Cytogenetic and Molecular Profile of Endometrial Stromal Sarcoma

Francesca Micci1,2, Ludmila Gorunova1,2, Antonio Agostini1,2, Lene E. Johannessen1,2,

Marta Brunetti1,2, Ben Davidson3,4, Sverre Heim1,2,4, Ioannis Panagopoulos1,2

1 Section for Cancer Cytogenetics, Institute for Cancer Genetics and Informatics, The

Norwegian Radium Hospital, Oslo University Hospital, Oslo, Norway;

2 Centre for Cancer Biomedicine, University of Oslo, Oslo, Norway;

3 Department of Pathology, The Norwegian Radium Hospital, Oslo University Hospital, Oslo,

Norway;

4 Faculty of Medicine, University of Oslo, Oslo, Norway

Running title: Cytogenetic and Molecular Profile of ESS

Key words: fusion gene, endometrial stromal sarcoma, RNA sequencing, Reverse

TranscriptasePCR, microarray

Correspondance: Dr Francesca Micci, Section for Cancer Cytogenetics, Institute for Cancer

Genetics and Informatics, The Norwegian Radium Hospital, Oslo University Hospital, 0310

Oslo, Norway. phone: +4722782360; email: [email protected]

This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an ‘Accepted Article’, doi: 10.1002/gcc.22380

Abstract

Recent cytogenetic and molecular investigations have improved our understanding of endometrial stromal tumors, including sarcomas (ESS), and helped redefine their classification into more pathogenetically meaningful categories. Since much more can be gained through such studies, we add information on another 22 ESS examined by karyotyping,

PCR analysis, expression array analysis, and transcriptome sequencing. In spite of the known preference for certain pathogenetic pathways, we found considerable genetic heterogeneity in highgrade (HG) as well as in lowgrade (LG) ESS. Not all HG tumors showed a YWHAE-

NUTM chimeric transcript and as many as six LGESS showed no hitherto known ESSrelated fusions. Among the transcripts identified by transcriptome sequencing and verified by Sanger sequencing, new variants of ZC3H7-BCOR and its reciprocal BCOR-ZC3H7 were identified as was involvement of the CREBBP and MLLT4 genes (both well known leukemiarelated genes) in two new fusions. FISH analysis identified a known EPC1-PHF1 fusion which led to the identification of a new variant at the molecular level. The fact that around 70 genes were found differentially expressed, by microarray analysis, when comparing LGESS showing

ESSrelated fusions with LGESS without such transcripts, underscores the biochemical importance of the observed genetic heterogeneity and hints that new subgroups/entities in

LGESS still remain undiscovered.

John Wiley & Sons

Introduction

Endometrial stromal tumors (EST) are composed of cells resembling those of

proliferative phase endometrial stroma. According to the most recent World Health

Organization classification (WHO, 2014), four categories of EST exist depending on the

tumors’ mitotic activity, vascular invasion, and prognosis: benign endometrial stromal

nodules (ESN), lowgrade (LG) endometrial stromal sarcomas (ESS), highgrade (HG) ESS,

and undifferentiated endometrial/uterine sarcoma (UES/UUS). ESS, in its low and high

grade forms, account for less than 10 % of uterine sarcomas (WHO, 2014).

About 60 ESS with chromosome abnormalities have been karyotyped and

scientifically reported (Micci and Heim, 2015). Chromosomes 7 and 17 are recombined in the

first genetic hallmark to be discovered in ESS, namely the translocation t(7;17)(p15;q11)

(Fletcher et al., 1991; Sreekantaiah et al., 1991). Koontz et al. (2001) demonstrated that two

zinc finger genes were fused by this translocation, the JAZF1 gene from chromosomal band

7p15 and SUZ12 (formerly known as JJAZ1) from 17q11. Chromosomal band 7p1521 was

subsequently found rearranged with other partners than chromosome 17 in some ESS

(Laxman et al., 1993; Iliszko et al., 1998; GilBenso et al., 1999; Micci et al., 2003; Micci et

al., 2006) suggesting that alternative, pathogenetically equivalent variant translocations exist.

In the first such variant to be studied in molecular detail, a t(6;7), we found that JAZF1 was

recombined with the PHF1 gene from chromosomal band 6p21 (Micci et al., 2006). Band

6p21 may also be rearranged in other ESSspecific fusions with the EPC1 and MEAF6 genes

from 10p11 and 1p34, respectively (Micci et al., 2006; Panagopoulos et al., 2012; Micci et al.,

2014). Fusions of the JAZF1, SUZ12, and PHF1 genes appear to be frequent, although

certainly not ubiquitous, in LGESS, but have also been found in other types of EST (Chiang

et al., 2011).

John Wiley & Sons

Lately, another two fusion transcripts have also been identified in LGESS. ZC3H7B-

BCOR stems from an X;22translocation whereas MBTD1-Cxorf67 is caused by a t(X;17)

(Panagopoulos et al., 2013; Dewaele et al., 2014).

The cytogenetic literature contains altogether 19 cases with a t(10;17)(q22;p13), all of them belonging to the HGESS subtype with more aggressive clinical behavior. Lee et al.

(2012) described a YWHAE-NUTM (previously known as YWHAE-FAM22) chimeric fusion brought about by this rearrangement.

Gene expression profiles exist for 21 EST (Lee et al., 2012; Davidson et al., 2013;

Dewaele et al., 2014) of which six tumors were described as HGESS/UUS showing a 10;17 translocation (Lee et al., 2012; Dewaele et al., 2014), six were LGESS characterized by a specific 7;17translocation (Lee et al., 2012; Dewaele et al., 2014), two cases were LGESS showing a t(X;17), and the remaining seven were LGESS with no karyotypic and/or genetic information (Davidson et al., 2013).

We wanted to increase the knowledge on ESS analyzing a series of 27 tumors (19

LGESS and eight HGESS) using different approaches that vary from standard techniques such as karyotyping and PCR to the more modern microarray and sequencing methodologies.

Material and Methods

Tumors

The material consisted of 27 samples from primary EST (Table 1) surgically removed at The Norwegian Radium Hospital. All tumors showed presence of endometrial differentiation. Eight of the tumors were diagnosed as HGESS whereas 18 were LGESS.

HGESS are diagnosed based on morphology and the presence of diffuse (>70%) nuclear staining for cyclin D1 (WHO, 2014). Case 9 was an ESS showing areas with a mixture of LG and HG differentiation which changed from slide to slide. The case was described as not

John Wiley & Sons

otherwise specified (NOS). The tumor biobank has been registered according to national

legislation and the study has been approved by the Regional Committee for Medical Research

Ethics SouthEast, REK; project numbers S07194a and 2.2007.425.

G-Banding and karyotyping

The specimens intended for cytogenetic analysis (n=18) were mechanically and

enzymatically disaggregated and shortterm cultured as previously reported (Micci et al.,

1999). The subsequent cytogenetic analysis and karyotypic description followed the

recommendations of the International System for Human Cytogenetic Nomenclature (ISCN,

2009).

Molecular investigations

RNA extraction

RNA was extracted from the tumors using Trizol reagent (Life Technologies) with a

homogenizer (Omni THQ Digital Tissue Homogenizer, Kennesaw, GA, USA). The RNA

quality was evaluated using the Experion Automated Electrophoresis System (BioRad

Laboratories, Hercules, CA, USA). cDNA was synthesized using the iScript kit and random

primers (BioRad Laboratories). All procedures were done according to the manufacturers’

recommendations.

Polymerase Chain Reaction (PCR)

Reverse transcriptase (RT) PCR was used to investigate the presence of known fusion

transcripts in all the samples as well as to validate the results from RNA sequencing. The

primers used are listed in Table 2. The conditions used for PCR reactions were as previously

reported (Micci et al., 2006; Panagopoulos et al., 2012; Panagopoulos et al., 2013; Dewaele et

John Wiley & Sons

al., 2014). All PCR products obtained were sent for direct sequencing (Sanger Sequencing) at

GATC Biotech (http://www.gatcbiotech.com/en/sangerservices/lightrunsequencing.html).

Microarray

Twentyfour samples were analyzed for gene expression. The microarray experiments were performed at the Norwegian Genomics Consortium in Oslo (http://oslo.genomics.no/) using the Illumina iScan which is based upon fluorescence detection of biotinlabeled cRNA.

The experiments were performed as previously described (Micci et al., 2013). Bead summary data was imported into GenomeStudio to remove control probes and to produce a text file containing the signal and detection pvalues per probe for all samples, as well as inputing missing data using the knearest neighbor algorithm (Tech note: Inputing HumanHT12

Expression BeadChip Data; Illumina, Inc.). The text file was imported into JExpress Pro

2011, and signal intensity values were quantile normalized (Bolstad et al., 2003) and log transformed (base 2). Significance Analysis of Microarrays (SAM) (Tusher et al., 2001) was used to look for differentially expressed genes. To obtain manageable datasets, differentially expressed genes were defined by a fold change >2 and q value ¼ 0.

RNA sequencing

A total of 3 µg of RNA from 18 ESS with available RNA was sent for highthroughput pairedend RNAsequencing at the Norwegian Sequencing Centre, Ullevål Hospital

(http://www.sequencing.uio.no/). The sequencing was performed using the Illumina HiSeq

2000 instrument. The Illumina software pipeline was used to process image data into raw sequencing data and only sequence reads marked as “passed filtering” were used in the downstream data analysis. The FASTQC software was used for quality control of the raw sequence data (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). An average number of 93 million sequence reads (range 32 to 180 millions) was obtained from

John Wiley & Sons

transcriptome sequencing. We used the fusion discovery software FusionMap (release date

20120416) (Ge et al., 2011) and the prebuilt Human B37 and RefGene from the FusionMap

website (http://www.omicsoft.com/fusionmap/), as well as the Fusion Catcher software

(version 0.99.3a betaApril 15, 2014) with the associated ENSEMBL, UCSC, and RefSeq

databases automatically downloaded by FusionCatcher

(https://code.google.com/p/fusioncatcher/) (Kangaspeska et al., 2012) as an additional tool to

detect fusion transcripts.

Results

Karyotyping

The 18 samples which were cytogenetically analyzed all showed an abnormal

karyotype (Table 1). Thirteen of them have not been reported before whereas five karyotypes

have been published by our group (cases 13, 16, 17, 22, and 25) (Micci et al., 2006;

Panagopoulos et al., 2012; Panagopoulos et al., 2013; Micci et al., 2014). Among the 13 new

cases, four were HGESS, eight were LGESS, and one (case 9) was an ESS NOS. Only one

HGESS (case 8) showed a 10;17translocation as the sole karyotypic abnormality. Cases 1

and 2 presented triploid karyotypes showing both structural and numerical aberrations,

whereas case 3 had a nearpentaploid karyotype with multiple structural rearrangements only

few of which could be identified. None of the aberrations of these three HGESS showed

involvement of any of the chromosomes, let alone chromosome bands, known to be involved

in ESTspecific rearrangements. Among the eight LGESS, three tumors (cases 11, 12, and 26)

showed the specific 7;17translocation either as the sole karyotypic aberration (case 11) or

among other abnormalities (cases 12 and 26). Case 27 showed a 6;10 and a 10;6insertion.

Case 10 had monosomy 10 as the sole aberration, whereas in the remaining three LGESS

(cases 14, 15, and 24), a neardiploid karyotype was found showing both numerical and

John Wiley & Sons

structural aberrations. Case 9 had two unrelated clones, one with a possible del(X)(p21), the other, triploid, with both structural and numerical aberrations.

RT-PCR

All tumors were tested for the fusions known to be associated with ESS. A summary of the results is shown in Table 1. The fusions were all confirmed by Sanger sequencing. PCR investigations confirmed the presence of all fusions previously published (Micci et al., 2006;

Panagopoulos et al., 2012; Panagopoulos et al., 2013; Micci et al., 2014). The YWHAE-NUTM fusion was found in five cases, all of them HGESS. The JAZF1-SUZ12 fusion transcript was identified in four LGESS. A JAZF1-PHF1 fusion was identified in one tumor (case 24). Case

9, the ESS NOS, showed a specific fusion between the EPC1 gene, mapping on 10p11, and the PHF1 gene, from 6p21. Fusion of the same genes was also found in case 27 but with a new variant, i.e., the junction involved exon 9 of the EPC1 (accession number NM_025209.3)

(Figure 1).

RTPCR was used to validate those fusions obtained by sequencing analysis that showed higher seed count. An overview of the cases analyzed and the transcripts identified is provided in Table 1. In case 20, transcriptome sequencing (see below) identified the presence of a ZC3H7B-BCOR and its reciprocal BCOR-ZC3H7B fusion, previously described by

Panagopoulos et al. (2013) as brought about by a X;22translocation. Sequencing of the amplified cDNA fragments showed two transcripts from the ZC3H7B-BCOR fusion, one with involvement of exon 10 of ZC3H7B (accession number NM_017590.5) and exon 9 of BCOR

(accession number NM_017745.5), the other showing a fusion between exon 12 of ZC3H7B and exon 9 of BCOR (Figure 1). The reciprocal BCOR-ZC3H7B fusion was between exon 7 of BCOR and exon 13 of ZC3H7B.

Microarray 8

John Wiley & Sons

The original microarray data can be found in the public database Gene Expression

Omnibus (GEO; available at:http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE73361).

The microarray analysis of 24 ESS was performed taking into consideration the pathological

subclassification of the tumors so that the expression profiles of the HGESS (7 tumors) were

compared to those of the LGESS (17 tumors). The ESS classified as NOS was grouped with

the LG tumors since it showed an EPC1-PHF1. We identified 514 differentially expressed

unique genes in the comparison between the two groups, of which 187 genes were down

regulated in the HG compared to the LGgroup of ESS and 327 genes were upregulated in the

HG compared to the LGgroup of ESS (Supplementary Table S1). The data were plotted

using Correspondence Analysis (CA) (Fellenberg et al., 2001) to look for the greatest co

variance between samples and genes so as to see if any array behaved differently compared to

the others. The CAplot of the samples from the two groups (HG vs LG) showed a distinct

separation. Among the LGESS, several CAplots were also performed to compare different

subgroups based on the karyotypic aberration and/or specific gene fusion present. In these

analyses, False discovery rate (FDR) <0.05 was used as cutoff. The comparison between

tumors showing t(7;17) and the LGESS samples without specific chromosomal rearrangement

and/or gene fusion (referred to from now on as OTHER) revealed around 70 differentially

expressed genes (Figure 2), all other comparisons showed less than ten. The comparison

between tumors showing a t(X;22) and OTHER identified eight differentially expressed genes.

Furthermore, the comparisons between the group of ESS with 6prearrangements versus

t(X;22) or OTHER revealed no differentially expressed gene. A list of the genes and probes

differentially expressed in each comparison can be found in Supplementary Information.

RNA sequencing

John Wiley & Sons

The Fusion Map and Fusion Catcher programs were used to find fusion transcripts in the samples (Liu et al., 2016). We focused only on the common transcripts. Five out of the 18

ESS sequenced showed a previously described fusion: cases 13 and 17 had a BCOR-ZC3H7B

(Panagopoulos et al., 2013), cases 16 and 25 showed a MEAF6-PHF1 (Panagopoulos et al.,

2012; Micci et al., 2014), and in case 20 the ZC3H7B-BCOR and its reciprocal BCOR-

ZC3H7B transcript were found. Validation of the fusions by PCR using specific primer combinations revealed the presence of three transcripts in the latter case (see Results for PCR analyses). Since most of the putative fusions detected by both programs/algoritms may be false positives, we selected 22 different fusions with the highest seed counts from 13 tumors to validate their actual presence by PCR using specific primer combinations. PCR reactions for seven transcripts did not show any amplification of the putative fusion, but the remaining

15 transcripts could be amplified by PCR and direct sequencing (Supplementary Table S2).

For all but two transcripts (H2AFY-HMHB1 from case 19 and NAIP-OCLN from case 21), the two genes were found to be inframe. The transcriptome sequencing did not detect any

YWHAE-NUTM fusion in the seven HGESS with NGS data.

Discussion

Recent cytogenetic and molecular investigations have improved our understanding of

EST and helped classify them into more meaningful categories. These tumors typically demonstrate relatively simple karyotypes with specific chromosomal rearrangements (the majority of ESN, LGESS, and YWHAErearranged HGESS) or harbor complex cytogenetic aberrations lacking specific rearrangements (as in EUS/UUS). The 2014 WHO classification of EST (2014) incorporates molecular findings, and yet molecular testing is not routinely performed when these diagnoses are suspected. The molecular signature may be diagnostically helpful when dealing with cases of unusual location or morphology;

John Wiley & Sons

furthermore, a better genetic characterization of these tumors may also provide prognostically

and/or therapeutically relevant information. Since the cytogenetic and molecular literature on

EST is still severely limited (Table 3), we add to the body of knowledge information on 27

ESS investigated using cytogenetic, PCR, expression array, and transcriptome sequencing

analyses.

The karyotypic data on 13 of the ESS described here (Table 1) have not been reported

before. Karyotypic complexity was observed in both HG and LG tumors. In five cases, a neat

correspondence between karyotypic aberrations and molecular findings was identified, i.e.,

case 8 showed a 10;17translocation leading to a YWHAE-NUTM fusion, cases 11, 12, and 23

had a specific t(7;17) and a JAZF1-SUZ12 fusion, and case 27 showed two insertions, an

ins(6;10) and an ins(10;6), leading to an EPC1-PHF1 fusion. In case 9, on the other hand, a

specific fusion was seen between the EPC1 gene, mapping on 10p11, and the PHF1 gene

from 6p21, in spite of the fact that no rearrangement of these two chromosome bands was

seen cytogenetically. Likewise, a JAZF1-PHF1 fusion was identified in one tumor (case 24)

which in its karyotype had no visible rearrangement of 7p15 and/or 6p21. Evidently, cases of

ESS exist that by karyotyping are “false negatives,” i.e., the pathogenetically crucial gene

level rearrangement takes place without visible change of the chromosomal morphology. The

fact that some ESS may carry cryptic rearrangements leading to one of the known fusions

characteristic of this tumor type has also previously been alluded to (Micci et al., 2014).

Specific gene fusions may also possibly be hidden in rings and/or marker chromosome(s) that

are part of incompletely described karyotypes.

The karyotypic data gave the impression of increasing complexity from LG to HG

ESS, something that has also been seen by others. Flicker et al. (2015) performed aCGH on

30 EST showing an increasing number of copy number changes from ESN to LGESS and

John Wiley & Sons

UES. In their study as well as in the present one, the chromosomal aberrations differed considerably among the groups, indicating that a linear tumor progression from one group to the next does not take place. Instead, classification into different entities based on genetic aberration pattern is more appropriate.

The microarray analysis identified 514 differentially expressed genes between HG and

LGESS. Seventysix of these genes are already known to be associated with cancer. No hint as to which of them may be the most important in ESS is at hand. The comparison between

LGESS having a t(7;17) and/or JAZF1-SUZ12 fusion versus those showing 6p rearrangements and/or PHF1 involvement showed no differentially expressed genes. In contrast, the comparison between tumors with t(7;17) and those with t(X;22) showed nine genes that were differentially expressed. These results show once more that despite the presence of different fusions, these tumors are quite similar and belong to the same subgroup as far as phenotype and gene expression pattern are concerned. The JAZF1-SUZ12, JAZF1-

PHF1, EPC1-PHF1, MEAF6-PHF1, ZC3H7B-BCOR, and possibly also MBTD1-Cxorf67 gene fusions (admittedly, the latter was not found in our comparison/series) appear to represent biologically and clinically equivalent oncogenic events in the tumorigenesis of

LGESS.

JAZF1 is a transcriptional repressor and SUZ12, PHF1, and MBTD1 are members of the polycomb group protein family involved in transcriptional repression. ZC3H7B is involved in proteinnucleic acid interactions, while BCOR is known to interact with polycomb group proteins; hence, ZC3H7BBCOR probably mediates its oncogenic effects through aberrant epigenetic regulation (Panagopoulos et al., 2013). EPC1 is part of the nucleosome acetyltransferase of histone H4 complex, whereas MEAF6 is part of histone acetyltransferase multisubunit complexes. EPC1PHF1 and MEAF6PHF1 are believed to alter acetylation

John Wiley & Sons

patterns of histone proteins resulting in unravelling of the heterochromatin and aberration

gene expression (Avvakumov and Cote, 2007; Panagopoulos et al., 2012). All these fusions

appear to combine genes that are known to be involved in transcriptional regulation, i.e.,

polycomb group complexmediated and aberration methylation/acetylation; hence, their

presumed oncogenic effects are probably mediated through altered transcriptional control in

endometrial stromal progenitor cells.

In contrast, the comparison between 7;17associated tumors and those described as

OTHER (6 tumors; cases 10, 14, 15, 18, 19, and 21), the ones showing no characteristic

chromosomal rearrangement and/or fusion genes, revealed around 70 differently expressed

genes (Supplementary Table 3). Little cytogenetic information is available on these tumors as

only three of them were sent for cell culturing and karyotyping. Case 10 showed monosomy

10 as the sole aberration in the karyotype, whereas case 14 showed as many as twelve

chromosomal aberrations with both numerical and structural rearrangements, and case 15 had

a hyperdiploid stemline with aberrations that could only be partly described in a composite

karyotype. The cytogenetic literature contains information on seven ESS with no visible

rearrangements of the chromosomal bands known to be involved in ESSspecific fusions, but

no molecular information is available on these tumors allowing a classification based on

molecular signature. We cannot but speculate that the said six cases of our series may

represent a subgroup or variants of “classical” LGESS, despite their unequivocal histological

classification.

Transcriptome sequencing was performed on the 18 tumors with available RNA.

Surprisingly and alarmingly, none of the programs/algoritms used to screen the data for fusion

transcripts, i.e., FusionMap and Fusion Catcher, detected the presence of YWHAE-NUTM in

the four HGESS positive for this fusion by PCR. We did not check, however, if such a

John Wiley & Sons

transcript was nevertheless present in the raw data and retrievable by use of the “grep” command (Panagopoulos et al., 2014a; Panagopoulos et al., 2014b), but assume that to be the case. In spite of its immense investigative and attraction value, the next generation sequencing technology regrettably yields results that may be both falsely negative and positive

(Panagopoulos et al., 2014a).

The only tumor showing a known ESSrelated fusion transcript by NGS was case 20 in which a ZC3H7B-BCOR and its reciprocal BCOR-ZC3H7B were detected. However, PCR analyses confirmed the presence of variants of fusions compared to those previously reported by Panagopoulos et al. (2013). The three new transcripts fuse either exon 10 or exon 12 of

ZC3H7B (accession number NM_017590.5) with exon 9 of BCOR (accession number

NM_017745.5) in the two variants of the ZC3H7B-BCOR, whereas the variant of BCOR-

ZC3H7B shows an inframe fusion between exon 7 of BCOR and exon 13 of ZC3H7B (Figure

1).

Twentytwo putative fusions were selected from those ranking highest based on the sequence analyses with both programs in the 13 cases examined. Amplification of cDNA with specific primers for each fusion confirmed the presence of the transcripts in 15 instances

(Supplementary Table 2). The seven transcripts that were not confirmed by PCR could be false positives/artefacts introduced during the RNA library preparation stage (Quail et al.,

2008; Panagopoulos et al., 2014c) and/or the consequence of readthrough transcription which occurs when the RNA polymerase continues beyond the normal termination sequence into an adjacent gene (Nacu et al., 2011). Among these 15 transcripts, GMPS-SYNPR (case 14) was particularly interesting since the two involved genes map to 3q25 and 3p14, respectively, and the karyotype showed two different rearrangements involving 3q. The correspondence between the molecular and karyotypic data adds credibility to the idea that this could be an

John Wiley & Sons

important transcript in tumor development. Its function needs further investigation. The fusion

is inframe and involves exon 12 from the GMPS gene and exon 3 from SYNPR

(Supplementary Table 2). GMPS (accession number NM_003875) encodes a guanine

monophosphate synthetase whereas SYNPR (accession number NM_144642) codes for a

synatoporin. None of these genes has been reported to be directly involved in cancer; however,

a study by Reddy et al. (2014) showed that GMPS is required for USP7mediated stabilization

of p53.

Case 15 showed another interesting fusion, between the lysine (K)specific

demethylase 2B (KDM2B) on 12q24 and the CREB binding protein (CREBBP) on 16p13. The

inframe fusion is between exon 22 of KDM2B (accession number NM_032590) and exon 2

of CREBBP (accession number NM__004380). The KDM2B gene (also known as Ndy1,

FBXL10, and JHDM1B) encodes a member of the Fbox protein family which is characterized

by an approximately 40 amino acid motif (Fbox). The Fbox proteins constitute one of the

four subunits of the ubiquitin protein ligase complex called SCFs (SKP1cullinFbox) which

functions in phosphorylationdependent ubiquitination. It has been found that KDM2B, an

H3K36 histone demethylase implicated in bypassing cellular senescence and somatic cell

reprogramming, is markedly overexpressed in human pancreatic ductal adenocarcinoma

(PDAC), with levels increasing with disease grade and stage, and showing the highest

expression in metastases (Tzatsos et al., 2013). KDM2B silencing abrogated tumorigenicity of

PDAC cell lines exhibiting loss of epithelial differentiation, whereas KDM2B overexpression

cooperated with KrasG12D to promote PDAC formation in mouse models. Gain and lossof

function experiments coupled to genomewide gene expression and ChIP studies revealed that

KDM2B drives tumorigenicity through two different transcriptional pathways. KDM2B

repressed developmental genes through cobinding with Polycomb group (PcG) proteins at

John Wiley & Sons

transcriptional start sites, but also activated a module of metabolic genes, including mediators of protein synthesis and mitochondrial function, cobound by the MYC oncoprotein and the histone demethylase KDM5A. These results defined epigenetic programs through which

KDM2B subverts cellular differentiation and drives the pathogenesis of an aggressive subset of PDAC (Tzatsos et al., 2013). The CREBBP gene is ubiquitously expressed and is involved in the transcriptional coactivation of many different transcription factors. First isolated as a nuclear protein that binds to cAMPresponse element binding protein (CREB), the gene is now known to play critical roles in embryonic development, growth control, and homeostasis by coupling chromatin remodeling to transcription factor recognition. The protein encoded by this gene has intrinsic histone acetyltransferase activity but also acts as a scaffold to stabilize additional protein interactions with the transcription complex. It acetylates both histone and nonhistone proteins. Chromosomal translocations targeting this gene have been associated with acute myeloid leukemia (AML) (Borrow et al., 1996; Panagopoulos et al., 2014b). The breakpoint identified in our case 15 is the same as that previously described (Panagopoulos et al., 2000) indicating that the fusion retains the oncogenic activities typical for AML (Borrow et al., 1996) also in this case of LGESS. This is the first time that CREBBP is found involved in a fusion transcript in solid tumors, and its importance in LGESS needs to be evaluated in larger series. The Mitelman Database for Chromosome Aberrations and Gene Fusions in

Cancer (http://cgap.nci.nih.gov/Chromosomes/Mitelman) reports two ESS with alteration of chromosome 16 (Laxman et al., 1993; Iliszko et al., 1998) and one with 12q rearrangement

(Havel et al., 1989), though with different breakpoint positions from those of the 6;12 translocation we identified. These rearrangements may possibly lead to a cryptic KDM2B-

CREBBP fusion since the three tumors did not show any rearrangement typical of ESS.

John Wiley & Sons

The finding of similar, specific gene fusions in different tumor types is well known in

cancer, and ESSrelated fusions are no exception. Recently, ZC3H7B-BCOR, MEAF6-PHF1,

and EPC1-PHF1 fusions have been found in ossifying fibromyxoid tumors (OFMT)

(Antonescu et al., 2014) and a JAZF1-PHF1 was found in a cardiac ossifying sarcoma

(Schoolmeester et al., 2013). Furthermore, a new PHF1fusion variant, EP400-PHF1, was

also described in OFMT (GebreMedhin et al., 2012; Endo et al., 2013). We do not have any

explanation for such similarities between different mesenchymal tumors or the involvement of

the CREBBP gene in leukemias and ESS; it seems that they are not tissuespecific although

their tumorigenic role is unquestionable. The same can be said for the MLLT4-RB1 transcript

found in case 6. The fusion is between the myeloid/lymphoid or mixedlineage leukemia gene

(MLLT4 on 6q27) and the retinoblastoma 1 gene (RB1 in 13q14). The former gene is usually

found rearranged through a t(6;11)(q27;q23) leading to an MLL-AF6 in childhood AML; its

finding is associated with poor disease outcome. The latter gene encodes a negative regulator

of the cell cycle and was the first tumor suppressor gene discovered. This is the first time the

two genes have been found together in a fusion transcript. Their role as well as the mechanism

through which they act, being it the formation of a chimeric protein or loss of function for

RB1, needs to be clarified.

The eight remaining fusions detected by the sequencing analysis and confirmed by

PCR have not been reported before and their role in ESS needs further elucidation. Since

these tumors were all classified as ESS by histology but showed no known ESSspecific

fusion, they may represent new subgroups/entities under the big umbrella of ESS highlighting

the presence of genetic heterogeneity in these tumors. Such heterogeneity is present in both

HGESS and LGESS. In the former group, it was demonstrated by the fact that not all HG

showed YWHAEfusion neither in the present series nor in the previous report by Sciallis et al.

John Wiley & Sons

(2014). Both studies found that whereas YWHAErearranged ESS consistently show HG cytomorphology, the reverse is not always true, i.e, not all uniform HGESS carry YWHAE rearrangements. Furthermore, there remains a small group of LGESS which lack genetic rearrangements of known ESSassociated fusion genes, indicating that additional, still unknown fusion transcripts may be characteristic of this tumor type and will be identified in the future. The expression profile, showing around 70 differently expressed genes, hints to the possibility that these tumors may belong to a new genetic subgroup. Further studies are necessary to obtain a more complete picture of ESS tumorigenesis. Since each approach has its pros and cons, it is mandatory to use a combination of techniques to avoid skewness brought about by both false positive and false negative results.

Supplementary Information accompanies this paper.

Disclosure/Conflict of interest

The authors declare no conflict of interest.

Acknowledgment

This work was supported by grants from the Radium Hospital Foundation.

References

Antonescu CR, Sung YS, Chen CL, Zhang L, Chen HW, Singer S, Agaram NP, Sboner A,

Fletcher CD. 2014. Novel ZC3H7BBCOR, MEAF6PHF1, and EPC1PHF1 fusions

in ossifying fibromyxoid tumorsmolecular characterization shows genetic overlap

with endometrial stromal sarcoma. Genes Chromosomes Cancer 53:183193.

John Wiley & Sons

Avvakumov N, Cote J. 2007. The MYST family of histone acetyltransferases and their

intimate links to cancer. Oncogene 26:53955407.

Bolstad BM, Irizarry RA, Astrand M, Speed TP. 2003. A comparison of normalization

methods for high density oligonucleotide array data based on variance and bias.

Bioinformatics 19:185193.

Borrow J, Stanton VP, Jr., Andresen JM, Becher R, Behm FG, Chaganti RS, Civin CI,

Disteche C, Dube I, Frischauf AM, Horsman D, Mitelman F, Volinia S, Watmore AE,

Housman DE. 1996. The translocation t(8;16)(p11;p13) of acute myeloid leukaemia

fuses a putative acetyltransferase to the CREBbinding protein. Nat Genet 14:3341.

Chiang S, Ali R, Melnyk N, McAlpine JN, Huntsman DG, Gilks CB, Lee CH, Oliva E. 2011.

Frequency of known gene rearrangements in endometrial stromal tumors. Am J Surg

Pathol 35:13641372.

Davidson B, Abeler VM, Hellesylt E, Holth A, Shih I, SkeieJensen T, Chen L, Yang Y,

Wang TL. 2013. Gene expression signatures differentiate uterine endometrial stromal

sarcoma from leiomyosarcoma. Gynecol Oncol 128:349355.

Dewaele B, Przybyl J, Quattrone A, Finalet FJ, Vanspauwen V, Geerdens E, Gianfelici V,

Kalender Z, Wozniak A, Moerman P, Sciot R, Croce S, Amant F, Vandenberghe P,

Cools J, DebiecRychter M. 2014. Identification of a novel, recurrent MBTD1

CXorf67 fusion in lowgrade endometrial stromal sarcoma. Int J Cancer 134:1112

1122.

John Wiley & Sons

Endo M, Kohashi K, Yamamoto H, Ishii T, Yoshida T, Matsunobu T, Iwamoto Y, Oda Y.

2013. Ossifying fibromyxoid tumor presenting EP400PHF1 fusion gene. Hum Pathol

44:26032608.

Fellenberg K, Hauser NC, Brors B, Neutzner A, Hoheisel JD, Vingron M. 2001.

Correspondence analysis applied to microarray data. Proc Natl Acad Sci U S A

98:1078110786.

Fletcher JA, Kozakewich HP, Hoffer FA, Lage JM, Weidner N, Tepper R, Pinkus GS, Morton

CC, Corson JM. 1991. Diagnostic relevance of clonal cytogenetic aberrations in

malignant softtissue tumors. N Engl J Med 324:436442.

Flicker K, Smolle E, Haybaeck J, Moinfar F. 2015. Genomic characterization of endometrial

stromal sarcomas with array comparative genomic hybridization. Exp Mol Pathol

98:367374.

Ge H, Liu K, Juan T, Fang F, Newman M, Hoeck W. 2011. FusionMap: detecting fusion

genes from nextgeneration sequencing data at basepair resolution. Bioinformatics

27:19221928.

GebreMedhin S, Nord KH, Moller E, Mandahl N, Magnusson L, Nilsson J, Jo VY, Vult von

SF, Brosjo O, Larsson O, Domanski HA, Sciot R, DebiecRychter M, Fletcher CD,

Mertens F. 2012. Recurrent rearrangement of the PHF1 gene in ossifying fibromyxoid

tumors. Am J Pathol 181:10691077.

GilBenso R, LopezGines C, Navarro S, Carda C, LlombartBosch A. 1999. Endometrial

stromal sarcomas: immunohistochemical, electron microscopical and cytogenetic

findings in two cases. Virchows Arch 434:307314.

John Wiley & Sons

Havel G, Wedell B, Dahlenfors R, Mark J. 1989. Cytogenetic relationship between uterine

lipoleiomyomas and typical leiomyomas. Virchows Arch B Cell Pathol Incl Mol

Pathol 57:7779.

Iliszko M, Mandahl N, Mrozek K, Denis A, Pandis N, Pejovic T, Babinska M, Nedoszytko B,

Debniak J, Emerich J, Hrabowska M, Bloomfield CD, Limon J. 1998. Cytogenetics of

uterine sarcomas: presentation of eight new cases and review of the literature. Gynecol

Oncol 71:172176.

ISCN. 2009. An International System for Human Cytogenetic Nomenclature. Shaffer LG,

Slovak ML, Campbell LJ (eds), Basel: Karger.

Kangaspeska S, Hultsch S, Edgren H, Nicorici D, Murumagi A, Kallioniemi O. 2012.

Reanalysis of RNAsequencing data reveals several additional fusion genes with

multiple isoforms. PLoS One 7:e48745.

Koontz JI, Soreng AL, Nucci M, Kuo FC, Pauwels P, Van den Berghe H, Dal Cin P, Fletcher

JA, Sklar J. 2001. Frequent fusion of the JAZF1 and JJAZ1 genes in endometrial

stromal tumors. Proc Natl Acad Sci U S A 98:63486353.

Laxman R, Currie JL, Kurman RJ, Dudzinski M, Griffin CA. 1993. Cytogenetic profile of

uterine sarcomas. Cancer 71:12831288.

Lee CH, Ou WB, MarinoEnriquez A, Zhu M, Mayeda M, Wang Y, Guo X, Brunner AL,

Amant F, French CA, West RB, McAlpine JN, Gilks CB, Yaffe MB, Prentice LM,

McPherson A, Jones SJ, Marra MA, Shah SP, van de Rijn M, Huntsman DG, Dal Cin

P, DebiecRychter M, Nucci MR, Fletcher JA. 2012. 1433 fusion oncogenes in high

grade endometrial stromal sarcoma. Proc Natl Acad Sci U S A 109:929934.

John Wiley & Sons

Liu S, Tsai WH, Ding Y, Chen R, Fang Z, Huo Z, Kim S, Ma T, Chang TY, Priedigkeit NM,

Lee AV, Luo J, Wang HW, Chung IF, Tseng GC. 2016. Comprehensive evaluation of

fusion transcript detection algorithms and a metacaller to combine top performing

methods in pairedend RNAseq data. Nucleic Acids Res. 18;44(5):e47.

Micci F, Heim S. 2015. Tumors of the female genital organs. In: Heim S, Mitelman F (eds)

Cancer Cytogenetics. Wiley Blackwell, pp 447480.

Micci F, Gorunova L, Gatius S, MatiasGuiu X, Davidson B, Heim S, Panagopoulos I. 2014.

MEAF6/PHF1 is a recurrent gene fusion in endometrial stromal sarcoma. Cancer Lett

347:7578.

Micci F, Panagopoulos I, Bjerkehagen B, Heim S. 2006. Consistent rearrangement of

chromosomal band 6p21 with generation of fusion genes JAZF1/PHF1 and

EPC1/PHF1 in endometrial stromal sarcoma. Cancer Res 66:107112.

Micci F, Panagopoulos I, Haugom L, Dahlback HS, Pretorius ME, Davidson B, Abeler VM,

Trope CG, Danielsen HE, Heim S. 2013. Genomic aberration patterns and expression

profiles of squamous cell carcinomas of the vulva. Genes Chromosomes Cancer

52:551563.

Micci F, Teixeira MR, Dietrich CU, Saeter G, Bjerkehagen B, Heim S. 1999. Combined

RxFISH/Gbanding allows refined karyotyping of solid tumors. Hum Genet 104:370

375.

Micci F, Walter CU, Teixeira MR, Panagopoulos I, Bjerkehagen B, Saeter G, Heim S. 2003.

Cytogenetic and molecular genetic analyses of endometrial stromal sarcoma:

John Wiley & Sons

nonrandom involvement of chromosome arms 6p and 7p and confirmation of

JAZF1/JJAZ1 gene fusion in t(7;17). Cancer Genet Cytogenet 144:119124.

Nacu S, Yuan W, Kan Z, Bhatt D, Rivers CS, Stinson J, Peters BA, Modrusan Z, Jung K,

Seshagiri S, Wu TD. 2011. Deep RNA sequencing analysis of readthrough gene

fusions in human prostate adenocarcinoma and reference samples. BMC Med

Genomics 4:11.

Panagopoulos I, Isaksson M, Lindvall C, Bjorkholm M, Ahlgren T, Fioretos T, Heim S,

Mitelman F, Johansson B. 2000. RTPCR analysis of the MOZCBP and CBPMOZ

chimeric transcripts in acute myeloid leukemias with t(8;16)(p11;p13). Genes

Chromosomes Cancer 28:415424.

Panagopoulos I, Micci F, Thorsen J, Gorunova L, Eibak AM, Bjerkehagen B, Davidson B,

Heim S. 2012. Novel fusion of MYST/Esa1associated factor 6 and PHF1 in

endometrial stromal sarcoma. PLoS One 7:e39354.

Panagopoulos I, Thorsen J, Gorunova L, Haugom L, Bjerkehagen B, Davidson B, Heim S,

Micci F. 2013. Fusion of the ZC3H7B and BCOR genes in endometrial stromal

sarcomas carrying an X;22translocation. Genes Chromosomes Cancer 52:610618.

Panagopoulos I, Gorunova L, Bjerkehagen B, Heim S. 2014a. The "grep" command but not

FusionMap, FusionFinder or ChimeraScan captures the CICDUX4 fusion gene from

whole transcriptome sequencing data on a small round cell tumor with

t(4;19)(q35;q13). PLoS One 9:e99439.

Panagopoulos I, Torkildsen S, Gorunova L, Tierens A, Tjonnfjord GE, Heim S. 2014b.

Comparison between karyotypingFISHreverse transcription PCR and RNA

John Wiley & Sons

sequencingfusion gene identification programs in the detection of KAT6ACREBBP

in acute myeloid leukemia. PLoS One 9:e96570.

Panagopoulos I, Thorsen J, Gorunova L, Micci F, Heim S. 2014c. Sequential combination of

karyotyping and RNAsequencing in the search for cancerspecific fusion genes. Int J

Biochem Cell Biol 53:462465.

Quail MA, Kozarewa I, Smith F, Scally A, Stephens PJ, Durbin R, Swerdlow H, Turner DJ.

2008. A large genome center's improvements to the Illumina sequencing system. Nat

Methods 5:10051010.

Reddy BA, van der Knaap JA, Bot AG, MohdSarip A, Dekkers DH, Timmermans MA,

Martens JW, Demmers JA, Verrijzer CP. 2014. Nucleotide biosynthetic enzyme GMP

synthase is a TRIM21controlled relay of p53 stabilization. Mol Cell 53:458470.

Schoolmeester JK, Sukov WR, Maleszewski JJ, Bedroske PP, Folpe AL, Hodge JC. 2013.

JAZF1 rearrangement in a mesenchymal tumor of nonendometrial stromal origin:

report of an unusual ossifying sarcoma of the heart demonstrating JAZF1/PHF1 fusion.

Am J Surg Pathol 37:938942.

Sciallis AP, Bedroske PP, Schoolmeester JK, Sukov WR, Keeney GL, Hodge JC, Bell DA.

2014. Highgrade endometrial stromal sarcomas: a clinicopathologic study of a group

of tumors with heterogenous morphologic and genetic features. Am J Surg Pathol

38:11611172.

Sreekantaiah C, Li FP, Weidner N, Sandberg AA. 1991. An endometrial stromal sarcoma

with clonal cytogenetic abnormalities. Cancer Genet Cytogenet 55:163166.

John Wiley & Sons

Tusher VG, Tibshirani R, Chu G. 2001. Significance analysis of microarrays applied to the

ionizing radiation response. Proc Natl Acad Sci U S A 98:51165121.

Tzatsos A, Paskaleva P, Ferrari F, Deshpande V, Stoykova S, Contino G, Wong KK, Lan F,

Trojer P, Park PJ, Bardeesy N. 2013. KDM2B promotes pancreatic cancer via

Polycombdependent and independent transcriptional programs. J Clin Invest

123:727739.

WHO. 2014. WHO classification of tumors of female reproductive organs. Lyon: IARC

WHO Classification of Tumours, No 6.

Figure Legends

Figure 1: Partial chromatogram of the EPC1-PHF1 fusion (a); ZC3H7B-BCOR with

involvement of exon 10 from ZC3H7B and exon 9 from BCOR (b); as well as fusion between

exon 13 of ZC3H7B and exon 9 of BCOR (c); and the reciprocal BCOR-ZC3H7B transcript

(d).

Figure 2: Image of the 74 differentially expressed genes between ESS carrying a t(7;17) and

ESS without any known fusion transcript.

John Wiley & Sons

Table 1. Summary of the data obtained on 27 ESS tumors by karyotyping and expression analyses.

Case* ESS RNA- Micro- Karyotype** Fusion transcript subtype seq array 1 HG yes yes 60~70,add(1)(q32),i(6)(p10),dic(12;22)(p13;q13),add(19)(p13),+1~2r,inc[cp9]/46,XX[10] YWHAE-NUTM ILF3-CATSPERD RabGAP1L-RBKS 2 HG yes yes 53~71<3n>,XXX,+i(1)(q10),+2,+2,-3,-4,-5,-6,+7,+7,-8, add(9)(q13),-11,-12,-13,-14,-15,-15, GPR180-DZIP1 -17,-17,-17,-19,+20,+add(20)(p13),+21,+21,+11mar[cp14] WIPF2-LASP1 3 HG yes yes 118~125,del(1)(q11)x3,i(1)(q10)x2,add(2)(p13~15),i(17)(q10),inc[cp5] RNF126-NDUFA11 RPH3AL-BZW2 4 HG yes yes nd YWHAE-NUTM 5 HG yes yes nd YWHAE-NUTM 6 HG yes yes nd YWHAE-NUTM MLL4-RB1 7 HG yes yes nd NRP2-C2orf66 8 HG 46,XX,t(10;17)(q22;p13)[17]/46,XX[1] YWHAE-NUTM 9 NOS yes 46,X,?del(X)(p21)[2]/77~80,XX,-X,+3,-6,+del(7)(p11),+8,+11,-12,+16,-18,+19,+20,+20, EPC1-PHF1 +21,+21[cp2]/46,XX[11] 10 LG yes yes 45,XX,-10[16]/46,XX[1] 11 LG yes 46,XX,t(7;17)(p15;q21)[10]/46,XX,idem,+13,-15[3] JAZF1-SUZ12 12 LG yes 82~90,XXXX,t(6;7)(q16;p15)x2,t(7;17)(p15;q12~21)x2,add(11)(p15)x2,add(12)(q13), JAZF1-SUZ12 del(20)(q13),-22,-22,+mar[cp9] 13* LG yes yes 46,X,t(X;22)(p11;q13),t(3;4)(p23;q27)[8]/46,XX[8] ZC3H7-BCOR 14 LG yes yes 46,XX,t(2;14)(q21;q24),-3,add(3)(q21~24),der(5)t(3;5)(q13~21;p15),+del(5)(q13),der(6) GMPS-SYNPR t(5;6)(q13;q21),del(9)(p13),-16,der(17)t(12;17)(q13;p13),-22,+der(?;3)(?;p21),+mar[13] 15 LG yes yes 47~51,XX,+i(1)(q10),+2,+11,+13,+mar[cp9]/46,XX[6] KDM2B-CREBBP 16* LG yes 46,XX,t(1;6)(p32~34;p21)[15] MEAF6-PHF1 17* LG yes yes 42,X,dic(X;22)(p11;p11),der(1;9)(q25;p22~24)ins(1;?)(q25;?),der(9)t(1;9)(q25;p22),-10, ZC3H7-BCOR der(13;15)(q10;q10),-21,der(22)t(X;22)(p11;q13),+r[20] 1

John Wiley & Sons

50 51 52 53 54 55 56 57 58 59 60 Page 27 of 53 Genes, Chromosomes & Cancer

18 LG yes yes nd PXDN-XIRP2 19 LG yes yes nd H2AFY-HMHB1 WTIP-BIRC6 20 LG yes yes nd ZC3H7B-BCOR*** BCOR-ZC3H7B*** 21 LG yes yes nd NAIP-OCLN 22* LG yes 46,XX,inv(2)(p21q37),der(6)del(6)(p21)t(6;7)(q21;p15),der(7)t(6;7)(p21;p15)del(6)(q21)[11] JAZF1-PHF1 /46,XX[4] 23 LG yes nd JAZF1-SUZ12 24 LG yes yes 42~45,XX,-6,del(6)(q15),-7,add(13)(q14),add(15)(q15),-21,+r,+mar[cp9] JAZF1-PHF1 25* LG yes 46,XX,inv(5)(p13~p14q23~q31)[13] MEAF6-PHF1 26 LG yes 45,XX,dic(7;14)(p11;p11),t(7;17)(p15;q21)[7] JAZF1-SUZ12 27 LG 46,XX,ins(6;10)(p21;p?13p11),ins(10;6)(p11;p21p21),del(16)(q22)[18]/46,XX[1] EPC1-PHF1*** *Case already published: case 13 in [14]; case 16 in [11]; case 17 in [14]; case 22 in [10]; case 25 in [12].

**nd: not done

***New variant of the fusion

John Wiley & Sons

50 51 52 53 54 55 56 57 58 59 60 Genes, Chromosomes & Cancer Page 28 of 53

Table 2. Overview of the primers used in the PCR assays for detection of ESS specific fusions.

Primer Sequence 5’→3’ Reported in

JAZF1-357F CCACAGCAGTGGAAGCCTTA [9] EPC1-1651F CGCGGTGGAAGGGTCTTACTGGA [10] MEAF6-322F CATTGGCAGGAGTTCAGGACCAGC [11] ZC3H7B-1190F TGGACCCCTCCAAGAAGCTGGC [14] ZC3H7B-1250F TGGACCCCTCCAAGAAGCTGGC Present study ZC3H7B-1339F TCGGAGACCCGGCTGGATGC Present study MBTD1_CXorf67_F CTACAGCCTCCAGCATCACA [15] X_17_nestedRT-F1 CATTTTGATGGATGGGAAGA [15] X_17_nestedRT-F2 TGATCAGTGGGTAGACTGTGAGT [15] YWHAEF1 GCGGAGAACAGCCTAGTG Present study YWHAEF2 CTTAATTCCCCTGACCGTGC Present study EPC1F4 GGTGTATTGGATTTGCACGA Present study PHF1-327R AGCCCATCAGTCCATCTGGCCAG [10] PHF1-380R GGACCAGACACACCTCCCTAGCACTG [11] JJAZ1-843R CCGGGTTTTGTTTGATTGAGG [9] BCOR-3954R TTGCCATCTGCTGCCGACACCT [14] BCOR-4201R GAGGCAGCCTGGCAATCCTCTTCT Present study BCOR-4048R TGGGCGGAGAGCCGGAGAAC Present study MBTD1_CXorf67_R2 CTCATCAGCTGACCCAGACA [15] X_17_nestedRT-R1 CTCATCAGCTGACCCAGACA [15] X_17_nestedRT-R2 CGCAGATTCAGGGCTTAGAC [15] FAM22ABR1 AGCCATCCTGTTCTGTCAC Present study FAM22ABR2 GTGAACACAGACAGGGAGGT Present study PHF1R4 TGGCAGTCCTGGTGATAAG Present study

John Wiley & Sons

Table 3. Overview of the ESS cases present in the literature. The cases are grouped based on chromosomal rearrangements.

Case Karyotype Reported by 7;17-rearrangements 1 46,XX,t(7;13)(p15;q14),t(7;17)(p15;q11),del(11)(q21q23) Fletcher et al. 1991 2 46,XX,t(7;13)(q11;p13),t(7;17)(p21;q12),del(11)(q13q21) Sreekantaiah et al. 1991 3 46,XX,t(7;17)(p15-21;q12-21)/46,idem,-7,+der(?)t(?;7) Dal Cin et al. 1992 (?;q11)/45,idem,-7,dic(15;22)(p11;p11),+der(?)t(?;7) 4 46,XX,del(6)(q15),der(6)t(6;11)(p21;q11),add(7)(p21), Pauwels et al. 1996 t(7;17)(p15-21;q12-21),+9,-11 5 46,XX,der(7)t(7;16)(p14-15;q22)t(7;9)(q22;q22),t(7;17) Hennig et al. 1997 (p14-21;q11-21),der (9)t(7;9)(q22;q22),del(16)(q22)/ 47,idem,del(3)(p13p23),+mar 6 42-44,X,-X,der(2)t(2;7)(p23;p15)t(2;15)(q35;q15),add(4) Iliszko et al. 1998 (p16),del(7)(p13p15),der(7)t(7;17)(p14;q12),add(8)(q24), -10,del(11)(p11),t(11;13)(p15;q14),del(15)(q15),-16, del(17)(q12),der(18)t(16;18)(p11;p11),add(19)(p13),-20, add(21)(q22),-22,+2-3mar/78-83,idemx2 7 53-55,X,-X,del(1)(p32),+del(1)(p21),+der(1)t(1;3)(p32;p21), Gil-Benso et al. 1999 del(3)(p21),+der (3;15)(q10;q10),-5,+6,+der(6)add(6) (p11)add(6)(q27),add(7)(p11),+add(7) (p21),+8,+8,-11,-13, der(13;21)(q10;q10),add(14)(p11),der(15)t(6;15) (p21;p12), der(17)t(3;17)(p21;p13)x2,+18,+18,add(19)(q13),-20, der(21;21) (q10;q10),+2mar,dmin 8 46,XX,t(7;13)(p15;p13),t(7;17)(p15;q21) Koontz et al. 2001 9 46,XX,t(7;17)(p15;q21) Koontz et al. 2001 10 46,XX,t(7;17)(p15;q21) Koontz et al. 2001 11 45,XX,-7,t(7;17)(p15;q21) Koontz et al. 2001 12 46,XX,der(7)t(7;21)(p11-12;q11-21),t(7;17)(p15;q12),r(8), Micci et al. 2003 der(13)del(13)(?q12q14)del(13)(?q22) 13 46,XX,t(7;17)(p15;q11),del(9)(q22),add(19)(q13) Satoh et al. 2003 14 45,XX,der(3)t(3;7)(p21;p13)t(7;17)(p15;q21),add(5)(q33), Regauer et al. 2008 der(7)t(3;7),der(7)t(7;12)(p15;p13),add(9)(q34),der(12) t(12;22)(p13;q11),del(14)(q24),der(16)t(7;16)(p15;q24), del(17)(q21),-22 6p21-rearrangements 1 46,XX,del(5)(q33),der(7)t(6;7)(p21;p21) Laxman et al. 1993 2 46,XX,der(3)t(3;7)(p12;p12),der(6)t(3;6)(p12;p21)t(6;7) Hrynchak et al. 1994 (q21;q22),der(7)t(6;7)(q12;p13)t(6;7)(p21;q22),

1 John Wiley & Sons

inv(17)(p12q11)c 3 38,XX,-1,del(1)(q11),-2,add(2)(p13),-3,der(4;14)t(4;14) Sonobe et al. 1999 (q35;q11)add(4)(p12),add(6)(p21),add(7)(q22),del(7) (p11p13),-8,-9,add(9)(q34),-10,add(10)(q24),-11,-11, ins(12;?)(q13;?),-14,-14,-15,ins(15)(q22;?),add(16)(q22), add(17)(q11),-18,der(18)t(7;18)(q11;p11),-19,add(20)(p13), add(21)(p11),-22,add(22) (p11),+6mar 4 46,XX,der(6)ins(6;7)(p21;q34q11)del(6)(p21),der(7)del(7) Micci et al. 2003 (p15)t(6;7)(p21;q11),dup(7)(p22p15) 5 46,XX,inv(2)(p21q37),der(6)del(6)(p21)t(6;7)(q21;p15), Micci et al. 2006 der(7)t(6;7)(p21;p15)del(6)(q21) 6 47,X,der(X)t(X;16),+add(2)(q21),ins(2;22)(q31;q11q13), Micci et al. 2006 der(3)ins(3;13)(p24;q?22q32)t(3;6)(q28;q22),del(6)(p11), der(6)t(3;6),der(7)t(6;7)(?;p15)t(6;15)t(3;15)t(3;13)t(13;15) t(6;15)t(X;6)t(X;6)t(3;6),der(14)t(1;14)(q25;q32) 7 46,XX,t(6;10;10)(p21;q22;p11) Micci et al. 2006 8 46,XX,t(1;6)(p32-34;p21) Panagopoulos et al. 2012 X;22-rearrangements 1 46,X,t(X;22)(p11;q13),t(3;4)(p23;q27) Panagopoulos et al. 2013 2 42,X,dic(X;22)(p11;p11),der(1;9)(q25;p22-24)ins(1;?) Panagopoulos et al. 2013 (q25;?),der(9)t(1;9),-10,der(13;15)(q10;q10),-21,der(22) t(X;22)(p11;q13),+r X;17-rearrangements 1 46,X,t(X;17)(p11;q23) Amant et al. 2003 2 46,X,t(X;17)(p11;q21)/45,idem,dic(4;22)(p15;q13) Dewaele et al. 2014 Cytogenetics rearrangements not known to be associated with LGESS 1 45,XX,-10,der(19)ins(10;19)(p11;p13q13)/45,idem,del(1) Dal Cin et al. 1988 (p21-22)/45,idem,del(1)(p21p35) 2 46,XX,del(7)(q22q32),del(12)(q14q22) Havel et al. 1989 3 76-118,XXXX,del(3)(p12p21),t(11;21)(q13;q22),inc Fletcher et al. 1991 4 49,XX,+7,+8,+9,der(14)t(14;22)(p13;q12)/49,XX,+3,+7,+8, Laxman et al. 1993 der(14) 5 80,XX?,del(1)(p11),i(1)(p10),del(4)(q24),del(5)(p11), Laxman et al. 1993 del(6)(q12),del(12)(p11),add(16)(q12),add(19)(q13),inc 6 45-48,XX,der(3)t(3;6)(q29;p21),der(6)t(3;6)(q21;q27), Gunawan et al. 1998 +i(19)(q10)/88-93,idemx2 7 48-50,XX,+2,+7/49-50,XX,+der(1;7)(q10;q10),+2,+7,+10 Iliszko et al. 1998 8 45-46,XX,del(6)(q21),del(12)(p13) Iliszko et al. 1998

2 John Wiley & Sons

9 46,XX,+t(1;3)(p13;p25),i(8)(q10),dic(15;16)(p11;q13) Iliszko et al. 1998 10 46,XX,del(6)(q22),add(20)(q13) Gil-Benso et al. 1999 11* 46,XX,inv(5)(p13-14q23-31) Micci et al. 2014 t(10;17) 1 46,XX,t(10;17)(q22;p13) Leunen et al. 2003 2 45,XX,add(3)(p11),der(9)t(7;9)(q11;p24),del(10)(q11q26), Micci et al. 2003 t(10;17)(q22;p13),der(11)t(3;11)(p22;q22),-13 3 46,XX,t(10;17)(q22;p13),t(12;13)(q24;q14) Regauer et al. 2008 4 47,XX,der(9)del(9)(p11)del(9)(q12),del(10)(q22),der(11) Amant et al. 2011 t(9;11)(p12;q12),der(17)t(10;17)(q22;p13),+19 5 47,XX,der(9)del(9)(p11)del(9)(q12),del(10)(q22),der(11) Lee et al. 2012a t(9;11)(q12;q12),der(17)t(10;17)(q22;p13),+19 6 46,XX,t(10;17)(q22;p13) Lee et al. 2012a 7 46,XX,t(10;17)(q22;p13) Lee et al. 2012a 8 46,XX,t(10;17)(q22;p13) Lee et al. 2012a 9 43,XX,der(5)t(5;21)(q35;q11),der(9;11)(q10;q10),-10, Lee et al. 2012a t(10;17)(q22;p13),-21 10 44,XX,der(5)t(5;21)(q35;q11),der(9;11)(q10;q10),-10, Lee et al. 2012b t(10;17)(q22;p13),-21 11 44,XX,t(10;17)(q22;p13),del(11)(q1?2),-19,-22 Lee et al. 2012a 12 44,XX,t(10;17)(q22;p13),del(11)(q1?2),-19,-22 Lee et al. 2012b 13 47,XX,+i(1)(q10),t(9;9)(p24;q11),-16,add(17)(p13),+mar Lee et al. 2012a 14 46,XX,t(10;17)(q22;p13) Lee et al. 2012b 15 46,XX,t(4;10;17)(q12;q22;p13) Lee et al. 2012b 16 46,XX,t(10;17)(q22;p13) Lee et al.2012b 17 46,XX,t(10;17)(q22;p13) Lee et al. 2012b 18 45,X,-X,t(10;17;12)(q22;p11;q13),add(19)(p13) Lee et al. 2012a 19 45,X,-X,t(10;17;12)(q22;p11;q13),add(19)(p13) Lee et al. 2012b 20 46,XX,t(10;17)(q22;p13) Lee et al. 2012b 21 47,XX,t(10;17)(q22;p13),-11,+19,+mar Lee et al. 2012b Cytogenetics rearrangements not known to be associated with HGESS but with a YWHAE-NUTM fusion 1 55-58,X,del(X)(p11),+i(1)(q10),+2,+3,+4,+del(6)(q21),+7, Lee et al. 2012a -9,+del(12)(q21), +15,+17,+22,add(22)(q12)x2,+2r 2 46,XX,inv(6)(p21q13) Lee et al. 2012a 3 46,X,del(X)(p22),?dup(1)(q42),+i(1)(q10),+2,+3,+4,t(4;7) Lee et al. 2012a (q21;p22),+7,-9,+12,+der(17)t(5;17)(p11;p11),+22,

3 John Wiley & Sons

add(22)(q13)x2,+2-4mar 4 46,X,der(X)t(X;1)(p22;q24),dup(1)(q12q32) Lee et al. 2012a *molecular analysis detected a MEAF6-PHF1 fusion.

Lee et al., 2012a. 14-3-3 fusion oncogenes in high-grade endometrial stromal sarcoma. Proc Natl Acad Sci U S A 109:929-934. Lee et al., 2012b. The clinicopathologic features of YWHAE-FAM22 endometrial stromal sarcomas: a histologically high-grade and clinically aggressive tumor. Am J Surg Pathol 36:641-653.

4 John Wiley & Sons

Figure 1: Partial chromatogram of the EPC1-PHF1 fusion (a); ZC3H7B-BCOR with involvement of exon 10 from ZC3H7B and exon 9 from BCOR (b); as well as fusion between exon 13 of ZC3H7B and exon 9 of BCOR (c); and the reciprocal BCOR-ZC3H7B transcript (d). 180x179mm (300 x 300 DPI)

John Wiley & Sons

Figure 2: Image of the 74 differentially expressed genes between ESS carrying a t(7;17) and ESS without any known fusion transcript. 80x202mm (300 x 300 DPI)

John Wiley & Sons

141x279mm (300 x 300 DPI)

John Wiley & Sons

160x85mm (300 x 300 DPI)

John Wiley & Sons

221x90mm (300 x 300 DPI)

John Wiley & Sons

Supporting Information Table 1: List of the 514 differentially expressed genes in the HG- and LGESS groups. The first 187 genes, highlighted by green colour on the left, were found downregulated in the HG compared to the LG-group of ESS whereas the latter 327 genes, higlighted by the red colour on the left, were upregulated in the HG compared to the LG-group of ESS.

Gene/probe Accession number Chromosome Description name position NPTX1 NM_002522 17q25.3 neuronal pentraxin I precursor SPON1 NM_006108.3 11p15.2 Homo sapiens spondin 1 MEG3 NR_046473.1 14q32.2 Homo sapiens maternally expressed 3 (non-protein coding) APCDD1 NM_153000.4 18p11.2 Homo sapiens adenomatosis polyposis coli downregulated 1 GFRA2 NM_001165038.1 8p21.3 Homo sapiens GDNF family receptor alpha 2 NSG1 NM_014392.4 4p16.3 Homo sapiens neuron specific gene family member 1 ECEL1 NM_004826.3 2q37.1 Homo sapiens endothelin converting enzyme-like 1 CCND2 NM_001759.3 12p13.3 Homo sapiens cyclin D2 SOX8 NM_014587.4 16p13.3 Homo sapiens SRY (sex determining region Y)-box 8 CACNA1H NM_021098.2 16p13.3 Homo sapiens calcium channel, voltage-dependent, T type, alpha 1H subunit LEF1 NM_016269 4q25 lymphoid enhancer binding factor-1. NDN NM_002487 15q11.2 necdin HES4 NM_021170 1p36.3 hairy and enhancer of split 4 ILMN_1783149 CRTAC1 NM_018058 10q24.2 cartilage acidic protein 1 PPP2R2C NM_181876 4p16.1 gamma isoform of regulatory subunit B55, protein OLFM1 NM_014279 9q34.3 olfactomedin related ER localized protein TMEM158 NM_015444.2 3p21.3 Homo sapiens transmembrane protein 158 CAMK2N1 NM_018584.5 1p36.1 Homo sapiens calcium/calmodulin-dependent protein kinase II inhibitor 1 CRMP1 NM_001014809 4p16.1 collapsin response mediator protein 1 isoform 1 FAM150 NM_001002919.2 2p25.3 Homo sapiens family with sequence similarity 150 AXIN2 NM_004655 17q24.1 axin 2 KCNQ2 NM_172109 20q13.3 potassium voltage-gated channel KQT-like protein DLL1 NM_005618 6q27 delta-like 1 TBX3 NM_016569 12q24.2 T-box 3 protein isoform 2 CDH11 NM_033664 16q21 cadherin 11, type 2 isoform 2 preproprotein PNMA2 NM_007257 8p21.2 paraneoplastic antigen MA2 DPP6 NM_001039350.2 7q36.2 Homo sapiens dipeptidyl-peptidase 6 ASCL2 NM_005170 11p15.5 achaete-scute complex homolog-like 2 BTBD11 NM_001017523 12q23.3 BTB (POZ) domain containing 11 isoform 2 PTH1R NM_000316 3p21.3 parathyroid hormone receptor 1 precursor GRM8 NM_000845 7q31.3 glutamate receptor, metabotropic 8 precursor CDH4 NM_001794 20q13.3 cadherin 4, type 1 preproprotein MAPT NM_005910 17q21.3 microtubule-associated protein tau isoform 4 TRNP1 NM_001013642.2 1p36.1 Homo sapiens TMF1-regulated nuclear protein 1 EPB41L3 NM_012307 18p11.3 erythrocyte membrane protein band 4.1-like 3 WNT5A NM_003392 3p14.3 wingless-type MMTV integration site family, member 5A TLE4 NM_007005 9q21.3 transducin-like enhancer protein 4

John Wiley & Sons

ILMN_1878029 RASD1 NM_016084 17p11.2 RAS, dexamethasone-induced 1 TMEM132B NM_052907.3 12q24.3 Homo sapiens transmembrane protein 132B BAI1 NM_001702 8q24.3 brain-specific angiogenesis inhibitor 1 NRXN2 NM_138732 11q13.1 neurexin 2 isoform alpha-2 precursor SMARCA2 NM_003070 9p24.3 SWI/SNF-related matrix-associated CHST7 NM_019886 Xp11.3 carbohydrate (N-acetylglucosamine 6-O) ILMN_1845086 ILMN_1751559 EEF1A1 NM_001402 6q13 eukaryotic translation elongation factor 1 alpha RPL15 NM_002948 3p24.2 ribosomal protein L15 HSPA12A AB007877 10q25.3 heat shock 70kDa protein 12A CIRBP NM_001280 19p13.3 cold inducible RNA binding protein PIK3R1 NM_181523 5q13.1 phosphoinositide-3-kinase, regulatory subunit ZNF704 NM_001033723.2 8q21.1 Homo sapiens zinc finger protein 704 NISCH NM_007184.3 3p21.1 Homo sapiens nischarin FAM178A NM_001243770.1 10q24.3 Homo sapiens family with sequence similarity 178, member A EFNB2 NM_004093 13q33.3 ephrin B2 PER2 NM_022817 2q37.3 period 2 isoform 1 LOC155060 NM_001004302 7q36.1 hypothetical protein LOC155060 TMEM204 NM_024600.5 16p13.3 Homo sapiens transmembrane protein 204 P4HTM NM_177939.2 3p21.3 Homo sapiens prolyl 4-hydroxylase KLF2 NM_016270 19p13.1 Kruppel-like factor FOXF2 NM_001452 6p25.3 forkhead box F2 IFFO1 NM_080730.4 12p13.3 Homo sapiens intermediate filament family orphan 1 MGEA5 NM_012215 10q24.3 meningioma expressed antigen 5 ISM1 NM_080826.1 20p12.1 Homo sapiens isthmin 1, angiogenesis inhibitor REEP5 NM_005669.4 5q22.2 Homo sapiens receptor accessory protein 5 ILMN_2098947 TCTN1 NM_001082538.2 12q24.1 Homo sapiens tectonic family member 1 EPM2AIP1 NM_014805 3p22.3 EPM2A interacting protein 1 EMILIN3 NM_052846 20q12 elastin microfibril interfacer 3 ATP1B2 NM_001678 17p13.1 Na+/K+ -ATPase beta 2 subunit TRIM22 NM_006074 11p15.4 tripartite motif-containing 22 PTPRU NM_133177 1p35.3 protein tyrosine phosphatase, receptor type, U SRSF5 NM_006925 14q24.2 splicing factor, arginine/serine-rich ILMN_1802808 FGD5 NM_152536 3p25.1 FYVE, RhoGEF and PH domain containing 5 SERF2 NM_005770 15q15.3 small EDRK-rich factor 2 NME5 NM_003551 5q31.2 non-metastatic cells 5, protein expressed in GLI1 NM_005269 12q13.3 glioma-associated oncogene homolog 1 BBS1 NM_024649 11q13.2 Bardet-Biedl syndrome 1 CHD9 NM_025134 16q12.2 chromodomain helicase DNA binding protein 9 IQCK NM_153208.1 16p12.3 Homo sapiens IQ motif containing K EPHB6 NM_004445 7q34 ephrin receptor EphB6 precursor XPC NM_004628.4 3p25.1 Homo sapiens xeroderma pigmentosum, complementation group C ANKRA2 NM_023039 5q13.2 ankyrin repeat, family A

John Wiley & Sons

VIPR2 NM_003382 7q36.3 vasoactive intestinal peptide receptor 2 WDR6 NM_018031 3p21.3 WD repeat domain 6 protein CYP2E1 NM_000773 10q26.3 cytochrome P450, family 2, subfamily E, NKTR NM_005385 3p22.1 natural killer-tumor recognition sequence DNAH1 NM_015512.4 3p21.1 Homo sapiens dynein, axonemal, heavy chain 1 HNRNPDL NM_031372.3 4q21.2 Homo sapiens heterogeneous nuclear ribonucleoprotein D- like PPM1M NM_144641 3p21.2 protein phosphatase 1M LMO4 NM_006769 1p22.3 LIM domain only 4 RPL23AP32 NR_002229.2 2p16.2 Homo sapiens ribosomal protein L23a pseudogene 32 PPIEL NR_003929.2 1p34.3 Homo sapiens peptidylprolyl isomerase E-like pseudogene N6AMT1 NM_182749.3 21q21.3 Homo sapiens N-6 adenine-specific DNA methyltransferase 1 SETDB2 NM_031915 13q14.2 CLLL8 protein RBM4B NM_031492.3 11q13.2 Homo sapiens RNA binding motif protein 4B MIS18BP1 NM_018353.4 14q21.2 Homo sapiens MIS18 binding protein 1 VAMP2 NM_014232.2 17p13.1 Homo sapiens vesicle-associated membrane protein 2 USP47 NM_017944 11p15.3 ubiquitin specific protease 47 SRSF7 NM_006276 2p22.1 splicing factor, arginine/serine-rich 7, 35kDa ILMN_1707434 IDUA NM_000203.4 4p16.3 Homo sapiens iduronidase, alpha-L- TMEM8B NM_001042589.2 9p13.3 Homo sapiens transmembrane protein 8B PGBD5 NM_001258311.1 1q42.1 Homo sapiens piggyBac transposable element derived 5 ILMN_1841620 MRI1 NM_032285.2 19p13.1 Homo sapiens methylthioribose-1-phosphate isomerase 1 ATOH8 NM_032827.6 2p11.2 Homo sapiens atonal homolog 8 ATM NM_000051 11q22.3 ataxia telangiectasia mutated protein isoform 1 RBM25 NM_021239 14q24.2 RNA binding motif protein 25 CLUAP1 NM_024793 16p13.3 clusterin associated protein 1 SMARCE1 NM_003079 17q21.2 SWI/SNF-related matrix-associated RAB11FIP3 NM_014700 16p13.3 rab11-family interacting protein 3 PCF11 NM_015885 11q14.1 pre-mRNA cleavage complex II protein Pcf11 SMAD5 NM_005903.6 5q31.1 Homo sapiens SMAD family member 5 LETMD1 NM_015416 12q13.1 cervical cancer 1 protooncogene protein p40 SMIM7 NM_024104.3 19p13.1 Homo sapiens small integral membrane protein 7 DHFRL1 NM_176815.4 3q11.2 Homo sapiens dihydrofolate reductase-like 1 EIF4B NM_001417.4 12q13.1 Homo sapiens eukaryotic translation initiation factor 4B RBL2 NM_005611 16q12.2 retinoblastoma-like 2 (p130) CRAMP1L NM_020825 16p13.3 Crm, cramped-like ILMN_1661593 NRDE2 NM_017970.3 14q32.1 Homo sapiens NRDE-2, necessary for RNA interference ATP5L NM_006476 11q23.3 ATP synthase, H+ transporting, mitochondrial F0 RBM5 NM_005778.3 3p21.3 Homo sapiens RNA binding motif protein 5 ATP6AP1L NM_001017971.2 5q14.2 Homo sapiens ATPase, H+ transporting, lysosomal accessory protein 1-like FLJ31306 NR_029434.1 14q23.1 Homo sapiens uncharacterized LOC379025 MBTPS1 NM_003791.3 16q23.3 Homo sapiens membrane-bound transcription factor peptidase, site 1 INTS6 NM_001039937.1 13q14.3 Homo sapiens integrator complex subunit 6 SRP14 NM_003134.4 15q15.1 Homo sapiens signal recognition particle 14kDa 3

John Wiley & Sons

LZTFL1 NM_020347 3p21.3 leucine zipper transcription factor-like 1 TRIM41 NM_033549 5q35.3 tripartite motif-containing 41 isoform 2 CGGBP1 NM_001008390 3p11.1 CGG triplet repeat binding protein 1 MFF NM_020194.5 2q36.3 Homo sapiens mitochondrial fission factor FBRSL1 NM_001142641.1 12q24.3 Homo sapiens fibrosin-like 1 TBC1D9B NM_015043.3 5q35.3 Homo sapiens TBC1 domain family, member 9B TERF2IP NM_018975.3 16q23.1 Homo sapiens telomeric repeat binding factor 2 PDDC1 NM_182612.2 11p15.5 Homo sapiens Parkinson disease 7 domain containing 1 RASA1 NM_022650 5q14.3 RAS p21 protein activator 1 isoform 2 MRPS25 NM_022497 3p25.1 mitochondrial ribosomal protein S25 ILMN_1787539 CCDC130 NM_030818.2 19p13.1 Homo sapiens coiled-coil domain containing 130 TTC17 NM_018259 11p12 tetratricopeptide repeat domain 17 AKAP8 NM_005858 19p13.1 A-kinase anchor protein 8 PDS5B NM_015032.3 13q13.1 Homo sapiens PDS5, regulator of cohesion maintenance, homolog B CCDC66 NR_024460.1 3p14.3 Homo sapiens coiled-coil domain containing 66 ARNTL NM_001178 11p15.2 aryl hydrocarbon receptor nuclear translocator-like ZNF627 NM_145295 19p13.2 zinc finger protein 627 CLK4 NM_020666 5q35.3 CDC-like kinase 4 RALGAPA1 NM_014990.1 14q13.2 Homo sapiens Ral GTPase activating protein, alpha subunit 1 RET NM_020975 10q11.2 ret proto-oncogene isoform a TRAK1 NM_014965.4 3p22.1 Homo sapiens trafficking protein, kinesin binding 1 MAU2 NM_015329.3 19p13.1 Homo sapiens MAU2 sister chromatid cohesion factor PHYKPL NM_153373.3 5q35.3 Homo sapiens 5-phosphohydroxy-L-lysine phospho-lyase ILMN_1899903 FAM160A2 NM_032127.3 11p15.4 Homo sapiens family with sequence similarity 160, member A2 TXNDC15 NM_024715.3 5q31.1 Homo sapiens thioredoxin domain containing 15 SKP1 NM_006930.3 5q31.1 Homo sapiens S-phase kinase-associated protein 1 LOC338799 12q24.3 RPL24 NM_000986 3q12.3 ribosomal protein L24 RECK NM_021111 9p13.3 RECK protein precursor TMEM132C NM_001136103.2 12q24.3 Homo sapiens transmembrane protein 132C NDFIP1 NM_030571 5q31.3 Nedd4 family interacting protein 1 JKAMP NM_001284202.1 14q23.1 Homo sapiens JNK1/MAPK8-associated membrane protein ADRA2A NM_000681 10q25.2 alpha-2A-adrenergic receptor SEC31B NM_015490.3 10q24.3 Homo sapiens SEC31 homolog B ILMN_1911059 TUBGCP5 NM_052903 15q11.2 tubulin, gamma complex associated protein 5 GIN1 NM_017676.2 5q21.1 Homo sapiens gypsy retrotransposon integrase 1 AKAP11 NM_016248 13q14.1 A-kinase anchor protein 11 isoform 1 ILMN_1775444 ILMN_1893511 RCCD1 NM_001017919.1 15q26.1 Homo sapiens RCC1 domain containing 1 TRIM5 NM_033034 11p15.4 tripartite motif protein TRIM5 isoform delta IFT140 NM_014714.3 16p13.3 Homo sapiens intraflagellar transport 140 RNPC3 NM_017619 1p21.1 RNA-binding region 4

John Wiley & Sons

ZNF564 NM_144976 19p13.2 zinc finger protein 564 ZNF137P NR_023311.1 19q13.4 Homo sapiens zinc finger protein 137 ILMN_1699058 VILL NM_015873 3p22.3 villin-like ILMN_1651364 CAPRIN1 NM_203364.2 11p13 Homo sapiens cell cycle associated protein 1 C3orf62 NM_198562.2 3p21.3 MRPS36 NM_033281 5q13.2 mitochondrial ribosomal protein S36 AMN1 NM_001278411.1 12p11.2 Homo sapiens antagonist of mitotic exit network 1 MED17 NM_004268.4 11q21 Homo sapiens mediator complex subunit 17 GPER1 NM_001505.2 7p22.3 Homo sapiens G protein-coupled estrogen receptor 1 LOC100131655 NR_040024.1 18q23 Homo sapiens uncharacterized locus TMPRSS15 NM_002772.2 21q21.1 Homo sapiens transmembrane protease, serine 15 DIRAS2 NM_017594 9q22.2 Di-Ras2 ILMN_1863647 ILMN_1887177 ZNF383 NM_152604.1 19q13.1 Homo sapiens zinc finger protein 383 CCNE1 NM_001238 19q12 cyclin E1 isoform 1 ILMN_3242967 ILMN_3281365 WHSC1 NM_001042424.2 4p16.3 Homo sapiens Wolf-Hirschhorn syndrome candidate 1 SGMS2 NM_001136258.1 4q25 Homo sapiens sphingomyelin synthase 2 ZNF695 NM_020394 1q44 zinc finger protein SBZF3 ITPRIPL1 NM_001008949.2 2q11.2 Homo sapiens inositol 1,4,5-trisphosphate receptor interacting protein-like 1 UBQLN4 NM_020131 1q22 ataxin-1 ubiquitin-like interacting protein HSF2BP NM_007031 21q22.3 heat shock transcription factor 2 binding TSC22D1 NM_183422 13q14.1 TSC22 domain family 1 isoform 1 ANKRD40 NM_052855.3 17q21.3 Homo sapiens ankyrin repeat domain 40 PHF20L1 NM_198513 8q24.2 PHD finger protein 20-like 1 isoform 2 LOC285548 4p15.3 PAIP1 NM_006451 5p12 poly(A) binding protein interacting protein 1 CNRIP1 NM_015463.2 2p14 Homo sapiens cannabinoid receptor interacting protein 1 NDUFAF4 NM_014165.3 6q16.1 Homo sapiens NADH dehydrogenase (ubiquinone) complex I ILMN_1701289 TMEM104 NM_017728.3 17q25.1 Homo sapiens transmembrane protein 104 SEC63 NM_007214 6q21 SEC63-like protein SMIM13 NM_001135575.1 6p24.2 Homo sapiens small integral membrane protein 13 WTAP NM_152858 6q25.3 Wilms' tumour 1-associating protein isoform 2 NIPBL NM_133433 5p13.2 delangin isoform A GET4 NM_015949.2 7p22.3 Homo sapiens golgi to ER traffic protein 4 homolog SMAP1 NM_021940 6q13 stromal membrane-associated protein UBR3 NM_172070.3 2q31.1 Homo sapiens ubiquitin protein ligase E3 component n- recognin 3 ALX3 NM_006492 1p13.3 aristaless-like homeobox 3 ILMN_1708160 PEX13 NM_002618 2p16.1 peroxisome biogenesis factor 13 ILMN_1798615

John Wiley & Sons

FABP3 NM_004102 1p35.2 fatty acid binding protein 3 MRPL35 NM_016622 2p11.2 mitochondrial ribosomal protein L35 ILMN_1773819 LOC401317 C6orf57 NM_145267 6q13 hypothetical protein LOC135154 EMC6 NM_031298.3 17p13.2 Homo sapiens ER membrane protein complex subunit 6 MYO6 NM_004999 6q14.1 myosin VI BRWD1 NM_018963 21q22.2 bromodomain and WD repeat domain containing 1 GAR1 NM_032993.2 4q25 Homo sapiens GAR1 ribonucleoprotein PSMD11 NM_002815.3 17q11.2 Homo sapiens proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 ENPP6 NM_153343 4q35.1 ectonucleotide pyrophosphatase/phosphodiesterase ILMN_1660270 KRT80 NM_001081492.1 12q13.3 Homo sapiens keratin 80 SHKBP1 NM_138392 19q13.2 SH3KBP1 binding protein 1 ILMN_1754068 ILMN_1703894 AVL9 NM_015060.1 7p14.3 Homo sapiens AVL9 homolog ILMN_1666706 C19orf12 NM_031448.4 19q12 LRRC47 NM_020710 1p36.3 hypothetical protein LOC57470 ZNF408 NM_024741 11p11.2 zinc finger protein 408 PSMD3 NM_002809 17q21.1 proteasome 26S non-ATPase subunit 3 MICALL1 NM_033386 22q13.1 molecule interacting with Rab13 TGFBRAP1 NM_004257 2q12.1 TGF beta receptor associated protein -1 NUS1 NM_138459.3 6q22.1 Homo sapiens nuclear undecaprenyl pyrophosphate synthase 1 MFSD8 NM_152778.2 4q28.1 Homo sapiens major facilitator superfamily domain containing 8 SENP5 NM_152699. 3q29 Homo sapiens SUMO1/sentrin specific peptidase 5 MAPKAP1 NM_001006617 9q33.3 mitogen-activated protein kinase associated DNAJC3 NM_006260 13q32.1 DnaJ (Hsp40) homolog, subfamily C, member 3 CCDC137 NM_199287.2 17q25.3 Homo sapiens coiled-coil domain containing 137 RNF8 NM_003958 6p21.2 ring finger protein 8 isoform 1 ILMN_3289779 MTFR2 NM_138419.3 6q23.3 Homo sapiens mitochondrial fission regulator 2 MT1H NM_005951 16q12.2 metallothionein 1H PAQR3 NM_177453 4q21.2 progestin and adipoQ receptor family member III C6orf47 NM_021184 6p21.3 G4 protein SNORA56 NR_002984.1 Xq28 Homo sapiens small nucleolar RNA, H/ACA box 56 STRADB NM_018571.5 2q33.1 Homo sapiens STE20-related kinase adaptor beta RECQL NM_004259 17q25.1 RecQ protein-like 5 isoform 1 LSMEM1 NM_182597.2 7q31.1 Homo sapiens leucine-rich single-pass membrane protein 1 SELRC1 NM_001243594.1 1p32.3 Sus scrofa Sel1 repeat containing 1 DENND1A NM_020946.1 9q33.3 Homo sapiens DENN/MADD domain containing 1A AMMECR1 NM_015365 Xq23 AMMECR1 protein ATF2 NM_001880 2q31.1 activating transcription factor 2 PITPNB NM_012399 22q12.1 phosphatidylinositol transfer protein, beta KHDC1 NM_030568.3 6q13 Homo sapiens KH homology domain containing 1

John Wiley & Sons

EIF5B NM_015904 2q11.2 translation initiation factor IF2 ZWINT NM_032997 10q21.1 ZW10 interactor isoform a CENPP NM_001012267.2 9q22.3 Homo sapiens centromere protein P CREB5 NM_182899 7p15.1 cAMP responsive element binding protein 5 LOC646214 NR_027053.2 15q11.2 Homo sapiens p21 protein (Cdc42/Rac)-activated kinase 2 LETM1 NM_012318.2 4p16.3 Homo sapiens leucine zipper-EF-hand containing transmembrane protein 1 NDC1 NM_018087.4 1p32.3 Homo sapiens NDC1 transmembrane nucleoporin FAM49B NM_016623 8q24.2 hypothetical protein LOC51571 NOD1 NM_006092.2 7p15.1 Homo sapiens nucleotide-binding oligomerization domain containing 1 ADNP2 NM_014913.3 18q23 Homo sapiens ADNP homeobox 2 SNX11 NM_152244 17q21.3 sorting nexin 11 RAE1 NM_001015885.1 20q13.3 Homo sapiens ribonucleic acid export 1 SRP68 NM_014230 17q25.1 signal recognition particle 68kDa MRPL10 NM_148887 17q21.3 mitochondrial ribosomal protein L10 isoform b SRP72 NM_006947 4q12 signal recognition particle 72kDa SSNA1 NM_003731 9q34.3 nuclear autoantigen of 14 kDa ITGAE NM_002208 17p13.2 integrin, alpha E (antigen CD103, human mucosal LYPLA2 NM_007260.2 1p36.1 Homo sapiens lysophospholipase II CDK1 NM_001786.4 10q21.2 Homo sapiens cyclin-dependent kinase 1 STARD3NL NM_032016 7p14.1 MLN64 N-terminal homolog METTL17 NM_001029991.1 14q11.2 Homo sapiens methyltransferase like 17 MRPL2 NM_015950 6p21.1 mitochondrial ribosomal protein L2 ILMN_1713875 NFKBIB NM_002503 19q13.2 nuclear factor of kappa light polypeptide gene MEA1 NM_014623.2 6p21.1 Homo sapiens male-enhanced antigen 1 STX7 NM_003569 6q23.2 syntaxin 7 SRSF10 NM_054016.2 1p36.1 Homo sapiens serine/arginine-rich splicing factor 10 KCNMB3 NM_171830 3q26.3 calcium-activated potassium channel beta 3 HSBP1L1 NM_001136180.1 18q23 Homo sapiens heat shock factor binding protein 1-like 1 PKN3 NM_013355 9q34.1 protein kinase PKNbeta ILMN_1667925 WDR70 NM_018034 5p13.2 hypothetical protein LOC55100 MDK NM_001012334 11p11.2 Midkine DIRC3 NR_026597.1 2q35 Homo sapiens disrupted in renal carcinoma 3 NOL7 NM_016167 6p23 nucleolar protein 7, 27kDa RPS19BP1 NM_194326.2 22q13.1 Homo sapiens ribosomal protein S19 binding protein 1 IMMT NM_006839 2p11.2 inner membrane protein, mitochondrial DFFA NM_213566 1p36.2 DNA fragmentation factor, 45kDa, alpha C6orf106 NM_024294 6p21.3 chromosome 6 open reading frame 106 ZC3H8 NM_032494 2q13 zinc finger CCCH-type domain containing 8 GBAS NM_001483 7p11.2 nipsnap homolog 2 LGALSL NM_014181.2 2p14 Homo sapiens lectin, galactoside-binding-like CDV3 NM_001282763.1 3q22.1 Homo sapiens CDV3 homolog (mouse) FTL NM_000146 19q13.3 ferritin, light polypeptide CD82 NM_002231 11p11.2 CD82 antigen NUDC NM_006600 1p36.1 nuclear distribution gene C homolog A MIR1228 NR_031597.1 12q13.3 Homo sapiens microRNA 1228

John Wiley & Sons

PHKA1 NM_002637 Xq13.1 phosphorylase kinase, alpha 1 FAM105B NM_001100328.1 5p15.2 Bos taurus family with sequence similarity 105, member B ODF2 NM_153437 9q34.1 outer dense fiber of sperm tails 2 isoform 2 SFT2D1 NM_145169.1 6q27 Homo sapiens SFT2 domain containing 1 GOSR2 NM_004287 17q21.3 golgi SNAP receptor complex member 2 isoform A NRAS NM_002524 1p13.1 neuroblastoma RAS viral (v-ras) oncogene AGO3 NM_024852 1p34.3 eukaryotic translation initiation factor 2C FAF1 NM_131917 1p32.3 FAS-associated factor 1 PHF19 NM_015651 9q33.2 PHD finger protein 19 C1orf122 NM_001142726.1 1p34.3 Homo sapiens chromosome 1 open reading frame 122 SLC39A11 NM_139177 17q24.3 solute carrier family 39 SLC25A39 NM_016016.2 17q21.3 Homo sapiens solute carrier family 25, member 39 RALY NM_016732 20q11.2 RNA binding protein CHCHD2 NM_016139 7p11.2 coiled-coil-helix-coiled-coil-helix domain MRTO4 NM_016183.3 1p36.1 Homo sapiens mRNA turnover 4 homolog TIMM17B NM_005834 Xp11.2 translocase of inner mitochondrial membrane 17 GPS1 NM_212492 17q25.3 G protein pathway suppressor 1 SRPK1 NM_003137 6p21.3 SFRS protein kinase 1 CDC42 NM_044472 1p36.1 cell division cycle 42 isoform 2 DESI1 NM_015704.2 22q13.2 Homo sapiens desumoylating isopeptidase 1 GPN2 NM_018066.3 1p36.1 Homo sapiens GPN-loop GTPase 2. M6PR NM_002355 12p13.3 cation-dependent mannose-6-phosphate receptor NDUFA4 NM_002489 7p21.3 NADH dehydrogenase (ubiquinone) 1 alpha FANCE NM_021922 6p21.3 Fanconi anemia, complementation group E FAM96A NR_110310.1 15q22.3 Homo sapiens family with sequence similarity 96 member A SYAP1 NM_032796 Xp22.2 SYAP1 protein PLEKHB2 NM_017958 2q21.1 pleckstrin homology domain containing, family B CCT7 NM_006429 2p13.2 chaperonin containing TCP1, subunit 7 UBE2V2 NM_003350 8q11.2 ubiquitin-conjugating enzyme E2 variant 2 COPRS NM_018405.3 17q11.2 Homo sapiens coordinator of PRMT5, differentiation stimulator METTL23 NM_001080510.3 17q25.1 Homo sapiens methyltransferase like 23 SEC14L1 NM_003003 17q25.2 SEC14 (S. cerevisiae)-like 1 SNRPC NM_003093 6p21.3 small nuclear ribonucleoprotein polypeptide C GNL2 NM_013285 1p34.3 guanine nucleotide binding protein-like 2 SKA2 NM_001100595.1 17q23.2 Homo sapiens spindle and kinetochore associated complex subunit 2 TUBB NM_178014 6p21.3 tubulin, beta polypeptide SZRD1 NR_073502.1 1p36.1 Homo sapiens SUZ RNA binding domain containing 1 RNF181 NM_016494.3 2p11.2 Homo sapiens ring finger protein 181 . EIF6 NM_002212.3 20q11.2 Homo sapiens eukaryotic translation initiation factor 6 LRIG3 NM_153377 12q14.1 leucine-rich repeats and immunoglobulin-like CTNS NM_004937 17p13.2 cystinosis, nephropathic GALE NM_000403 1p36.1 UDP-galactose-4-epimerase C1GALT1 NM_020156 7p21.2 core 1 synthase, TACO1 NM_016360.3 17q23.3 Homo sapiens translational activator of mitochondrially encoded cytochrome c oxidase I PGM3 NM_015599 6q14.2 phosphoglucomutase 3 PSMD2 NM_002808 3q27.1 proteasome 26S non-ATPase subunit 2 8

John Wiley & Sons

FBXO17 NM_148169 19q13.2 F-box protein FBG4 isoform 1 PDCL3 NM_024065 2q11.2 phosducin-like KATNA1 NM_007044 6q25.1 katanin p60 subunit A 1 CCT6P1 NR_003110.2 7q11.2 Homo sapiens chaperonin containing TCP1, subunit 6 (zeta) pseudogene 1 ZC3H3 NM_015117.2 8q24.3 Homo sapiens zinc finger CCCH-type containing 3 FAM195B NM_001288798.1 17 random Homo sapiens family with sequence similarity 195, member B SNX13 BC045667 7p21.1 sorting nexin 13 MRPL38 NM_032478 17q25.1 mitochondrial ribosomal protein L38 PUF60 NM_001271100.1 8q24.3 Homo sapiens poly-U binding splicing factor 60KDa KLHL5 NM_199039 4p14 kelch-like 5 isoform 2 NNT NM_012343 5p12 nicotinamide nucleotide transhydrogenase AGAP3 NM_001042535.2 7q36.1 Homo sapiens ArfGAP with GTPase domain, ankyrin repeat and PH domain 3 TBPL1 NM_004865 6q23.2 TBP-like 1 LSM2 NM_021177 6p21.3 LSM2 homolog, U6 small nuclear RNA associated FAM136A NM_032822.2 2p13.3 Homo sapiens family with sequence similarity 136, member A CCRN4L NM_012118 4q31.1 CCR4 carbon catabolite repression 4-like RALY NM_001199817.1 7p14.3 Homo sapiens gamma-glutamylcyclotransferase ADRM1 NM_007002 20q11.3 adhesion regulating molecule 1 precursor RAB9B NM_016370 Xq22.2 RAB9-like protein SPR NM_003124 2p13.2 sepiapterin reductase NELFE NM_002904.5 6p21.3 Homo sapiens negative elongation factor complex member E. CSNK1D NM_139062 17q25.3 casein kinase 1, delta MTX2 NM_006554 2q31.1 metaxin 2 ZUFSP NM_145062.2 6q22.1 Homo sapiens zinc finger with UFM1-specific peptidase domain GSPT1 NM_002094 16p13.1 G1 to S phase transition 1 AUNIP NM_024037.2 1p36.1 Homo sapiens aurora kinase A and ninein interacting protein STRAP NM_007178 12p12.3 serine/threonine kinase receptor associated ICT1 NM_001545.1 17q25.1 Homo sapiens immature colon carcinoma transcript 1 NAMPT NM_005746.2 7q22.3 Homo sapiens nicotinamide phosphoribosyltransferase TCEB3 NM_003198.2 1p36.1 Homo sapiens transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A) DEPDC1 NM_017779 1p31.2 DEP domain containing 1 MAPRE1 NM_012325 20q11.2 microtubule-associated protein, RP/EB family PRADC1 NM_032319.1 2p13.2 Homo sapiens protease-associated domain containing 1 PRR11 NM_018304.3 17q23.2 Homo sapiens proline rich 11 ADAM9 NM_003816 8p11.2 a disintegrin and metalloproteinase domain 9 CACYBP NM_014412 1q25.1 calcyclin binding protein isoform 1 RRP36 NM_033112.2 6p21.1 Homo sapiens ribosomal RNA processing 36 homolog (S. cerevisiae) DYNLL2 NM_080677.2 17q23.2 Homo sapiens dynein, light chain, LC8-type 2 ILMN_1729325 POP4 NM_006627 19q12 POP4 (processing of precursor , S. cerevisiae) ILMN_3228639 9

John Wiley & Sons

NTMT1 NM_014064.3 9q34.1 Homo sapiens N-terminal Xaa-Pro-Lys N- methyltransferase 1 CPSF3 NM_016207 2p25.1 cleavage and polyadenylation specific factor 3, ABCF1 NM_001090.2 6p21.3 Homo sapiens ATP-binding cassette, sub-family F (GCN20), member SPCS3 NM_021928 4q34.2 signal peptidase complex subunit 3 POPDC3 NM_022361 6q21 popeye protein 3 FLOT2 NM_004475 17q11.2 flotillin 2 E2F6 NM_212540 2p25.1 E2F transcription factor 6 EYA3 NM_001990 1p35.3 eyes absent 3 ILMN_1766219 SESTD1 NM_178123 2q31.2 SEC14 and spectrin domains 1 UBR2 NM_015255 6p21.1 ubiquitin protein ligase E3 component n-recognin DERA BC041328 12p12.3 2-deoxyribose-5-phosphate aldolase homolog (C. elegans) GRB2 NM_203506 17q25.1 growth factor receptor-bound protein 2 FUCA2 NM_032020 6q24.2 fucosidase, alpha-L- 2, plasma SMC4 NM_005496.3 3q25.3 Homo sapiens structural maintenance of chromosomes 4 SNF8 NM_007241.2 17q21.3 Homo sapiens SNF8, ESCRT-II complex subunit SYNCRIP NM_006372 6q14.3 synaptotagmin binding, cytoplasmic RNA HDAC2 NM_001527 6q21 histone deacetylase 2 CDCA7L NM_001127370.2 7p15.3 Homo sapiens cell division cycle associated 7-like EIF4EBP1 NM_004095 8p12 eukaryotic translation initiation factor 4E PRELID1 NM_013237.3 5q35.3 Homo sapiens PRELI domain containing 1 PSMG1 NM_203433 21q22.2 Down syndrome critical region protein 2 isoform SF3B5 NM_031287 6q24.2 SF3b10 MRPL14 NM_032111 6p21.1 mitochondrial ribosomal protein L14 DYRK2 NM_006482 12q15 dual-specificity tyrosine-(Y)-phosphorylation POLR2D NM_004805 2q14.3 DNA directed RNA polymerase II polypeptide D SMG5 NM_015327.2 1q22 Homo sapiens SMG5 nonsense mediated mRNA decay factor ANAPC11 NM_001002249 17q25.3 APC11 anaphase promoting complex subunit 11 NPC1 NM_000271 18q11.2 Niemann-Pick disease, type C1 LYAR NM_017816 4p16.3 hypothetical protein FLJ20425 C5orf34 NM_198566.3 5p12 Homo sapiens chromosome 5 open reading frame 34 THOC5 NM_001002877.1 22q12.2 Homo sapiens THO complex 5 BAIAP2L1 NM_018842 7q21.3 BAI1-associated protein 2-like 1 MT1M NM_176870.2 16q12.2 Homo sapiens metallothionein 1M PSME4 NM_014614 2p16.2 proteasome (prosome, macropain) activator MED10 NM_032286.2 5p15.3 Homo sapiens mediator complex subunit 10 BLVRA NM_000712 7p13 biliverdin reductase A SLC52A2 NM_024531.4 8q24.3 Homo sapiens solute carrier family 52 (riboflavin transporter), member 2 GTF3C6 NM_138408.3 6q21 Homo sapiens general transcription factor IIIC, polypeptide 6, alpha 35kDa. IMP4 NM_033416 2q21.1 IMP4, U3 small nucleolar ribonucleoprotein MCUR1 NM_001031713.3 6p23 Homo sapiens mitochondrial calcium uniporter regulator 1 MRPS23 NM_016070 17q23.2 mitochondrial ribosomal protein S23 YBX1 NM_004559.3 1p34.2 Homo sapiens Y box binding protein 1 MRPS17 NM_015969 7p11.2 mitochondrial ribosomal protein S17 AZI1 NM_014984 17q25.3 5-azacytidine induced 1 isoform a 10

John Wiley & Sons

DMRT2 NM_181872 9p24.3 doublesex and mab-3 related transcription factor TIMP2 NM_003255 17q25.3 tissue inhibitor of metalloproteinase 2 SNRPB NM_198216 20p13 small nuclear ribonucleoprotein polypeptide B/B' MRPL12 NM_002949 17q25.3 mitochondrial ribosomal protein L12 MNF1 NM_001206614.1 6p21.3 Bos taurus mitochondrial nucleoid factor 1 PSMC4 NM_153001 19q13.2 proteasome 26S ATPase subunit 4 isoform 2 TEAD4 NM_201443.2 12p13.3 Homo sapiens TEA domain family member 4 CHAF1B NM_005441 21q22.1 chromatin assembly factor 1 subunit B TUBG1 NM_001070 17q21.2 tubulin, gamma 1 MCM5 NM_006739 22q12.3 minichromosome maintenance deficient protein 5 PLEKHG4 NM_015432 16q22.1 pleckstrin homology domain containing, family G POLE4 NM_019896 2p12 DNA polymerase epsilon subunit 4 ICA1 NM_022307 7p21.3 islet cell autoantigen 1 isoform 1 ANLN NM_018685 7p14.2 anillin, actin binding protein SUV39H1 NM_003173 Xp11.2 suppressor of variegation 3-9 homolog 1 FLOT1 NM_005803 6p21.3 flotillin 1 SLC38A10 NM_001037984.2 17q25.3 Homo sapiens solute carrier family 38, member 10 CLPTM1L NM_030782.3 5p15.3 Homo sapiens CLPTM1-like PSMB2 NM_002794 1p34.3 proteasome beta 2 subunit PSMD12 NM_174871 17q24.2 proteasome 26S non-ATPase subunit 12 MSANTD3 NM_001198807.1 9q31.1 Homo sapiens Myb/SANT-like DNA-binding domain containing 3 PHB NM_002634 17q21.3 Prohibitin ILMN_1678300 RPF2 NM_032194.2 6q21 Homo sapiens ribosome production factor 2 homolog (S. cerevisiae) BRIX1 NM_018321.3 5p13.2 Homo sapiens BRX1, biogenesis of ribosomes, homolog (S. cerevisiae) ABRACL NM_021243.2 6q24.1 Homo sapiens ABRA C-terminal like RPL39L NM_052969 3q27.3 ribosomal protein L39-like protein COA1 NM_198834 17q12 acetyl-Coenzyme A carboxylase alpha isoform 1 RPA3 NM_002947 7p21.3 replication protein A3, 14kDa IRX6 NM_024335 16q12.2 iroquois homeobox protein 6 E2F3 NM_001949 6p22.3 E2F transcription factor 3 AGPS NM_003659 2q31.2 alkylglycerone phosphate synthase precursor IRAK1 NM_001569 Xq28 interleukin-1 receptor-associated kinase 1 ILMN_2383383 IDH2 NM_002168 15q26.1 isocitrate dehydrogenase 2 (NADP+) DCAF7 NM_005828.4 17q23.3 Homo sapiens DDB1 and CUL4 associated factor 7 BUB1 NM_004336 2q13 BUB1 budding uninhibited by benzimidazoles 1 PSMD14 NM_005805 2q24.2 26S proteasome-associated pad1 homolog NUP155 NM_153485 5p13.2 nucleoporin 155kDa isoform 1 PDCD5 NM_004708 19q13.1 programmed cell death 5 MT1X NM_005952 16q12.2 metallothionein 1X RIOK3 NM_145906 18q11.2 sudD suppressor of bimD6 homolog isoform 2 GNG5 NM_005274 1p22.3 guanine nucleotide binding protein (G protein) SEC14L1 NM_005950 16q12.2 metallothionein 1G HGC6.3 NM_001129895.2 6q27 Homo sapiens uncharacterized LOC100128124 ILMN_1761247

John Wiley & Sons

SOD2 NM_000636 6q25.3 superoxide dismutase 2, mitochondrial KPNA2 NM_002266 17q24.2 karyopherin alpha 2 CCDC167 NM_138493.2 6p21.2 Homo sapiens coiled-coil domain containing 167 TTK NM_003318 6q14.1 TTK protein kinase C17orf53 NM_024032.3 17q21.3 Homo sapiens chromosome 17 open reading frame 53 TACC3 NM_006342 4p16.3 transforming, acidic coiled-coil containing TMEM108 NM_001136469.2 3q22.1 Homo sapiens transmembrane protein 108 HEBP2 NM_014320 6q23.3 heme binding protein 2 MAPK13 NM_002754 6p21.3 mitogen-activated protein kinase 13 OCIAD2 NM_152398 4p12 OCIA domain containing 2 EYA1 NM_172060 8q13.3 eyes absent 1 TRIP13 NM_004237 5p15.3 thyroid hormone receptor interactor 13 RRAGD NM_021244 6q15 Ras-related GTP binding D EYA2 NM_172113 20q13.1 eyes absent 2 RNA28S CDKN2A NM_058197.4 9p21.3 Homo sapiens cyclin-dependent kinase inhibitor 2A RAB32 NM_006834 6q24.3 RAB32, member RAS oncogene family ILMN_3308961 CENPW NM_001012507.3 6q22.3 Homo sapiens centromere protein W SPP1 NM_000582 4q22.1 secreted phosphoprotein 1

John Wiley & Sons

Supplementary Table 2. Overview of the fusion transcripts found to be positive by RT-PCR and Sanger sequencing.

Case Fusion Transcript sequence num transcript

1 ILF3-CATSPERD ACATGGATGTGCCCCCAGAGGACGACAGTAAAGAAGGGGCTGG*GTGGCGAAAAGACAGTTTCCAGGAGGTCATCGACGCCGAGTAT

1 RabGAP1L-RBKS AATAAGCCATCTCTTCAGTTAATTTTGGATCCGTCTAACACAG*GGTGCTGGTGACAGCTTTGTGGGAGCTCTGGCCTTCTACCTGG

2 GPR180-DZIP1 TGCATGCATTTCTGTCATTTTTAGCGACTACCAAAGAGACAAG*CTCCTGTCACATATAGAGAAACTTCGAACCTCAATGATAGATG

2 WIPF2-LASP1 GTGTAGGCGGCAGAGGATTCGCTCCCAGAGCAGCTGCGGCCAG*ATAAAATACCATGAGGAGTTTGAGAAGAGCCGCATGGGCCCTA

3 RNF126- CTTCTGCCACTGCTGCTCCGTGGAGATCGTCCCGCGCCTGCCG*GCCTGACCGCCGCTGCCTACAGAGTCACACTCAATCCTCCGGG NDUFA11

3 RPH3AL-BZW2 CTTCCTGGGCAGCTCGTCGGTGTTCTGCAAAGACTGCAGGAAG*GAACTCTTTCCAGTTAACAGACAGAGTGTGGATCATTTTGCTA

6 MLL4-RB1 ACTGGAACGCCAACCGGCTGGACCTGTTCGAGATCAGCCAGCCGACCGAG*ACTTCTGAGAAGTTCCAGAAAATAAATCAGATGGTATGTAAC AGCGACCG

7 NRP2-C2orf66 ACGGCAAGGACTGGGAATACATTCAGGACCCCAGGACCCAGCAGCCAAAG*CTTCACTCCACCATGACCAGAGCACCTCTCCTGCTACTATGTG TTGCCCT

14 GMPS-SYNPR ACTGAATGCCTTCTTGCTGCCAATTAAAACTGTAGGTGTGCAG*CTTTTTGCAATCTTTGCATTTGCAACATGCGGTGGCTATTCTG

15 KDM2B-CREBBP GGCACCACCACCCGAGACTCCTTAACCGAGATCAACCTGTCTG*ATTTTGGATCATTGTTTGACTTGGAAAATGATCTTCCTGATGA

18 PXDN-XIRP2 GAGCATGTACAGCATGGCTTGATGGTCGACCTCAACGGAACAA*CGACTGCTGGCCCTAATAAGCCTGAGAGTGGATTTGCAGAAGA

19 H2AFY-HMHB1 GGGGCACCCGTGTACATGGCCGCCGTCCTGGAATACCTGACAG*GTTCTCTGCATGTTTGGAAGTCGGAATTGGTTGAAGTTGAAGA

19 WTIP-BIRC6 GTCCATGGACAGAGACTACCACGTGGCATGTTACCACTGTGAG*CGTCACACTGCTCAGCTCCGCGAAGAGTTGCTGAAACTTCCCT

John Wiley & Sons

50 51 52 53 54 55 56 57 58 59 60 Page 51 of 53 Genes, Chromosomes & Cancer

15 NAIP-OCLN GTCCTGTGTGCCTGCAGACACATTTTTAAC*CTAGTTTGGAAGGATCATACTCAGCTGAAA and 21

* Fusion junction

John Wiley & Sons

50 51 52 53 54 55 56 57 58 59 60 Genes, Chromosomes & Cancer Page 52 of 53

Supplementary Table 3: List of the differentially expressed genes in the LGESS showing a t(7;17) and/or a JAZ1/SUZ12 fusion versus LGESS without any know rearrangement/fusion (called OTHER). The genes highlighted by green colour on the left, were found downregulated in the t(7;17) group of tumors compared to the OTHER group of LGESS whereas the genes highlighted by the red colour were upregulated in the t(7;17) group compared to the OTHER group.

Gene/probe Accession number Description name CKS2 NM_001827 CDC28 protein kinase regulatory subunit 2 PARPBP NM_017915 PARP1 binding protein TXNDC12 NM_015913 thioredoxin domain containing 12 CBX3 NM_007276 chromobox homolog 3 TOPBP1 NM_007027 topoisomerase (DNA) II binding protein 1 ILMN_1691402 DUOXA1 NM_144565 dual oxidase maturation factor 1 SLC6A1 NR_046647 SLC6A1 antisense RNA 1 PLA2R1 NM_007366 phospholipase A2 receptor MAL NM_002371 T-cell differentiation protein ISM2 NM_199296 isthmin 2 MYO5B NM_001080467 myosin VB UTF1 NM_003577 undifferentiated embryonic cell transcription factor 1 NR5A1 NM_004959 nuclear receptor subfamily 5, group A,member 1 TCAIM NM_173826 T cell activation inhibitor, mitochondrial PKD1L2 NM_052892 polycystic kidney disease 1-like 2 ILMN_2289844 CST6 NM_001323 cystatin E/M SLC27A6 NM_014031 solute carrier family 27 (fatty acid transporter) IQCK NM_153208 IQ motif containing K ISM2 NM_199296 isthmin 2 TDRD10 NM_182499 tudor domain containing 10 PACRG NM_152410 PARK2 co-regulated RGS11 NM_183337 regulator of G-protein signaling 11 TMEM42 NM_144638 transmembrane protein 42 BMP8B NM_001720 bone morphogenetic protein 8b SLC4A8 NM_001039960 solute carrier family 4, member 8 HAP1 NM_177977 huntingtin-associated protein 1 PDIA2 NM_006849 protein disulfide isomerase family A, member 2 PER2 NM_022817 period circadian clock 2 CROCCP2 NR_026752 ciliary rootlet coiled-coil, rootletin pseudogene 2 KCNK17 NM_031460 potassium channel, two pore domain subfamily K, member 17 SLC6A1 NM_003042 solute carrier family 6, member 1 C12orf68 chromosome 12 open reading frame 68 FAM83H NM_198488 family with sequence similarity 83, member H FBXL16 NM_153350 F-box and leucine-rich repeat protein 16 CDCP1 NM_022842 CUB domain containing protein 1

1 John Wiley & Sons

SLC17A7 NM_020309 solute carrier family 17, member 7 CLN5 NM_006493 ceroid-lipofuscinosis, neuronal 5 SEPT4 NM_001256782 septin 4 ARHGDIG NM_001176 Rho GDP dissociation inhibitor, gamma VENTX NM_014468 VENT homeobox DUOX1 NM_017434 dual oxidase 1 NGB NM_021257 neuroglobin ABLIM2 NM_001130083 actin binding LIM protein family, member 2 MLXIPL NM_032951 MLX interacting protein-like TMEM114 NM_001146336 transmembrane protein 114 WNT4 NM_030761 wingless-type MMTV integration site family CA11 NM_001217 carbonic anhydrase XI REEP6 NM_138393 receptor accessory protein 6 ILMN_1783149 C1QL1 NM_006688 complement component 1,q subcomponent-like1 PPP2R2C NM_020416 protein phosphatase 2, regulatory subunit B, gamma CPLX1 NM_006651 complexin 1 TRAF3IP2 NM_147686 TRAF3 interacting protein 2 TMEM74B NM_018354 transmembrane protein 74B CAMKV NM_024046 CaM kinase-like vesicle-associated RBP7 NM_052960 retinol binding protein 7 PPP1R1B NM_032192 protein phosphatase 1, regulatory subunit 1B PKD1L2 NM_052892 polycystic kidney disease 1-like 2 C16orf11 chromosome 16 open reading frame 11 ABCC8 NM_000352 ATP-binding cassette, sub-family C (CFTR/MRP), member 8 SLC7A10 NM_019849 solute carrier family 7, member 10 PCSK1N NM_013271 proprotein convertase subtilisin/kexin type 1 inhibitor NPAS1 NM_002517 neuronal PAS domain-containing protein 1 KIAA1210 NM_020721 uncharacterized protein KIAA1210 GRIN2C NM_000835 glutamate receptor, ionotropic, N-methyl D- aspartate 2C FAM198B NM_001128424 family with sequence similarity 198, member B KRT19 NM_002276 keratin 19 KCNK4 NM_033310 potassium channel, two pore domain subfamily K, member 4 GALR2 NM_003857 galanin receptor 2 ECM1 NM_004425 extracellular matrix protein 1 RGS11 NM_183337 regulator of G-protein signaling 11 GRIN3B NM_138690 glutamate receptor, ionotropic, N-methyl-D- aspartate 3B GCGR NM_000160 glucagon receptor

2 John Wiley & Sons