Interleukin-4 Receptor Signal Transduction: Involvement of P62

Den Naturwissenschaftlichen Fakult¨aten der Friedrich–Alexander–Universit¨at Erlangen–Nurnberg¨ zur Erlangung des Doktorgrades

vorgelegt von Susanne Burgis¨ aus Nurnberg¨ Als Dissertation genehmigt von den Naturwissenschaftlichen Fakult¨aten der Universit¨at Erlangen–Nurnberg¨

Tag der mundlichen¨ Prufung:¨ 6. Oktober 2006

Vorsitzender der Prufungskommission:¨ Prof. Dr. D.–P. H¨ader Erstberichterstatter: Prof. Dr. Dr. A. Gessner Zweitberichterstatter: Prof. Dr. T. Winkler Contents

1 Introduction 1 1.1 The biology of interleukin-4 and its receptor ...... 1 1.1.1 Interleukin-4 and its biological functions ...... 1 1.1.2 Interleukin-4-receptor complexes ...... 2 1.1.3 Interleukin-4-receptor signaling ...... 3 1.2 TheadaptorproteinP62 ...... 5 1.3 LinkbetweenIL-4RandP62...... 7 1.4 Aimsofthisstudy ...... 9

2 Materials and Methods 11 2.1 Materials ...... 11 2.1.1 Cytokines ...... 11 2.1.2 Commercialsystems ...... 11 2.1.3 Enzymes...... 12 2.1.4 Antibodies...... 12 2.1.5 Plasmids...... 13 2.1.6 Oligonucleotides...... 14 2.1.7 Celllinesandbacteria ...... 16 2.1.8 Media ...... 17 2.1.9 Animals ...... 17 2.2 Methods...... 18 2.2.1 Genotypingofmice...... 18 2.2.2 Polymerase chain reaction ...... 18 2.2.3 SequencingofplasmidsandPCRproducts ...... 19 2.2.4 Isolation of genomic DNA ...... 19 2.2.5 Southernblot ...... 20 2.2.6 IsolationoftotalRNA ...... 20 2.2.7 Reverse transcription RT–PCR ...... 20 2.2.8 QuantitativeRT–PCR ...... 20 2.2.9 Enzyme linked immuno sorbent assay ...... 21 2.2.10 GenerationofaP62antiserum...... 21 2.2.11 Transfection of cells with calcium–phosphate ...... 22 2.2.12 Westernblot ...... 22 2.2.13 Immunoprecipitation ...... 22 2.2.14 Proliferation of cells ...... 23 2.2.15 Stimulation of macrophages ...... 23

iii iv CONTENTS

2.2.16 Manipulation of mouse embryonic stem cells ...... 24 2.2.17 Preparation of mouse embryo ﬁbroblasts ...... 24 2.2.18 Class switching of splenic B cells ...... 25 2.2.19 TH2 diﬀerentiation of na¨ıve T cells ...... 25 2.2.20 Infection with Leishmania major ...... 26 2.2.21 Oral glucose tolerance of mice ...... 26 2.2.22 OVA induced allergic lung disease ...... 26

3 Results 27 3.1 Studiesincellculture...... 27 3.1.1 Phosphorylation of signaling intermediates ...... 27 3.1.2 Effectofkinaseinhibitors ...... 27 3.2 Involvement of P62 in IL-4R signaling ...... 30 3.2.1 BindingofP62totheIL-4R ...... 30 3.2.1.1 Colocalization of P62-EGFP and IL-4R-RFP ...... 30 3.2.1.2 Co-Immunoprecipitation of P62 with the IL-4R ...... 30 3.2.1.3 Trimolecular Co-Immunoprecipitation ...... 31 3.2.2 Description of the P62 gene deficient mouse model ...... 32 3.2.2.1 P62 deficiency on genomic level ...... 32 3.2.2.2 P62 deficiency on transcriptome level ...... 32 3.2.2.3 P62 deficiency on protein level ...... 34 3.2.3 Steady state phenotype of P62 gene-targeted mice ...... 35 3.2.4 Immunological phenotypes of P62 gene-targeted mice ...... 36 3.2.4.1 Oral glucose tolerance ...... 36 3.2.4.2 Functionality of macrophages ...... 37 3.2.4.3 Class switching of splenic B cells in vitro ...... 38 3.2.4.4 Differentiation of na¨ıve T cells in vitro ...... 39 3.2.4.5 Infection with Leishmania major ...... 41 3.2.4.6 Fibroblast functionality ...... 42 3.2.4.7 OVA induced allergic asthma ...... 43 3.3 Generationofa∆N388IL-4Rmousemodel ...... 44 3.3.1 Targetingstrategy ...... 44 3.3.2 Homologous recombination ...... 45 3.3.3 Blastocyst injection and breeding strategy ...... 46

4 Discussion 47 4.1 Mechanism of IL-4 induced proliferation in TF1 cells ...... 47 4.2 Binding of P62 to IL-4R and PKCζ ...... 49 4.3 Involvement of P62 in IL-4R signal transduction ...... 50 4.4 Generation of a ∆N388 IL-4R knock in mouse model ...... 52

5 Summary 55

A Abbreviations 59

Bibliography 61 Chapter 1

Introduction

1.1 The biology of interleukin-4 and its receptor

1.1.1 Interleukin-4 and its biological functions Murine interleukin-4 (IL-4) is a pleiotropic cytokine of 140 amino acids that is secreted after removal of a signal peptide as a mature protein of 120 amino acids, and has first been described as a growth factor for B cells by the group of William Paul [58]. Similar to other cytokines, it has a compact, globular fold, which is stabilized by three disulphide bonds [18]. The crystal structure has been solved for the human protein, and based on the amino acid sequence identity, the murine protein is expected to have a similar tertiary structure dominated by a four alpha-helix bundle with a left handed twist [153]. IL-4 is mainly sectreted by CD4+ T cells that also produce IL-5 and IL-13 (TH2 cells) [128]. In mice, basophils have been shown to secrete IL-4 after infection with the nematode Nippostrongylus brasiliensis [93], in humans upon challenge with allergens [127]; likewise, mast cells have been reported to secrete IL-4 [13, 15]. Additional sources of IL-4 are NK1.1 positive CD4+ T cells [20], γ/δ T cells [35] and eosinophils [31]. Recently, also dendritic cells and B cells have been suggested to produce IL-4 [90, 52]. IL-4 is an important cytokine in shaping immune responses and exerts different effects on various hematopoietic cells including lymphocytes (reviewed in [43] and [101]). On B cells, it acts as a growth factor [58] and is responsible for the upregulation of surface molecules such as MHC II [103], the low affinity IgE receptor CD23 [25] and the IL-4R itself [104]. Likewise, IL-4 induces Ig heavy chain class switching of human B cells to IgE and IgG4 [39] and is indispensable for class switching of murine B cells to IgE and IgG1 [23, 150]. On T cells, IL-4 acts as a growth factor that induces either proliferation or antiapoptotic effects [60]. IL-4 is also required for the development of TH2 cells from na¨ıve T cells after antigen stimulation. These cells secrete large amounts of IL-4 and other cytokines such as IL-5 or IL-13, thereby initiating a positive feedback loop. Additionally, IL-4 blocks the development of IFN-γ secreting TH1 cells, thus stabilizing a TH2 dominated immune response [59, 128]. In some infectious disease models it is decisive for the outcome of the infection, whether the immune system mounts a TH1- or TH2-dominated immune response. The importance of IL-4 for this decision has been clearly shown in various mouse

1 2 CHAPTER 1. INTRODUCTION

models using either neutralizing anti-IL-4 antibodies [117, 121], soluble IL-4R [113, 44] or IL-4 gene-deficient mice [75]. Apart from lymphocytes, IL-4 also affects other cells of the hematopoietic lineage. It upregulates MHC II expression on monocytes and leads to enhanced antigen presentation by macrophages, while at the same time the production of proinflammatory cytokines is downregulated [10]. IL-4 is also involved in inflammatory processes. It influences the expression of endothelial adhesion molecules like vascular cell adhesion molecule 1 (VCAM-1) [145] or E-selectin [6] and promotes chemokine production, thereby favouring the recruitment of eosinophils to the site of infection. Dysregulation of IL-4 expression results in uncontrolled allergic inflammation in mice and humans [115, 143], so a thorough understanding of IL-4R signal transduction processes is essential for therapeutic applications.

1.1.2 Interleukin-4-receptor complexes

IL-4 binds to a high affinity receptor IL-4Rα (Kd 20 to 80 pM [87]), that is a member of the type I cytokine receptor family as it contains conserved cysteine residues and an extracellular WSXWS motif, which is required for ligand binding [85]. The receptor is expressed on a variety of hematopoietic (monocytes, macrophages, mast cells, T cells and B cells) and nonhematopoietic cells (fibroblasts, neuroblasts, keratinocytes and hepatocytes) at relatively low frequencies (100 to 5000 copies per cell). Apart from the glycosylated 140 kD transmembrane protein, a 40 kD soluble IL-4R has been identified, that results from an alternatively spliced mRNA [99]. Compared to the transmembrane receptor, the soluble IL-4R binds IL-4 with similar affinity [34] and has been employed in the treatment of human asthma [11] and murine leishmaniasis [44]. Signal tranduction can be initiated through artificial cross-linkage of IL-4Rα chains [80], whereas physiological activity is obtained through heterodimerization of the IL-4Rα chain with either the common gamma chain (γc chain, CD132) to yield the type I receptor complex, or the IL-13Rα1 chain to yield the type II receptor complex, respectively. The majority of cells, including hematopoietic cells, express the type I IL-4R complex in which γc chain participates. This protein is also involved in the signal transduction of receptor complexes for IL-2, IL-7, IL-9, IL-15 [138] and IL-21 [108]. First, a complex of IL-4 and IL-4Rα is formed and subsequently γc chain interacts with this complex [82]; this binding does not increase the affinity for IL-4, but is required for the initiation of signal transduction [119].

Cells lacking the γc chain (mostly nonhematopoietic cells) can signal via the type II IL-4R complex [16, 56]. This receptor can also transduce signals in response to the cytokine IL- 13 [92]. Additionally to the IL-13Rα1 chain, an IL-13Rα2 chain exists, that binds IL-13 with even higher aﬃnity but does not contribute to signal transduction; it acts as a decoy receptor for IL-13 [158]. However, most recently the IL-13Rα2 chain was described to transduce IL-13 signals in macrophages, thereby fostering TGF-β-mediated ﬁbrosis [36]. Recently the IL-4Rα chain has been proposed to contribute to the signal transduction of progesterone-induced blocking factor (PIBF), which induces a TH2 dominated cytokine 1.1. THE BIOLOGY OF INTERLEUKIN-4 AND ITS RECEPTOR 3

production through signaling via STAT6. This novel receptor complex consists of the IL-4Rα chain and the GPI-anchored PIBF receptor [77].

1.1.3 Interleukin-4-receptor signaling As a typical member of the hematopoietin receptor family, the IL-4Rα and the associated receptor molecules γc chain and IL-13Rα1 lack endogenous kinase activity. Thus, for the initiation of signaling cascades, intracellular kinases and adaptor proteins have to be recruited. Janus tyrosine kinases (Jaks) are known to contribute to cytokine signaling [62]: Jak-1, Jak-2 and Jak-3 have been shown to interact with the IL-4R. The IL-4Rα chain itself recruits Jak-1 and in some cell lines also Jak-2 [101]; in doing so, binding is mediated by a conserved motif of the IL-4Rα chain, located in close proximity to the transmembrane region and containing several acidic amino acids (box-1 motif) [27, 95]. The γc chain also contains a box-1 motif and has been shown to bind Jak-3, whereas the IL-13Rα1 chain is associated with Jak-2 or the tyrosine kinase 2 (Tyk2) [106]. Activation of Jaks or other IL-4R associated kinases leads to tyrosine phosphorylation of the IL-4Rα chain [130]. Five conserved tyrosine residues of the intracellular receptor portion are phosphorylated, namely tyrosines Y475, Y550, Y578, Y606 and Y684 (num- bering according to Mosley et al. [99]). Subsequently, adaptor proteins with Src homology 2 domains (SH2) or phosphotyrosine-binding domains (PTB) can bind to the receptor. Two major pathways for IL-4R signal transduction have been described [101]: one employs insuline receptor substrates (IRS) and transduces mainly IL-4 induced proliferation signals (IRS-pathway), the other uses signal transducers and activators of transcription (STATs) and mediates gene activation in response to IL-4 (Jak/STAT-pathway).

Figure 1.1: IL-4R type I and type II. Schematic representation with receptor chains involved and conserved interaction domains for adaptor proteins. 4 CHAPTER 1. INTRODUCTION

Signaling via the IRS-pathway is initiated by the recruitment of IRS molecules, that possess a PTB domain, to the phosphorylated consensus motif 466PIxxxxNPxYxSxSD480 within the IL-4Rα chain [71] (see figure 1.1). This motif is also known as insulin-/IL-4R- motif (I4R) due to the homology in receptor sequences [155]. Subsequently, IRS molecules are multiply phosphorylated at up to 20 different amino acids by Jaks [140, 160], after which they act as adaptor proteins linking other signal transduction molecules to the receptor [139, 141]. Phosphorylated IRS molecules have been described to bind to the regulatory subunit of the phosphoinositide-3 kinase (PI3-kinase); the activated PI3-kinase phosphorylates membrane lipids that act as second messengers and are crucial for the survival of the cell [37]. Another binding partner of phosphorylated IRS is the adaptor molecule Grb-2, that establishes a link to the Ras/Raf-pathway [26]. Similarly, signaling via the STAT6-pathway requires the recruitment of cytoplasmatic STAT6 molecules to the IL-4Rα chain. The three conserved tyrosine residues Y550, Y578 and Y606 of the IL-4Rα act as binding sites for the SH2 domain of STAT6 (see figure 1.1), and bound STAT6 is phosphorylated by Jaks. After tyrosine phosphorylation, STAT6 dis- sociates from the receptor and translocates as a homodimer to the nucleus, where it acts as a transcription factor binding to promotor consensus motifs (GAS-elements) of IL-4 inducible genes [63, 91]. STAT6 regulates genes responsible for allergic reactions, a TH2- dominated immune response and IgE production [110].

Figure 1.2: IL-4R deletion mutants. Schematic representation of C-terminal IL-4Rα deletion mutants and their ability to proliferate upon IL-4 stimulation and to activate signaling intermediates. 1.2. THE ADAPTOR PROTEIN P62 5

However, identification of functional regions within IL-4Rα being strictly responsible for either proliferation or gene activation is difficult. On the one hand, the IRS-pathway also phosphorylates high mobility group protein-I (HMG-I), a DNA-binding protein involved in the regulation of Iǫ expression in response to IL-4 [154], hence influencing gene expression (IgE class switching). Also, cell lines transfected with truncated human IL-4Rα constructs, that lack all STAT6 binding sites, were still able to signal weak IL-4 induced gene activation as measured by surface expression of CD23 [120]. More recently, an acidic serine rich motif of the IL-4Rα termed ID-1 (347VQSVEEEEDEMVKEDLSMSPENSG370) has been connected to IL-4 induced activation of STAT6 and also STAT5 [97, 136], which resulted in the induction of TH2 differentiation in activated T cells. On the other hand, activated STAT6 also leads to the expression of genes important for survival and proliferation of lymphocytes like growth factor-independent gene-1 (GFI-1) or E4 binding protein 4 (E4BP4) [162]. Data from our own laboratory also challenge the model of IL-4R signal transduction described above: using a cell culture system of human TF-1 cells, that were stably transfected with truncated murine IL-4Rα constructs, it was shown that IL-4 induced proliferation required neither phosphorylation of IRS-2 nor STAT6 (see figure 1.2), whereas phosphorylation of Jak1 was a strict prerequisite for functionality [144]. As functional receptors lacked binding sites for both IRS molecules and STAT6, and alternative activation of these adaptor proteins was not observed, the existence of an alternative signal transduction pathway for IL-4 signals, employing additional adaptor proteins, was postulated.

1.2 The adaptor protein P62

In the literature P62 protein has been described in a variety of different contexts and under various synonyms: in humans, the protein has been identified as a phosphotyrosine- independent ligand of the Src homology 2 (SH2) domain of p56lck [68, 107]; in rat, the protein was shown to interact with the regulatory domain of the atypical protein kinase C- ζ [114], and was therefore termed PKCζ interacting protein (ZIP). In the murine system, P62 has been described as an oxidative stress protein induced in peritoneal macrophages (A170) [64], and also as signal transduction and adaptor protein (STAP) expressed in osteoblasts [105]. Amino acid sequences are highly conserved between species, the murine protein shares 97% and 90% homology with rat and human P62, respectively. Proteins share several structural motifs, including an SH2 binding domain, an acidic interaction domain (AID) that binds the atypical PKCζ, a ZZ zink finger, a binding site for TNF receptor associated factor 6 (TRAF6), two PEST sequences that are associated with the rapid degradation of proteins, and a ubiquitin associated (UBA) domain (see figure 1.3) [40]. Two splice variants of rat P62, termed ZIP2 and ZIP3 have been identified, that lack the TRAF6 binding domain or the PEST and UBA domains, respectively [24, 46]. Endogenous P62 is located either in the cytoplasm or as a membrane associated protein [114], and is sometimes detected in lysosome targeted endosomes colocalizing with Rab7 and partially with lamp-1 [123]. On the contrary, in HeLa cells stimulated with sorbitol, P62 has been detected in the nucleus consistent with its suggested role as a transcription factor [137]. For example, P62 has been shown to potentiate transactivation by chicken 6 CHAPTER 1. INTRODUCTION

Figure 1.3: Schematic domain organization of murine P62

ovalbumin upstream promoter transcription factor II (COUP-TFII), an orphan member of the nuclear hormone receptor superfamily of ligand-activated transcription factors [89]. As P62 lacks any classical nuclear localization signals itself, it is supposed to shuttle into the nucleus bound to adaptor proteins [40, 109]. In earlier publications, P62 has been assumed to possess either serine/threonine kinase activity [107], or, due to a number of putative target sites for several protein kinases, to be a substrate for phosphorylation itself [114]. Today, the general notion prevails, that P62 is neither a kinase nor the substrate of a kinase, but acts as a scaffold protein or a molecular adaptor, linking the functionality of otherwise promiscous cellular enzymes to discrete signal transduction events. The binding of P62 to atypical protein kinases (aPKCs), namely PKCζ and PKCλ/ι, seems to be of outstanding functional relevance. The aPKCs share a conserved catalytic domain with the classical and novel PKCs, but possess a clearly distinct regulatory domain [65, 98]. They are insensitive to Ca2+ as well as diacylglycerol and phorbol esters, and in contrast to other family members, they contain only one zinc finger domain and no C2 domain. On a functional level, aPKCs are essential components of signal transduction cascades regulating cell growth and survival [7, 29], as well as cytoskeletal rearrange- ments [149] and cell polarity [83]. The interaction of P62 with aPKCs, especially PKCζ, has been reported by independent groups [17, 114, 123], and the interacting domains have been mapped using deletional mutants: P62 utilizes a novel acidic motif comprising amino acids 69 to 81 (AID domain) for the interaction [124], whereas the regulatory domain of PKCζ (PB1 domain) is involved. More recently, the solution structure of aPKC’s PB1 domain and its mode of interaction with P62 was determined [57]. Furthermore, the crystal structure of the interacting motifs was solved [157], confirming earlier results regarding this interaction. The interaction of P62 and PKCζ has been shown to target PKC activity to several pathways and cellular functions. For example, P62 links the Kvβ2 subunit of the voltage-gated potassium channel as well as the ρ subunit of the ligand-gated ion channel GABAC R to PKCζ [24, 46]. In 2002 Burnol et al. showed that growth factor receptor-bound protein 14 (Grb14), a negative regulator of insulin signaling, is phosphorylated by PKCζ as a consequence of the interaction of Grb14 and the heterodimeric P62/PKCζ complex. As phosphorylated Grb14 is an even stronger inhibitor of insulin signaling, the cellular metabolism is influenced by the scaffold protein P62 [17]. 1.3. LINK BETWEEN IL-4R AND P62 7

Selective activation of the transcription factor nuclear factor κB (NF-κB) in response to different extracellular stimuli is another funtion of P62, which has been extensively studied. For example, signals induced by nerve growth factor (NGF) are transduced via the neurotrophin receptors p75 and TrkA and result in P62 mediated NF-κB activation. P62 directly binds to TrkA, and to p75 using TRAF6 as a molecular bridge. PKCζ, that is recruited to this macromolecular complex, phosphorylates IκB kinase, leading to phosphorylation and degradation of inhibitor of κB (IκB) and subsequent activation of NF-κB, which results in cell survival. P62 has also been shown to participate in TrkA internalization, connecting receptor signals with the endosomal signaling network required for neuronal differentiation [41, 67, 122, 159]. In a similar manner, signal transduction processes in response to the cytokines tumor necrosis factor-α (TNF-α) and IL-1 are influenced by P62: P62 binds to RIP, a death domain kinase that associates with the TNF receptor 1 (TNF-R1) through interaction with the adaptor molecule TRAAD, thereby recruiting PKCζ. As a result, IKKβ-kinase functionality (mediated by PKCζ) is targeted to the TNF receptor [81, 125]. Likewise, the IL-1 receptor is connected via myeloid differentiation primary response gene 88 (MyD88), interleukin-1 receptor associated kinase (IRAK) and TRAF6 to the scaffold protein P62, which recruits PKCζ and consequently causes NF-κB activation upon stimulation with IL-1 [124]. The involvement of P62 in these signal transduction pathways has been investigated mainly in cell culture systems employing siRNA approaches or using dominant negative variants of participating proteins. To verify these oberservations, a P62 gene-deficient mouse model was established. The first study on this mouse model reported an impaired induced osteoclastogenesis in P62 gene-deficient mice, whereas the basal physiology of bones was not affected [33]. Stimulation with the calciotropic hormone parathyroid hormone-related protein (PTHrP) induces osteoclastogenesis via the receptor activator of NF-κB ligand (RANK-L), which is a member of the TNF-α family of cytokines. Engage- ment of RANK leads to the formation of a ternary complex of TRAF6, P62 and aPKC. Most likely, PKCλ/ι is involved in this complex formation, since PKCζ gene-deficient mice displayed no osteopetrotic phenotype. Recently, Rodriguez et al. reported that the loss of P62 leads to mature-onset obesity [116]. Mice older than five months displayed increased body fat, a reduced metabolic rate and insulin- as well as leptin-resistance. Most likely this phenotype is due to an enhanced basal activity of the extracellular signal-regulated protein kinase (ERK) in adipose tissue, which has been shown to be important for adipogenesis and obesity [12]. P62 can directly interact with ERK, and in a WT situation this interaction seems to block ERK activity, resulting in reduced adipocyte differentiation.

1.3 Link between IL-4R and P62

Both IRS- and STAT6-independent IL-4 induced proliferation in a TF1 cell culture system was observed in the laboratory of Prof. Gessner. As a logical consequence, we postulated that a third signal transduction pathway for IL-4R signals, independent of the signal transduction proteins described until now, must exist. To identify proteins involved in this hypothetical signal pathway, a yeast two hybrid (Y2H) screen was performed. In 8 CHAPTER 1. INTRODUCTION

this experiment, P62 was detected as an interaction partner of the cytoplasmic portion of the shortest functional IL-4R mutant. Additionally, a short peptide stretch of the IL-4R (297KTDFPKAAPTKSPQSPGKA315) was mapped as the region interacting with P62 in a pepscan experiment. Mutation of serine 308, completely abolished IL-4 induced proliferation in cells carrying the truncated ∆N388 IL-4R, whereas cells transfected with a mutated WT-IL-4R were unaffected [144]. This observation indicated a functional relevance of the putative binding motif for P62. In 2004 Durán et al. linked IL-4 signal transduction to PKCζ, which is a functionally important binding partner of P62 [33]. In this report, PKCζ gene-deficient mice displayed reduced liver damage in a ConA-induced hepatitis model, which was due to impaired IL- 4R signaling, resulting in reduced activation of JAK1 and STAT6. Based on our previous data, the established link between P62 and PKCζ, and the recently reported connection between PKCζ and IL-4R signaling, we propose that P62 is invoved in IL-4R signaling, possibly via an IRS- and STAT6-independent pathway. To test this hypothesis, a mouse model with a mutated P62 gene, in which exons two to four have been removed, was generated in the group of Prof. Gessner. 1.4. AIMS OF THIS STUDY 9

1.4 Aims of this study

IL-4, together with IL-13, are key cytokines in atopic diseases and allergic asthma. Poly- morphisms in the IL-4R gene have been shown to associate with susceptibility to and severity of atopic asthma [61]. With approximately 300 million people worldwide suffer- ing from asthma (Global Initiative for Asthma, GINA), this disease is an important health problem. Therefore, a thorough understanding of IL-4R signaling pathways is important, especially with regard to therapeutic implications. To date, two signaling pathways have been described for IL-4: one functions via Jak1 and STAT6, the other via IRS-molecules. In the laboratory of Prof. Gessner, IL-4 induced proliferation was observed, which was independent of STAT6- and IRS-phosphorylation. Additionally, P62 was detected as a binding partner of the IL-4R in a Y2H screen. Based on these data, the existence of a third signal transduction pathway for IL-4 was postulated, presumably independent of STAT6 and IRS, but depending on the adaptor protein P62. Therefore, this study investigated the following topics: First, the mechanism of STAT6- and IRS-independent proliferation in TF1 cells was investigated. Cells transfected with either WT IL-4R or ∆388 IL-4R were treated with different kinase inhibitors to discriminate between different proliferation pathways (PI3 Kinase/Akt pathway vs. MAP kinase pathway). Second, the binding of IL-4R to P62, a novel interaction partner of the receptor, was verified. It was tested whether stimulation of cells with IL-4 or the expression levels of P62 exerted any influence on this interaction. Additionally, the functional relevance of the interaction between P62 and IL-4R was investigated both in vitro and in vivo. For this purpose, P62 gene-deficient mice were characterized in steady state and were subsequently tested for their ability to respond to IL-4 stimulation. Finally, the functionality of the truncated ∆388 IL-4R, which lacks binding sites for IRS and STAT6, and which was able to mediate proliferation in vitro, should be further analyzed. Therefore, a transgenic mouse model carrying this ∆388 IL-4R was established. 10 CHAPTER 1. INTRODUCTION Chapter 2

Materials and Methods

2.1 Materials

2.1.1 Cytokines

All recombinant cytokines (mIL-4, hIL-4, mIL-13, mIL-1α, mIL-1β and mIL-10) for cell stimulation and proliferation studies were purchased from Strathmann Biotech AG, Ham- burg. IL-2, IL-3 and IL-4 for cell culture were isolated from supernatants of X63Ag8-653 cells transfected with the respective cDNAs [70].

2.1.2 Commercial systems

Unless stated otherwise, all systems were used according to manufacturers’ recommendation.

Kit Manufacturer DuoSet Mouse Eotaxin 1/CCL11 R&D Systems ECL plusTM Western Blotting Detection System Amersham EndoFreeTM Plasmid Maxi Kit Qiagen Long template PCR Kit Roche PureLink HiPure Plasmid Midiprep Kit Invitrogen pGEM-T easyTM Vector Systems Promega QIAprepTM Plasmid Midi Kit Qiagen QIAprepTM Spin Miniprep Kit Qiagen QIAquickTM Gel Extraction Kit Qiagen QIAquickTM PCR Puriﬁcation Kit Qiagen QIAshredderTM Qiagen Ready-to-goTM DNA Labelling Beads (-dCTP) Amersham RNeasyTM Mini Kit Qiagen StreptABComplex/HRP DAKO

11 12 CHAPTER 2. MATERIALS AND METHODS

2.1.3 Enzymes Restriction enzymes were used in appropriate buﬀers recommended by the manufacturer. Digestions were carried out in 10-fold the volume compared to the enzyme volume and incubated at 37◦C for 4h up to 12h.

Enzyme Manufacturer Pfu Ultra Hotstart DNA Polymerase Statagene Platinum TaqTM DNA Polymerase Invitrogen Restriction enzymes New England Biolabs or Fermentas Superscript IITM-reverse transcriptase Invitrogen Shrimp alkaline phosphatase (SAP) Pharmacia-Biotech T4 DNA ligase Invitrogen

2.1.4 Antibodies Antibodies were stored at 4◦C or −20◦C and were diluted to the appropriate working concentration shortly prior to use. Antibodies for Western Blotting were reused and stored at 4◦C in Western Blot blocking buﬀer supplemented with sodium azide.

Antibody Application Manufacturer mouse anti Flag IgG FITC Western Blot, IP Sigma rabbit anti goat IgG POX Western Blot Dianova goat anti GST IgG (polyclonal) Western Blot Pharmacia-Biotech mouse anti HIS IgG1 Western Blot Qiagen rat anti mouse IL-4R (M1) Western Blot, IP Beckmann [5] rabbit anti mouse IL-4R serum Western Blot AG Gessner goat anti mouse IgG POX Western Blot Dianova goat anti rat Cy5-conjugated FACS Jackson donkey anti rabbit POX Western Blot Dianova rabbit anti P62 polyclonal serum Western Blot AG Gessner rabbit anti PKCζ Western Blot Sigma PathScan Multiplex Western Cocktail I Western Blot Cell Signaling anti CD40L stimulation of cells AG Winkler anti IFNγ ELISA capture R&D Systems anti IFNγ-bio ELISA detection BD Biosciences anti IL-4 (11B11) ELISA capture BD Biosciences continued on next page 2.1. MATERIALS 13

continued from previous page Antibody Application Manufacturer anti IL-4-bio ELISA detection BD Biosciences anti IL-13 (38213.11) ELISA capture R&D Systems anti IL-13-bio ELISA detection R&D Systems anti IgE (R35-72) ELISA capture BD Biosciences anti IgE-bio (R35-118) ELISA detection BD Biosciences anti IL-5 (TRF-K5) ELISA capture cell sciences anti IL-5-bio ELISA detection Pharmingen anti IL-12p40 ELISA capture BD Biosciences anti IL-12p40-bio ELISA detection BD Biosciences anti B220-bio (RA3-6B2) cell depletion, BD Biosciences FACS anti CD3-bio (145-2C11) cell depletion BD Biosciences anti CD4-bio cell depletion Caltag anti CD8-bio (53-6.7) cell depletion BD Biosciences anti CD62L-bio (MEL-14) cell enrichment BD Biosciences anti CD11b-bio (M1/70) cell depletion BD Biosciences Pan NK (DX5)-bio cell depletion Pharmingen Ter119 / Ly76-bio cell depletion BD Biosciences Gr1-bio (RB6-8C5) cell depletion, BD Biosciences FACS c-Kit-PE FACS Caltag Lab. CCR3-PE FACS R&D Systems CD11b-FITC FACS BD Bioscience CD80-PE (B7.1) (16-10A1) FACS Pharmingen CD86-FITC (B7.2) FACS BD Biosciences CD11c-bio (HL3) FACS BD Biosciences MHC II-PE FACS Biotechnology F4/80-bio FACS Caltag CD23-FITC (B3B4) FACS Pharmingen CD69-PE (H1.2F3) FACS BD Biosciences CD44-bio (IM7) FACS Pharmingen CD3-PE FACS Caltag B220-PE (CD45R) FACS Caltag CD62L-PE FACS Caltag Gr1-PE (RB6.8C5) FACS BD Biosciences

2.1.5 Plasmids

All plasmids were isolated with the QIAprep Plasmid Midi Kit or the PureLink HiPure Plasmid Midiprep Kit from cultures of E. coli DH10B. Plasmids were stored at −20◦C and were digested with the appropriate restriction enzymes prior to use. 14 CHAPTER 2. MATERIALS AND METHODS

Plasmid Application Reference pGEM-T easy subcloning Promega notes pEGFP-N1 EGFP fusion constructs [112] pDsRed1-N1 (T4mut) RFP fusion constructs [8] pFLAG-CMV-2 FLAG expression constructs [2] pCI-TPA vector for DNA–vaccination [156] pcDNA 3.1 myc-His expression constructs Invitrogen pROSA26-1 STOP targeting construct for IL–4R knock in T. Buch, Universtity of Cologne

2.1.6 Oligonucleotides Oligonucleotides were ordered from Thermo Hybaid and stored at −20◦C at a concentration of 80 pmol/µl. Primers were used at a ﬁnal concentration of 0.2 µM for PCR reactions.

Name Sequence 5′ to 3′ Usage HPRT-P1 GTT GAA TAC AGG CCA GAC TTT GTT G qRT–PCR HPRT-P2 GAT TCA ACT TGC GCT CAT CTT AGG C qRT–PCR PBGD-P1 ATG TCC GGT AAC GGC GGC qRT–PCR PBGD-P2 CAA GGC TTT CAG CAT CGC CAC CA qRT–PCR mu-Eotaxin 1 ATG CAG AGC TCC ACA GCG CTT CTA qRT–PCR LC1 fwd mu-Eotaxin 1 TGT AGC TCT TCA GTA GTG TGT TGG qRT–PCR LC1 rev mu-Eotaxin-P1 TAT CAC CCT GAC TGA CCT GTA ACT CA RT-PCR mu-Eotaxin-P2 CAC TTA AAG GCA GAG GCA GGT AA RT–PCR Neo-P3 GGG CGC CCG GTT CTT TTT G mouse screen Neo-P4 ACA CCC AGC CGG CCA CAG TCG mouse screen Cre-P1 ACC AGC CAG CTA TCA ACT CG mouse screen Cre-P2 TTA CAT TGG TCC AGC CAC C mouse screen EGFP-P1 CGT CCA GGA GCG CAC CAT CTT CTT mouse screen EGFP-P2 ATC GCG CTT CTC GTT GGG GTC TTT mouse screen Stat6-P1 CTG GAC CTC ACC AAA CGC mouse screen Stat6-P2 CCC GGA TGA CGT GTG C mouse screen IL-4R I6 fwd CCC TTC CTG GCC CTG AAT TT mouse screen IL-4R E10 rev ACC TGT GCA TCC TGA ATG AT mouse screen IL-4R E8 fwd GTA CAG CGC ACA TTG TTT TT mouse screen IL-4R E8 rev CTC GGC GCA CTG ACC CAT CT mouse screen continued on next page 2.1. MATERIALS 15

continued from previous page Name Sequence 5′ to 3′ Usage P62 Ex2-3-4 P1 AAT CCG GGG CTT CCT TCC TG mouse screen P62 Ex2-3-4 P2 GCC CTT CCC CTC GCA CAC G mouse screen P62-3′ TCA GGA AAT TGA CAT TGG GAT CTT mouse screen P62-5′ AAC AAC TTA GAT GGA GCC TGA ATG mouse screen mP62 Ex1 GAG CCG AGT GGC TGT GCT GTT CCC cloning P62 LCP4 GCC AGG CCT AGG GGA AGC AGA G cloning s IL-4R P1 GCC CCA GTG GTA ATG TGA AGC CCT sequencing ROSA26 AGC ATA GAA GGG GCT TTC CCA GGA G probe Sonde 1 fwd Southern ROSA26 AGT TCC TAT CTC AGA TGG CTG CTG C probe Sonde 1 rev Southern pM5Neo- CGG GCG CGC CGC CGC GCC GCG CGT cloning Rosa26-Stop1 CTT GTC TGC TG sequencing mouse screen pM5Neo- GCG GCC GGC CCA CAA GCT TAT CGA sequencing Rosa26-Stop-2 TGA TAA GTG TC p-ROSA26-sa GGA GGC AGG AAG CAC TTG CTC TCC C sequencing mouse screen 570-Stop- CCC GGC CGG CCT TAG TTC TCA GTG cloning and ROSA26 AGC CGA GCC AT sequencing ROSA26-ﬂank CCT AAA GAA GAG GCT GTG CTT TGG sequencing nidogen-P1 CCA GCC ACA GAA TAC CAT CC PCR nidogen-P2 GGA CAT ACT CTG CTG CCA TC PCR WT IL-4R TTT AGA TCT TTT GTG TCC CCA ATG cloning DSred BglII f. GGG CGG WT IL-4R AAA AGA TCT AGA AAC AAT GCC cloning DSred BglII r. CAG GGC IL-4R P3 TTC AGC AAG CAA GGC AGC AGC sequencing IL-4R P4 CGA GGC ACC TTT TGT GTC CCC sequencing IL-4R P5 TCG GGA AGC TCA GCC TGG GTT sequencing mouse screen IL-4R P6 TCA ACC AAG TAC CCG CAC TGG A sequencing IL-4R P19 GGA ATT CCT AGT TCT CAG TGA GCC sequencing GAG CCA T IL-4R P21 CCG CAG AAT TCA TTG TCT ATA ATG sequencing TGA CCT AC IL-4R P22 CCG GAT CCA TTA AGA AGA TAT GGT sequencing GGG ACC AG continued on next page 16 CHAPTER 2. MATERIALS AND METHODS

continued from previous page Name Sequence 5′ to 3′ Usage IL-4R P23 GGG AAT TCC TAC TCC TGG CTT CGG sequencing GTC TGC TTA TC Neo ext P1 ACC TGC GTG CAA TCC ATC TTG TTC sequencing Neo ext P2 CGC CTT CTT GAC GAG TTC TTC TGA sequencing P62 Myc-tag TTT AAG CTT TAG ACC GCG GTT ATG cloning Hind III GCG TCG P62 Myc-tag AAA CTC GAG CAA TGG TGG AGG GTG cloning XhoI CTT CGA P62 Start TTT AAG CTT GCG TCG TTC ACG GTG cloning (pFlag) AAG GCC P62 Stop GGG AGA TCT TCA CAA TGG TGG AGG cloning (pFlag) GTG CTT mu-P62 P1 CCC GGA TCC GCG TCG TTC ACG GTG cloning AAG GCC TAT C mu-P62 P2 AAA GGA TCC TCA CAA TGG TGG AGG cloning GTG CTT CGA A mu-P62 P0 CCA GCT GTT TCG TCC GTA CCT AGA cloning CCG mu-P62 GGG GGA TCC CGC AAT GGT GGA GGG cloning End BamHI TGC TTC GAA TA WT IL-4R TTT AGA TCT TTT GTG TCC CCA ATG cloning DSred fwd GGG CGG WT IL-4R AAA AGA TCT AGA AAC AGC AAT GCC cloning DSred rev CAG GGC IeF TGGGATCAGATCTTTGAG PCR CeR CCAGGGTCATGGAAGCAGTG PCR ImF CTCTGGCCCTGCTTATTGTTG PCR

2.1.7 Cell lines and bacteria

Cell Line Origin Reference 3T3 mouse ﬁbroblast (Swiss mouse) [147] HEK293T embryonal kidney cell, human [47] CTLL-2 mouse T-lymphocyte (C57BL/6) [45] TF-1 erythroleukemia, human [74] Balb/c ES cell embryonal stem cell (Balb/c) Prof.Nitschke (Uni- versity of Erlangen) 2.1. MATERIALS 17

Strain Genotype Reference DH10B F− mcrA ∆(mrr-hsdRMS-mcrBC) Invitrogen [48] φ80lacZ∆M15 ∆lacX74 recA1 deoR araD139 ∆ ara-leu7697 galU galK rpsL (StrR) endA1 nupG λ− − − − BL21(DE3) F ompT hsdSB(rB mB) gal dcm Sigma Aldrich

2.1.8 Media

Media for propagation of cell lines or primary cells was purchased ready to use and was kept at 4◦C. Medium for bacteria was prepared from powder and autoclaved prior to use.

• Bacteria were cultured in LB-Medium (10 g/l tryptone; 5 g/l yeast-extract; 10 g/l NaCl). For plates 20 g/l agar were added.

• Suspension cells were kept in RPMI 1640 medium (PAA) supplemented with 1% 100 x Pen/Strep (PAA), 1% 1 M HEPES Buﬀer Solution (PAA), 10% FCS (fetal bovine serum from Sigma) and 1% 200 mM L-glutamine (Gibco).

• Adherent cells were cultured in D-MEM (high glucose, plus L-glutamine, plus pyru- vate from Gibco). Medium was supplemented with 1% 100 x Pen/Strep (PAA), 1% 1 M HEPES Buﬀer Solution (PAA), 10% FCS (fetal bovine serum from Sigma) and 1% 200 mM L-glutamine (Gibco).

• MEFs and ES cells were kept in D-MEM (high glucose, plus L-glutamine, plus pyru- vate from Gibco). Medium was supplemented with 15% fetal bovine serum (PANTM Biotech GmbH), 1% MEM Non Essential Amino Acids (Gibco), 1% Pen/Strep (Gibco) and 0.001% β-mercaptoethanol (Gibco). Cells were detached with 1 x Trypsin EDTA from Gibco. To cultures of ES cells, additionally ESGRO leukemia inhibitory factor (LIF) from Chemicon was added at a concentration of 120 U/ml.

2.1.9 Animals

Mice were obtained from the internal animal breeding house of the Institute of Clinical Microbiology, Immunology and Hygiene or purchased from Charles River Laboratories (Sulzfeld, Germany). STAT6 gene-deﬁcient and IL-4R gene-deﬁcient mice were on a Balb/c background (minumum F10), P62 gene-targeted mice for most experiments were also Balb/c background (F6 speed congenics and subsequently F10 conventional backcross) or F6 C57/Bl6. Animals recieved humane care according to the legal requirements in Germany. Mice were kept under controlled conditions (22◦C, 12h day/night rhythm) and were fed a standard laboratory chow (Altromin 1434) ad libitum. Mice were used for experiments between six and ten weeks of age weighing 20 to 25 g. 18 CHAPTER 2. MATERIALS AND METHODS

2.2 Methods

2.2.1 Genotyping of mice Genomic DNA from mice was obtained from tail biopsies lysed in 50mM KCl, 10mM Tris HCl pH 8.3, 2.5 mM MgCl2, 0.1 mg/ml gelatine, 0.45% TritonX-100, 0.45% Tween-20 in water supplemented with Proteinase K. Samples were incubated at 56◦C with gentle agitation over night. After boiling at 95◦C for 5 min, tail DNA was subjected to a PCR reaction with the corresponding primers; resulting bands were resolved by agarose gel electrophoresis. The following PCR conditions were used:

PCR Cycles Annealing Elongation Product Size P62 KO 35 60◦C, 60 sec 72◦C, 60 sec 700 bp P62 WT 35 60◦C, 60 sec 72◦C, 60 sec 300 bp STAT6 WT 35 54◦C, 30 sec 72◦C, 45 sec 250 bp STAT6 KO (Neo) 40 65◦C, 30 sec 72◦C, 45 sec 500 bp GFP /4get 35 60◦C, 30 sec 72◦C, 40 sec 400 bp Cre 12 64◦C, 30 sec 72◦C, 35 sec 200 bp 25 58◦C, 30 sec 72◦C, 35 sec IL-4R WT 40 57◦C, 30 sec 72◦C, 30 sec 170 bp IL-4R KO 40 57◦C, 30 sec 72◦C, 60 sec 1300 bp ∆388 IL-4R ROSA KI 37 60◦C, 40 sec 72◦C, 50 sec 630 bp (IL-4R P5 pM5Neo-Rosa26-Stop-1) ∆388 IL-4R ROSA KI 40 65◦C, 40 sec 72◦C, 60 sec 870 bp (IL-4R P5 p-ROSA26-sa)

2.2.2 Polymerase chain reaction PCR reactions for ampliﬁcation of plasmid-DNA, genomic DNA or cDNA were carried out in 40 µl total volume. Each sample included: 1–100 ng DNA 8 pmol 5’primer 8 pmol 3’primer 1.25 U Taq-polymerase 2.5 mMol dNTPs 4 µl 10 x Buﬀer w/o MgCl2 2 mMol MgCl2

An initial denaturing step of 5min at 95◦C was performed. Cycling conditions were dependent on several parameters (length of sequence to be ampliﬁed and melting temperature 2.2. METHODS 19

of primers employed) and were optimized for each pair of primers separately. One last elongation step of 5 min at 72◦C was added. Products were assessed for purity and speci- ﬁcity by agarose gel electrophoresis.

2.2.3 Sequencing of plasmids and PCR products PCR products used for cloning and expression plasmids were either sequenced at MWG Biotech (Ebersberg, Germany) or at the internal sequencing facility of the Institute for Clinical Microbiology, Immunology and Hygiene. Shortly, the BigDye Terminator Cycle Seq kit (Applied Biosystems) was used according to manufacturer’s protocol with the corresponing primers. The PCR reaction employed:

1x 5 min 95◦C 25x 10 sec 95◦C 5 sec 50◦C 4 min 60◦C 1x ∞ 4◦C

PCR products were precipitated with EtOH and solved in water. Analysis was carried out with an ABI PRISM 310 Genetic Analyzer and the DNAStar SeqMan software.

2.2.4 Isolation of genomic DNA Genomic DNA from Balb/c ES cell clones was isolated for Southern Blot analysis. Shortly, cells were harvested from conﬂuent 6-well cell culture plates or 10cm Petri dishes and were washed twice with PBS to remove residual FCS. Afterwards, cells were resuspended in 500 µl PBS and 500 µl 2 x Bradley Lysis Buﬀer supplemented with Proteinase K was added. Samples were incubated over night at 55-60◦C with gentle agitation.

2 x Bradley Lysis Buﬀer: 20 mM Tris/HCl (pH 7.5) 20 mM EDTA 20 mM NaCl 10% SDS Proteinase K 2 mg/ml

Cell lysates were extracted twice with 1Vol phenol, once with 1Vol phenol/chloroform and subsequently with 1 Vol chloroform. Genomic DNA was precipitated from the aqueous phase by adding 2 Vol EtOH and 1/10 Vol 3 M sodium acetate (pH 5.2). The precipitate was washed once with 70% EtOH and solved in 100 µl of water for downstream applications. 20 CHAPTER 2. MATERIALS AND METHODS

2.2.5 Southern blot

The method was performed essentially as described previously by Southern [133]. Briefly, 10-20 µg of genomic DNA were digested over night with appropriate restriction enzymes. Digests were precipitated with EtOH and loaded on a 0.8% agarose gel in 30 µl total volume. Gels were run for approximately 4 h at 100 V. Photographs of the gels were taken with an Image Master VDS (Pharmacia Biotech) to document the position of the marker (gene ruler 1 kb). Afterwards gels were treated 20 min with 0.25M HCl followed by 30min neutralizing buffer (0.5M NaOH; 1.5M NaCl) to facilitate blotting. DNA was transfered to a nylon membrane (Biodyne by PALL) by upward capillary transfer with a high salt buffer (20 x SSC: 3 M NaCl; 0.3 M Na-Citrate pH 7.0) over night. Blots were dried for 20 min at 37◦C and stored at room temperature. 30-40 min prior to hybridisation, blots were incubated at 55◦C in ULTRAhyb Hybridiza- tion Buffer (Ambion) with gentle rotation. Radioactive probes were generated with the Ready-To-Go kit (Amersham) according to the manufacturer’s protocol. Excessive [α– 32P] dCTP Nucleotides were removed with the QIAquick Nucleotide Removal kit. The denatured probe was added to the Hybridisation solution at a concentration of 106 cpm/ml and incubated at 42◦C over night. The following day, blots were washed twice for 10 min with wash bufferI (2 x SSC; 0.1% SDS; RT) and twice for 15 min with wash bufferII (0.1 x SSC; 0.1% SDS; 42◦C); afterwards an X-ray film was exposed to the blot for 1-3 days.

2.2.6 Isolation of total RNA

Isolation of total RNA from mammalian cells was carried out with the RNeasy kit from Qiagen. For one preparation 106 to 2 x 107 cells were used. Qualtity and quantity of isolated RNA was assessed by photometry (ratio 260 nm/280 nm) and gel electrophoresis.

2.2.7 Reverse transcription RT–PCR

Total RNA isolated from mammalian cells was used as template for RT–PCR to generate cDNA. 1 ng to 5 µg of RNA were incubated with 1 µl oligo(dT) primer in the presence of 0.4 µl 25 mM dNTPs for 5 min at 65◦C in 13 µl total volume. Samples were kept on ice and 4 µl 10 x Reaction Buﬀer and 2 µl DTT (0.1 M) were added. After preincubation at 42◦C for 2 min, 1 µl SuperScript II reverse transcriptase was added to each tube and the reaction was carried out at 42◦C for 50min, followed by 70◦C for 15min. Obtained cDNA was diluted 1:5 for downstream applications.

2.2.8 Quantitative RT–PCR

Levels of mRNA were determined by quantitative RT-PCR with the Roche Light Cycler PCR System employing the SYBR Green method. The reaction was carried out in 20 µl total volume and contained per sample 1 U Platinum Taq polymerase, 2 µl 10 x Reaction Buﬀer, 4mM MgCl2, 0.4µM of each primer, 0.25mM dNTPs, 0.5xSYBR Green, 0.5 mg/ml BSA, 5% DMSO and 2 µl cDNA or standard-plasmid. 2.2. METHODS 21

Cycling conditions were as follows:

1x 10 min 95◦C 50x 15 sec 95◦C 10 sec annealing 15 sec 72◦C

The annealing temperature was specific for each pair of primers (Eotaxin 1 60◦C; HPRT 63◦C; PBGD 59◦C). Fluorescence was measured after each elongation step. Specificity of the product was verified by a melting curve and by gel electrophoresis. A six point standard curve using 10–fold serial dilutions and a high standard of 104 fg was generated with every run. Data was analyzed with the LightCycler 5.32 software and expression levels were normalized to the housekeeping genes HPRT and PBGD.

2.2.9 Enzyme linked immuno sorbent assay Enzyme linked immuno sorbent assays (ELISAs) were carried out to determine the amount of protein released by cultured cells. ELISAs were used to measure Cytokines (IL-4, IFN- γ, IL-13, IL-5, IL-12p40), Chemokines (Eotaxin 1) or antibodies (IgE). Brieﬂy, 96–well round bottom ELISA plates were coated with the corresponing capture antibody in an appropriate concentration over night at 4◦C. Plates were washed (PBS; 0.05% Tween) and unspeciﬁc binding sites were blocked with 10% FCS or 1% BSA for several hours at RT. Samples and standards were incubated over night at 4◦C. After washing, the biotinylated detection antibody was added at an appropriate concentration for 2 h at RT. The detection antibody was coupled to strepavidin–HRP (20 min, RT) and after another wash step, substrate (TMB) was added. The reaction was stopped by adding 0.5 Vol of 1 N HCl and plates were read at 450 nm on a Dynatech MR5000. Samples were analysed as duplicates and a 9–point standard curve was generated for each measurement.

2.2.10 Generation of a P62 antiserum A New Zealand White (NZW) rabbit (Charles River) was used for gene–gun vaccination. Gene gun ammunition was prepared by cloning the complete ORF of the P62 protein into the BamHI cloning site of the pCI–TPA vector. Endotoxin free plasmid was obtained with the EndoFreeTM Plasmid Maxi Kit (Qiagen). Gold particles carrying the vaccination plasmid were coated on the inside of a polypropylene tube according to manufacturer’s recommendation (Helios gene gun). Brieﬂy, 50 mg gold particles were incubated with 100µl 50mM spermidine solution and 100µl of plasmid DNA (1 µg/µl). With gentle agitation 200 µl 1 M CaCl2 were slowly added, and after 10 min incubation at RT gold particles were washed three times with EtOH. Particles were resuspended in 6 ml EtOH supplemented with 50 µg/µl polyvinylpyrrolidone (PVP) and applied to the polypropylene tube. The tube was cut into 1 cm pieces that were used 22 CHAPTER 2. MATERIALS AND METHODS

as gene gun ammunition. Gold particles were applied intradermally with a pressure of 350–380 psi. Prior to the ﬁrst vaccination, preimmune serum was collected, and the rabbit was then immunized with 6 x 1 µg DNA at a time. The rabbit was bled 8 days after the 3rd and 5th vaccination.

2.2.11 Transfection of cells with calcium–phosphate

6 Adherent cells were transfected by Ca3(PO4)2 precipitation. Brieﬂy, 5 x 10 cells were seeded in a 10 cm Petri dish and after 8 h medium was replaced with 9 ml of fresh, prewarmed medium. 20 µg plasmid DNA were mixed with 48 µl 2.5 M CaCl2 in a total volume of 480µl. This mixture was slowly added to 480µl of 2 x HBS-Buﬀer to precipitate the DNA. After 20 min at RT, 5 µl Chloroquin (100 mM) were added and the solution was applied to the cell culture. Medium was replaced after 8 h and cells were used for downstream applications 48 h after transfection.

2 x HBS-Buﬀer: 50 mM HEPES 280 mM NaCl 1.5 mM Na2HPO4

2.2.12 Western blot Western Blot was used to specifically identify proteins in complex mixtures. The sample mixture was resolved by SDS polyacrylamide gel electrophoresis (SDS-PAGE) [79] and subsequently transfered to a nitrocellulose membrane by electroblotting (2h, 1mA). Un- specific binding sites were blocked with blocking buffer (5% powdered milk in TBST) and membranes were incubated with specific antibodies in blocking buffer over night at 4◦C. The next day membranes were washed with TBST (3 x 15 min; RT) and incubated with peroxidase-coupled (POX) secondary antibody in blocking buffer (1 h, RT). Again membranes were washed with TBST (3 x 15 min) and blots were developed with the ECL-Plus Detection Kit (Amersham). For reprobes, bound antibodies were removed with the Anti- body Stripping Solution from Chemicon.

Transfer-Buﬀer: TBST-Buﬀer: 200 mM Glycin 100 mM NaCl 20 mM Tris HCl pH 8.0 10 mM Tris HCl pH 7.5 20% Methanol 0.005% Tween-20

2.2.13 Immunoprecipitation Proteins and their interaction partners can be concentrated employing the interaction between a speciﬁc antibody and its antigen. The resulting immune-complexes are precipi- 2.2. METHODS 23

tated through interaction with Protein A/G-agarose beads as described by Ausubel and colleagues [4]. Briefly, 5 x 106–2 x 107 cells were harvested and washed twice with PBS. Cells were lysed in 1 ml of RIPA Lysis Buffer supplemented with protease and phosphatase inhibitors for 1 h on ice. Nuclei were precipitated by centrifugation (20 min; 15000 rpm; 4◦C) and the appropriate antibody was added to the cell lysate at a concentration of 5 µg/ml. Samples were incubated over night at 4◦C with gentle rotation. The next day, 30 µl Protein A/G- agarose beads equilibrated in RIPA Wash Buffer were added to each sample and the mixture was incubated for 1 h at 4◦C with gentle rotation. Beads were precipitated by centrifugation and washed four times with 1 ml RIPA Wash Buffer. Samples were boiled for 5 min with 40 µl Laemmli Loading Buffer and resolved on a SDS–Page gel. After Western blotting samples were analysed for the presence of the precipitated protein and its interaction partners, respectively.

RIPA Lysis-Buﬀer: RIPA Wash-Buﬀer: 50 mM Tris HCl pH 7.4 50 mM Tris HCl pH 7.4 150 mM NaCl 150 mM NaCl 2mM EDTA 1mM EDTA 1% Igepal CA-630 0.1% Igepal CA-630 0.25% Sodium desoxycholate 0.25% Sodium desoxycholate

Protease Inhibitors: Phosphatase Inhibitors: 1 µl/ml Aprotinin 1mM PMSF 1 µl/ml Leupeptin 1 mM Na3VO4 1 µl/ml Pepstatin A 1 mM NaF 1 mM sodium-pyrophosphate

2.2.14 Proliferation of cells Proliferation of cells was measured via incorporation of [3H]-thymidine into de novo syn- thesized DNA. Cell lines, that were cultured with growth factors, like TF1 or CTLL–2 were starved without growth factors for 16 h or 8 h, respectively. Cells were seeded on ﬂat–bottom 96–well plates at a density ranging from 5 x 103 to 5 x 105 cells per well. IL-4 (in serial dilutions starting from 20 ng/ml) and other growth factors or inhibitors were added in the appropriate concentrations in a total volume of 200 µl. After 48 h, cells were pulsed with 0.5 µCi/well [3H]-thymidine in 50 µl volume and cells were cultured for another 24 h. Subsequently, cells were transferred to a ﬁlter with a cell-harvester (Berthold) and incorporated radioactivity was measured with a betacounter (Berthold). Samples were analyzed as triplets and data was normalized to maximum stimulation.

2.2.15 Stimulation of macrophages Mice were injected with 2 ml 4% thioglycolate intraperitoneally, and peritoneal exsudate cells (PECs) were harvested on day 4 post injection by rinsing the peritoneum with PBS. 24 CHAPTER 2. MATERIALS AND METHODS

Cells were seeded on 24–well plates at a concentration of 1 x 106/ml and were allowed to adhere for a minumum of 6 h. Cells were washed to remove non–adherent cells; the cells bound to the tissue culture plate were largely macrophages. Macrophages were stimulated with lysate of Borellia burgdorferi (10 µl of a lysate of MOI 10 per well), with IL-1α, IL-1β or with LPS (100 ng/ml). 30min prior to stimulation, cytokines (IL-4 or IL-13) were added in the appropriate concentrations. Supernatants of the stimulated cells were taken after 48 h and analyzed for the production of the proinﬂammatory cytokines IL-12 (IL-12p40), MCP-1, IL-6 and PGE2 by ELISA.

2.2.16 Manipulation of mouse embryonic stem cells Balb/c embryonic stem cells (ES cells) were obtained from Prof. Nitschke (Department of Genetics; University of Erlangen) at passage 14. Cells were kept in 10 cm Petri dishes covered with mitotically inactive primary mouse embryo fibroblasts (MEFs) in a tissue ◦ culture incubator at 37 C with 10% CO2. D–MEM medium was supplemented with 15% FCS tested for ES culture (PAN), and 120 U/ml ESGRO LIF (Chemicon). For propagation, cells were detached with Trypsin (7 min, 37◦C) and seeded 1:3 on new Petri dishes. On day one, 2x107 ES cells were electroporated with 20µg targeting vector DNA (500µF, 250V). Cells were harvested, resuspended in 800µl of PBS and linearized vector DNA was added 10min prior to electroporation. After electroporation cells were kept 10min at RT, and were then transferred to 50 ml fresh medium and seeded on five 10 cm Petri dishes with irradiated feeder cells. After 24 h medium was replaced by fresh medium containing 350 µg/ml Neomycin for positive selection of clones. Medium was changed every day and after 9 to 11 days, clones were picked: Briefly, plates were washed with PBS and clones were mechanically isolated with a P20 pipet set to 10 µl. Cells were transfered to individual wells of a 96–well plate containing trypsin and incubated for 5 min at 37◦C. The reaction was stopped by adding 200 µl fresh medium. Colonies were expanded to 24–well plates and finally to 6–well plates and samples were frozen and used for isolation of genomic DNA to screen clones for homologous recombination. Positive clones were thawn on 6–well plates and propagated to four 10cm plates. Aliquots were frozen for subsequent injection and again DNA was isolated and analyzed by Southern Blotting to confirm successful targeting. ES cells were injected into blastocysts at the Department of Genetics, University Erlangen (Prof. Winkler).

2.2.17 Preparation of mouse embryo fibroblasts Mouse embryo fibroblasts (MEFs) were derived from a strain transgenic for the neomycin- resistance gen (STAT6 KO) or from Balb/c WT and P62 gene-targeted mice, respectively. Female mice were sacrificed on d12–14 postcoitus and the uterine horns were dissected out. Embryos were isolated, decapitated and eviscerated. The material was placed in a fresh Petri dish containing 1 ml trypsin per embryo and was cut into pieces and subesquently incubated for 5 min at 37◦C. 20 ml medium was added and the suspension was passed through a sterile needle with a diameter of 0,9 mm. Volume was adjusted to 10ml per 2.2. METHODS 25

dissected embryo and aliquots of 10 ml were seeded per tissue culture dish. The next day, medium was removed and plates were washed several times with PBS. Cells were cultivated to 80% conﬂuency and subsequently split 1:3 to expand the culture. MEFs were frozen as backups (2 vials/plate) or irradiated (2000 Rad) for immediate use.

2.2.18 Class switching of splenic B cells A single cell suspension of splenic cells was obtained by passing spleens through a cell TM strainer (BD Falcon ). Lysis of erythrocytes was achieved by incubation with NH4Cl (5 min, 37◦C). Afterwards cells were enriched for B cells by depletion of cells positive for CD3, CD11b, Gr1, NK DX-5 and TER-119 with the magnetic labeling and separation protocol (BD Biosciences) according to manufacturer’s recommendation. Briefly, cells were treated with Mouse Fc BlockTM on ice for 15 min and subsequently labeled with biotinylated antibodies specific for the surface markers mentioned above (15 min, 4◦C; PBS, 0.5% BSA, 2mM EDTA, 0.1% sodium azide). Cells were washed and incubated with 150 µl of BDTM IMag Streptavidin Particles Plus per spleen on ice for 30 min. Samples were adjusted to a volume of to 2 ml with PBS, 0.5% BSA, 2 mM EDTA, 0.1% sodium azide and placed on the BD IMagnet for 6 min. The procedure was repeated twice and unbound cells were collected as the enriched fraction. Purity of enriched cells was assessed by FACS staining plotting CD3+ versus B220+ cells. Generally, a purity greater than 90% B220+ cells was obtained. For class switching of splenic B cells towards IgE production, 5x105 cells per well (24–well plate, culture volume 1 ml) were cultured either with medium alone, or in the presence of 5% α–CD40–antibody (hybridoma supernatant; generous gift from Prof. Winkler, Depart- ment of Genetics, University Erlangen) in the absence or presence of 20 ng/ml recombinant IL-4. Supernatants were collected on days 3, 5, 7 and 9 for ELISAs. On the same days cells were analyzed for viability by trypan blue exclusion and stained for the activation markers CD23 and MHCII. Additionally, total RNA was isolated on days 2 and 4 for detection of switch transcripts after RT–PCR. Germ line transcripts were amplified with primers IeF and CeR; post switch transcripts were amplified with primers ImF and CeR.

2.2.19 TH2 differentiation of na¨ıve T cells Single cell suspensions were obtained from spleens, erythrocytes were removed and cells were enriched for na¨ıve T cells (CD4, CD62L double positive) either by magnetic labeling (BD Biosciences) or by cell sorting with the MoFlo cell sorter (Nikolaus Fiebiger Center, Erlangen). Purity of cells ranged from 90% (magnetic sorting) to 98% (MoFlo). For differentiation experiments 106 cells per ml of culture medium were used per well of a 24–well cell culture plate coated with 5 µg/ml α–CD3 antibody and 5 µg/ml α–CD28 antibody in coating buffer (1 h; 37◦C; 50 mM Tris HCl pH 9.5). Cells were stimulated to drive development either towards TH1 (2 µg/ml α-IL-4 (11B11); 1 ng/ml IL-12) or towards TH2 (10 µg/ml α-IFN-γ (XMG-1); 100 ng/ml IL-4). After 4 days cells were washed to remove stimuli and expanded for 2 days with 5 ng/ml IL-2. Subsequently, cells were seeded at a concentration of 106 per ml and restimulated for 24h either with medium, α–CD3 (5 µg/ml platebound) or PMA/IONO (50 ng/ml and 750 ng/ml). Supernatants 26 CHAPTER 2. MATERIALS AND METHODS

were analyzed by ELISA for the production of IFN-γ as key cytokine of TH1 diﬀerentiated cells and for the production of IL-4, IL-13 and IL-5 as typical TH2 cytokines.

2.2.20 Infection with Leishmania major Mice were infected with the Leishmania major strain MHOM/IL/81/FEBNI. The parasite was maintained in culture by 10–15 passages of promastigotes cultured in vitro on rabbit- blood-agar plates, followed by in vivo culture in infected Balb/c mice as described [131]. For infection experiments, Leishmania were harvested and washed several times with PBS. 2 x 106 promastigotes were injected in the right hind foot pad of mice. Foot pad swelling was measured over a period of three weeks and the ratio of foot pad thickness of infected vs. uninfected pad was plotted against time.

2.2.21 Oral glucose tolerance of mice Glucose tolerance tests were performed with age-matched female mice fasted for 12 h. Mice were injected with 2 mg/g glucose intraperitoneally at time point 0. Tail blood was collected at time points -30, 30, 60, 120 and 180 min, and blood glucose concentration was determined with a FreeStyleTM bloodsugar measuring system (Disetronic Medical Systems, Sulzbach).

2.2.22 OVA induced allergic lung disease Mice were immunized intraperitoneally with 200 µg chicken egg ovalbumin (OVA) on days 1, 14 and 20. Starting six days after the last injection, lightly anesthetized mice recieved two intranasal administrations of 100 µg OVA twice a day for four subsequent days. Mice were sacrificed 18 h after the last challenge, and lungs were lavaged three times with 1 ml of HBSS containing 10 mM Na–EDTA and 10 mM HEPES. Bronchoalveolar lavage fluid (BALF) was collected for analysis of cytokines, cell numbers were determined and cells were differentially counted after cytospin and hematoxylin/eosin staining. Chapter 3

Results

3.1 Studies in cell culture

For proliferation studies the human myeloid progenitor cell line TF1 was used, that was stably transfected with either the murine WT IL-4R or the murine ∆N388 IL-4R. These cells proliferate upon mu-IL-4 stimulation even if both STAT6 and IRS2 remain unphos- phorylated, which is the case in cells that carry the truncated receptor [144]. To further elucidate the mechanism responsible for this STAT6 and IRS2 independent proliferation, the respective contribution of the PI3 Kinase/Akt pathway and the MAP kinase pathway was investigated.

3.1.1 Phosphorylation of signaling intermediates Proliferation in response to cytokines can be mediated by two distinct pathways: either the PI3 Kinase/Akt pathway or the MAP kinase pathway (see ﬁgure 3.1). Transfected TF1 cells were stimulated with IL-4 for 0, 10 or 20 min and cell lysates were assessed for phosphorylation of signaling intermediates involved in these two pathways. No phosphorylation of the Akt kinase was detectable, as might have been expected from the lack of IRS2 phosphorylation, because IRS2 acts upstream of the PI3 Kinase in IL- 4R signaling. On the other hand, both ERK1/2 and p90RSK, two signaling molecules of the MAP kinase pathway, were readily phosphorylated after IL-4 stimulation. This observation holds true for both cell lines carrying either the WT or the ∆N388 IL-4R, indicating that proliferation in TF1 cells is mediated preferentially via the MAP Kinase pathway.

3.1.2 Effect of kinase inhibitors To further clarify the contribution of the different pathways, TF1 cells carrying either the WT or the ∆N388 IL-4R were stimulated with IL-4 in the presence of various kinase inhibitors. 3T3 cells were used as a toxicicity control as these cells proliferate in the absence of growth factor signaling [147] (data not shown). Both U0126 and PD98059, two inhibitors of the MAP kinase kinase MEK, abrogated IL-4 induced proliferation in TF1 cells at low concentrations (see figure 3.2). At inhibitor

27 28 CHAPTER 3. RESULTS

Figure 3.1: Proliferation signals initiated by cytokines are mediated via two distinct pathways. (A) Schematic representation of the PI3 kinase/Akt pathway and the MAP kinase pathway addressed by various growth factors (adapted from Cell Signaling Technology). Inibitors and their targets are indicated in red. (B) Phosphorylation pattern of signaling intermediates. TF1 ∆N388 cells were stimulated with 20 ng/ml mu-IL-4 for 0, 10, or 20 min after which whole cell lysates were prepared and probed for phosphorylation of Akt, S6 ribosomal protein, ERK1/2 and p90 RSK.

concentrations of 2 µM and 1.5 µM, respectively, only 50% of the maximun proliferation was observed for both cell lines, thereby indicating that the MAP kinase pathway is involved in mediating proliferation signals. Rapamycin, an inhibitor of the P70S6 kinase by means of binding to mTOR, exerted no inﬂuence on TF1 proliferation at concentrations of up to 400 nM, which was markedly higher than reported IC50 values of 50 pM [22]. Two other inhibitors of the PI3 Ki- nase/Akt pathway, namely PI3 Kinase inhibitors LY294002 and Wortmannin were tested in the TF1 system. 62 nM Wortmannin reduced TF1 proliferation by only 12% although the IC50 for this substance has been reported to range between 2 and 4nM [3]. LY294002 led to impaired TF1 proliferation with an IC50 of about 2.5 µM and almost no proliferation at 20 µM, which is in good agreement with data reported in the literature (IC50 = 1.4 µMol [151]). 3.1. STUDIES IN CELL CULTURE 29

Figure 3.2: Proliferation of TF1 ∆N388 IL-4R cells in the presence of kinase inhibitors. (A) U0126, (B) PD98059, (C) Rapamycin, (D) Wortmannin, (E) LY294002 and (F) PKCζ pseudosubstrate. Cells were starved without growth factors for 24 h and were subsequently stimulated with 20 ng/ml recombinant mu-IL-4. Kinase inhibitors were added 30 min prior to stimulation. After 48 h of stimulation, cells were pulsed with [3H]-thymidine for 20 h and incorporation of radioactivity was measured in a beta counter. Data are expressed as % maximum stimulation (in the absence of inhibitors) and are represenative for at least three independent experiments.

As we observed proliferation to be mediated predominantly by the MAP-kinase pathway, we hypothesized that P62 and PKCζ might be involved in the signal transduction (see chapter 1). Therefore, we inhibited PKCζ functionality with a speciﬁc pseudosubstrate in TF1 proliferation studies. A concentration of 20 µM PKCζ inhibitor reduced IL-4 induced proliferation by approximately 50%, which indicated the involvement of PKCζ in TF1 proliferation. With all inhibitors tested, no diﬀerence was observed between cells carrying the WT IL- 4R or the ∆N388 IL-4R, indicating that proliferation in TF1 cells is only to a small extent dependent on the IRS2-triggered PI3 Kinase pathway. 30 CHAPTER 3. RESULTS

3.2 Involvement of P62 in IL-4R signaling

One aim of this thesis was to confirm the involvement of the P62 protein in an alternative IL-4R signal transduction pathway (see chapter 1.3), and to evaluate its relative importance both in vitro and in vivo. To achieve this goal, the interaction of the two proteins had to be confirmed by independent techniques. Subsequently, a P62 gene deficient mouse, generated in the laboratory of Prof. Gessner, was analysed on genomic level and was characterized in steady state as well as in immunological settings.

3.2.1 Binding of P62 to the IL-4R

It has been mentioned in section 1.1 that P62 has been identiﬁed as a novel interaction partner of the IL-4R in a Yeast-Two-Hybrid screen. To verify this result, several independent techniques were applied.

3.2.1.1 Colocalization of P62-EGFP and IL-4R-RFP

As a first approach, the two putative binding partners were overexpressed as fusion proteins with green fluorescent protein (GFP) or red fluorescent protein (RFP), respectively. For this purpose, the complete open reading frame (ORF) of P62 was cloned into the BamHI site of the expression vector pEGFP-N1, whereas the cDNA coding for the ∆388 IL-4R was inserted into the BglII site of the pDsRed1-N1 plasmid. 20 ng of each plasmid were transiently transfected into HEK293T cells by calcium phosphate precipitation and cells were analyzed after 48 h by confocal laser microscopy. Both overexpressed proteins resided in the cytoplasm near the cell membrane and colocalization of the two proteins was detected as yellow fluorescence in the overlay (see figure 3.3 A).

3.2.1.2 Co-Immunoprecipitation of P62 with the IL-4R

As a second approach the interaction of the binding partners was shown by immunoprecipitation. Again, both proteins were overexpressed in HEK293T cells, cells were gently lysed 48 h after transfection and the IL-4R was precipitated with a specific antibody coupled to protein A/G-agarose. The isolated protein complex was loaded on a polyacrylamide-gel and was analyzed for the presence of P62 by Western blotting. In initial experiments P62 was expressed as a tagged protein with either an N-terminal Flag-tag (pFlag-CMV-2) or a C-terminal His-tag (pcDNA3.1/myc-His). The P62 protein bound to the WT IL-4R as well as to the ∆388 IL-4R, thereby confirming the previous observation of the Yeast-Two-Hybrid experiment (see figure 3.3 B). Furthermore, interaction of the binding partners was shown in a more physiological setting without overexpression of P62: TF1 cells, that were stably transfected with IL-4R constructs, were utilized in a coimmunoprecipitation experiment as described above. En- dogenous P62 was proven to bind to the receptor even in the absence of IL-4 stimulation (see figure 3.3 C). 3.2. INVOLVEMENT OF P62 IN IL-4R SIGNALING 31

Figure 3.3: Binding of P62 to the IL-4R. (A) HEK293T cells transfected with plasmids encoding the fusion proteins P62-GFP and ∆388 IL-4R-RFP. Confocal imaging 48h after transfection. (B) and (D) Immunoprecipitation of P62 with an α-IL-4R specific antibody. HEK293T cells were transfected with plasmids coding for IL-4R variants and tagged P62. Whole cell lysates were prepared after 48 h and incubated with an IL-4R specific antibody coupled to agarose beads. (B) Transfection with IL-4R variants and P62-Flag. Precipitates were analyzed for the presence of P62 with an α-Flag antibody after Western Blotting. (D) Trimolecular Immunoprecipitation. Cells were transfected with plasmids encoding IL-4R, P62-His and PKCζ-Flag. Precipitates were probed with antibodies specific for IL-4R, His-Tag and Flag-tag. (C) Cell lysates of TF1 cells stably transfected with either WT IL-4R or ∆388 IL-4R were incubated with an IL-4R specific antiboby. Precipitates were probed for the presence of the endogenous P62.

3.2.1.3 Trimolecular Co-Immunoprecipitation Finally, we conducted a trimolecular immunoprecipitation to identify possible downstream binding partners of P62. The atypical protein kinase C isoform PKCζ is described as a binding partner of P62, which is also known as ZIP (PKCZeta Interacting Protein) [57, 123, 157]. In several signaling pathways, e.g. the NGF or TNFα pathway, P62 acts as a scaﬀold protein linking receptor signals to NFκB via the atypical PKCs [40]. In addition to this, a recent publication by Moscat et al. connected IL-4R function to PKCζ for the ﬁrst time [33]. Based on these data we hypothesized that P62 might function 32 CHAPTER 3. RESULTS

as an adaptor protein directly linking the IL-4R to downstream events mediated by this atypical PKC. To test this hypothesis, HEK293T cells were transiently transfected with expression constructs coding for the IL-4R, His-tagged P62 and FLAG-tagged PKCζ. Cells were lysed 48 h after transfection and the immunoprecipitation was carried out. The precipitates were analysed by Western Blotting with specific antibodies (see figure 3.3 D). In independent experiments binding of P62 to the WT IL-4R even in the absence of IL-4 stimulation was confirmed. PKCζ was also detected in this complex, thereby supporting our hypothesis. However, PKCζ was also found in association with the IL-4R in samples that were not transfected with the P62 construct, arguing for a possible role of endogenous P62.

3.2.2 Description of the P62 gene deﬁcient mouse model

A P62 gene-deficient mouse model was established in the laboratory of Prof. Gessner. For this purpose, the coding exons two, three and four of the P62 gene located on chromosome 11 were replaced by a neomycin resistance cassette in 129/SV ES cells (unpublished data of Gessner). Clones growing under positive/negative selection were subjected to Southern blotting and clones that underwent homologous recombination were injected into blastocysts. The transgene showed successful germline transmission; resulting heterozygous mice were mated to yield homozygous offspring. As the genetic alteration affected only a part of the P62 gene and did not knock out the entire locus, it was necessary to assess the degree of alteration both on genomic and on protein level.

3.2.2.1 P62 deﬁciency on genomic level

Although the genetic alteration introduced into ES cells has been analyzed by Southern blotting prior to blastocyst injection, the genotypes of the resulting P62 gene-deficient mice and their littermates were confirmed in a Southern blot experiment. Genomic DNA was isolated from livers of the respective mice by phenol/chloroform extraction and 20 µg of each sample were digested with HindIII. Samples were resolved by agarose gel electrophoresis and blots were incubated with a radioactive probe located in exon 1 beyond the short arm of homology (see figure 3.4). Samples showed the expected bands of 6.8 kb for the WT allele and 5.2 kb for the gene-targeted allele, thereby confirming the successful genetic alteration. From this experiment it cannot be concluded whether the neomycin cassette is still present in the gene-targeted configuration, as the newly introduced HindIII site lies upstream of the loxP site that acts as recognition sequence of the Cre recombinase. Deletion of the neomycin resistance cassette was verified by an additional Southern Blot experiment that employed a probe located in the neomycin cassette (data not shown).

3.2.2.2 P62 deﬁciency on transcriptome level

As the ﬁrst exon of the P62 gene is still present in the gene-targeted mice, it was investigated if any transcript from this locus could be detected. For this purpose splenocytes 3.2. INVOLVEMENT OF P62 IN IL-4R SIGNALING 33

Figure 3.4: Southern blot of P62 gene-targeted mice. (A) Genomic organization of the P62 locus. The targeting vector replaces exons two to four with a neomycin resistance cassette. (B) Southern blot with genomic DNA isolated from ES cells or livers of mice. The 5′ probe is located in exon 1 (closed bar in (A) and recognizes a 6.8 kb fragment in the WT or a 5.2 kb fragment in the gene-targeted conﬁguration.

isolated from P62 gene-targeted mice were stimulated for 24h with ConA, after which total RNA was isolated and transcribed into cDNA using oligo(dT) primers. The obtained cDNA was used as template in a PCR reaction amplifying the P62 core sequence with primers ﬂanking the knocked out exons. Both from WT and from knock out cDNAs a product was ampliﬁed that was subsequently sequenced. Sequencing provided additional evidence for the genomic alteration and showed that an internal deletion of bases 205 to 753 occured in mRNA. Since the deleted region covered a multitude of three bases, a truncated mRNA resulted without changing the reading frame, thereby making the existence of a residual protein theoretically possible. 34 CHAPTER 3. RESULTS

Figure 3.5: Shematic view of P62 domain organisation (adapted from Wooten et al. [40]). The amino acids missing in the hypothetical gene-targeted protein (69 to 251) are indicated by a closed box.

3.2.2.3 P62 deficiency on protein level For the reasons stated above, it was necessary to analyze the P62 gene-targeted mice on protein level for the existence of a truncated protein generated from the manipulated locus. Any residual truncated protein was expected to be non-functional based on literature data. If the P62 protein mediates its effects via binding to PKCζ, an intact binding site for this downstream partner will be a prerequisite for its functionality. This binding site has been mapped by several groups to the region comprising the acidic interaction domain (AID-domain; see figure 3.5) [114, 157, 159]. The truncated protein derived from the gene-targeted mRNA lacks this binding site (amino acids 69 to 251), and subsequently the protein will no longer be able to recruit the atypical protein kinase Cζ. Moreover, nonphysiological mRNA might have a short half-life and might be rapidly degraded by

Figure 3.6: Immunoprecipitation of PKCζ. HEK293T cells were transfected with plasmids coding for PKCζ-Flag and P62-His, either WT or the truncated protein hypothetically generated from the gene-targeted configuration. Whole cell lysates were prepared after 48 h and incubated with a Flag-specific antiboby coupled to agarose beads. Precipitates were analyzed for the presence of P62 with an antibody specific for the His-tag and were reprobed for the presence of PKCζ. 3.2. INVOLVEMENT OF P62 IN IL-4R SIGNALING 35

the cell machinery, or the deletion in the protein could interfere with its folding. Still, we performed immunoprecipitation studies in HEK293T cells, which overexpressed the truncated P62 and PKCζ in order to confirm the theoretical inability of the truncated P62 protein to recruit PKCζ. After immunoprecipitation of PKCζ, WT P62 was readily detectable in the precipitates, whereas the truncated P62 protein was not able to bind to the kinase (see figure 3.6), as would have been expected from literature data. Additionally, we investigated protein expression in a Western blot experiment. As no specific antibody against P62 existed, we immunized a rabbit with the complete P62 ORF cloned into the BamHI site of the pCI–TPA DNA vaccination vector. After five rounds of DNA vaccination the antiserum recognized overexpressed P62 (both WT and the theoretically existing deleted protein variant) in lysates from transfected cells, but in organ lysates of both WT or P62 gene-targeted animals no specific band was detectable (data not shown). Due to these constrictions, we cannot rule out the possibility of a residual P62 protein being present in the gene-targeted mice, but if such a protein existed, it would not be able to recruit PKCζ.

3.2.3 Steady state phenotype of P62 gene-targeted mice

The newly established P62 gene-targeted mouse line was first characterized in steady state. Mice appeared and behaved normal, were fully fertile and viable and were born in expected Mendeleian ratios. As these mice were to be further used in immunological experiments, we carefully investigated their hematopoietic compartments with regard to their specific relative compositions as well as absolute numbers of cells. Dendritic cells were analyzed for the specific marker CD11c and the activation markers MHC II, CD80 and CD86. Mast cells were characterized by expression of c-Kit, CCR3 and GR-1. Additionally, macrophages present in peritoneal exsudat cells (PECs) were stained with CD11b, Gr-1 and CD19 and after activation also with MHC II, CD80 and CD86. In all these compartments, there were no differences detectable between littermates of WT, P62 gene-targeted or heterozygous genotype (data not shown). IL-4 is an important cytokine for the function of lymphocytes, exerting non-redundant effects on both T– and B–cells. Also, P62 has been described as an apaptor protein involved in signaling of the T cell receptor [107]. Therefore, we also examined cells isolated from thymus, spleen or bone marrow for their lymphocyte composition. Again, littermates of WT, P62 gene-deficient and heterozygous genotype were used and isolated cells were stained for B– and T–cell markers (see figure 3.7). In the thymus all mice displayed mostly double positive T cells with little amounts of single positives, mostly CD4 positives. As anticipated, bone marrow contained approximately 80% B cells staining for B220 and 10% Ter119 positive erythroid cells. In spleens, the ratio of B– vs. T–cells and CD4 vs. CD8 positive cells was normal. Taken together, P62 knock out mice showed no hematopoietic abnormalities in all compartments analyzed. 36 CHAPTER 3. RESULTS

Figure 3.7: FACS analysis of lymphoid compartments. Single cell suspensions of cells isolated from lymphoid compartments of P62 gene-deﬁcient or WT mice were analyzed for their surface expression of hematopoietic markers. (A) Thymocytes were analyzed for expression of CD4 and CD8. (B) Cells isolated from bone marrow were analyzed for B220 and Ter119. (C) Spleen cells were stained for CD4, CD8 and B220. All plots represent one individual sample and are representative for at least ﬁve animals analyzed.

3.2.4 Immunological phenotypes of P62 gene-targeted mice For all following experiments, in which P62 gene-targeted mice were analyzed in immunological settings, a deﬁned genetic background was a strict prerequisite. To shorten the necessary time for backcrossing, a speed congenic approach was followed as previously described by Longmate et al. [152]. In each generation of backcrossing, males were analyzed for their content of target–strain and donor–strain DNA by PCR reactios with alltogether 62 primer pairs distributed over the whole genome. After six generations all markers displayed Balb/c conﬁguration, so backcrossing was continued in the classical way. Mice used for experiments were minumum F6 speed congenic and in later experiments F10. After backcrossing, the P62 gene-targeted mice were analyzed for IL-4 mediated phenotypes.

3.2.4.1 Oral glucose tolerance The IL-4R and the insuline receptor share a motif of striking sequence homology, namely the I4R (insuline/IL-4R) motif comprising amino acids P466 to D480, that is also present in insuline like growth factor-1 receptor (IGF-1R) [49, 71]. This sequence homology alone already suggests similarities in signal transduction pathways. Additionally, a publication by Burnol et al. [17] directly linked the P62 protein to insulin signaling by showing that 3.2. INVOLVEMENT OF P62 IN IL-4R SIGNALING 37

Figure 3.8: Glucose tolerance of P62 gene-targeted mice. Female mice, either WT, gene- deﬁcient or HZ for P62 were fasted overnight and challenged with 2 mg/g glucose solved in PBS by i.p. injection. Blood glucose levels were monitored over a period of 2h. Data are expressed as mean ± SEM (n=3).

Grb14, a negative regulator of insulin signaling, forms a ternary complex with P62 and PKCζ. This complex formation results in phosphorylation of Grb14 by PKCζ, which is increased upon insulin stimulation; the phosphorylated Grb14 displays elevated inhibition of insuline receptor tyrosine kinase activity. Taken together, a negative feedback loop in insuline receptor signaling was shown to signal via P62. Based on these observations, P62 gene-targeted mice and their littermates were analyzed in a glucose tolerance test. Mice were fasted overnight and blood glucose levels were determined prior to injection with 2 mg/g glucose i.p. Blood glucose levels were determined at time points 30, 60, 120 and 180 min (see ﬁgure 3.8). All goups of mice showed a similar trend of glucose levels over time, starting with 100 to 150 mg/dl glucose prior to challenge, reaching peak levels approximately after 30 min, and declining to starting levels by 180 min.

3.2.4.2 Functionality of macrophages Macrophages are important mediators of inflammatory processes through release of proinflammatory cytokines TNFα, IL-1, PGE2 or IL-12 [66]. Upon stimulation with LPS or Borrelia burgdorferi, peritoneal exsudate cells (PECs), that mainly consist of macrophages, release these cytokines that can be measured in cell culture supernatants by ELISA. IL-4, and to a lesser extent IL-13, are able to suppress this proinflammatory cytokine milieu when added 30 min prior to stimulation [50, 53]. Based on these data the question arose, if macrophages from P62 gene-targeted mice are still able to transduce these antiinflammatory IL-4 signals. To address this, PECs were isolated from P62 gene-deficient and WT mice as well as IL-4R KO mice and were stimulated in vitro with LPS or B. burgdorferi-lysate. Supernatants were taken after 48h 38 CHAPTER 3. RESULTS

Figure 3.9: Cytokine release by stimulated macrophages. PECs were isolated from P62 gene- targeted, Balb/c WT and IL-4R KO mice on d 4 after thioglycolate injection and were enriched for macrophages. Cells were stimulated with 100 ng/ml LPS or 10 µl B. burgdorferi-lysate (MOI=10, Bb). 30 min prior to stimulation 20 ng/ml recombinant IL-4 was added to test its antiinﬂammatory potential on IL-12p40 release. Supernatants were taken after 48h and analyzed by ELISA. Data are expressed as percent of maximum stimulation and are representative of three independent experiments.

and were analyzed for the presence of the proinflammatory cytokine IL-12 (see figure 3.9). All groups of mice showed a strong increase in IL-12 release after stimulation with both LPS and B. burgdorferi-lysate with absolute levels of IL-12 of about 1500 pg/ml. Addition of 20 ng/ml recombinant IL-4 prior to stimulation reduced the proinflammatory response by approximately 75% in both WT and P62 gene-targeted samples, whereas IL-4R KO cells exhibited no change in secreted IL-12 levels. Similar results were obtained for the measurement of monocyte chemoattractant protein-1 (MCP-1), another proinflammatory cytokine produced by macrophages (data not shown).

3.2.4.3 Class switching of splenic B cells in vitro IgE class switching of murine B cells is known to be mediated exclusively by IL-4 stimulation [23] and requires transcriptional activation of the Cǫ locus which manifests itself in sterile heavy chain transcripts [42]. Additionally, B cells of IL-4 knock out mice [78] and IL-4R knock out mice [102] show severely reduced IgE secretion as compared to WT, thereby confirming the necessity of IL-4 signals for this important lymphocyte function. Based upon these data, we examined P62 gene-targeted mice for their ability to undergo IgE class switching. Firstly, upregulation of the activation markers MHC II and CD23 on B cells was analyzed by FACS, secondly the generation of sterile germline Ig transcripts [73] was verified, and thirdly the generation of IgE antibodies was directly measured by ELISA at several timepoints after stimulation. As anticipated, IL-4R knock out mice were not able to undergo IgE class switching upon stimulation with αCD40 and IL-4 or LPS and IL-4, whereas WT mice showed the published phenotype (see figure 3.10). P62 gene-targeted mice behaved like WT, being activated upon IL-4 stimulation and secreting comparable amounts of IgE with the same kinetics as WT mice. 3.2. INVOLVEMENT OF P62 IN IL-4R SIGNALING 39

Figure 3.10: Class switching of splenic B cells towards IgE in vitro. Spleenocytes were isolated from P62 gene-targeted and WT mice and were enriched for B cells. Cells were stimulated with αCD40 and 20 ng/ml IL-4 to induce class switching towards IgE. (A) On day 4 cells were surface-stained for activation markers MHC II and CD23 in FACS analysis. Data are depicted as overlay of the ﬂuorescence of αCD40 stimulated cells (grey areas) vs. αCD40 plus IL-4 stimulated cells (white areas) and are representative for three individual mice. (B) PCR for germ line transcripts (GLTs) and post switch transcripts (PST). RNA was isolated from αCD40 + IL-4 stimulated cells on d 2 and d 4 and was transcribed into cDNA with oligo-(dT) primer. cDNA from WT and P62 gene-targeted mice was analyzed for the presence of GLTs at d 2 and CTs at d 4, respectively. (C) Supernatants from stimulated cultures were collected on days 3, 5, 7 and 9 and were analysed by ELISA for production of IgE antibodies. Data are expressed as mean ± SEM (n≥3).

We also detected no diﬀerences in the capacity of B cells to proliferate upon IL-4 stimulation comparing P62 KO and WT mice (data not shown), so the lack of the P62 protein does not aﬀect these B cells functions induced by IL-4.

3.2.4.4 Differentiation of na¨ıve T cells in vitro CD4 positive T helper cells can be classified into two groups, namely TH1 and TH2 cells based on their pattern of cytokine secretion [100]. Na¨ıve T cells defined as CD4+, CD62L+ can differentiate into either of these two subsets, depending on the cytokine milieu present during antigen stimulation [1, 128]. TH2 differentiation takes place in the presence of IL- 4 and is characterized by secretion of IL-4, IL-5 and IL-13. Since intact IL-4R signal transduction is required for the efficient development of TH2 cells, P62 knock out mice were analyzed for their capacity to develop this phenotype. 40 CHAPTER 3. RESULTS

Figure 3.11: Cytokine production by in vitro diﬀerentiated T cells. Slenocytes of P62 gene- targeted or WT mice were enriched for CD4+, CD62L+ double positive na¨ıve T cells and were diﬀerentiated either towards TH1 (IL-12 plus αIL-4) or TH2 phenotype (IL-4 plus αIFN-γ). Cells were restimulated with medium (C=Control), αCD3 (CD3) or PMA/IONO (P/I) for 24h, after which supernatants were analyzed by ELISA for cytokine production. (A) IL-4 secretion, (B) IL-5 secretion, (C) IL-13 secretion, or (D) IFN-γ secretion. Data are representative of three independent experiments.

Na¨ıve CD4+ T cells were isolated by FACS from spleens of P62 gene-targeted mice and WT littermates and were differentiated in vitro into TH1 or TH2 cells, respectively. After 72 h of stimulation, cells were rested for 48 h and restimulated with either PMA/IONO or αCD3 for 24h. Secreted cytokines were analyzed by ELISA, with IFN-γ being considered the major TH1 cytokine and IL-4, IL-5 and IL-13 being TH2 cytokines. Cells of both WT and P62 gene-deficient mice displayed a robust IFN-γ secretion of up to 20 ng/ml by TH1 differentiated cells, whereas TH2 differentiated cells showed a residual level of up to 2 ng/ml (see figure 3.11). The TH2 cytokines IL-4 and IL-13 were not detectable in supernatants of TH1 differentiated cells and averaged 4000 pg/ml and 1500 ng/ml in supernatants of TH2 differentiated cells; IL-5 was detectable in minor concentrations of up to 100 pg/ml in supernatants of both TH1 and TH2 differentiated cells. Taken together, both WT and P62 gene-deficient T cells showed secretion of the expected key cytokines for either TH1 or TH2 differentiated cells. In this setting of in vitro differentiation, no difference was detectable between P62 gene-targeted or WT mice, indicating that P62 is dispensable for this IL-4 function. 3.2. INVOLVEMENT OF P62 IN IL-4R SIGNALING 41

3.2.4.5 Infection with Leishmania major Experimental leishmaniasis is a well established in vivo model in which the generation of a TH2 immune response is fatal for the host organism. The parasites (Leishmania major) reside intracellularly in macrophages and can be controlled by a cellular immune response employing CD4+ T helper cells. In this setting protection is mediated by a TH1 type response, where IFN-γ activates macrophages to produce reactive oxygen- and nitrogen- intermediates like the inducible nitric oxide synthetase (INOS) that acts leishmanicide. On the contrary, generation of a TH2 immune response results in the production of cytokines such as IL-4, IL-6 and IL-10, inhibiting the activation of macrophages and rendering the host unable to control the infection [9, 55, 86]. We infected P62 gene-targeted and WT mice on a susceptible Balb/c genetic backgound with L. major promastigotes in the right hind foot pad and monitored footpad swelling over time (see figure 3.12 A). Both groups of mice exhibited footpad swelling starting on d 14 and getting worse until mice were sacrificed on d34 as a regression in the inflammatory response no longer seemed likely. P62 gene-deficient mice showed no resistance towards this infection, thereby indicating that the development of a TH2 immune response was also possible in this in vivo experiment, supporting the data from the in vitro differentiation studies. Additionally, the parasite burden in the infected foot, the draining lymph node and the spleen was monitored (data not shown), and the immune response was characterized by measuring immunoglobulin levels in sera of infected mice. Levels of IgE, which correlate with the failure to control the infection, are shown in figure 3.12 B. Again, no difference

Figure 3.12: Infection of mice with Leishmania major. P62 gene-targeted and WT mice on a susceptible Balb/c background were immunized on d 0 with 2 x 106 promastigotes in the right hind foot pad. (A) Footpad swelling was monitored over time and is expressed as ratio of footpad thickness of the infected foot vs. the uninfected foot. Data are expressed as mean ± SEM (n=5). (B) Serum levels of IgE 27 d after infection. Data are expressed as mean ± SEM (n=5) 42 CHAPTER 3. RESULTS

was detected between P62 gene-targeted and WT mice, supporting the observation that P62 protein is not required for mounting an immune response against Leishmania or is at least redundant in this setting.

3.2.4.6 Fibroblast functionality In the human sytem, IL-4 is described to be involved in eotaxin secretion by fibroblasts, which is of importance in atopic diseases and asthma [94, 96]. A recent publication by Moscat et al. [32] connected the upregulation of eotaxin in mouse embryonal fibroblasts (MEFs) upon IL-4 stimulation with the atypical protein kinase C, which prompted us to analyze P62 gene-deficient mice for this IL-4 phenotype. Short term primary cell lines of MEFs were generated from P62 gene-targeted and Balb/c WT mice and were stimulated in vitro with recombinant IL-4. For quantification of eotaxin transcription, total RNA was isolated at time points 12, 24 and 48 h and was subjected to a light cycler PCR for CCL11. Supernatants collected after 24 and 48h were analyzed by ELISA. Quantification of mRNA levels showed a pronounced upregulation of eotaxin in WT MEFs after 48 h, whereas samples from P62 gene-targeted mice exhibited a significantly reduced upregulation of mRNA levels (≥200–fold vs. approximately 20–fold as compared to unstimulated controls; see figure 3.13). Also, direct measurement of the protein levels displayed a high concentration of eotaxin in supernatants of IL-4 stimulated WT fibroblasts (3000 pg/ml), whereas in P62 gene-targeted fibroblasts less than 1000 pg/ml were secreted. This observation supported the observation made on transcriptome level.

Figure 3.13: Upregulation of eotaxin in MEFs upon IL-4 stimulation. MEFs were prepared from three diﬀerent donors for P62 gene-targeted or Balb/c WT mice, respectively. Cells at passage 1 or 2 were stimulated with 20 ng/ml IL-4 or were left unstimulated. (A) Total RNA was prepared after 48h of stimulation and eotaxin1 mRNA levels were determined with normalization to the house keeping gene HPRT. Data are expressed as mean ± SEM (n=6). ∗, p≤0.005 vs WT. (B) Supernatans were collected after 48 h and analyzed by ELISA. Data are expresed as mean ± SEM (n=4). ∗, p≤0.05 vs WT. 3.2. INVOLVEMENT OF P62 IN IL-4R SIGNALING 43

These data indicate a non-redundant role of the P62 protein in the release of eotaxin by primary mouse ﬁbroblasts upon IL-4 stimulation. This observation constitutes the ﬁrst phenotype of P62 gene-targeted mice in response to IL-4, thereby supporting the initial assumption that P62 protein contributes to IL-4R signal transduction in some cell types.

3.2.4.7 OVA induced allergic asthma Based on our observations in vitro (see 3.2.4.6), we assessed eotaxin functionality in P62 gene-targeted mice in vivo. Rothenberg et al. reported that eotaxin is important for early recruitment of eosinophils in a murine model of asthma [118], which was later confirmed by knock out studies in mice deficient for eotaxin or its receptor CCR3 [111]. Therefore we established a model of OVA induced allergic airway disease in our laboratory (in cooperation with the group of PD Dr. A. Pahl, Department of Experimental and Clinical Pharmacology and Toxicology, University of Erlangen) [21]. Mice on a susceptible Balb/c background, either P62 gene-deficient or WT, were sensitized by i.p. administration of 200 µg OVA on days 1, 14 and 20. Mice were challenged by intranasal application of 100 µg OVA in saline on days 26 to 29, two times a day. 18 h after the last challenge, mice were sacrificed, and lungs were rinsed three times with 1 ml HBSS-buffer. Samples were centrifuged, supernatants were collected as broncheoalveolar lavage fluid (BALF) for measurement of cytokines and cells were differentially counted for composition and absolute numbers. Levels of IL-4, IL-5, IL-13 and the chemokine eotaxin1 were determined in BALF of OVA- challenged mice by ELISA, whereat no significant difference was detected between P62 gene-targeted mice and WT controls. Likewise, both absolute numbers of cells recovered from the lungs, and absolute numbers of eosinophils did not differ between groups of mice (see figure 3.14). Taken together, no abnormalities in eosinophil recruitment could be detected in this animal model of late phase eosinophilia.

Figure 3.14: OVA induced allergic airway disease. (A) Absolute eosinophil numbers in the BALF of OVA-challenged mice were determined by diﬀerential cell count after hematoxylin/eosin staining. (B) Levels of IL-4 in BALF were determined by ELISA. Data are expressed as the mean ± SD (n=6) and are representative of two independent experiments. 44 CHAPTER 3. RESULTS

3.3 Generation of a ∆N388 IL-4R mouse model

Cells transfected with a truncated IL-4R that lacks the binding sites for both STAT6 and IRS (∆N388 IL-4R) still proliferate upon stimulation with IL-4 [144]. Based on this observation a mouse model employing the shortest IL-4R functional in proliferation assays, namely the truncated ∆N388 IL-4R was generated with the aim to investigate other IL-4 functions apart from proliferation both in vitro and in vivo.

3.3.1 Targeting strategy To obtain a mouse model with a truncated IL-4R, the endogenous locus on chromosome 7 can be manipulated in a way that a deletion mutant will be expressed. This strategy employs the original promotor and regulatory sequences and subsequently should ensure a physiological expression level of the receptor. However, a major drawback of this approach is the autoregulation of IL-4R expression levels through STAT6 mediated IL-4 signals as described by Reich and confirmed by Grusby [69, 76]. Thus, with the endogenous approach it can not be ensured that a truncated IL-4R lacking the STAT6 binding site will be sufficiently expressed. Alternatively, a knock-in of the ∆N388 IL-4R can be created in a defined locus, namely the ROSA26 locus. This locus was originally described by Soriano et al. [161] and ensures a satisfactory expression of the transgene in hematopoietic cells. We employed the ROSA26-STOP plasmid generated by T. Buch (University of Cologne) that consists of the original pROSA26-1 plasmid with a neomycin resistance cassette and a STOP-cassette cloned into the XbaI site between the arms of homology. The ∆N388 IL-4R cDNA was inserted after the STOP-cassette at unique AscI and FseI sites and the vector was linearized for injection of ES cells using KpnI (figure 3.15). The features of the targeting vector allow positive/negative selection of clones and time– or tissue–specific expression of the transgene depending on the expression of the Cre-recombinase.

Figure 3.15: Targeting construct for ∆N388 IL-4R knock in. The neomycin resistance cassette (neo) and the diphteria toxin cassette (DT) allow for positive or negative selection, respectively. cDNA coding for the truncated IL-4R was cloned into AscI and FseI sites after the STOP cassette. 3.3. GENERATION OF A ∆N388 IL-4R MOUSE MODEL 45

3.3.2 Homologous recombination In two independent experiments Balb/c ES cells were transfected with the linearized targeting vector and were incubated on mitotically inactive MEFs in the presence of neomycin for positive selection of clones. Negative selection was achieved by the diphteria toxin (DT) cassette in the targeting construct (see figure 3.15). After 6 to 8 days clones were visible and ready for propagation. Genomic DNA of isolated clones was prepared from 6–well plates and was digested with EcoRI for Southern blotting. Figure 3.16 A shows the fragments expected for the WT and knock-in (KI) configuration of the ROSA26 locus respectively. The radioactive probe employed was located upstream of the 3′ arm of homology as described by Orkin et al. [88]. Approximately one fifth of all clones screened gave two bands of the expected sizes in a Southern blot experiment, thereby indicating successful homologous recombination (figure 3.16 B). Additionally, clones were screened in a FACS experiment after electroporation

Figure 3.16: Screening of ROSA targeted ES cells. (A) Genomic organisation of the ROSA26 locus in WT and targeted conﬁguration. The 5′ probe used to verify the mutant allele is indicated as closed bar. E=EcoRI. (B) Southern blot of ES cells. Genomic DNA was digested with EcoRI and resulting bands were resolved on an agarose gel. The radioactive probe recognized a 15.6 kb fragment (WT) or a 6 kb fragment (knock in). (C) FACS screening of ES cell clones. Cells were electroporated with a Cre expressing plasmid and after 48 h were stained for surface expression of the IL-4R. 46 CHAPTER 3. RESULTS

with a Cre expressing plasmid; after excission of the STOP-cassette the transgene was expressed under the control of the ROSA26 promotor which is active in ES cells, and the IL-4R was stained on the surface of ES cells with a specific antibody (figure 3.16 C). Three clones with successful homologous recombination were chosen for injection into blastocysts to yield chimeric offspring.

3.3.3 Blastocyst injection and breeding strategy ES cells were injected into blastocysts and implanted into pseudopregnant foster mothers at the mouse facility of the University of Erlangen (Chair of Genetics). From the three injected ES cell clones, altogether six chimeric males were obtained which ranged from 60 to 95% chimerism. Chimeric males were mated to IL-4R KO Balb/c females expressing the Cre-recombinase under the CMV-promotor. Five of these chimeric males transmitted the transgene through the germline, so oﬀspring carrying the ∆N388 IL-4R heterozygously were obtained that were also heterozygous for the WT IL-4R (see ﬁgure 3.17). Crossing of these F1 mice with IL-4R KO mice will yield the desired ∆N388 IL-4R mice, that express the truncated IL-4R and lack the endogenous WT IL-4R, at a theroretical frequency of 25%. The ∆N388 IL-4R mice will be assessed for various IL-4 mediated phenotypes in the future.

Figure 3.17: Breeding strategy for ∆N388 IL-4R knock in mice. Chimeric males obtained from blastocyst injections are mated to CMV-Cre carrying, IL-4R knock out mice to delete both the STOP cassette and the neomycin resistance cassette. F1 mice are heterozygous for the WT IL-4R as well as the ∆N388 IL-4R. Mating of F1 mice to IL-4R KO mice results in WT IL-4R knock out mice carrying the ∆N388 IL-4R transgene in the F2 generation. Chapter 4

Discussion

4.1 Mechanism of IL-4 induced proliferation in TF1 cells

IL-4R signaling is known to employ either IRS– or STAT6–pathways. However, IL-4 induced proliferation of TF1 cells was observed in the laboratory of Prof. Gessner without phosphorylation of these molecules (see chapter 1). Even more, proliferation was mediated by truncated receptors lacking all five conserved tyrosines of the IL-4Rα chain, although phosphorylation of these residues was shown earlier by other groups to be a prerequisite for signaling [101]. In the literature two models of IL-4 induced proliferation are presented: in factor-dependent 32D cells, the I4R motif with its conserved tyrosine Y475 was found to be necessary for proliferation [27, 71], whereas other authors using Ba/F3 cells described proliferation mediated by truncated receptors comprising the acidic and serine-rich ID1 region [51, 129]. Recently, Stephenson et al. supported the second model of proliferation by reporting cell cycle progression of activated primary lymphocytes, transfected with IL-4Rα chains that lacked all cytoplasmic tyrosines [136]. In this study the conserved ID-1 region, which is also present in the ∆388 IL-4R mutant employed in the TF1 system, was necessary and sufficent to mediate proliferation signals. However, the authors emphasized that pre- activation of cells via the T cell receptor was necessary to reprogram the IL-4R complex, and only after this reprogramming, tyrosine-deficient receptors were rendered functional. This contrasts our own observation, as a truncated ∆388 IL-4R required no additional stimulation apart from IL-4 to mediate proliferation in TF1 cells. To elucidate the mechanism of IL-4 induced proliferation in TF1 cells, several kinase inhibitors were employed to discriminate between activation of the MAP kinase pathway or the PI3 kinase pathway, respectively. Rapamycin, a potent and selective inhibitor of mTOR activity did not affect proliferation, just as Wortmannin, an inhibitor of the PI3 kinase. Together with the finding that IRS-2 was not phosphorylated in IL-4 stimulated cells, this argues for a proliferation mechanism independent of the PI3 kinase pathway. However, LY294002, another inhibitor of PI3 kinase activation, alomst completely blocked IL-4 induced proliferation of cells in non-toxic concentrations. A similar observation has already been made in primary lymphocytes transfected with IL-4Rα constructs: in cells

47 48 CHAPTER 4. DISCUSSION

transfected with WT IL-4R, LY294002, but not rapamycin inhibited transition from G1 to S phase [136]. The fact that LY294002 blocks all PI3 kinase activity including basal activity induced by serum present in the medium, whereas rapamycin selectively inhibits mTOR activity, is a possible explanation for this finding. Another explanation would be an unspecific inhibition exerted by LY294002, but this seems unlikely as no such effect has been reported to date in the literature. U0126 and PD98059, two inhibitors of the MAP kinase kinase MEK, abolished IL-4 induced proliferation in TF1 cells at low concentrations, suggesting involvement of the MAP kinase pathway. Consistent with this notion, Erk1/2, a substrate of MEK, is rapidly phosphorylated upon IL-4 stimulation in the TF1 system. Possibly the observed activation of Erk is mediated by the postulated third signal transduction pathway employing P62 and PKCs. Supporting our data, Stephenson et al. reported a complete dependance of proliferation on Erk activation in primary T cells transfected with truncated IL-4R mutants lacking all cytoplasmic tyrosines. However, in this model active Erk led to an ID1 dependent activation of STAT5, which has been implicated in IL-4 signaling [84, 142], and also STAT6 [97, 136]. In the TF1 model, STAT6 activation was not detected, whereas STAT5 phosphorylation has not been investigated. Alternatively, IL-4 induced activation of the MAP kinase pathway might be sufficient for cell cycle progression, independent of STAT activation. It has been previously shown, that constitutively active PKCζ can activate MEK [28, 126], most likely independent of Raf, whereas other isoforms of PKC directly activate Ras or Raf [30, 134]. Eventually the PKCs are recruited to the IL-4R via P62, leading to activation of the MAP kinase pathway

Figure 4.1: Hypothetical model of IL-4 induced TF1 proliferation. The MAP kinase pathway is activated by PKCζ, which is recruited to the IL-4R by P62. Whether this activation is dependent on Ras or Raf has yet to be clariﬁed. 4.2. BINDING OF P62 TO IL-4R AND PKCζ 49

upon IL-4 stimulation (see ﬁgure 4.1). This hypothesis is supported by ﬁrst studies using a PKCζ pseudosubstrate, which was able to reduce IL-4 induced proliferation. This mechanism could explain the fact that TF1 cells transfected with either a truncated ∆388 IL-4R or WT IL-4R behave similarly, as P62 and subsequently PKC binding is localized to membrane-proximal domains of the IL-4R. Summarizing these results, the MAP kinase pathway seems to be responsible for IL-4 induced proliferation in TF1 cells, whereas the PI3 kinase pathway plays only a minor role. The reason for the contradictory results in experiments using the inhibitors Wortmannin or LY294002 remains elusive yet, and has to be further investigated. To unravel the exact signaling mechanism involved in proliferation in the TF1 system, dominant negative PKCs, or siRNA approaches against Ras or Raf are promising strategies.

4.2 Binding of P62 to IL-4R and PKCζ

Previous work identified P62 as a novel interaction partner of the IL-4R in a Y2H screen [144]. This study clearly confirmed the interaction by independent techniques: on the one hand, confocal microscopy showed colocalization of ectopically expressed fusion proteins EGFP-P62 and IL-4R-RFP in the cytoplasm near the cell membrane. This was not significantly changed upon IL-4 stimulation, indicating a preformed interaction, although this may be due to the overexpression of the binding partners. In cells transfected with EGFP-P62 alone, the protein localized throughout the cytoplasm in a vesicular pattern, which has also been reported for endogenous P62 [123]. This aggregate formation is due to a homodimerization mediated by electrostatic interactions of PB1 domains, that interact via an acidic surface (OPCA motif) with the basic portion of another PB1 domain [157]. On the other hand, immunoprecipitation studies confirmed the interaction of P62 with IL- 4R. In lysates of HEK293T cells overexpressing both binding partners, P62 was detected in a Western blot experiment after precipitation of the IL-4R. To rule out the possibility that the tag utilized to detect P62 was responsible for this interaction, both Flag– and His–tag were employed. Again, no stimulation with IL-4 was required to precipitate P62. Furthermore, an IL-4 independent binding of endogenous P62 to overexpressed IL-4R constructs was confirmed in TF1 cells, making it very likely that the interaction exists in a preformed manner, and is not due to overexpression of proteins. Once the binding of P62 to IL-4R has been proven, the protein domains responsible for this interaction were to be identified. Previous work already identified a short peptide stretch of the IL-4R (297KTDFPKAAPTKSPQSPGKA315) as the region interacting with P62 in a pepscan experiment [144]. Mutation of the serine 308 in this region abrogated binding of P62 to the receptor as analyzed by immunoprecipitation studies. Due to its modular structure, P62 is able to interact with proteins through a variety of domains, e.g. the AID domain comprising amino acids 69 to 81 binds PKCζ [124]. Additionally, binding to TrkA has been reported to occur via amino acids 266 to 446 [159], to TRAF6 via amino acids 225 to 251 [159], to RIP via amino acids 117 to 266 [125] and to the ρ3 subunit of the GABAC receptor via amino acids 119 to 221 [24]. In the case of P62 binding to IL-4R, no exact mapping of the interacting region was performed, but the internal deletion-mutant of P62, which lacked amino acids 69 to 251, was still able to bind 50 CHAPTER 4. DISCUSSION

to the receptor in co-immunoprecipitation experiments. Taken together, binding is most likely mediated by the N-terminal amino acids 1 to 69, as the C-terminal region comprises two PEST sequences and the UBA domain, which have not previously been described in protein-protein interactions. Furthermore, binding of P62 to Par4 has been described to occur via amino acids 1 to 80 [19], but several other truncation mutants of P62 have to be tested in immunoprecipitation studies to map the exact binding region. P62 has been shown to bind to PKCζ, targeting kinase functionality to distinct cellular pathways [40]. Therefore, we hypothesized that this may also be the case in IL-4R signal transduction. In immunoprecipitation experiments using lysates of HEK293T cells overexpressing all three potential binding partners (IL-4R, P62-His and PKCζ-Flag) both P62 and PKCζ were detected in samples precipitated with an α-IL-4R antibody. This finding confirmed our assumption of a trimolecular complex, making it likely that P62 acts as a molecular bridge directly linking the IL-4R to downstream functionality mediated by PKCζ. In the literature this connection between transmembrane receptors and the functionally relevant PKC has already been reported to be mediated by P62 in signal transduction pathways including IL-1R [124] or TNF-αR [81, 125]. In other cases, e.g. the interaction between P62, PKCζ and prostate apoptosis response-4 (PAR-4), a ternary complex has been described in which all three components directly interact [19]. Whether P62 acts as a molecular bridge linking PKCζ and the IL-4R, or a trimolecular interaction between each of the three proteins exists, can not be concluded from the data presented in this study. P62 was found to bind to the IL-4R, and is known from the literature to directly interact with PKCζ [17, 114, 123]. On the other hand, PKCζ was immunopreci- pitated with an α-IL-4R antibody from cell lysates that did not overexpress P62. However, endogenous P62 might also be sufficient to bridge the two proteins. This was reported for the association of Grb14, P62 and PKCζ [17], where the bridging function of P62 could not be shown clearly by immunoprecipitation, but was unravelled through in vitro interaction studies with purified proteins. To elucidate the mode of interaction between the IL-4R, P62 and PKCζ, overexpression of the truncated P62 lacking amino acids 69 to 251, that can no longer bind to PKCζ might be helpful. In transfected cells, this protein would possibly act as a dominant negative P62 and would no longer be able to recruit PKCζ to the IL-4R, unless a direct interaction between these two proteins existed. Taken together, these results clearly establish P62 as a novel interaction partner of the IL-4R. This binding very likely exists in a preformed manner in unstimulated cells and recruits PKCζ to the IL-4R.

4.3 Involvement of P62 in IL-4R signal transduction

Once the binding between P62 and the IL-4R had been conﬁrmed, we raised the question whether this interaction has functional consequences for IL-4R signaling. Data from the TF1 system already suggested a functional relevance, as a mutation in the putative binding region for P62 not only abrogated binding of P62 to the receptor, but also rendered the mutated ∆388 IL-4R unfunctional with regard to IL-4 induced cell proliferation [144]. Therefore, it seemed very promising to further investigate the role of P62 in IL-4R signaling in the P62 gene-targeted mouse model established in the group of Prof. Gessner. 4.3. INVOLVEMENT OF P62 IN IL-4R SIGNAL TRANSDUCTION 51

This model allowed to analyze complex phenotypes of IL-4R signaling, including infection models, whereas the TF1 sytem had been limited to proliferation as the only readout system. The analysis of lymphocytes for IL-4 induced functions, including the most prominent effects like proliferation capacity, TH2 differentiation of na¨ıve T cells or class switching of B cells towards IgE production, revealed no defects of P62 gene-targeted mice in their ability to respond to IL-4 stimulation. This might be explained by the fact, that P62 gene- targeted mice carry the WT IL-4R, which is still able to signal via the established IRS– or Jak/STAT–pathway. These classical signal transduction events could mask any functionality, that could otherwise be exerted by a third alternative pathway employing P62. Again, the TF1 sytem provides first evidence for this assumption: mutation of the potential binding site for P62 within the IL-4R completely abolished IL-4 induced proliferation in cells carrying the truncated ∆388 IL-4R, whereas cells carrying the WT IL-4R were not affected by this mutation [144]. This observation already suggested redundancy in IL-4R signaling and could explain the observation that lymphocytes of P62 gene-targeted mice exhibited no IL-4 signaling defect. However, any phenotype, and also the lack of any phenotype, in gene-targeted mice can be due to either the loss of function of the targeted gene, or the reaction the organism initiates to compensate for this loss [148]. This study also investigated IL-4 effects on non-hematopoietic cells. Promted by a publication of Moscat et al., which described the phenotype of a PKCζ gene-deficient mouse model [32], particularly the production of eotaxin 1 by fibroblasts, which is strongly induced by IL-4 stimulation, was analyzed. MEFs of P62 gene-deficient mice were stri- kingly compromised in their ability to upregulate the production of this chemokine when stimulated with IL-4, both on protein and transcript level. This finding represents the first phenotype of P62 gene-deficient mice in response to IL-4, confirming the assumption that P62 contributes to IL-4R signaling ex vivo. The fact that fibroblasts express the type II IL-4R complex, whereas lymphocytes signal exclusively via the type I IL-4R complex, might explain the discrepancy between a non-redundant function of P62 in the upregulation of eotaxin 1 in fibroblasts, and the absence of effects on lymphocytes. The signaling pathway leading to the upregulation of eotaxin 1 most probably employs PKCζ, as mice gene-deficient for this kinase exhibited the same defect. In PKCζ gene-deficient mice, phosphorylation of Jak1, and subsequently also activation of the transcription factor STAT6 was reduced, which explained the reduced response to IL-4 stimulation [32]. Concluding from these data, we propose that P62 serves as a molecular adapter linking PKCζ activity to the IL-4R. P62 gene-deficient mice were analyzed in a model of OVA–induced allergic asthma to elucidate the effect of reduced eotaxin 1 production by IL-4 stimulated fibroblasts in an in vivo setting. In this model of late phase eosinophilia no difference was detectable in the total number of eosinophils recruited to the lung in P62 gene-deficient mice. Also, levels of IL-5, IL-4, IL-13 and eotaxin 1 measured in the broncheoalveolar lavage fluid (BALF) displayed no significant differences. Previously, Rothenberg et al. reported, that mice deficient in eotaxin 1 exhibited a reduction of approximately 70% in the number of eosinophils recruited to the lungs 18h after challenge, whereas late phase eosinophilia was not affected [118]. Additionally, also in human 549 alveolar type II epithelium-like cells 52 CHAPTER 4. DISCUSSION

stimulated with IL-4, the release of CCL11 (eotaxin 1) occurred predominantly during the first 24 h of simulation, whereas at later time points the release of CCL24 (eotaxin 2) and CCL26 (eotaxin 3) dominated [54]. Therefore, the late phase eosinophila model which was employed in this study, might have failed to show a difference in eosinophil– recruitment due to the late time point at which mice were analyzed. Also, eotaxin 2 (CCL24) might have occluded the functional absence of eotaxin 1: a recent publication reported a dominant role of eotaxin 2, but only a modest role of eotaxin 1 in pulmonary tissue eosinophilia in a mouse model of OVA–induced experimental asthma, whereas the most striking defect was observed in animals deficient for both chemokines [111]. In P62 gene-deficient mice, IL-4 induced upregulation of eotaxin 2 in MEFs was not reduced compared to WT samples. A mouse model deficient for P62 has also been established in another group, but P62 functionality has not been linked to IL-4R signal transduction in this model. One publication reports impaired osteoclastogenesis upon RANK-L stimulation, whereas basal bone physiology is not affected [33], the other study describes mature-onset obesity and insulin resistance in P62 gene-deficient mice [116]. An oral glucose tolerance test revealed insuline resistance in P62 gene-deficient mice older than five months, which is in contrast to the observations made by us. However, mice in our studies were around three month of age, so probably the insuline resistane was not apparent yet. Another explanation might be the different genetic background of mice employed in the two studies. We used mice backcrossed to a Balb/c background with speed congenics, whereas the mice in the study of Rodriguez et al. were on a mixed 129 SvJ and C57BL/6 background. Especially the 129 SvJ background is considered problematic, as it is highly contaminated with genomic regions of non-129 origin [146], and has also been reported to harbour alleles that predispose to insulin resistance [72]. In summary, a functional relevance of P62 for IL-4R signaling was shown in a mouse model deficient for P62. MEFs from P62 gene-deficient mice were compromised in their ability to upregulate eotaxin 1 in response to IL-4 stimulation. Whether this defect results in a reduced recruitment of eosinophils in suitable in vivo mouse models, and whether other IL-4 functions are affected, awaits further investigation.

4.4 Generation of a ∆N388 IL-4R knock in mouse model

A truncated ∆388 IL-4R, that lacked binding sites for both IRS and STAT6, was still able to mediate IL-4 induced proliferation in a cell culture system [144]. Therefore, the capacity of this mutated receptor to transduce IL-4 signals in other settings should be investigated. It is of special interest, whether this receptor could still induce TH2 diﬀerentiation of na¨ıve T cells or class switching of B cells towards IgE, two IL-4 functions that are important for the outcome of infections. A mouse model employing this truncated ∆388 IL-4R is a prerequisite to analyze these phenotypes, consequently the generation of such a transgenic mouse model was one objective of this study. 4.4. GENERATION OF A ∆N388 IL-4R KNOCK IN MOUSE MODEL 53

Genetic alteration of the endogenous IL-4R locus is one possible approach to generate an IL-4R transgenic mouse model. The insertion of suitable STOP-codons leads to the expression of a truncated receptor, driven by the original promotor and regulatory sequences. However, expression levels of the endogenous IL-4R are regulated by IL-4 signals through a positive feedback loop requiring STAT6 [69, 76], therefore this approach can not ensure a sufficient expression of any truncated receptor that no longer harbors the STAT6 binding site. Alternatively, we decided to express the ∆388 IL-4R as a transgene under control of the ROSA26 promotor and to backcross these mice to WT IL-4R gene-deficient mice. The ROSA26 locus was originally described by Soriano et al. and has been identified by gene trap mutagenesis, where a promotorless reporter gene is introduced into ES cells [38]. Expression of the reporter gene was detectable in a generalized fashion in all hematopoietic cells as well as in all embryonic tissues. Normally, three transcripts are generated from the ROSA26 locus, two of which contain no significant open reading frame. The third transcript potentially encodes a novel protein, but homozygous mice are fully viable and exhibit no overt phenotype [161]. Therefore, a variety of knock–in lines have been generated targeting the ROSA26 locus, achieving ubiquitous expression of the transgene [88, 132, 135]. For the gene targeting experiment in Balb/c ES cells, we used the pROSA26-STOP plasmid described by Buch et al. [14], into which we inserted the cDNA coding for the truncated ∆388 IL-4R. With this approach, the transgene will only be expressed after excission of the STOP-cassette by Cre recombinase, allowing a time– or tissue–specific expression of the ∆388 IL-4R, depending on the Cre expression-pattern of the mouse strain used for backcrossing. We obtained several successfully targeted clones of ES cells as verified by Southern blotting, three of which were injected into blastocysts. All injections yielded highly chimeric offspring and to date two of the three ES cell clones injected have been transmitted through the germline as detected by PCR reaction. Currently, these mice are backcrossed to WT IL-4R deficient, CMV-Cre expressing mice, since a uniform expression of the truncated IL-4R is desired in a first step of analysis. These chimeric mice will provide a valuable tool for the investigation of alternative IL-4R signal transduction, as they allow to analyze which IL-4 effects are still functional in mice expressing a truncated receptor that lacks the binding sites for both STAT6 and IRS. The expression of this ∆388 IL-4R will be independent of STAT6, circumventing the problem of an insuf- ficient expression level of the transgene. One drawback of this targeting strategy could be unphysiologically high expression levels of the ∆388 IL-4R expressed under control of the ROSA26 promotor. Expression levels might be significantly higher as in the WT situation, so another transgenic mouse model, expressing the WT IL-4R under control of the ROSA26 promoter, will be the best control to identify whether phenotypes are due to overexpression of the receptors. In summary, a transgenic mouse model was established, in which the ∆388 IL-4R is expressed in the absence of the WT IL-4R. Importantly, the expression of the transgene is independent of STAT6, so expression levels will be sufficiently high for functional analyses. Furthermore, the ES cell line and all mice used were Balb/c to circumvent time–consuming backcrossing of mice to a pure genetic background. This new mouse model will provide a valuable tool for the analysis of residual IL-4 functionality mediated by a truncated 54 CHAPTER 4. DISCUSSION

receptor lacking binding sites for both STAT6 and IRS. This truncated receptor might also reveal additional P62 functionality after backcrossing of this mouse model to P62 gene-targeted mice, as potential redundancy in signaling should be absent in truncated receptors. Chapter 5

Summary

Interleukin-4 (IL-4) is a pleiotropic cytokine that plays a pivotal role in shaping immune responses. IL-4-receptor (IL-4R) signal transduction is described to be mediated either by the IRS-pathway leading to cell proliferation, or the Jak/STAT-pathway resulting in gene activation. Recent publications and also data from our own laboratory question this hitherto existing model of IL-4R signaling. As a consequence, the existence of a third signal transduction pathway for IL-4 signals independent of STAT6 and IRS, but possibly dependent on the adaptor protein P62, was postulated. In a cell culture system we observed IL-4-induced proliferation of TF1 cells transfected with IL-4R variants, that failed to activate IRS or STAT6. The relative contribution of the MAP kinase pathway or the PI3 kinase pathway to this proliferation was investigated in this study. TF1 cells, either transfected with WT or truncated IL-4R constructs, employed predominantly the MAP kinase pathway to transduce IL-4 induced proliferation signals, since the MEK inhibitors U0126 and PD98059 abrogated IL-4 induced proliferation, whereas Rapamycin and Wortmannin exerted no inhibitory effect. In line with this, no IRS phosphorylation was detectable after IL-4 stimulation, on the contrary Erk was rapidly phosphorylated. The recruitment of PKCζ to the IL-4R through the adaptor protein P62 is a possible mechanism that could activate the MAP kinase pathway, resulting in MEK activation. P62 has been identified in our laboratoy as an interaction partner of the IL-4Rα-chain in a Y2H screen, that might be involved in alternative IL-4R signal transduction. This study verified the interaction between the IL-4R α-chain and P62 by independent techniques: confocal microscopy showed colocalization of the hypothetical binding partners, and co-immunoprecipitation studies further confirmed this interaction. The association between the proteins most likely exists in a preformed manner and does not require IL-4 stimulation. Additionally, we were able to precipitate a trimolecular protein complex comprising the IL-4R, P62 and PKCζ, thereby linking the IL-4R–P62 complex to a possible downstream effector kinase. In the present study a mouse model gene-deficient for P62 was analyzed for IL-4 induced phenotypes to elucidate the potential contribution of P62 to IL-4R signal transduction both in vitro and in vivo. In various assays, no significant differences between P62 gene- targeted mice and WT controls in response to IL-4 were detected, which might be due to redundancy in signaling, as the P62 gene deficient mouse harbors the WT IL-4R with

55 56 SUMMARY

its capacity to activate IRS or STAT6. In contrast, a non-redundant function of P62 in response to IL-4 stimulation was detected in non-hematopoietic fibroblasts: IL-4 induced upregulation of the chemokine eotaxin 1 (CCL11) was dependent on P62, as cells from gene-deficient mice showed a clear reduction in eotaxin levels after IL-4 stimulation, both on mRNA and protein levels. This finding confirms our initial hypothesis, establishing P62 as a functionally relevant protein in IL-4R signal transduction processes. The signaling capacity of the truncated IL-4R, unable to activate IRS or STAT6, but still mediating IL-4 induced proliferation in the TF1 system, will be further analyzed. Therefore, a mouse model carrying the ∆388 IL-4R was established in this study. The endogenous locus was not manipulated, as expression levels of the IL-4Rα-chain are regulated by IL-4 signals through a positive feedback loop requiring STAT6. Alternatively, we decided to express the truncated receptor as a transgene under control of the ROSA26 promotor, which ensures sufficient expression levels. Three independent embryonic stem cell (ES) clones obtained from the gene-targeting experiment, which displayed successful homologous recombination as confirmed by Southern blot, were chosen for injection. After injection into blastocysts, two of these ES cell clones have been transmitted through the germline of chimeric founders and are bred to yield transgenic mice expressing the ∆388 IL-4R in the absence of the WT IL-4R. This new mouse model will provide a valuable tool for the analysis of residual IL-4 functionality mediated by a truncated receptor lacking binding sites for both IRS and STAT6, and will contribute to the elucidation of the postulated third signal transduction pathway of the IL-4R. Zusammenfassung

Interleukin-4 (IL-4) ist ein pleiotropes Zytokin, das eine Schlusselrolle¨ bei der Steu- erung der Immunantwort spielt. Signale werden ausgehend vom IL-4-Rezeptor (IL-4R) entweder uber¨ den IRS-Signalwg transduziert, was zu Zellproliferation fuhrt,¨ oder uber¨ den Jak/STAT-Signalweg, was in der Aktivierung spezifischer Gene resultiert. Neuere Veröffentlichungen wie auch Daten aus unserem eigenen Labor stellen dieses bisherige Modell der IL-4R Signaltransduktion allerdings in Frage. Daher postulierten wir die Exi- stenz eines dritten Signalweges fur¨ IL-4 Signale, welcher unabhängig von STAT6 und IRS ist, und möglicherweise durch das Adapter-Protein P62 vermittelt wird. In einem Zellkultursystem konnten wir IL-4-vermittelte Proliferation von Zellen beobach- ten, welche mit IL-4R Varianten transfiziert waren, die weder IRS noch STAT6 aktivieren konnten. In der vorliegenden Arbeit wurde untersucht, in welchem Ausmaß der MAP-Kinase Signalweg, beziehungsweise der PI3-Kinase Signalweg zu dieser Prolifera- tion beitragen. TF1 Zellen benutzten hauptsächlich den MAP-Kinase Signalweg um IL- 4-induzierte Proliferationssignale zu transduzieren, unabhängig davon, ob sie mit WT- oder verkurzten¨ IL-4R Konstrukten transfiziert waren, da die beiden MEK-Inhibitoren U0126 und PD98059 zu einem vollständigen Erliegen der IL-4-induzierten Proliferation fuhrten,¨ während Rapamycin und Wortmannin keine inhibitorische Wirkung zeigten. In Ubereinstimmung¨ hiermit war nach IL-4-Stimulation keine Phosphorylierung von IRS nachweisbar, wohingegen Erk rasch phosphoryliert wurde. Die Rekrutierung der PKCζ an den IL-4R mit Hilfe des Adapter-Proteins P62 ist ein möglicher Mechanismus, der zur Aktivierung von MEK fuhren¨ könnte. P62 wurde in unserem Labor mit Hilfe eines Y2H als Interaktionspartner der IL-4Rα- Kette identifiziert, welcher an einer alternativen IL-4R Signaltransduktion beteiligt sein könnte. In dieser Arbeit konnte die Bindung zwischen der IL-4Rα-Kette und P62 mit mehreren unabhängigen Techniken bestätigt werden. Zum einen wurde mittels konfokaler Mikroskopie die Co-Lokalisation der hypothetischen Bindepartner gezeigt, zum anderen konnten Co-Immunopräzipitationsstudien diese Interaktion weiter bestätigen. Hierbei be- steht die Assoziation der beiden Proteine höchstwahrscheinlich ab initio und bedarf nicht der IL-4 Stimulation. Des weiteren konnte ein trimolekularer Proteinkomplex bestehend aus der IL-4Rα-Kette, P62 und PKCζ präzipitiert werden, wodurch die Assoziation des IL-4R–P62-Komplexes mit einer wahrscheinlichen Effektorkinase gezeigt werden konnte. Um eine mögliche Beteiligung von P62 bei der IL-4R-Signaltransduktion sowohl in vitro als auch in vivo zu untersuchen, wurden in Rahmen dieser Arbeit Mäuse, die kein funktio- nelles P62 exprimieren, hinsichtlich IL-4-vermittelter Funktionalität analysiert. Bei mehreren Untersuchungen von IL-4 Effekten auf Immunzellen zeigten sich zunächst keine

57 58 ZUSAMMENFASSUNG

signifikanten Unterschiede zwischen den WT Kontrollen und Mäusen, welche gendefizient fur¨ P62 waren. Dies kann durch eine mögliche Redundanz der Signalwege erklärt werden, da P62 gendefiziente Mäuse den WT IL-4R exprimieren, welcher in der Lage ist IRS oder STAT6 zu aktivieren. Im Gegensatz dazu war die IL-4 induzierte Expression des Chemo- kins Eotaxin 1 (CCL11) in Fibroblasten sowohl auf mRNA- als auch auf Proteinebene in P62 gendefizienten Mäusen stark beeinträchtigt. Diese nicht-redundante Funktionalität von P62 bestätigt unsere ursprungliche¨ Hypothese, dass P62 ein funktionell relevantes Protein der IL-4R Signaltransduktion ist. Die Funktionalität des trunkierten IL-4R, welcher IRS und STAT6 nicht mehr zu aktivieren vermag, aber dennoch IL-4-induzierte Proliferation in Zellkultur vermitteln konnte, soll weitergehend untersucht werden. Daher wurde im Rahmen dieser Arbeit ein Maus- Modell etabliert, das den ∆388 IL-4R exprimiert. Da die Expression der IL-4Rα-Kette uber¨ STAT6-vermittelte IL-4 Signale reguliert wird, wurde nicht der endogene Lokus mani- puliert. Um eine ausreichende Expressionshöhe des trunkierten Rezeptors sicher zu stellen, haben wir uns statt dessen entschieden den trunkierten IL-4R als Transgen unter Kontrolle des ROSA26 Promotors zu exprimieren. Drei unabhängige embryonale Stammzell-Klone, deren erfolgreiche homologe Rekombination durch Southern Blot bestätigt worden war, wurden zur Blasotysteninjektion ausgewählt. Zwei dieser Klone resultierten in chimären Mäusen, die das inserierte ∆388 IL-4R-Gen weitervererbten. Die Nachkommen wurden mit IL-4R defizienten Tieren verpaart um Mäuse zu erhalten, die den ∆388 IL-4R in Ab- wesenheit des WT IL-4R exprimieren. Dieses neue Mausmodell wird es uns ermöglichen, die Funktionalität eines trunkierten IL-4R, der keine Bindestellen fur¨ IRS und STAT6 besitzt, zu untersuchen und wird so dazu beitragen die Relevanz des postulierten alternativen Signaltransduktionsweges zu klären. Appendix A

Abbreviations

aPKC atypical protein kinase C Ab antibody B. burgdorferi Borrelia burgdorferi bp base pair cDNA copy deoxynucleic acid cpm counts per minute d day D Dalton (molecular weight) DNA deoxynucleic acid dNTP deoxyribonucleotide triphosphate E. coli Escherichia coli EDTA ethylenediaminetetraacetic acid ELISA enzyme-linked immunosorbent assay ES embryonic stem cell EtOH ethanol γc common gamma chain (CD132) h hour HPRT hypoxanthine guanine phosphoribosyl transferase IFN interferon I4R insuline- / IL-4-receptor motif Ig immunoglobulin IL interleukin IL-4R interleukin-4 receptor i.n. intranasal IONO ionomycin i.p. intraperitoneal IRS insulin receptor substrate KO knock out / gene-deﬁcient continued on next page

59 60 ABBREVIATIONS

continued from previous page

LIF leukemia inhibitor factor L. major Leishmania major LPS lipopolysaccharide M molar (concentration) MEF mouse embryo ﬁbroblast MHC major histocompatibility complex mRNA messenger ribonucleic acid ORF open reading frame PBGD porphobilinogen deaminase PBS phosphate buﬀered saline PCR polymerase chain reaction PKC protein kinase C PMA phorbol myristate acetate RT room temperature RT-PCR reverse transcriptase-polymerase chain reaction SDS sodium dodecyl sulfate STAT signal transducer and activator of transcription TH1 T helper cell type 1 TH2 T helper cell type 2 TMB 3 ,3′ ,5,5′ -tetramethylbenzidine TNF tumor necrosis factor Tris trishydroxymethylaminomethan WT wild-type Bibliography

[1] A. K. Abbas, K. M. Murphy, and A. Sher. Functional diversity of T helper lymphocytes. Nature, 383(6603):787–793, 1996.

[2] S. Andersson, D. L. Davis, H. Dahlback, H. Jornvall, and D. V. Russel. Cloning, structure, and expression of the mitochondrial cytochrome P-450 sterol 26- hydrolase, a bile acid biosynthetic enzyme. The Journal of Biological Chemistry, 264(14):8222–8229, 1989.

[3] A. Arcaro and M. P. Wymann. Wortmannin is a potent phosphatidylinositol 3- kinase inhibitor: the role of phosphatidylinositol 3,4,5-trisphosphate in neutrophil responses. Biochemical Journal, 296(2):297–301, 1993.

[4] Ausubel. Current Protocols in Molecular Biology. John Wiley & Sons, New York, 1987.

[5] L. P. Beckmann, K. A. Schooley, B. Gallis, T. Vanden Bos, D. Friend, A. R. Alpert, R. Raunio, K. S. Prickett, P. E. Baker, and L. S. Park. Monoclonal antibodies block IL–4 receptor function. The Journal of Immunology, 144:4212–4217, 1990.

[6] B. L. Bennett, R. Cruz, R. G. Lacson, and A. M. Manning. Interleukin-4 suppression of tumor necrosis factor alpha-stimulated E-selectin gene transcription is mediated by STAT6 antagonism of NF-kappaB. The Journal of Biological Chem- istry, 272(15):10212–10219, 1997.

[7] E. Berra, M. T. Diaz-Meco, I. Dominguez, M. M. Municio, L. Sanz, J. Lozano, R. S. Chapkin, and J. Moscat. Protein kinase C zeta isoform is critical for mitogenic signal transduction. Cell, 74(3):555–563, 1993.

[8] B. J. Bevis and B. S. Glick. Rapidly maturating variants of the Discosoma red ﬂuorescent protein (DsRed). Nature Biotechnology, 20(1):83–87, 2002.

[9] C. Bogdan, A. Gessner, and M. R¨ollinghoﬀ. Cytokines in leishmaniasis: a complex network of stimulatory and inhibitory interactions. Immunobiology, 189:356–396, 1993.

[10] C. Bogdan and C. Nathan. Modulation of macrophage function by transforming growth factor beta, interleukin-4, and interleukin-10. Annals of the New York Academy of Sciences, 685:713–739, 1993.

61 62 BIBLIOGRAPHY

[11] L. C. Borish, H. S. Nelson, J. Corren, G. Bensch, W. W. Busse, J. B. Whitmore, J. M. Agosti, and IL-4R Asthma Study Group. Eﬃcacy of soluble IL-4 receptor for the treatment of adults with asthma. Journal of Allergy and Clinical Immunology, 107(6):963–970, 2001.

[12] F. Bost, M. Aouadi, L. Caron, P. Even, N. Belmonte, M. Prot, C. Dani, P. Hofman, G. Pages, J. Pouyssegur, Y. Le Marchand-Brustel, and B. Binetruy. The extracellular signal-regulated kinase isoform ERK1 is speciﬁcally required for in vitro and in vivo adipogenesis. Diabetes, 54(2):402–411, 2005.

[13] M. A. Brown, J. H. Pierce, C. J. Watson, J. Falco, J. N. Ihle, and W. E. Paul. B cell stimulatory factor-1/interleukin-4 mRNA is expressed by normal and transformed mast cells. Cell, 50(5):809–818, 1997.

[14] T. Buch, F. L. Heppner, C. Tertilt, T. J. Heinen, M. Kremer, F. T. Wunderlich, S. Jung, and A. Waisman. A Cre-inducible diphteria toxin receptor mediates cell lineage ablation after toxin administration. Nature Methods, 2(6):419–426, 2005.

[15] P. R. Burd, H. W. Rogers, J. R. Gordon, C. A. Martin, S. Jayaraman, S. D. Wilson, A. M. Dvorak, S. J. Galli, and M. E. Dorf. Interleukin 3-dependent and -independent mast cells stimulated with IgE and antigen express multiple cytokines. The Journal of Experimental Medicine, 170(1):245–257, 1989.

[16] D. Caput, P. Laurent, M. Kaghad, J. M. Lelias, S. Lefort, N. Vita, and P. Fer- ara. Cloning and characterization of a speciﬁc interleukin (IL)-13 binding protein structurally related to the IL-5 receptor alpha chain. The Journal of Biological Chemistry, 271(28):16921–16926, 1996.

[17] B. Cariou, D. Perdereau, K. Cailliau, E. Browaeys-Poly, V. B´er´eziat, M. Vasser- Cognet, J. Girard, and A. Burnol. The adapter protein ZIP binds Grb14 and regulates its inhibitory action on insulin signaling by recruiting protein kinase Cζ. Molecular and Cellular Biology, 22(20):6959–6970, 2002.

[18] C. Carr, S. Aykent, N. M. Kimack, and A. D. Levine. Disulﬁde assignments in recombinant mouse and human interleukin 4. Biochemistry, 30(6):1515–1523, 1991.

[19] S. Chang, J. H. Kim, and J. Shin. P62 forms a ternary complex with PKCζ and PAR-4 and antagonizes PAR-4-induced PKCζ inhibiton. FEBS letters, 510(1):57– 61, 2001.

[20] H. Chen and W. E. Paul. Cultured NK1.1+ CD4+ T cells produce large amounts of IL-4 and IFN-gamma upon activation by anti-CD3 or CD1. The Journal of Immunology, 159(5):2240–2249, 1997.

[21] L. Chialda, M. Zhang, K. Brune, and A. Pahl. Inhibitors of mitogen–activated protein kinases diﬀerentially regulate costimulated T cell cytokine production and mouse airway eosinophilia. Respiratory Research, 6:36, 2005. BIBLIOGRAPHY 63

[22] J. Chung, C. J. Kuo, G. R. Crabtree, and J. Blenis. Rapamycin-FKBP speciﬁcally blocks growth-dependent activation of and signaling by the 70 kd S6 protein-kinases. Cell, 69(7):1227–1236, 1992.

[23] R. L. Coﬀman, J. Ohara, M. W. Bond, J. Carty, A. Zlotnik, and W. E. Paul. B cell stimulatory factor-1 enhances the IgE response of lipopolysaccharide-activated B cells. The Journal of Immunology, 136(12):4538–4541, 1986.

[24] C. Croci, J. H. Brandstatter, and R. Enz. ZIP3, a new splice variant of the PKC- zeta-interacting protein family, binds to GABAC receptors, PKC-zeta, and Kv beta 2. The Journal of Biological Chemistry, 278(8):6128–6135, 2003.

[25] T. Defrance, J. P. Aubry, F. Rousset, B. Vanbervliet, J. A. Bonnefoy, N. Arai, Y. Takebe, T. Yokota, F. Lee, and K. Arai. Human recombinant interleukin 4 induces Fc epsilon receptors (CD23) on normal human B lymphocytes. The Journal of Experimental Medicine, 139(4):1459–1467, 1987.

[26] D. T. Denhardt. Signal-transducing protein phosphorylation cascades mediated by Ras/Rho proteins in the mammalian cell: the potential for multiplex signaling. The Biochemical Journal, 318(3):729–747, 1996.

[27] H. Deutsch, K. Koettnitz, J. Chung, and F. S. Kalthoﬀ. Distinct sequence motifs within the cytoplasmic domain of the human IL-4 receptor diﬀerentially regulate apoptosis inhibition and cell growth. The Journal of Immunology, 154:3696–3703, 1995.

[28] M. T. Diaz-Meco, I. Dominguez, L. Sanz, P. Dent, J. Lozano, M. M. Municio, E. Berra, R. T. Hay, T. W. Sturgill, and J. Moscat. Zeta PKC induces phosphorylation and inactivation of I-kappaB-alpha in vitro. The EMBO Journal, 13(12):2842– 2848, 1994.

[29] M. T. Diaz-Meco, M. M. Municio, S. Frutos, P. Sanchez, J. Lozano, L. Sanz, and J. Moscat. The product of par-4, a gene induced during apoptosis, interacts selectively with the atypical isoforms of protein kinase C. Cell, 86(5):777–786, 1996.

[30] J. Downward, J. D. Graves, P. H. Warne, S. Rayter, and D. A. Cantrell. Stimulation of p21ras upon T-cell activation. Nature, 346(6286):719–723, 1990.

[31] S. Dubucquoi, P. Desreumaux, A. Janin, O. Klein, M. Goldman, J. Tavernier, A. Capron, and M. Capron. Interleukin 5 synthesis by eosinophils: association with granules and immunoglobulin-dependent secretion. The Journal of Experimental Medicine, 179(2):703–708, 1994.

[32] A. Dur´an, A. Rodriguez, P. Martin, M. Serrano, J. M. Flores, M. Leitges, M. T. Diaz-Meco, and J. Moscat. Crosstalk between PKCζ and the IL4/Stat6 pathway during T-cell-mediated hepatitis. The EMBO Journal, 23(23):4595–4605, 2004. 64 BIBLIOGRAPHY

[33] A. Dur´an, M. Serrano, M. Leitges, J. M. Flores, S. Picard, J. P. Brown, J. Moscat, and M. T. Diaz-Meco. The atypical PKC-interacting protein p62 is an important mediator of RANK-activated osteoclastogenesis. Developmental Cell, 6:303–309, 2004.

[34] R. Fernandez-Botran and E. S. Vitetta. A soluble, high-aﬃnity, interleukin-4- binding protein is present in the biological ﬂuids of mice. Proceedings of the National Academy of Sciences, 87(11):4202–4206, 1990.

[35] D. A. Ferrick, M. D. Schrenzel, T. Mulvania, B. Hsieh, W. G. Ferlin, and H. Lep- per. Diﬀerential production of interferon-gamma and interleukin-4 in response to Th1- and Th2-stimulating pathogens by gamma delta T cells in vivo. Nature, 373(6511):255–257, 1995.

[36] S. Fichtnr-Feigl, W. Strober, K. Kawakami, R. K. Puri, and A. Kitani. IL-13 signaling through the IL-13alpha2 receptor is involved in induction of TGF-beta1 production and ﬁbrosis. Nature Medicine, 12(1):13–14, 2006.

[37] T. F. Franke, D. R. Kaplan, L. C. Cantley, and A. Toker. Direct regulation of the Akt proto-oncogene product by phosphatidylinositol-3,4-bisphosphate. Science, 275(5300):665–668, 1997.

[38] G. Friedrich and P. Soriano. Promoter traps in embryonic stem cells: a genetic screen to identify and mutate developmental genes in mice. Genes and Development, 5(9):1513–1523, 1991.

[39] H. Gascan, J. F. Gauchat, M. G. Roncarolo, H. Yssel, H. Spits, and J. E. de Vries. Human B cell clones can be induced to proliferate and to switch to IgE and IgG4 synthesis by interleukin 4 and a signal provided by activated CD4+ T cell clones. The Journal of Experimental Medicine, 173(3):747–750, 1991.

[40] T. Geetha and M. W. Wooten. Structure and functional properties of the ubiquitin binding protein p62. FEBS Letters, 512:19–24, 2002.

[41] T. Geetha and M. W. Wooten. Association of the atypical protein kinase C- interacting protein p62/ZIP with nerve growth factor receptor TrkA regulates receptor traﬃcking and Erk5 signaling. The Journal of Biological Chemistry, 278(7):4730– 4739, 2003.

[42] S. Gerondakis. Structure and expression of murine germ-line immunoglobulin ǫ heavy chain transcripts induced by interleukin 4. Proceedings of the National Academy of Sciences, 87(4):1581–1585, 1990.

[43] A. Gessner and M. R¨ollinghoﬀ. Biologic functions and signaling of the interleukin-4 receptor complexes. Immunobiology, 201:285–307, 2000.

[44] A. Gessner, K. Schröppel, A. Will, K. H. Enssle, L. Lauffer, and M. Röllinghoff. Recombinant soluble interleukin-4 (IL-4) receptor acts as an antagonist of IL-4 in murine cutaneous leishmaniasis. Infection and Immunity, 62(10):4112–4117, 1994. BIBLIOGRAPHY 65

[45] S. Gillis and K. A. Smith. Long term culture of tumor–speciﬁc cytotoxic T cells. Nature, 268:154–156, 1977.

[46] J. Gong, J. Xu, M. Bezanilla, R. van Huizen, R. Derin, and M. Li. Diﬀerential stimulation of PKC phosphorylation of potassium channels by ZIP1 and ZIP2. Science, 285(5433):1565–1569, 1999.

[47] F. L. Graham, J. Smiley, W. C. Russel, and R. Nairn. Characteristics of a human cell line transformed by DNA from human adenovirus type 5. Journal of General Virology, 36:59–74, 1977.

[48] S. G. Grant, J. Jessee, F. R. Bloom, and D. Hanahan. Diﬀerential plasmid rescue from transgenic mouse DNAs into Escherichia coli methylation–restriction mutants. Proceedings of the National Academy of Sciences, 87(12):4645–4649, 1990.

[49] T. A. Gustafson, W. He, A. Craparo, C. D. Schaub, and T. J. ONeill. Phosphotyrosine-dependent interaction of SHC and insuline receptor substrate 1 with the NPEY motif of the insulin receptor via a novel non-SH2 domain. Molecu- lar Cell Biology, 15(5):2500–2508, 1995.

[50] T. A. Hamilton, Y. Ohmori, and J. Tebo. Regulation of chemokine expression by antiinﬂammatory cytokines. Immunologic Research, 25(3):229–245, 2002.

[51] N. Harda, G. Yang, A. Miyajima, and M. Howard. Identiﬁcation of an essential region for growth signal transduction in the cytoplasmic domain of the human interleukin-4 receptor. The Journal of Biological Chemistry, 267(32):22752–22758, 1992.

[52] D. P. Harris, S. Goodrich, K. Mohrs, M. Mohrs, and F. E. Lund. Cutting edge: the development of IL-4-producing B cells (B eﬀector 2 cells) is controlled by IL-4, IL-4 receptor alpha, and Th2 cells. The Journal of Immunology, 175(11):7103–7107, 2005.

[53] P. H. Hart, G. F. Vitti, D. R. Burgess, G. A. Whitty, D. S. Piccoli, and J. A. Hamilton. Potential antiinﬂammatory eﬀects of interleukin 4: suppression of human monocyte tumor necrosis factor alpha, interleukin 1, and prostaglandin E2. Proceedings of the National Academy of Sciences, 86(10):3803–3807, 1989.

[54] A. S. Heiman, B. O. Abonyo, S. F. Darling-Reed, and M. A. Alexander. Cytokine- stimulated human lung alveolar epithelial cells release eotaxin-2 and eotaxin-3 (CCL26). Journal of Interferon and Cytokine Research, 25(2):82–91, 2005.

[55] F. P. Heinzel, M. D. Sadick, B.J. Holaday, R. L. Coﬀman, and R. M. Locksley. Reciprocal expression of interferon gamma or interleukin 4 during the resolution or progression of murine leishmaniasis. Evidence for expansion of distinct helper T cell subsets. The Journal of Experimental Medicine, 169(1):59–72, 1989. 66 BIBLIOGRAPHY

[56] D. J. Hilton, J. G. Zhang, D. Metcalf, W. S. Alexander, N. A. Nicola, and T. A. Willson. Cloning and characterization of a binding subunit of the interleukin-13 receptor that is also a component of the interleukin-4 receptor. Proceedings of the National Academy of Sciences, 93(1):497–501, 1996.

[57] Y. Hirano, S. Yoshinaga, K. Ogura, M. Yokochi, Y. Noda, H. Sumimoto, and F. Inagaki. Solution structure of atypical protein kinase C PB1 domain and its mode of interaction with ZIP/p62 and MEK5. The Journal of Biological Chemistry, 279(30):31883–31890, 2004.

[58] M. Howard, J. Farrar, M. Hilﬁker, B. Johnson, K. Takatsu, T. Hamaoka, and W.E. Paul. Identiﬁcation of a T cell derived B cell growth factor distinct from interleukin 2. The Journal of Experimental Medicine, 155(3):914–923, 1982.

[59] C. S Hsieh, A. B. Heimberger, J. S. Gold, A. O’Garra, and K. M. Murphy. Diﬀer- ential regulation of T helper phenotype development by interleukin 4 and 10 in an alpha beta T-cell-receptor transgenic system. Proceedings of the National Academy of Sciences, 89(13):6065–6069, 1992.

[60] J. Hu-Li, E. M. Shevach, J Mizuguchi, J. Ohara, T. Mosmann, and W. E. Paul. B cells stimulatory factor 1 (interleukin 4) is a potent costimulant for normal resting T lymphocytes. The Journal of Experimental Medicine, 165(1):157–172, 1987.

[61] H. M. Hytonen, O. Lowhagen, M. Arvidsson, B. Balder, A. L. Bjork, S. Lindgren, M. Hahn-Zoric, L. A. Hanson, and L. Padyukov. Haplotypes of the interleukin- 4 receptor alpha chain gene associate with susceptibility to and severity of atopic asthma. Clinical and Experimental Allergy, 34(10):1570–1575, 2004.

[62] J. N. Ihle. The Janus protein tyrosine kinase family and its role in cytokine signaling. Advances in Immunology, 60:1–35, 1995.

[63] J. N. Ihle. STATs: signal transducers and activators of transcription. Science, 84(3):331–334, 1996.

[64] T. Ishii, T. Yanagawa, T. Kawane, K. Yuki, J. Seita, H. Yoshida, and S. Bannai. Murine peritoneal macrophages induce a novel 60-kDa protein with structural sim- ilarity to a tyrosine kinase p56lck-associated protein in response to oxidative stress. Biochemical and Biophysical Research Communications, 226(2):456–460, 1996.

[65] S. Jaken and P. J. Parker. Protein kinase C binding partners. BioAssays, 22(3):245– 254, 2000.

[66] C. A. Janeway, P. Travers, M. Walport, and M. Slomchik. Immunobiology. The Immune System. Garland Publishing, New York and London, 2004.

[67] I. Joung, H. J. Kim, and Y. K. Kwon. P62 modulates Akt activity via association with PKCζ in neuronal survival and diﬀerentiation. Biochemical and Biophysical Research Communications, 334(2):654–660, 2005. BIBLIOGRAPHY 67

[68] I. Joung, J. L. Strominger, and J. Shin. Molecular cloning of a phosphotyrosine- independent ligand of the p56lck SH2 domain. Proceedings of the National Academy of Sciences, 93(12):5991–5995, 1996.

[69] M. H. Kaplan, U. Schindler, S.T. Smiley, and M. J. Grusby. Stat6 is required for mediating responses to IL-4 and for the development oh Th2 cells. Immunity, 4:313–319, 1996.

[70] H. Karasuyama, A. Rolink, and F. Melchers. Recombinant Interleukin 2 or 5, but not 3 or 4, induces maturation of resting mouse B lymphoytes and propagates proliferation of activated B cell blasts. The Journal of Experimental Medicine, 167:1377–1390, 1988.

[71] A. D. Keegan, K. Nelms, M. White, L. Wang, J. H. Pierce, and W. E. Paul. An IL-4 receptor containing an insulin receptor motif is important for IL-4-mediated IRS-1 phosphorylation and cell growth. Cell, 76:811–820, 1994.

[72] Y. Kido, N. Philippe, A. A. Schäffer, and M. Accili. Genetic modifiers of the insuline resistance phenotype in mice. Diabetes, 49:589–596, 2000.

[73] K. Kinoshita, M. Harigai, S. Fagarasan, M. Muramatsu, and T. Honjo. A hallmark of active class switch recombination: Transcripts directed by I promoters on looped- out circular DNAs. Proceedings of the National Academy of Sciences, 98(22):12620– 12633, 2001.

[74] T. Kitamura, A. Tojo, T. Kuwaki, S. Chiba, K Miyazono, A. Urabe, and F. Takaku. Identiﬁcation and analysis of human erythropoietin receptors on a factor-dependent cell line, TF–1. Blood, 73(2):375–380, 1989.

[75] M. Kopf, G. Le Gros, M. Bachmann, M. C. Lamers, H. Bluethmann, and G. Kohler. Disruption of the murine IL-4 gene blocks Th2 cytokine responses. Nature, 362(6417):245–248, 1993.

[76] H. Kotanides and N. C. Reich. Interleukin–4-induced STAT6 recognizes and activates a target site in the promotor of the interleukin-4 receptor gene. The Journal of Biological Chemistry, 271(41):25555–25561, 1996.

[77] N. Kozma, M. Halasz, B. Polgar, T. G. Poehlmann, U. R. Markert, T. Palkovics, M. Keszei, G. Par, K. Kiss, J. Szeberenyi, L. Grama, and J. Szekeres-Bartho. Progesterone-induced blocking factor activates STAT6 via binding to a novel IL4 receptor. The Journal of Immunology, 176(2):819–826, 2006.

[78] R. Kuhn, K. Rajewsky, and W. Muller. Generation and analysis of interleukin-4 deﬁcient mice. Science, 254(5032):707–710, 1991.

[79] U. K. Laemmli. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227:680–685, 1970. 68 BIBLIOGRAPHY

[80] S. Y. Lai, J. Molden, K. D. Liu, J. M. Puck, M. D. Hite, and M. A. Goldsmith. Interleukin-4-speciﬁc signal transduction events are driven by homotypic interactions of the interleukin-4 receptor alpha subunit. The EMBO Journal, 15(17):4506– 4514, 1996.

[81] M. J. Lallena, M. T. Diaz-Meco, G. Bren, C. V. Paya, and J. Moscat. Activation of I-kappaB kinase beta by protein kinase C isoforms. Molecular and Cellular Biology, 19(3):2180–2188, 1999.

[82] F. Letzelter, Y. Wang, and W. Sebald. The interleukin-4 site-2 epitope determining binding of the common receptor gamma chain. European Journal of Biochemistry, 257(1):11–20, 1998.

[83] D. Lin, A. S. Edwards, J. P. Fawcett, G. Mbamalu, J. D. Scott, and T. Pawson. A mammalian PAR-3-PAR-6 complex implicated in Cdc42/Rac1 and aPKC signaling and cell polarity. Nature Cell Biology, 2(8):540–547, 2000.

[84] A. Lischke, R. Moriggl, S. Brandlein, S. Berchtold, W. Kammer, W. Sebald, B. Groner, X. Liu, L. Henninghausen, and K. Friedrich. The interleukin-4 receptor activates STAT5 by a mechanism that relies upon common gamma-chain. The Journal of Biological Chemistry, 273(47):31222–31229, 1998.

[85] O. Livnah, E. A. Stura, D. L. Johnson, S. A. Middleton, L. S. Mulcahy, L. C. Wrighton, W. J. Dower, L. K. Jolliﬀe, and I. A. Wilson. Functional mimicry of a protein hormone by a peptide agonist: The EPO receptor complex at 2.8 a. Science, 273(5274):464–471, 1996.

[86] M. Lohoff, A. Gessner, C. Bogdan, and M. Röllinghoff. The Th1/Th2 paradigm and experimental murine leishmaniasis. International Archives of Allergy and Im- munology, 115(3):191–202, 1998.

[87] J. W. Lowenthal, B. E. Castle, J. Christiansen, J. Schreurs, D. Rennick, N. Arai, P. Hoy, J. Takebe, and M. Howard. Expression of high aﬃnity receptors for murine interleukin 4 (BSF-1) on hemopoietic and nonhemopoietic cells. The Journal of Immunology, 140(2):456–464, 1988.

[88] X. Mao, Y. Fujiwara, A. Chapdelaine, H. Yang, and S. H. Orkin. Activation of EGFP expression by Cre-mediated excision in a new ROSA26 reporter mouse strain. Blood, 97(1):324–326, 2001.

[89] S. L. Marcus, C. J. Winrow, J. P. Capone, and R. A. Rachubinski. A p56(lck) ligand serves as a coactivator of an orphan nuclear hormone receptor. The Journal of Biological Chemistry, 271(44):27197–27200, 1996.

[90] A. Maroof, M. Penny, R. Kingston, C. Murray, S. Islam, P. A. Bedford, and S. C. Knight. Interleukin-4 can induce interleukin-4 production in dendritic cells. Im- munology, 117(2):271–279, 2006. BIBLIOGRAPHY 69

[91] T. Mikita, D. Campbell, P. Wu, K. Williamson, and U. Schindler. Requirements for interleukin-4-induced gene expression and functional characterization of Stat6. Molecular and Cellular Biology, 16(10):5811–5820, 1996.

[92] B. Miloux, P. Laurent, O. Bonnin, J. Lupker, D. Caput, N. Vita, and P. Ferrara. Cloning of the human IL-13R alpha1 chain and reconstitution with the IL4R alpha of a functional IL-4/IL-13 receptor complex. Federation of European Biochemical Societies Letters, 401(1–2):163–166, 1997.

[93] B. Min, M. Prout, J. Hu-Li, J. Zhu, D. Jankovic, E. S. Morgan, J. F. Urban, A. M. Dvorak, F. D. Finkelman, G. LeGros, and W. E. Paul. Basophils produce IL-4 and accumulate in tissues after infection with a Th-2-inducing parasite. The Journal of Experimental Medicine, 200(4):507–517, 2004.

[94] M. Miyamasu, Y. Misaki, M. Yamaguchi, K. Yamamoto, Y. Morita, K. Matsushima, T. Nakajima, and K. Hirai. Regulation of human eotaxin generation by Th1-/Th2- derived cytokines. International Archives of Allergy and Immunology, 122:54–58, 2000.

[95] T. Miyazaki, A. Kawahara, H. Fujii, Y. Nakagawa, Z. J. Minami, Y. Liu, I. Oishi, O. Silvennoinen, B. A. Witthuhn, and J. N. Ihle. Functional activation of Jak1 and Jak3 by selective association with IL-2 receptor subunits. Science, 266(5187):1045– 1047, 1994.

[96] M. Mochizuki, J. Bartels, A. I. Mallet, E. Christophers, and J. M. Schroder. IL-4 induces eotaxin: a possible mechanism of selective eosinophil recruitment in helminth infection and atopy. The Journal of Immunology, 160(1):60–68, 1998.

[97] A. L. Mora, L. M. Stephenson, B. Enerson, J. Youn, A. D. Keegan, and M. Boothby. New programming of IL-4 receptor signal transduction in activated T cells: Stat6 induction and Th2 diﬀerentiation mediated by IL–4Rα lacking cytoplasmic tyrosines. The Journal of Immunology, 171:1891–1900, 2003.

[98] J. Moscat and M. T. Diaz-Meco. The atypical PKC scaﬀold protein P62 is a novel target for anti-inﬂammatory and anti-cancer therapies. Advances in Enzyme Regu- lation, 42:173–179, 2002.

[99] B. Mosley, M. P. Beckmann, C. J. March, R. L. Idzerda, S. D. Gimpel, T. Van- denBos, D. Friend, A. Alpert, D. Anderson, J. Jackson, J. M. Wignall, C. Smith, B. Gallis, J. E. Sims, D. Urdal, M. B. Widmer, D. Cosman, and L. S. Park. The murine interleukin-4 receptor: Molecular cloning and characterization of sectreted and membrane bound forms. Cell, 59:335–348, 1989.

[100] T. R. Mosmann, H. Cherwinski, M. W. Bond, M. A. Giedlin, and R. L. Coffman. Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. The Journal of Immunology, 136(7):2348– 2357, 1986. 70 BIBLIOGRAPHY

[101] K. Nelms, A. D. Keegan, J. Zamorano, J. J. Ryan, and W. E. Paul. The IL- 4 receptor: signaling mechanisms and biologic functions. Annu. Rev. Immunol., 17:701–738, 1999.

[102] N. Noben-Trauth, L. D. Shultz, F. Brombacher, J. F. Urban, H. Gu, and W. E. Paul. An interleukin 4 (IL-4)-independent pathway for CD4+ T cell IL-4 production is revealed in IL-4 receptor-deﬁcient mice. Proceedings of the National Academy of Sciences, 94(20):10838–10843, 1997.

[103] R. Noelle, P. H. Krammer, Ohara J., J. W. Uhr, and E. S. Vitette. Increased expression of Ia antigens on resting B cells: an additional role for B-cell growth factor. Proceedings of the National Academy of Sciences, 81(19):6149–6153, 1984.

[104] J. Ohara and W. E. Paul. Upregulation of interleukin 4/B-cell stimulatory factor 1 receptor expression. The Journal of Experimental Medicine, 85(21):8221–8225, 1988.

[105] M. Okazaki, S. Ito, K. Kawakita, S. Takeshita, S. Kawai, F. Makishima, H. Oda, and A. Kakinuma. Cloning, expression proﬁle, and genomic organization of the mouse STAP/A170 gene. Genomics, 60(1):87–95, 1999.

[106] P. L. Orchansky, S. D. Ayres, D. J. Hilton, and J. W. Schrader. An interleukin (IL)- 13 receptor lacking the cytoplasmic domain fails to transduce IL-13-induced signals and inhibits responses to IL-4. The Journal of Biological Chemistry, 272(36):22940– 22947, 1997.

[107] I. Park, J. Chung, C. T. Walsh, Y. Yun, and J. L. Strominger. Phosphotyrosine- independent binding of a 62-kDa protein to the src homology 2 (SH2) domain of p56lck and its regulation by phosphorylation of Ser-59 in the lck unique N-terminal region. Proceedings of the National Academy of Sciences, 92(26):12338–12342, 1995.

[108] J. Parrish-Novak, S. R. Dillon, A. Nelson, A. Hammond, C. Sprecher, J. A. Gross, J. Johnston, K. Madden, W. Xu, J. West, S. Schrader, S. Burkhead, M. Heipel, C. Brandt, J. L. Kuijper, J. Kramer, D. Conklin, S. R. Presnell, J. Berry, F. Shiota, S. Bort, K. Hambly, S. Mudri, C. Clegg, M. Moore, F. J. Grant, C. Lofton-Day, T. Gilbert, F. Rayond, A. Ching, L. Yao, D. Smith, P. Webster, T. Whitmore, M. Maurer, K. Kaushansky, R. D. Holly, and D. Foster. Interleukin-21 and its receptor are involved in NK cell expansion and regulation of lymphocyte function. Nature, 408(6808):57–63, 2000.

[109] M. Perander, G. Bjorkoy, and T. Johansen. Nuclear import and export signals enable rapid nucleocytoplasmatic shuttling of the atypical protein kinase C lambda. The Journal of Biological Chemistry, 276(16):13015–13024, 2001.

[110] A. B. Pernis and P. B. Rothman. JAK-STAT signaling in asthma. The Journal of Clinical Investigation, 109(10):1279–1283, 2002. BIBLIOGRAPHY 71

[111] S. M. Pope, N. Zimmermann, K. F. Stringer, M. L. Karo, and M. E. Rothenberg. The eotaxin chemokines and CCR3 are fundamental regulators of allergen-induced pulmonary eosinophilia. The Journal of Immunology, 175:5341–5350, 2005.

[112] D. C. Prasher, V. K. Eckenrode, W. W. Ward, F. G. Prendergat, and M. J. Cormier. Primary structure of the Aequorea victoria green-ﬂuorescent protein. Gene, 111(2):229–233, 1992.

[113] P. Puccetti, A. Mencacci, E. Cenci, R. Spaccapelo, P. Mosci, K. H. Enssle, L. Ro- mani, and F. Bistoni. Cure of murine candidiasis by recombinant soluble interleukin- 4 receptor. The Journal of Infectious Diseases, 169(6):1325–1331, 1994.

[114] A. Puls, S. Schmidt, F. Grawe, and S. Stabel. Interaction of protein kinase C ζ with ZIP, a novel protein kinase C-binding protein. Proceedings of the National Academy of Sciences, 94:6191–6196, 1997.

[115] M Ricci, A. Matucci, and O. Rossi. IL-4 as a key factor inﬂuencing the development of allergen-speciﬁc Th2-like cells in atopic individuals. Journal of Investigational Allergology and Clinical Immunology, 7(3):144–150, 1997.

[116] A. Rodriguez, A. Dur´an, M. Selloum, M. F. Champy, F. J. Diez-Guerra, J. M. Flores, M. Serrano, J. Auwerx, M. T. Diaz-Meco, and J. Moscat. Mature-onset obesity and insulin resistance in mice deﬁcient in the signaling adapter p62. Cell Metabolism, 3(3):211–222, 2006.

[117] L. Romani, A. Mencacci, U. Grohmann, S. Mocci, P. Mosci, P. Puccetti, and F. Bis- toni. Neutralizing antibody to interleukin 4 induces systemic protection and T helper type 1-associated immunity in murine candidiasis. The Journal of Experimental Medicine, 176(1):19–25, 1992.

[118] M. E. Rothenberg, J. A. MacLean, E. Pearlman, A. D. Luster, and P. Leder. Tar- geted disruption of the chemokine eotaxin partially reduces antigen-induced tissue eosinophilia. The Journal of Experimental Medicine, 185(4):785–790, 1997.

[119] S. M. Russell, A. D. Keegan, M. Harada, Y. Nakamura, M. Noguchi, P. Leland, M. C. Friedmann, A. Miyajima, R. K. Puri, and W. E. Paul. Interleukin-2 receptor gamma chain: a functional component of the interleukin-4-receptor. Science, 262(5141):1880–1883, 1993.

[120] J. J. Ryan, L. J. McReynolds, A. Keegan, L. H. Wang, E. Garfein, P. Rothman, K. Nelms, and W. E. Paul. Growth and gene expression are predominantly controlled by distinct regions of the human IL-4 receptor. Immunity, 4:123–132, 1996.

[121] M. D. Sadick, F. P. Heinzel, B. J. Holaday, R.T Pu, R. S. Dawkins, and R. M. Locksley. Cure of murine leishmaniasis with anti-interleukin 4 monoclonal antibody. Evidence for a T cell-dependent, interferon gamma-independent mechanism. The Journal of Experimental Medicine, 171(1):115–127, 1990. 72 BIBLIOGRAPHY

[122] I. S. Samuels, M. L. Seibenhener, K. B. Neidigh, and M. W. Wooten. Nerve growth factor stimulates the interaction of ZIP/p62 with atypical protein kinase C and targets endosomal localization: evidence for regulation of nerve growth factor-induced diﬀerentiation. Journal of Cellular Biochemistry, 82(3):452–466, 2001.

[123] P. Sanchez, G. DeCarcer, I. v.Sandoval, J. Moscat, and M. T. Diaz-Meco. Localiza- tion of atypical protein kinase C isoforms into lysosome-targeted endosomes through interaction with p62. Molecular and Cellular Biology, 18(5):3069–3080, 1998.

[124] L. Sanz, M. T. Diaz-Meco, H. Nakano, and J. Moscat. The atypical PKC-interacting protein p62 channels NF-kappaB activation by the IL-1-TRAF6 pathway. The EMBO Journal, 19(7):1576–1586, 2000.

[125] L. Sanz, P. Sanchez, M. J. Lallena, M. T. Diaz-Meco, and J. Moscat. The interaction of p62 with RIP links the atypical PKCs to NF-κB activation. The EMBO Journal, 18(11):3044–3053, 1999.

[126] D. C. Sch¨onwasser, C. J. Marais, R. M.and Marshall, and P. J. Parker. Activation of the mitogen-activated protein kinase/extracellular signal-regulated kinase pathway by conventional, novel, and atypical protein kinase C isotypes. Molecular and Cellular Biology, 18(2):790–798, 1998.

[127] J. T. Schroeder, L. M. Lichtenstein, E. M. Roche, H. Xiao, and M. C. Liu. IL- 4 production by human basophils found in the lung following segmental allergen challenge. Journal of Allergy and Clinical Immunology, 107:265–271, 2001.

[128] R. A. Seder, W. E. Paul, M. M. Davis, and B. Fazekas de St Groth. The presence of interleukin 4 during in vitro priming determines the lymphokine-producing potential of CD4+ T cells from T cell receptor transgenic mice. The Journal of Experimental Medicine, 176(4):1091–1098, 1992.

[129] D. C. Seldin and P. Leder. Mutational analysis of a critical signaling domain of the human interleukin 4 receptor. Proceedings of the National Academy of Sciences, 91:2140–2144, 1994.

[130] C. Smerz-Bertling and A. Duschl. Both interleukin 4 and interleukin 13 induce tyrosine phosphorylation of the 140-kDa subunit of the interleukin 4 receptor. The Journal of Biological Chemistry, 270(2):966–970, 1995.

[131] W. Solbach, K. Forberg, and M. Röllinghoff. Effect of T-lymphocyte suppression on the parasite burden in Leishmania major–infected, genetically susceptible BALB/c mice. Infection and Immunity, 54(3):909–912, 1986.

[132] P. Soriano. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nature Genetics, 21(1):70–71, 1999.

[133] E. M. Southern. Detection of speciﬁc sequences among DNA fragments separated by gel electrophoresis. Journal of Molecular Biology, 98(3):503–517, 1975. BIBLIOGRAPHY 73

[134] O. Sozeri, K. Vollmer, M. Liyanage, D. Frith, G. Kour, G. E. Mark, and S. Sta- bel. Activation of the c-Raf protein kinase by protein kinase C phosphorylation. Oncogene, 7(11):2259–2262, 1992.

[135] S. Srinivas, T. Watanabe, C. S. Lin, C. M. William, Y. Tanabe, T. M. Jessell, and F. Costantini. Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus. BMC Developmental Biology, 1(1):1–4, 2001.

[136] L. M. Stephenson, D. S. Park, A. L. Mora, S. Goenka, and M. Boothby. Sequence motifs in IL-4R alpha mediating cell-cycle progression of primary lymphocytes. The Journal of Immunology, 175(8):5178–5185, 2005.

[137] T. Sudo, M. Maruyama, and H. Osada. p62 functions as a p38 MAP kinase regulator. Biochemical and Biophysical Research Communications, 269(2):521–525, 2000.

[138] K. Sugamura, H. Asao, M. Kondo, N. Tanka, N. Ishii, K. Ohbo, M. Nakamura, and T. Takeshita. The interleukin-2 receptor gamma chain: its role in the multiple cytokine receptor complexes and T cell development in XSCID. Annual Review of Immunology, 14:179–205, 1996.

[139] X. J. Sun, D. L. Crimmins, M. G. Myers, M. Miralpeix, and M. F. White. Pleiotropic insulin signals are engaged by multisite phosphorylation of IRS-1. Molecular and Cellular Biology, 13(12):7418–7428, 1993.

[140] X. J. Sun, P. Rothenberg, C. R. Kahn, J. M. Backer, E. Araki, P. A. Wilden, D. A. Cahill, B. J. Goldstein, and M. F. White. Structure of the insuline receptor substrate IRS-1 deﬁnes a unique signal transduction protein. Nature, 352(6330):73–77, 1991.

[141] X. J. Sun, L. M. Wang, Y. Zhang, L. Yenush, M. G. Myers, E. Glasheen, W. S. Lane, J. H. Pierce, and M. F. White. Role of IRS-2 in insulin and cytokine signalling. Nature, 377(6545):173–177, 1995.

[142] H. Takatori, H. Nakajima, K. Hirose, S. Kagami, T. Tamachi, A. Suto, K. Suzuki, Y. Saito, and I. Iwamoto. Indispensable role of Stat5 in Stat6-independent Th2 cell diﬀerentiation and allergic inﬂammation. The Journal of Immunology, 174(6):3734– 3740, 2005.

[143] R. I. Tepper, D. A. Levinson, B. Z. Stanger, J. Campos-Torres, A. K. Abbas, and P. Leder. IL-4 induces allergic-like inﬂammatory disease and alters T cell development in transgenic mice. Cell, 62(3):457–467, 1990.

[144] A. Thiel. Charakterisierung neuer Interleukin-4 Rezeptor Signaltransduktionswege. PhD thesis University of Erlangen, Erlangen, 2001.

[145] M. H. Thornhill, S. M. Wellicome, D. L. Mahiouz, J. S. Lanchbury, U. Kyan-Aung, and D. O. Haskard. Tumor necrosis factor combines with IL-4 or IFN-gamma to selectively enhance endothelial cell adhesiveness for T cells. The contribution of vascular cell adhesion molecule-1-dependent and -independent binding mechanisms. The Journal of Immunology, 146(2):592–598, 1991. 74 BIBLIOGRAPHY

[146] D. W. Threadgill, D. Yee, A. Matin, J. H. Nadeau, and T. Magnuson. Genealogy of the 129 inbred strains: 129/SvJ is a contaminated inbred strain. Mammalian Genome, 8:390–393, 1997.

[147] G. J. Todaro, K. Habel, and H. Green. Antigenic and cultural properties of cells doubly transformed by polyoma virus and SV40. Virology, 27:179–185, 1965.

[148] M. Tymms and I. Kola. Gene Knockout Protocols. Humana Press, Totawa, New Jersey, 2001.

[149] F. Uberall, K. Hellbert, S. Kampfer, K. Maly, A. Villunger, M. Spitaler, J. Mwan- jewe, G. Baier-Bitterlich, G. Baier, and H. H. Grunicke. Evidence that atypical protein kinase C-lambda and atypical protein kinase C-zeta participate in Ras- mediated reorganization of the F-actin cytoskeleton. The Journal of Cell Biology, 144(3):413–425, 1999.

[150] E. S. Vitetta, J Ohara, C. D. Myers, J. E. Layton, P. H. Krammer, and W. E. Paul. Serological, biochemical, and functional identity of B cell-stimulatory factor 1 and B cell diﬀerentiation factor for IgG1. The Journal of Experimental Medicine, 162(5):1726–1731, 1985.

[151] C. J. Vlahos, W. F. Matter, K. Y. Hui, and R. F. Brown. A speciﬁc inhibitor of phosphatidylinositol 3-kinase, 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one (LY294002). The Journal of Biological Chemistry, 269(7):5241–5248, 1994.

[152] E. Wakeland, L. Morel, K. Achey, M. Yui, and J. Longmate. Speed congenics: a clas- sic technique in the fast lane (relatively speaking). Immunology Today, 18(10):472– 477, 1997.

[153] M. R. Walter, W. J. Cook, B. G. Zhao, R. P. Cameron, S. E. Ealick, R. L. Walter, P. Reichert, T. L. Nagabhushan, P. P. Trotta, and C. E. Bugg. Crystal structure of recombinant human interleukin-4. The Journal of Biological Chemistry, 267(28):20371–20376, 1992.

[154] D. Wang, J. Zamorano, A. D. Keegan, and M. Boothby. HMG-I(Y) phosphorylation status as a nuclear target regulated through insulin receptor substrate-1 and the I4R motif of the interleukin-4 receptor. The Journal of Biological Chemistry, 272(40):25083–25090, 1997.

[155] L. M. Wang, A. D. Keegan, W. Li, G. E Lienhard, S. Pacini, J. S. Gutkind, M. G. Myers, X. J. Sun, M. F. White, and S. A. Aaronson. Common elements in interleukin 4 and insulin signaling pathways in factor-dependent hematopoietic cells. Proceedings of the National Academy of Sciences, 90(9):4032–4036, 1993.

[156] R. Weiss, S. Scheiblhofer, J. Freund, F. Ferreira, I. Livey, and J. Thalhamer. Gene gun bombardment with gold particles displays a particular Th2–promoting signal that over-rules the Th1–inducing eﬀect of immunostimulatory CpG motifs in DNA vaccines. Vaccine, 20:3148–3154, 2002. BIBLIOGRAPHY 75

[157] M. I. Wilson, D. J. Gill, O. Perisic, M. T. Quinn, and R. L. Williams. PB1 domain- mediated heterodimerization in NADPH oxidase and signaling complexes of atypical protein kinase C with Par6 and p62. Molecular Cell, 12:39–50, 2003.

[158] N. Wood, M. J. Whitters, B. A. Jacobson, J. Witek, J. P. Sypek, M. Kasaian, M. J. Eppihimer, M. Unger, T. Tanaka, S. J. Goldmann, M. Collins, D. D. Donaldson, and M. J. Grusby. Enhanced interleukin (IL)-13 responses in mice lacking IL-13 receptor alpha 2. The Journal of Experimental Medicine, 197(6):703–709, 2003.

[159] M. W. Wooten, M. L. Seibenhener, V. Mamidipudi, M. T. Diaz-Meco, P. A. Barker, and J. Moscat. The atypical protein kinase C-interacting protein p62 is a scaﬀold for NF-κB activation by nerve growth factor. The Journal of Biological Chemistry, 276(11):7709–7712, 2001.

[160] T. Yin, S. R. Keller, F. W. Quelle, B. A. Witthuhn, M. L. Tsang, G. E. Lienhard, J. N. Ihle, and Y. C. Yang. Interleukin-9 induces tyrosine phosphorylation of insulin receptor substrate-1 via JAK tyrosine kinases. The Journal of Biological Chemistry, 270(35):20497–20502, 1995.

[161] B. P. Zambrowicz, A. Imamoto, S. Fiering, L. A. Herzenberg, W. G. Kerr, and P. So- riano. Disruption of overlapping transcripts in the ROSA βgeo 26 gene trap strain leads to widespread expression of β-galactosidase in mouse embryos and hematopoietic cells. Proceedings of the National Academy of Sciences, 94:3789–3794, 1997.

[162] J. Zhu, L. Guo, B. Min, C. J. Watson, J. Hu-Li, H. A. Young, P. N. Tsichlis, and W. E. Paul. Growth factor independent-1 induced by IL-4 regulates Th2 cell proliferation. Immunity, 16(5):733–744, 2002. 76 BIBLIOGRAPHY Danksagung

Zuerst möchte ich mich ganz herzlich bei meinem Betreuer und Doktorvater Prof. Dr. Dr. AndréGessner bedanken. Die Möglichkeiten, in seiner Arbeitsgruppe das interessante und vielschichtige Thema der IL-4R Signaltransduktion zu bearbeiten, waren wirklich ausgezeichnet. Als besonders positiv möchte ich die methodische Vielfalt erwähnen, mit der Fragestellungen angegangen werden konnten, so dass die Laborarbeit immer wieder neue und spannende Aspekte erhielt. Trotz seiner vielen anderen Verpflichtungen war er stets zu fachlichen Diskussionen bereit, und hat dadurch erheblich zum Gelingen dieser Arbeit beigetragen.

Herrn Prof. Dr. Martin Röllinghoff danke ich fur¨ die Möglichkeit diese Arbeit an seinem Lehrstuhl anzufertigen und die hervorragende Ausstattung des Instituts zu nutzen.

Meinem Zweitgutachter Prof. Dr. Thomas Winkler, sowie PD Dr. Andreas Pahl, den Mit- gliedern meiner Betreuungskommission im Rahmen des Graduiertenkollegs Lymphozyten, danke ich besonders fur¨ die interessanten und fruchtbaren Diskussionen und Vorschläge. Ferner danke ich allen Mitgliedern des GRK 592, vor allem seinem Sprecher Prof. Dr. Hans–Martin Jäck, fur¨ die schöne Zeit im Kolleg und die vielfältigen Möglichkeiten bei Seminaren, Symposien, Kursen und Kongressen Fähigkeiten jenseits der Laborarbeit zu erlangen.

Ein großes Dankeschön geht an alle Mitarbeiter der Arbeitsgruppe Gessner, die fur¨ eine angenehme Arbeitsatmosphäre gesorgt, und mich auf verschiedenste Art und Weise unterstutzt¨ haben. Besonders möchte ich hier Heike Danzer erwähnen, die mir im ersten Jahr der Doktorarbeit bei unzähligen Versuchen geholfen hat, sowie Andrea Debus und Rimma Husch, die bei methodischen Problemen stets kompetente Auskunft geben konnten. Ein besonderes Dankeschön möchte ich Gerhard Groer und Dr. Thomas Bebenek, meinen beiden Mitstreitern“ im IL-4 Projekt, aussprechen, die mir durch unzählige Gespräche ” fachlicher und weniger fachlicher Art uber¨ manche Durststrecke hinweggeholfen haben. Gerhard Groer danke ich ferner fur¨ das erste (und sicher schlimmste) Korrekturlesen meiner Arbeit.

Der Rest“ der Arbeitsgruppe Gessner soll naturlich¨ auch erw¨ahnt werden: Harald Arnold, ” Kerstin Blessing, Claudia Giessler, Joachim Gl¨asner, Stefanie Kranich und unsere Medi- ziner Max Traxdorf und Gabriel Wenzel haben alle auf ihre Weise zum guten Arbeitsklima beigetragen. Ausserdem war die Schokoladen-Schublade immer gut gefullt!¨

77 78 DANKSAGUNG

Ein ganz herzliches Dankesch¨on m¨ochte ich Christianne Leidecker fur¨ die Installation von LATEX aussprechen, sowie Timo Berkus fur¨ die unglaublich geduldige Hilfe bei der Formatierung der Arbeit und bei sonstigen Computerproblemen.

Allen anderen, die zum Gelingen dieser Arbeit beigetragen haben, sei an dieser Stelle ebenfalls gedankt. Besonders zu erwähnen sind hier Katrin Freund, Jörg Freund und Martin Leyh, die zu unzähligen Gelegenheiten mit Sushis, Feierabend–Bier, Grillpartys usw. fur¨ die nötige Ablenkung gesorgt haben.

Zuletzt m¨ochte ich mich ganz besonders bei meinem Mann Christoph fur¨ seinen wunder- baren und humorvollen Beistand bedanken. Er hat meine Entscheidung zu promovieren stets unterstutzt¨ und konnte mich bei experimentellen Ruckschl¨ ¨agen immer wieder auf- bauen (dafur¨ gibt es jetzt auch einen Dr. auf dem Turschild!).¨

Danke! Lebenslauf

Name Burgis.¨ geb. Wolf Vorname(n) Susanne Barbara Geburtsdatum 8. Juni 1976 Geburtsort Nurnberg¨ Staatsangehörigkeit deutsch Schulbildung 1982–1986 Grundschule Viatisstraße Nurnberg¨ 1986–1995 Martin–Behaim Gymnasium Nurnberg¨ 1995 Abitur am Martin–Behaim Gymnasium Nurnberg¨ Hochschulstudium WS 1995/96 Einschreibung in Lehramt fur¨ Gymnasien ” Biologie und Chemie“ an der FAU Erlangen–Nurnberg¨ Aug. 1997 Zwischenprufung¨ Chemie März 1998 Zwischenprufung¨ Biologie Okt. 1999 Zulassungsarbeit in anorganischer Chemie bis Okt. 2000 (Prof. van Eldik) Fruhjahr¨ 2001 vorgezogenes Staatsexamen in den Erziehungswissenschaften Fruhjahr¨ 2002 fachliches Staatsexamen Juli 2002 Studienabschluss Beschäftigung Okt. 2002 Wissenschaftliche Mitarbeiterin der bis Feb. 2003 Medizinischen Klinik III FAU Erlangen–Nurnberg¨ ab März 2003 Promotionsbeginn in der AG Gessner Institut fur¨ Klinische Mikrobiologie, Immunologie und Hygiene FAU Erlangen–Nurnberg¨ Mai 2003 Promotionsstipendium GRK 592 Lymphozyten “ ” bis Apr. 2006 ab Mai 2006 HWP Promotionsstipendium FAU Erlangen–Nurnberg¨