.4 203.9 6 12.4 CMS 178.5 6 11.1* 198.2 6 11.9* 165.1 6 8.5* 158.5 6 15.8* 1% Sucrose water consumption (ml/100 g) Ctrl 20.5 6 1.0 22.2 6 1.4 21.7 6 2.1 19.3 6 1.1 CMS 18.1 6 0.8* 16.6 6 2.4* 12.3 6 1.3* 13.3 6 1.1* Total distance (m) Ctrl 22.1 6 0.5 24.4 6 1.1 21.2 6 1.2 20.0 6 1.2 CMS 18.4 6 1.7* 21.5 6 1.1* 17.4 6 1.6* 17.5 6 1.5*

Ctrl, control group without depression modeling; Null-F, CYP2D1-null female rats; Null-M, CYP2D1-null male rats; WT-F, wild-type female rats; WT-M, wild-type male rats. *P , 0.01, compared with that of control groups.

In human beings, it has been reported that after administration of approach having very high gene-targeting efficiency. Zuo et al.

150mgVLFto141healthysubjects,theCmax,AUC0–t,andAUC0–‘ (2017) demonstrated a new C-CRISPR approach, in which three Downloaded from of VLF in PMs increased by 83%, 189%, and 212%, respectively, genes (Tet1, Tet2,andTet3) were completely knocked out in mouse compared with extensive metabolizers. The half-life was prolonged embryos after a one-step injection of sgRNAs in zygotes. Most by 71%, and the CL/F was decreased by 68% (Kandasamy et al., recently, Campa et al. (2019) demonstrated a multiplexed 2010). In another study, 14 healthy volunteers received 75 mg VLF targeting method using Cas12a and CRISPR arrays delivered on extended release formulations, and the mean Cmax and area under a single plasmid. These high efficiency methods would greatly

the curve of VLF were increased by 149% and 331% in the PMs facilitate our future generation of a CYP2D-null rat model with dmd.aspetjournals.org compared extensive metabolizers, while the CL/F was decreased by deletion of all six CYP2D genes. 83% (Preskorn et al., 2009). However, in our VLF metabolism study Depression is a serious mental disorder characterized by anhedonia, with rat models, the Cmax, AUC0–t, and AUC0–‘ of VLF in the weight loss, sleeping disturbances, a sense of worthlessness, cognitive CYP2D1-null males were only increased by 24%, 64%, and 59%, decline, or repeated thoughts of death (Xu et al., 2002). In the CMS rat respectively, compared with WT males, while the CL/F and apparent model, 1% sucrose water consumption reflected the euphoria of the rats, volume of distribution were decreased by 36% and 48%, respectively. and the locomotor activity in open-box was used to detect the state of The difference in VLF metabolism between CYP2D1-null and WT rats nervousness in the new environment (Matthews et al., 1995; Willner, seemed much smaller than that between human PMs and extensive 1997). Thus, body weight, 1% sucrose water consumption, and loco- at ASPET Journals on September 26, 2021 metabolizers. This fact suggested that other CYP2D isozymes might also motor activity tests are commonly used behavioral indicators in contribute to VLF metabolism, and the broad use of the current depression research (Bortolato et al., 2007; Dai et al., 2010). After knockout model was limited. Therefore, a rat model with multiple 20 days of depression modeling, the body weight, 1% sucrose water knockouts of CYP2D genes would be a better approach to un- consumption, and locomotor activity of the CMS groups were changed derstanding VLF metabolism in humans. similarly to the results obtained in previous reports (Pucilowski et al., The CRISPR/Cas9 system could be used to knockout multiple 1993; Orsetti et al., 2008; Zhao et al., 2008; Dai et al., 2010). These genes simultaneously by coexpressing multiple sgRNAs targeting results demonstrated the reproducibility in our depression modeling. different sites (Cong et al., 2013; Cao et al., 2016; Hashimoto et al., Notably, sporadic death occurred in both WT and CYP2D1-null female 2016). However, these approaches achieved complete bi-allelic rats during the CMS modeling (data not shown), whereas the rat knockout animals with low efficiencies (Zuo et al., 2017). Since mortality rate in our experiment was less than that of mice under the there were six members in the CYP2D subfamily, the deletion of same challenge (Goshen et al., 2008; Sun et al., 2011), indicating that these genes simultaneously in the rat genome would require an rats are more tolerant than mice in depression modeling.

TABLE 5 Body weight, 1% sucrose water consumption, and locomotor activity of CYP2D1-null and wild-type rats after administration All values are shown as mean 6 SD, n 5 5.

Parameter WT-M Null-M WT-F Null-F Body weight (g) Ctrl 255.8 6 9.0 240.1 6 15.5 228.7 6 14.6 220.7 6 7.3 CMS 1 saline 207.6 6 24.9* 185.6 6 14.0* 174.0 6 8.1* 134.3 6 14.5* CMS 1 VLF 237.0 6 14.4*,# 197.6 6 15.1*,$ 194.5 6 9.7*,# 152.5 6 11.5*,$ 1% Sucrose water consumption (ml/100 g) Ctrl 22.2 6 1.5 20.5 6 0.9 19.2 6 0.9 20.3 6 1.5 CMS 1 saline 17.8 6 1.7* 15.0 6 1.2* 13.0 6 1.6* 14.6 6 1.7* CMS 1 VLF 21.2 6 1.6# 16.2 6 1.3*,$ 17.1 6 1.0*,# 13.5 6 1.1*,$ Total distance (m) Ctrl 23.8 6 1.2 21.5 6 0.7 19.5 6 1.2 20.7 6 1.3 CMS 1 saline 20.4 6 0.9* 18.0 6 1.9* 17.4 6 0.7* 15.6 6 1.5* CMS 1 VLF 24.6 6 1.6# 20.2 6 1.5$ 21.4 6 1.5# 16.5 6 1.5*,$

CMS 1 saline, CMS-treated group administered with saline; CMS 1 VLF, CMS-treated group administered with venlafaxine; Ctrl, control group without depression modeling; Null-F, CYP2D1- null female rats; Null-M, CYP2D1-null male rats; WT-F, wild-type female rats; WT-M, wild-type male rats. *P , 0.05, compared with that of Ctrl group; #P , 0.05, compared with that of CMS 1 saline group; $P , 0.05, compared with that of WT group. CYP2D1-Knockout Rat Model 1431

References

Anderson KR, Haeussler M, Watanabe C, Janakiraman V, Lund J, Modrusan Z, Stinson J, Bei Q, Buechler A, Yu C, et al. (2018) CRISPR off-target analysis in genetically engineered rats and mice. Nat Methods 15:512–514. Bissig K-D, Han W, Barzi M, Kovalchuk N, Ding L, Fan X, Pankowicz FP, Zhang Q-Y, and Ding X (2018) P450-humanized and human liver chimeric mouse models for studying xenobiotic metabolism and toxicity. Drug Metab Dispos 46:1734–1744. Bortolato M, Mangieri RA, Fu J, Kim JH, Arguello O, Duranti A, Tontini A, Mor M, Tarzia G, and Piomelli D (2007) Antidepressant-like activity of the fatty acid amide hydrolase inhibitor URB597 in a rat model of chronic mild stress. Biol Psychiatry 62:1103–1110. Bradford LD (2002) CYP2D6 allele frequency in European Caucasians, Asians, Africans and their descendants. Pharmacogenomics 3:229–243. Bymaster FP, Dreshfield-Ahmad LJ, Threlkeld PG, Shaw JL, Thompson L, Nelson DL, Hemrick-Luecke SK, and Wong DT (2001) Comparative affinity of duloxetine and venlafaxine for serotonin and norepinephrine transporters in vitro and in vivo, human serotonin receptor subtypes, and other neuronal receptors. Neuropsychopharmacology 25:871–880. Campa CC, Weisbach NR, Santinha AJ, Incarnato D, and Platt RJ (2019) Multiplexed genome engineering by Cas12a and CRISPR arrays encoded on single transcripts. Nat Methods 16: 887–893. Cao J, Wu L, Zhang S-M, Lu M, Cheung WKC, Cai W, Gale M, Xu Q, and Yan Q (2016) An easy and efficient inducible CRISPR/Cas9 platform with improved specificity for multiple gene targeting. Nucleic Acids Res 44:e149.

Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Downloaded from et al. (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339:819–823. Dai Y, Li Z, Xue L, Dou C, Zhou Y, Zhang L, and Qin X (2010) Metabolomics study on the anti- depression effect of xiaoyaosan on rat model of chronic unpredictable mild stress. J Ethnopharmacol 128:482–489. de Leon J, Susce MT, Pan R-M, Fairchild M, Koch WH, and Wedlund PJ (2005) The CYP2D6 poor metabolizer may be associated with risperidone adverse drug reactions and discontinuation. J Clin Psychiatry 66:15–27. Egorin MJ, Rosen DM, Benjamin SE, Callery PS, Sentz DL, and Eiseman JL (1997) In vitro metabolism by mouse and human liver preparations of halomon, an antitumor halogenated dmd.aspetjournals.org monoterpene. Chemother Pharmacol 41:9–14. Goshen I, Kreisel T, Ben-Menachem-Zidon O, Licht T, Weidenfeld J, Ben-Hur T, and Yirmiya R (2008) Brain interleukin-1 mediates chronic stress-induced depression in mice via adrenocortical activation and hippocampal neurogenesis suppression. Mol Psychiatry 13:717–728. Gu J, Weng Y, Zhang Q-Y, Cui H, Behr M, Wu L, Yang W, Zhang L, and Ding X (2003) Liver- specific deletion of the NADPH-cytochrome P450 reductase gene: impact on plasma cholesterol homeostasis and the function and regulation of microsomal cytochrome P450 and heme oxy- Fig. 4. The levels of NE (A) and 5-hydroxytryptamine (5-HT) (B) in CYP2D1-null and genase. J Biol Chem 278:25895–25901. WT rats after administration of VLF hydrochloride. CMS 1 saline, CMS saline-treated Guengerich FP (2008) Cytochrome P450 and chemical toxicology. Chem Res Toxicol 21: group; CMS 1 VLF, the group of CMS-treated rats administered with venlafaxine; Ctrl, 70–. 83

Haduch A, Wójcikowski J, and Daniel WA (2005) Effect of short- and long-term treatment with at ASPET Journals on September 26, 2021 control group; Null-F, CYP2D1-null female rats; Null-M, CYP2D1-null male – rats; WT-F, wild-type female rats; WT-M, wild-type male rats. All values are antidepressant drugs on the activity of rat CYP2A in the liver. Pharmacol Rep 57:774 781. Handa T, Katare RG, Kakinuma Y, Arikawa M, Ando M, Sasaguri S, Yamasaki F, and Sato T shown as mean 6 S.D., n 5 6. *P , 0.05, compared with that of Ctrl group; ’ # $ (2009) Anti-Alzheimer s drug, donepezil, markedly improves long-term survival after chronic P , 0.05, compared with that of CMS 1 saline group. P , 0.05, compared heart failure in mice. JCardFail15:805–811. with that of WT group. Hashimoto M, Yamashita Y, and Takemoto T (2016) of Cas9 protein/sgRNA into early pronuclear zygotes generates non-mosaic mutants in the mouse. Dev Biol 418:1–9. Hertz DL, Snavely AC, McLeod HL, Walko CM, Ibrahim JG, Anderson S, Weck KE, Rubin P, Olajide O, Moore S, et al. (2015) CYP2D6 intermediate metabolizers includes patient groups For the depressed WT rats, after 14 days of VLF treatment, all with distinct metabolic activity. Cancer Res 75:P1-3–2. three depression indicators were significantly improved compared Kandasamy M, Srinivas P, Subramaniam K, Ravi S, John J, Shekar R, Srinivas N, and Thangam S (2010) Differential outcomes from metabolic ratios in the identification of CYP2D6 phenotypes with the saline-treated rats. This result suggested that VLF was —focus on venlafaxine and O-desmethylvenlafaxine. Eur J Clin Pharmacol 66:879–887. effective in our depression model. Based on the plasma levels of NE Kim H, Whang W-W, Kim H-T, Pyun K-H, Cho S-Y, Hahm D-H, Lee H-J, and Shim I (2003) Expression of neuropeptide Y and cholecystokinin in the rat brain by chronic mild stress. Brain and 5-hydroxytryptamine, it was clear that VLF treatment was more Res 983:201–208. effective in WT depression rats than in CYP2D1-null rats, possibly Li D, Qiu Z, Shao Y, Chen Y, Guan Y, Liu M, Li Y, Gao N, Wang L, Lu X, et al. (2013) Heritable gene targeting in the mouse and rat using a CRISPR-Cas system. Nat Biotechnol 31: because of the reduced formation of ODV in CYP2D1-null rats. 681–683. We also tried to determine ODV concentrations in the brain, but Li M, Zheng C, Sato T, Kawada T, Sugimachi M, and Sunagawa K (2004) Vagal nerve stimulation markedly improves long-term survival after chronic heart failure in rats. Circulation 109: were unable to obtain convincing results due to limitations of the 120–124. analytical instruments. Liu J, Li Y, Bai G, Wang J, and Xue C (2011) The change of behavior and the consumption of food In conclusion, we have successfully developed a novel and and syrup of depression rats model under space circumstances. Chin J Vet Med 47:12–14. Lu J, Shao Y, Qin X, Liu D, Chen A, Li D, Liu M, and Wang X (2017) CRISPR knockout rat valuable CYP2D1-null rat model in studying human drug metab- cytochrome P450 3A1/2 model for advancing drug metabolism and pharmacokinetics research. olism by CYP2D6 using the CRISPR/Cas9 technology and have Sci Rep 7:42922. Magalhães P, Alves G, Llerena A, and Falcão A (2014) Venlafaxine pharmacokinetics focused on demonstrated that the antidepressant effects of VLF were decreased drug metabolism and potential biomarkers. Drug Metabol Drug Interact 29:129–141. in depressed CYP2D1-null rats. Moreover, our data demonstrated Martignoni M, Groothuis GMM, and de Kanter R (2006) Species differences between mouse, rat, dog, monkey and human CYP-mediated drug metabolism, inhibition and induction. Expert Opin that the reduced ODV formation was associated with lower VLF Drug Metab Toxicol 2:875–894. efficacy in rats, suggesting a potential application of monitoring Matthews K, Forbes N, and Reid IC (1995) Sucrose consumption as an hedonic measure following plasma ODV levels in the clinical optimization of VLF for the chronic unpredictable mild stress. Physiol Behav 57:241–248. Meyer UA, Skoda RC, and Zanger UM (1990) The genetic polymorphism of debrisoquine/spar- treatment of depression. teine metabolism-molecular mechanisms. Pharmacol Ther 46 :297–308. Nelson DR, Koymans L, Kamataki T, Stegeman JJ, Feyereisen R, Waxman DJ, Waterman MR, Gotoh O, Coon MJ, Estabrook RW, et al. (1996) P450 superfamily: update on new sequences, Authorship Contributions gene mapping, accession numbers and nomenclature. Pharmacogenetics 6:1–42. Orsetti M, Di Brisco F, Canonico PL, Genazzani AA, and Ghi P (2008) Gene regulation in the Participated in research design: Wei, Gu, Zhou. frontal cortex of rats exposed to the chronic mild stress paradigm, an animal model of human Conducted experiments: Zhou, Yang, Wang, Li. depression. Eur J Neurosci 27:2156–2164. Performed data analysis: Zhou, Shan. Preskorn S, Patroneva A, Silman H, Jiang Q, Isler JA, Burczynski ME, Ahmed S, Paul J, and Nichols AI (2009) Comparison of the pharmacokinetics of venlafaxine extended release and Wrote or contributed to the writing of the manuscript: Zhou, Wei, Gu, desvenlafaxine in extensive and poor cytochrome P450 2D6 metabolizers. JClinPsycho- Ouyang. pharmacol 29:39–43. 1432 Zhou et al.

Pucilowski O, Overstreet DH, Rezvani AH, and Janowsky DS (1993) Chronic mild stress- but not female rats rendered growth hormone deficient by neonatal monosodium glutamate. Mol induced anhedonia: greater effect in a genetic rat model of depression. Physiol Behav 54: Pharmacol 48:790 –797. 1215–1220. Wei Y, Yang L, Zhang X, Sui D, Wang C, Wang K, Shan M, Guo D, and Wang H (2018) Robinson HJ, Phares HF, and Graessle OE (1968) Effects of indomethacin on acute, subacute, and Generation and characterization of a CYP2C11-null rat model by using the CRISPR/Cas9 latent infections in mice and rats. J Bacteriol 96:6–13. method. Drug Metab Dispos 46:525–531. Ryan DE and Levin W (1990) Purification and characterization of hepatic microsomal cytochrome Wellington K and Perry CM (2001) Venlafaxine extended-release: a review of its use in the P-450. Pharmacol Ther 45:153–239. management of major depression. CNS Drugs 15:643–669. Scheer N, Kapelyukh Y, McEwan J, Beuger V, Stanley LA, Rode A, and Wolf CR (2012) Willner P (1997) Validity, reliability and utility of the chronic mild stress model of depression: Modeling human cytochrome P450 2D6 metabolism and drug-drug interaction by a novel panel a 10-year review and evaluation. Psychopharmacology (Berl) 134:319–329. of knockout and humanized mouse lines. Mol Pharmacol 81:63–72. Xu S, Lu X, Ying Y, He X, Zhang J, and Ye C (2002) An controlled analysis of clinical characters Scheer N, McLaughlin LA, Rode A, Macleod AK, Henderson CJ, and Wolf CR (2014) Deletion of of 43 cases with chronic depression. Sichuan Ment Health 15:24–26. 30 murine cytochrome P450 genes results in viable mice with compromised drug metabolism. Yamazaki H, editor (2014) Fifty Years of Cytochrome P450 Research, Springer, Tokyo. Drug Metab Dispos 42:1022–1030. Ye H, Sui D, Liu W, Yuan Y, Ouyang Z, and Wei Y (2019) Effects of CYP2C11 gene knockout on Su T and Ding X (2004) Regulation of the cytochrome P450 2A genes. Toxicol Appl Pharmacol the pharmacokinetics and pharmacodynamics of warfarin in rats. Xenobiotica 49:1478–1484. 199:285–294. Zanger UM and Schwab M (2013) Cytochrome P450 enzymes in drug metabolism: regulation of Sun X-L, Liu Y, Dai T, Ding J-H, and Hu G (2011) Uncoupling protein 2 knockout exacerbates gene expression, enzyme activities, and impact of genetic variation. Pharmacol Ther 138: depression-like behaviors in mice via enhancing inflammatory response. Neuroscience 192: 103–141. 507–514. Zanger UM, Turpeinen M, Klein K, and Schwab M (2008) Functional pharmacogenetics/genomics Tan EP, Li Y, Del Castillo Velasco-Herrera M, Yusa K, and Bradley A (2015) Off-target as- of human cytochromes P450 involved in drug biotransformation. Anal Bioanal Chem 392: sessment of CRISPR-Cas9 guiding in human iPS and mouse ES cells. Genesis 53: 1093–1108. 225–236. Zhao Z, Wang W, Guo H, and Zhou D (2008) Antidepressant-like effect of liquiritin from Gly- Teh LK and Bertilsson L (2012) Pharmacogenomics of CYP2D6: molecular , interethnic cyrrhiza uralensis in chronic variable stress induced depression model rats. Behav Brain Res differences and clinical importance. Drug Metab Pharmacokinet 27:55–67. 194:108–113. Thangavel C, Garcia MC, and Shapiro BH (2004) Intrinsic sex differences determine expression of Zhou X, Chan K, and Yeung JHK (2012) Herb-drug interactions with Danshen (Salvia miltior- – rhiza): a review on the role of cytochrome P450 enzymes. Drug Metabol Drug Interact 27:9–18. growth hormone-regulated female cytochrome P450s. Mol Cell Endocrinol 220:31 39. Downloaded from Venhorst J, ter Laak AM, Commandeur JNM, Funae Y, Hiroi T, and Vermeulen NPE (2003) Zuo E, Cai Y-J, Li K, Wei Y, Wang B-A, Sun Y, Liu Z, Liu J, Hu X, Wei W, et al. (2017) One-step Homology modeling of rat and human cytochrome P450 2D (CYP2D) isoforms and generation of complete gene knockout mice and monkeys by CRISPR/Cas9-mediated gene computational rationalization of experimental ligand-binding specificities. J Med Chem editing with multiple sgRNAs. Cell Res 27:933–945. 46:74–86. Wallace BD and Redinbo MR (2013) Xenobiotic-sensing nuclear receptors involved in drug metabolism: a structural perspective. Drug Metab Rev 45:79–100. Address correspondence to: Yuan Wei, School of Pharmacy, Jiangsu University, Wang X, Tang Y, Lu J, Shao Y, Qin X, Li Y, Wang L, Li D, and Liu M (2016) Characterization of 301 Xuefu Road, Jingkou Zone, Zhenjiang 212013, Jiangsu, China. E-mail: ywei@ novel cytochrome P450 2E1 knockout rat model generated by CRISPR/Cas9. Biochem Phar- ujs.edu.cn; or Jun Gu, Wadsworth Center, New York State Department of Health, macol 105:80–90. dmd.aspetjournals.org Waxman DJ, Ram PA, Pampori NA, and Shapiro BH (1995) Growth hormone regulation of male- Empire State Plaza, Albany, NY 12201-0509. E-mail: [email protected] specific rat liver P450s 2A2 and 3A2: induction by intermittent growth hormone pulses in male at ASPET Journals on September 26, 2021 DMD # 88526

CYP2D1 Gene Knockout Reduces the Metabolism and Efficacy of Venlafaxine in

Rat

Hongqiu Zhou , Li Yang, Changsuo Wang, Zhiqiang Li, Zhen Ouyang , Mangting Shan,

Jun Gu*, Yuan Wei*

Drug Metabolism and Disposition

Supplementary Table 1 . Comparison of sgRNA1, sgRNA2 and sgRNA3 activity in zebrafish zygotes.

target sequences zebrafish zygotes relative activities (survival number / total number) sgRNA1 0% (0/10) sgRNA2 12.5 (1/8) sgRNA3 25% (2/8)

DMD # 88526

Supplementary Table 2. Primer corresponding to CYP2D1, -2D2, -2D3, -2D4, -2D5 and -2D18 genes.

Primer Sequence (5' to 3') actin-F 5' - TGGAATCCTGTGGCATCCATGAAAC - 3' actin-R 5' - TAAAACGCAGCTCAGTAACAGTCCG - 3'

CYP2D1-F 5' - ACATGCCATACAGCCTCTACAAGC - 3'

CYP2D1-R 5' - CTCTCCATGAGTCACCAGCACTTC - 3' CYP2D5-F 5' - ACCGCCACCACACTGACCTG - 3' CYP2D5-R 5' - TCATCTCTGGACACCGCACCTG - 3' CYP2D4/18-F 5' - TGACCACCTCCACCACACTGAC - 3' CYP2D4/18-R 5' - ATCTCTGGACGCCGCACCTG - 3' CYP2D3-F 5' - GTGCTGAAGGATGAGACTGTCTGG - 3' CYP2D3-R 5' - AGGAGGCAGGTGAAGAAGAGGAAG - 3' CYP2D2-F 5' - GCCTGGAAGCCTGTAGTTGTGATC - 3' CYP2D2-R 5' - TCGTCTCTGCTCTCGCCACTC - 3'

DMD # 88526

Supplementary Table 3. Chronic mild stimulations (CMS) regime

Day Stressor 1 Tail suspension (5 min) 2 Rat cage tilting at 45° (12 h) 3 Humid padding (18 h) 4 Overcrowding (7 rats per cage, 2 h) 5 Electric shock (36 V, 2 times/min, 5min) 6 Forced swimming (25 °C, 5 min ) 7 Alternated light (12 h) and dark (12 h) 8 Fasting and water deprivation (24 h) 9 Humid padding (18 h) 10 Alternated light (12 h) and dark (12 h) 11 Tail suspension (5 min) 12 Forced swimming (25 °C, 5 min ) 13 Rat cage tilting at 45° (12 h) 14 Electric shock (36 V, 2 times/min, 5min) 15 Ice water (4 °C, 5 min) 16 Heat stress (45 °C, 5 min) 17 Ice water (4 °C, 5 min), then humid padding (18 h) 18 Heat stress (45 °C, 5 min), then tail suspension (5 min) 19 Ice water (4 °C, 5 min), then electric shock (36 V, 2 times/min, 5min) 20 Heat stress (45 °C, 5 min), then fasting and water deprivation (24 h)

DMD # 88526

Supplementary Table 4. Potential off-target sites

Match Sequences Location Coordinate name 216,605,602-216,605,7 1 AAACCCTTACCTCATCAGGA Chr 1 14 2 AGGCCCTCACCTCATCAGGA Chr 12 46,458,952-46,459,064 3 AGGCCCTTACCTCATCTGGA Chr 15 99,179,930-99,180,042 4 AGAGCCTTCCCTCATCAGGA Chr 18 70,391,506-70,391,618 5 AGACTCTAACCTCATCAGGA Chr 16 32,380,804-32,380,916 6 AGACTCTTACCTCCTCAGGA Chr 7 79,122,071-79,122,183 7 AGACCCTGACCACATCAGGA Chr X 12,254,209-12,254,321 130,416,050-130,416,1 8 AGACCCTTACCCCATCATGA Chr 5 62 9 AGACCCTTACCTCAGCTGGA Chr 3 99,118,529-99,118,641 Bases marked in red are potential off-target sites

DMD # 88526

Supplementary Table 5. Primers corresponding to the off-target site

Potential off-target sequences Corresponding F/R primers F: GAGGACAGACACAGACACCT 1 R: CCCTAAGCCAGACCTGAGAG F:ACACCCTACAACACACGGAA 2 R:GGTGTATAGGGGAGTCAGGC F:CATAGGGCCACATCCAGGAT 3 R:TGTGCTTGGCTTCCTCTACA F:CTTCCTGCACTTGGTTGTCC 4 R:ACTTCTGACTCAGCCATTGG F:CTTCCTCAAGTCTCCCCAGT 5 R:GCCTGGGAGATTAATAAAGCACA F:AGGAAGAACGTCATGGGGAG 6 R:GCTTCCTCCTCGACCTACAA F:AAGGAAGGGTGTGGAGAAGG 7 R:TCTTTCCCTGTGTTCCCTGG F:CCATCTGTCAGTGTCGGAGA 8 R:CTACTCCCTTCCCCATGACC F:CTTTTCAGGATGTGGCCAGG 9 R:AGGGGAGAATGGTGTCTGTG DMD # 88526

Supplementary Table 6. Body weight of CYP2D1-null and WT rats during 60 days WT-M Null-M WT-F Null-F

Day 7 15.31 ±1.92 14.04 ± 1.55 13.07 ± 2.12 13.28 ± 2.77

Day 30 120.40 ± 2.23 117.38 ± 6.87 101.76 ± 9.31 102.11 ± 4.09 Day 60 230.13 ±13.79 213.67 ± 6.60 223.68 ± 9.25 209.67 ± 3.84 All values are shown as the mean ± SD, n = 10.

DMD # 88526

Supplementary Table 7. Fertility of WT and CYP2D1-null rats.

Age at copulation plug Number of fertile pairs Litter size detection (day)

WT 67  4 25 11  3 CYP2D1-null 65  4 23 10  3 The breeding pairs were set up by one male and one female at their age of 60 days. All values are shown as the mean ± SD, n = 20.

DMD # 88526

Supplementary Figure 1. Comparison of mRNA expressions for wild-type and targeted CYP2D1 genes in rat livers. All values are shown as the mean ± SD, n = 3.

DMD # 88526

Supplementary Figure 2. Comparison of mRNA expressions for wild-type and CYP2D2 (A), -2D3 (B), -2D4/18 (C) and -2D5 (D) genes in rat livers. All values are shown as the mean ± SD, n = 3.