MOLECULAR DETECTION OF HUMAN FUNGAL PATHOGENS
MOLECULAR DETECTION OF HUMAN FUNGAL PATHOGENS
EDITED BY DONGYOU LIU
Boca Raton London New York
CRC Press is an imprint of the Taylor & Francis Group, an informa business CRC Press Taylor & Francis Group 6000 Broken Sound Parkway NW, Suite 300 Boca Raton, FL 33487-2742 © 2011 by Taylor & Francis Group, LLC CRC Press is an imprint of Taylor & Francis Group, an Informa business
No claim to original U.S. Government works Version Date: 20120725
International Standard Book Number-13: 978-1-4398-1241-9 (eBook - PDF)
This book contains information obtained from authentic and highly regarded sources. Reasonable efforts have been made to publish reliable data and information, but the author and publisher cannot assume responsibility for the validity of all materials or the consequences of their use. The authors and publishers have attempted to trace the copyright holders of all material reproduced in this publication and apologize to copyright holders if permission to publish in this form has not been obtained. If any copyright material has not been acknowledged please write and let us know so we may rectify in any future reprint.
Except as permitted under U.S. Copyright Law, no part of this book may be reprinted, reproduced, transmitted, or utilized in any form by any electronic, mechanical, or other means, now known or hereafter invented, including photocopying, microfilming, and recording, or in any information storage or retrieval system, without written permission from the publishers.
For permission to photocopy or use material electronically from this work, please access www.copyright.com (http://www.copyright.com/) or contact the Copyright Clearance Center, Inc. (CCC), 222 Rosewood Drive, Danvers, MA 01923, 978-750-8400. CCC is a not-for-profit organization that provides licenses and registration for a variety of users. For organizations that have been granted a photocopy license by the CCC, a separate system of payment has been arranged.
Trademark Notice: Product or corporate names may be trademarks or registered trademarks, and are used only for identification and explanation without intent to infringe. Visit the Taylor & Francis Web site at http://www.taylorandfrancis.com and the CRC Press Web site at http://www.crcpress.com This volume is dedicated to a group of international mycologists, whose in-depth knowledge and technical expertise have made an all inclusive coverage of major human fungal pathogens possible.
Contents
Preface...... xv Editor ...... xvii Contributors ...... xix
Chapter 1 Introductory Remarks ...... 1 Dongyou Liu
PART I Ascomycota
Pezizomycotina: Dothideomycetes
Chapter 2 Alternaria ...... 27 Giuliana Lo Cascio and Marco Ligozzi
Chapter 3 Aureobasidium ...... 37 Miia Pitkäranta and Malcolm D. Richardson
Chapter 4 Bipolaris and Drechslera ...... 49 Dongyou Liu and Joanna Gray
Chapter 5 Botryomyces ...... 57 Dongyou Liu and R.R.M. Paterson
Chapter 6 Botryosphaeria and Lasiodiplodia ...... 61 Dongyou Liu
Chapter 7 Corynespora ...... 65 Dongyou Liu and Po-Ren Hsueh
Chapter 8 Curvularia ...... 71 Audrey N. Schuetz
Chapter 9 Exserohilum...... 83 K. Lily Therese and H.N. Madhavan
Chapter 10 Fusicoccum and Scytalidium ...... 93 Marie Machouart and Jean Menotti
Chapter 11 Hortaea ...... 101 Dongyou Liu and Larry Hanson
vii viii Contents
Chapter 12 Leptosphaeria ...... 105 Dongyou Liu
Chapter 13 Macrophomina ...... 109 Artur Alves, Alan J.L. Phillips, and António Correia
Chapter 14 Madurella ...... 117 Wendy W.J. van de Sande, Ahmed H. Fahal, G. Sybren de Hoog, and Alex van Belkum
Chapter 15 Neodeightonia ...... 129 Artur Alves, Alan J.L. Phillips, and António Correia
Chapter 16 Phoma and Phomopsis ...... 135 Dongyou Liu
Chapter 17 Piedraia ...... 141 Dongyou Liu
Chapter 18 Pyrenochaeta ...... 145 Dongyou Liu
Chapter 19 Ramichloridium...... 151 Dongyou Liu
Chapter 20 Ulocladium ...... 157 Dongyou Liu
Pezizomycotina: Eurotiomycetes
Chapter 21 Acrophialophora ...... 163 Dongyou Liu
Chapter 22 Arthrographis ...... 167 Dongyou Liu
Chapter 23 Aspergillus ...... 171 Maiken Cavling Arendrup, Yanan Zhao, and David S. Perlin
Chapter 24 Blastomyces ...... 189 Mark D. Lindsley
Chapter 25 Chrysosporium ...... 203 Dongyou Liu and R.R.M. Paterson Contents ix
Chapter 26 Cladophialophora ...... 209 Rubén Lopez-Martínez and Francisca Hernández-Hernández
Chapter 27 Coccidioides ...... 217 Rossana de Aguiar Cordeiro, Raimunda Sâmia Nogueira Brilhante, Marcos Fábio Gadelha Rocha, and José Júlio Costa Sidrim
Chapter 28 Cyphellophora ...... 231 Dongyou Liu
Chapter 29 Emmonsia ...... 235 Dongyou Liu and R.R.M. Paterson
Chapter 30 Epidermophyton ...... 241 Dongyou Liu and Susan Coloe
Chapter 31 Exophiala ...... 247 Dongyou Liu and Shoo Peng Siah
Chapter 32 Fonsecaea ...... 255 Hideki Miyagi
Chapter 33 Histoplasma ...... 263 Rosely Maria Zancopé Oliveira, Allan Jefferson Guimarães, Joshua D. Nosanchuk, Mauro de Medeiros Muniz, Priscila Costa Albuquerque, and Rodrigo de Almeida Paes
Chapter 34 Lacazia ...... 275 Dongyou Liu and Yi-Wei Tang
Chapter 35 Lecythophora ...... 281 Dongyou Liu
Chapter 36 Microsporum ...... 285 Rahul Sharma and Yvonne Gräser
Chapter 37 Myriodontium ...... 299 Dongyou Liu
Chapter 38 Onychocola ...... 303 Dongyou Liu
Chapter 39 Paecilomyces ...... 309 Ana Alastruey-Izquierdo, Maria Victoria Castelli, Leticia Bernal-Martinez, and Manuel Cuenca-Estrella x Contents
Chapter 40 Paracoccidioides ...... 317 Eduardo Bagagli, Sandra de Moraes Gimenes Bosco, Virgínia Bodelão Richini-Pereira, Raquel Cordeiro Theodoro, and Sílvio Alencar Marques
Chapter 41 Penicillium: Mycoses and Mycotoxinoses ...... 329 R.R.M. Paterson and N. Lima
Chapter 42 Phialophora ...... 345 Dongyou Liu and R.R.M. Paterson
Chapter 43 Rhinocladiella ...... 351 Dongyou Liu
Chapter 44 Trichophyton ...... 357 Sharon C.-A. Chen, David Ellis, Tania C. Sorrell, and Wieland Meyer
Chapter 45 Veronaea...... 377 Dongyou Liu
Pezizomycotina: Sordariomycetes
Chapter 46 Acremonium ...... 385 Dongyou Liu, Xianghong Du, and Song Weining
Chapter 47 Beauveria ...... 391 Dongyou Liu
Chapter 48 Chaetomium ...... 397 Dongyou Liu and R.R.M. Paterson
Chapter 49 Colletotrichum ...... 401 M.R. Shivaprakash, Abhishek Baghela, and Arunaloke Chakrabarti
Chapter 50 Cylindrocarpon ...... 411 Dongyou Liu
Chapter 51 Fusarium ...... 417 Palanisamy Manikandan, László Galgóczy, Kanesan Panneer Selvam, Coimbatore Subramanian Shobana, Sándor Kocsubé, Csaba Vágvölgyi, Venkatapathy Narendran, and László Kredics
Chapter 52 Microascus, Including Scopulariopsis ...... 435 Jouni Issakainen and Dongyou Liu Contents xi
Chapter 53 Myceliophthora and Thielavia ...... 445 Dongyou Liu
Chapter 54 Neocosmosporas ...... 449 Palanisamy Manikandan, Csaba Vágvölgyi, Venkatapathy Narendran, Kanesan Panneer Selvam, and László Kredics
Chapter 55 Ochroconis ...... 459 Ayako Sano and Kyoko Yarita
Chapter 56 Phaeoacremonium ...... 469 László Galgóczy, Laura Kovács, Tamás Papp, and Csaba Vágvölgyi
Chapter 57 Phialemonium ...... 481 Dongyou Liu and R.R.M. Paterson
Chapter 58 Pseudallescheria and Scedosporium ...... 485 Ana Alastruey-Izquierdo, Maria Victoria Castelli, Leticia Bernal-Martinez, and Juan Luis Rodríguez Tudela
Chapter 59 Sarcopodium ...... 493 Dongyou Liu and R.R.M. Paterson
Chapter 60 Sporothrix and Sporotrichosis ...... 497 Conchita Toriello, María del Rocío Reyes-Montes, Armando Pérez-Torres, and Amelia Pérez-Mejía
Chapter 61 Stachybotrys ...... 511 Dongyou Liu and R.R.M. Paterson
Chapter 62 Trichoderma ...... 517 László Kredics, Lóránt Hatvani, László Manczinger, Csaba Vágvölgyi, and Zsuzsanna Antal
Chapter 63 Verticillium ...... 535 Malena P. Pantou and Milton A. Typas
Saccharomycotina and Taphrinomycotina
Chapter 64 Candida ...... 551 P. Lewis White, Michael D. Perry, and Rosemary A. Barnes
Chapter 65 Debaryomyces ...... 569 María J. Andrade, Mar Rodríguez, Elena Bermúdez, Félix Núñez, Miguel A. Asensio, and Juan J. Córdoba xii Contents
Chapter 66 Geotrichum...... 581 Silvia D’Arezzo, Paolo Visca, and Corrado Girmenia
Chapter 67 Kluyveromyces ...... 591 Dongyou Liu
Chapter 68 Pichia and Kodamaea ...... 595 Dongyou Liu
Chapter 69 Pneumocystis ...... 603 Steve M. Taylor and Steven R. Meshnick
Chapter 70 Saccharomyces ...... 615 Franca Rossi and Sandra Torriani
PART II Bastidiomycota
Chapter 71 Coprinopsis and Hormographiella ...... 629 Dongyou Liu and R.R.M. Paterson
Chapter 72 Cryptococcus ...... 633 Massimo Cogliati, Anna Maria Tortorano, and Maria Anna Viviani
Chapter 73 Malassezia ...... 643 Takashi Sugita, Mami Tajima, Hisae Tsubuku, Mayumi Miyamoto, Enshi Zhang, Ryoji Tsuboi, Masako Takashima, Yoshio Ishibashi, and Akemi Nishikawa
Chapter 74 Rhodotorula ...... 653 Diego Libkind
Chapter 75 Schizophyllum ...... 669 Sophie Cassaing, Marie-Denise Linas, and Antoine Berry
Chapter 76 Sporobolomyces ...... 677 Dongyou Liu
Chapter 77 Trichosporon ...... 681 Takashi Sugita, Reiko Ikeda, Akemi Nishikawa, Masako Takashima, Nanthawan Mekha, Natteewan Poonwan, Ayse Kalkanci, and Semra Kustimur
Chapter 78 Ustilago and Pseudozyma ...... 687 Dongyou Liu Contents xiii
Chapter 79 Wallemia ...... 693 Dongyou Liu
PART III Entomohpthoromycotina and Mucoromyotina
Chapter 80 Apophysomyces ...... 699 Arunaloke Chakrabarti, Shiv Sekhar Chatterjee, and Varghese K. George
Chapter 81 Cokeromyces ...... 709 Dongyou Liu
Chapter 82 Cunninghamella ...... 713 Nancy L. Wengenack and D. Jane Hata
Chapter 83 Entomophthorales ...... 723 Johannes E. Rothhardt, Volker U. Schwartze, and Kerstin Voigt
Chapter 84 Lichtheimia (Absidia-Like Fungi)...... 735 Kerstin Hoffmann and Kerstin Voigt
Chapter 85 Mortierella ...... 749 Tamás Papp, Kerstin Hoffmann, Ildikó Nyilasi, Tamás Petkovits, Lysett Wagner, Csaba Vágvölgyi, and Kerstin Voigt
Chapter 86 Mucor ...... 759 Peter C. Iwen
Chapter 87 Rhizopus ...... 773 Dongyou Liu and Frank W. Austin
Chapter 88 Rhizomucor ...... 783 Tamás Papp, Ildikó Nyilasi, Miklós Takó, László G. Nagy, and Csaba Vágvölgyi
Chapter 89 Saksenaea ...... 791 Eric Dannaoui
Chapter 90 Syncephalastrum ...... 799 Dongyou Liu
PART IV Microsporidia
Chapter 91 Anncaliia (Brachiola) ...... 807 Govinda S. Visvesvara and Lihua Xiao xiv Contents
Chapter 92 Encephalitozoon ...... 817 Dongyou Liu and Elizabeth S. Didier
Chapter 93 Enterocytozoon ...... 827 Jaco J. Verweij and Dongyou Liu
Chapter 94 Nosema, Vittaforma, and Microsporidium ...... 837 Dongyou Liu
Chapter 95 Pleistophora and Trachipleistophora ...... 843 Dongyou Liu
PART V Oomycota, Chlorophyta, and Mesomycetozoea
Chapter 96 Pythium ...... 851 Theerapong Krajaejun, Boonmee Sathapatayavongs, and Thomas D. Sullivan
Chapter 97 Prototheca ...... 865 Uwe H. Roesler
Chapter 98 Rhinosporidium ...... 871 S.N. Arseculeratne
PART VI Panfungal and Drug Resistance Detection
Chapter 99 Nucleic Acid-Based Panfungal Detection...... 891 Sandra Preuner and Thomas Lion
Chapter 100 Molecular Characterization of Fungal Drug Resistance ...... 903 Maurizio Sanguinetti, Brunella Posteraro, and Patrizia Posteraro Preface
Fungi are a diverse group of eukaryotic organisms that range developments to know which are most appropriate to use for from yeasts, molds, mushrooms, lichens, rusts, smuts, to streamlined identication and detection of fungal organisms microsporidia. Forming a kingdom of their own and being of interest. ubiquitously distributed in all environments, most fungi are With contributions from international scientists in respec- saprophytes involved in the decomposition and recycling tive fungal pathogen research and diagnosis, this book aims of organic matters as well as in the formation of symbiotic to provide a reliable and comprehensive source relating the relationship with plants and animals. However, some fungi molecular detection and identication of major human fun- have the capacity to cause diseases in plants, animals, and gal pathogens. Each chapter consists of a brief review on the humans. Often occurring as a result of trauma or underlying classication, epidemiology, clinical features, and diagno- immunosuppression, human mycoses may manifest as super- sis of one or a group of related fungal species; an outline cial, cutaneous, subcutaneous, or systemic diseases. The of clinical sample collection and preparation procedures; a inability to distinguish human mycoses caused by various selection of representative stepwise molecular protocols; fungal pathogens on clinical ground necessitates the develop and a discussion on additional research for further improv- ment and use of laboratory diagnostic procedures in order to ing the diagnosis. This book represents an indispensable tool facilitate their treatment and prevention. for both upcoming and experienced medical, veterinary, and Given their complex life cycle and their tendency to pro- industrial laboratory scientists engaged in fungus character- duce morphologically similar structures, fungi are notori- ization and provides an essential reference for undergraduate ously difcult to identify on the basis of their macroscopic and graduate students majoring in mycology. and microscopic features, even for an experienced mycolo- An all-encompassing book such as this clearly demands a gist. To increase the accuracy, sensitivity, and efciency of concerted team’s efforts. I am fortunate and extremely hon- fungal identication, molecular techniques such as PCR ored to have had a large group of international mycologists and nucleotide sequencing have been increasingly adopted as chapter contributors, whose in-depth knowledge and tech- and applied in research and clinical laboratories worldwide. nological insights into human fungal pathogen detection have Consequently, a large number of molecular protocols have signicantly enriched this book. Additionally, the profession- been described in the literature for the identication and alism and dedication of executive editor Barbara Norwitz and detection of fungal organisms. As the saying goes, one per- senior project coordinator Jill Jurgensen at CRC Press have son’s medicine could easily turn into another’s poison. There enhanced its presentation. Finally, without the understand- is certainly no exception here. The overabundance of origi- ing and support of my family, Liling Ma, Brenda, and Cathy, nal protocols and subsequent modications has created a the compilation of this comprehensive book would have been dilemma for anyone who was not directly involved in their unimaginable.
xv
Editor
Dongyou Liu, PhD, undertook his veterinary science edu- dermatophyte fungi (Trichophyton, Microsporum, and cation at Hunan Agricultural University, Changsha, China. Epidermophyton), and listeriae (Listeria species). He is the Upon graduation, he received an overseas postgraduate rst author of more than 50 original research and review scholarship from the Chinese Ministry of Education to articles in various international journals and the editor of pursue further training at the University of Melbourne, the recently released Handbook of Listeria monocytogenes Melbourne, Victoria, Australia, where he worked toward (2008), Handbook of Nucleic Acid Puri¡cation (2009), improved immunological diagnosis of human hydatid dis- Molecular Detection of Foodborne Pathogens (2009), ease. During the past two decades, he has crisscrossed Molecular Detection of Human Viral Pathogens (2010), between research and clinical laboratories in Australia and and Molecular Detection of Human Bacterial Pathogens the United States, with focuses on molecular characteriza- (2011), as well as the forthcoming Molecular Detection of tion and virulence determination of microbial pathogens Human Parasitic Pathogens (2012), all of which are pub- such as ovine footrot bacterium (Dichelobacter nodosus), lished by CRC Press.
xvii
Contributors
Ana Alastruey-Izquierdo Eduardo Bagagli Raimunda Sâmia Nogueira Centro Nacional de Microbiologia Departamento de Microbiologia e Brilhante Instituto de Salud Carlos III Imunologia Specialized Medical Mycology Center Majadahonda, Spain Instituto de Biociências Federal University of Ceará Universidade Estadual Ceará, Brazil Priscila Costa Albuquerque Paulista-Botucatu Laboratório de Micologia Sao Paulo, Brazil Sophie Cassaing Instituto de Pesquisa Clinica Evandro Department of Parasitology and Chagas Abhishek Baghela Mycology Fundação Oswaldo Cruz Division of Mycology Faculty of Medicine Purpan Rio de Janeiro, Brazil Department of Medical Microbiology Toulouse University Hospitals Postgraduate Institute of Medical Toulouse University Artur Alves Education and Research Toulouse, France Departamento de Biologia Chandigarh, India Centro de Estudos do Ambiente e do Maria Victoria Castelli Mar Rosemary A. Barnes Centro Nacional de Microbiologia Universidade de Aveiro School of Medicine Instituto de Salud Carlos III Aveiro, Portugal University Hospital of Wales Majadahonda, Spain Cardiff University María J. Andrade Cardiff, United Kingdom Arunaloke Chakrabarti Higiene y Seguridad Alimentaria Division of Mycology Facultad de Veterinaria Alex van Belkum Department of Medical Microbiology Universidad de Extremadura Department of Medical Microbiology Postgraduate Institute of Medical Cáceres, Spain and Infectious Diseases Education and Research Erasmus Medical Center Chandigarh, India Zsuzsanna Antal Rotterdam, the Netherlands Laboratoire de Génomique Elena Bermúdez Shiv Sekhar Chatterjee Fonctionnelle des Champignons Higiene y Segurided Alimentaria Division of Mycology Pathogènes des Plantes Facultad de Veterinaria Department of Medical Microbiology Université Claude Bernard Lyon 1 Universidad de Extremadura Postgraduate Institute of Medical Villeurbanne, France Cáceres, Spain Education and Research Chandigarh, India Maiken Cavling Arendrup Leticia Bernal-Martinez Unit of Mycology and Parasitology Centro Nacional de Microbiologia Sharon C.-A. Chen Statens Serum Institute Instituto de Salud Carlos III Centre for Infectious Diseases and Copenhagen, Denmark Majadahonda, Spain Microbiology Westmead Hospital S.N. Arseculeratne Antoine Berry Westmead, New South Wales, Australia Faculty of Medicine Department of Parasitology and and University of Peradeniya Mycology Molecular Mycology Research Peradeniya, Sri Lanka Faculty of Medicine Rangueil Laboratory Toulouse University Hospitals Sydney Medical School—Western Miguel A. Asensio Toulouse University University of Sydney at Westmead Higiene y Seguridad Alimentaria Toulouse, France Hospital Facultad de Veterinaria Sydney, New South Wales, Australia Universidad de Extremadura Sandra de Moraes Gimenes Bosco Cáceres, Spain Departamento de Microbiologia e Massimo Cogliati Imunologia Laboratory of Medical Mycology Frank W. Austin Instituto de Biociências Department of Public Health – College of Veterinary Medicine Universidade Estadual Microbiology – Virology Mississippi State University Paulista-Botucatu Università degli Studi di Milano Mississippi State, Mississippi Sao Paulo, Brazil Milan, Italy
xix xx Contributors
Susan Coloe Xianghong Du Larry Hanson Microbiology Department College of Agronomy College of Veterinary Medicine Melbourne Pathology Northwest A&F University Mississippi State University Collingwood, Australia Shaanxi, China Mississippi State, Mississippi
Rossana de Aguiar Cordeiro David Ellis Specialized Medical Mycology Center Mycology Unit D. Jane Hata Federal University of Ceará South Australia Pathology Division of Clinical Microbiology Fortaleza, Brazil Adelaide, South Australia, Australia Mayo Clinic College of Medicine Jacksonville, Florida Ahmed H. Fahal Juan J. Córdoba Mycetoma Research Centre Higiene y Seguridad Alimentaria University of Khartoum Lóránt Hatvani Facultad de Veterinaria Khartoum, Sudan Faculty of Science and Informatics Universidad de Extremadura Department of Microbiology Cáceres, Spain László Galgóczy University of Szeged Faculty of Science and Informatics Szeged, Hungary António Correia Department of Microbiology Departamento de Biologia University of Szeged Centro de Estudos do Ambiente e do Szeged, Hungary Francisca Hernández-Hernández Mar Faculty of Medicine Department of Microbiology and Universidade de Aveiro Varghese K. George Parasitology Aveiro, Portugal Division of Mycology National Autonomous University of Department of Medical Microbiology Mexico Postgraduate Institute of Medical Manuel Cuenca-Estrella Mexico City, Mexico Centro Nacional de Microbiologia Education and Research Instituto de Salud Carlos III Chandigarh, India Majadahonda, Spain Kerstin Hoffmann Corrado Girmenia Jena Microbial Resource Collection Dipartimento di Ematologia, Eric Dannaoui (JMRC) Oncologia, Anatomia Patologica e Unité de Mycologie Moléculaire Institute of Microbiology Medicina Rigenerativa Centre National de Référence University of Jena Azienda Policlinico Umberto I Mycologie et Antifongiques and Sapienza Università de Roma Institut Pasteur Department of Microbiology and Rome, Italy and Molecular Biology Faculté de Médecine Leibniz-Institute for Natural Product Université Paris Descartes Yvonne Gräser Research and Infection Biology e.V. Unité de Parasitologie—Mycologie Institute für Mikrobiologie und Hans-Knöll-Institute (HKI) Assistance Publique-Hôpitaux de Paris Hygiene Neugasse, Jena, Germany Hôpital Européen Georges Pompidou Charité Universitätsmedizin Berlin Paris, France Berlin, Germany G. Sybren de Hoog Joanna Gray Central Bureau of Fungal Cultures Silvia D’Arezzo Royal College of Pathologists of Fungal Biodiversity Centre Unità di Microbiologia Molecolare Australasia Royal Netherlands Academy of Arts Azienda Policlinico Umberto I BioSecurity Quality Assurance and Sciences Istituto Nazionale per le Malattie Programs Utrecht, the Netherlands Infettive “Lazzaro Spallanzani” Surrey Hills, New South Wales, Sapienza Università de Roma Australia Rome, Italy Po-Ren Hsueh Allan Jefferson Guimarães Departments of Laboratory Medicine Elizabeth S. Didier Laboratório de Micologia and Internal Medicine Division of Microbiology Instituto de Pesquisa Clinica Evandro National Taiwan University Hospital Tulane National Primate Research Chagas National Taiwan University College of Center Fundação Oswaldo Cruz Medicine Covington, Louisiana Rio de Janeiro, Brazil Taipei, Taiwan Contributors xxi
Reiko Ikeda Semra Kustimur Dongyou Liu Department of Microbiology Department of Microbiology Royal College of Pathologists of Meiji Pharmaceutical University School of Medicine Australasia Tokyo, Japan Gazi University BioSecurity Quality Assurance Ankara, Turkey Programs Surrey Hills, New South Wales, Yoshio Ishibashi Australia Department of Immunobiology Diego Libkind Meiji Pharmaceutical University Laboratorio de Microbiología Aplicada Giuliana Lo Cascio Tokyo, Japan y Biotecnología Departmento ad Attività Integrata di Centro Regional Universitario Patologia e Diagnostica Bariloche Azienda Ospedaliera Universitaria Jouni Issakainen Consejo Nacional de Investigaciones Department of Biology Integrata Cientícas y Tecnológicas Verona, Italy University of Turku Instituto de Investigaciones en Turku, Finland Biodiversidad y Medio Ambiente Rubén Lopez-Martínez Universidad Nacional del Comahue Faculty of Medicine Bariloche, Argentina Peter C. Iwen Department of Microbiology and Department of Pathology and Parasitology Microbiology Marco Ligozzi National Autonomous University of University of Nebraska Medical Center Dipartimento di Patologia Mexico Omaha, Nebraska Università di Verona Mexico City, Mexico Verona, Italy Marie Machouart Ayse Kalkanci Faculté de Médecine Department of Microbiology N. Lima Centre Hospitalier Universitaire de School of Medicine Centre of Biological Engineering Nancy Gazi University Institute for Biotechnology and Hôpital Brabois Ankara, Turkey Bioengineering Université Henri Poincaré University of Minho Vandoeuvre-les-Nancy, France Sándor Kocsubé Braga, Portugal Faculty of Science and Informatics H.N. Madhavan Department of Microbiology L&T Microbiology Research Centre University of Szeged Marie-Denise Linas Vision Research Foundation, Sankara Szeged, Hungary Department of Parasitology and Nethralaya Mycology Chennai, India Faculty of Medicine Purpan Laura Kovács Toulouse University Hospitals László Manczinger Faculty of Science and Informatics Toulouse University Faculty of Science and Informatics Department of Microbiology Toulouse, France Department of Microbiology University of Szeged University of Szeged Szeged, Hungary Mark D. Lindsley Szeged, Hungary Mycotic Diseases Branch Theerapong Krajaejun Centers for Disease Control and Palanisamy Manikandan Faculty of Medicine Prevention Department of Microbiology Department of Pathology Atlanta, Georgia Aravind Eye Hospital and Postgraduate Ramathibodi Hospital Institute of Ophthalmology Mahidol University Coimbatore, India Bangkok, Thailand Thomas Lion Division of Molecular Microbiology Sílvio Alencar Marques and Development of Genetic Faculdade de Medicina László Kredics Diagnostics Departamento de Dermatolologia e Faculty of Science and Informatics Children’s Cancer Research Institute Radioterapia Department of Microbiology and Universidade Estadual University of Szeged LabDia Labordiagnostik Paulista-Botucatu Szeged, Hungary Vienna, Austria Sao Paulo, Brazil xxii Contributors
Nanthawan Mekha Venkatapathy Narendran Tamás Papp Department of Medical Sciences Department of Microbiology Faculty of Science and Informatics National Institute of Health Aravind Eye Hospital and Postgraduate Department of Microbiology Ministry of Public Health Institute of Ophthalmology University of Szeged Nonthaburi, Thailand Coimbatore, India Szeged, Hungary
Jean Menotti R.R.M. Paterson Hôpital Saint-Louis Akemi Nishikawa Centre for Biological Engineering Assistance Publique-Hôpitaux de Paris Department of Immunobiology Institute for Biotechnology and Université Paris-Diderot Meiji Pharmaceutical University Bioengineering Paris, France Tokyo, Japan University of Minho Braga, Portugal Steven R. Meshnick Joshua D. Nosanchuk Department of Epidemiology Division of Infectious Disease Amelia Pérez-Mejía Gillings School of Global Public Departments of Medicine and Facultad de Medicina Health Immunology Departamento de Microbiología y University of North Carolina Albert Einstein College of Medicine Parasitología Chapel Hill, North Carolina Yeshiva University Universidad Nacional Autónoma de Bronx, New York México Wieland Meyer México City, Mexico Centre for Infectious Diseases and Microbiology Félix Núñez Armando Pérez-Torres Westmead Hospital Higiene y Seguridad Alimentaria Facultad de Medicina Westmead, New South Wales, Australia Facultad de Veterinaria Departamento de Biología Celular y and Universidad de Extremadura Tisular Molecular Mycology Research Cáceres, Spain Universidad Nacional Autónoma de Laboratory México Sydney Medical School—Western México City, Mexico University of Sydney at Westmead Ildikó Nyilasi Faculty of Science and Informatics Hospital David S. Perlin Sydney, New South Wales, Australia Department of Microbiology University of Szeged Public Health Research Institute Szeged, Hungary New Jersey Medical School Hideki Miyagi University of Medicine and Dentistry Division of Dermatology of New Jersey University of the Ryukyus Rosely Maria Zancopé Oliveira Newark, New Jersey Okinawa, Japan Laboratório de Micologia Instituto de Pesquisa Clinica Evandro Michael D. Perry Mayumi Miyamoto Chagas Public Health Wales Department of Dermatology Fundação Oswaldo Cruz Microbiology—Cardiff Tokyo Medical University Rio de Janeiro, Brazil University Hospital of Wales Tokyo, Japan Cardiff, United Kingdom
Rodrigo de Almeida Paes Mauro de Medeiros Muniz Tamás Petkovits Laboratório de Micologia Laboratório de Micologia Faculty of Science and Informatics Instituto de Pesquisa Clinica Evandro Instituto de Pesquisa Clinica Evandro Department of Microbiology Chagas Chagas University of Szeged Fundação Oswaldo Cruz Fundação Oswaldo Cruz Szeged, Hungary Rio de Janeiro, Brazil Rio de Janeiro, Brazil Alan J.L. Phillips László G. Nagy Malena P. Pantou Faculdade de Ciências e Tecnologia Faculty of Science and Informatics Molecular Immunopathology and Departamento de Ciências da Vida Department of Microbiology Histocompatibility Laboratory Centro de Recursos Microbiológicos University of Szeged Onassis Cardiac Surgery Center Universidade Nova de Lisboa Szeged, Hungary Athens, Greece Caparica, Portugal Contributors xxiii
Miia Pitkäranta Virgínia Bodelão Richini-Pereira Maurizio Sanguinetti DNA Sequencing and Genomics Departamento de Microbiologia e Istituto di Microbiologia Laboratory Imunologia Istituto Di Ricovero e Cura a Carattere Institute of Biotechnology Instituto de Biociências Scientico University of Helsinki Universidade Estadual Istituto Dermopatico dell’Immacolata Helsinki, Finland Paulista-Botucatu Ospedale San Carlo Sao Paulo, Brazil Università Cattolica del Sacro Cuore Natteewan Poonwan Rome, Italy Department of Medical Sciences National Institute of Health Marcos Fábio Gadelha Rocha Faculty of Veterinary Medicine Ayako Sano Ministry of Public Health Medical Mycology Research Center Nonthaburi, Thailand Postgraduate Program in Veterinary Science Chiba University Chuo-ku, Japan Brunella Posteraro State University of Ceará Istituto di Microbiologia and Istituto Dermopatico dell’Immacolata Specialized Medical Mycology Center Boonmee Sathapatayavongs Istituto Di Ricovero e Cura a Carattere Federal University of Ceará Faculty of Medicine Scientico Ceará, Brazil Department of Medicine Ospedale San Carlo Ramathibodi Hospital Mahidol University Università Cattolica del Sacro Cuore Mar Rodríguez Bangkok, Thailand Rome, Italy Higiene y Seguridad Alimentaria Facultad de Veterinaria Patrizia Posteraro Universidad de Extremadura Audrey N. Schuetz Laboratory of Clinical Pathology and Cáceres, Spain Weill Cornell Medical College Microbiology NewYork-Presbyterian Hospital Istituto Dermopatico dell’Immacolata New York, New York Istituto Di Ricovero e Cura a Carattere Uwe H. Roesler Scientico Institute of Animal Hygiene and Ospedale San Carlo Environmental Health Volker U. Schwartze Università Cattolica del Sacro Cuore Freie University Berlin Institute of Microbiology Rome, Italy Berlin, Germany School of Biology and Pharmacy University of Jena Sandra Preuner Jena, Germany Division of Molecular Microbiology Franca Rossi and Development of Genetic Biotechnology Department Kanesan Panneer Selvam Diagnostics Children’s Cancer University of Verona Department of Microbiology Research Institute Verona, Italy Dr. G.R. Damodaran College of and Science LabDia Labordiagnostik Johannes E. Rothhardt Coimbatore, India Vienna, Austria Jena Microbial Resource Collection (JMRC) Rahul Sharma María del Rocío Reyes-Montes Institute of Microbiology Plant Science Division Facultad de Medicina University of Jena Agharkar Research Institute Departamento de Microbiología y and Pune, India Parasitología Department of Microbiology and Universidad Nacional Autónoma de Molecular Biology M.R. Shivaprakash México Leibniz-Institute for Natural Product México City, Mexico Department of Medical Microbiology Research and Infection Biology e.V. Postgraduate Institute of Medical Hans-Knöll-Institute (HKI) Education and Research Malcolm D. Richardson Neugasse, Jena, Germany Regional Mycology Laboratory Chandigarh, India Education and Research Centre Wythenshawe Hospital Wendy W.J. van de Sande Coimbatore Subramanian Shobana University Hospital of South Department of Medical Microbiology Department of Microbiology Manchester and Infectious Diseases Dr. G.R. Damodaran College of University of Manchester Erasmus Medical Center Science Manchester, United Kingdom Rotterdam, the Netherlands Coimbatore, India xxiv Contributors
Shoo Peng Siah Steve M. Taylor Juan Luis Rodríguez Tudela Human Genetic Signatures Department of Epidemiology Centro Nacional de Microbiologia North Ryde, New South Wales, Gillings School of Global Public Instituto de Salud Carlos III Australia Health Majadahonda, Spain University of North Carolina José Júlio Costa Sidrim Chapel Hill, North Carolina Specialized Medical Mycology Center and Milton A. Typas Federal University of Ceará Division of Infectious Diseases and Faculty of Biology Ceará, Brazil International Health Department of Genetics and Duke University Medical Center Biotechnology Tania C. Sorrell Durham, North Carolina University of Athens Centre for Infectious Diseases and Athens, Greece Microbiology Raquel Cordeiro Theodoro Westmead Hospital Departamento de Microbiologia e Westmead, New South Wales, Australia Imunologia Csaba Vágvölgyi and Instituto de Biociências Faculty of Science and Informatics Sydney Medical School Universidade Estadual Department of Microbiology Western University of Sydney at Paulista-Botucatu University of Szeged Westmead Hospital Sao Paulo, Brazil Szeged, Hungary Sydney, New South Wales, Australia K. Lily Therese Takashi Sugita L&T Microbiology Research Centre Jaco J. Verweij Department of Microbiology Vision Research Foundation, Sankara Department of Parasitology Meiji Pharmaceutical University Nethralaya Leiden University Medical Center Tokyo, Japan Chennai, India Leiden, the Netherlands
Thomas D. Sullivan Conchita Toriello Department of Pediatrics Facultad de Medicina Paolo Visca School of Medicine and Public Health Departamento de Microbiología y Dipartimento di Biologia University of Wisconsin Parasitología Università Roma Tre Madison, Wisconsin Universidad Nacional Autónoma de and México Azienda Policlinico Umberto I México City, Mexico Sapienza Università de Roma Mami Tajima and Department of Dermatology Sandra Torriani Unità di Microbiologia Molecolare Tokyo Medical University Biotechnology Department Istituto Nazionale per le Malattie Tokyo, Japan University of Verona Infettive “Lazzaro Spallanzani” Verona, Italy Rome, Italy Masako Takashima Japan Collection of Microorganisms, Anna Maria Tortorano RIKEN BioResource Center, Laboratory of Medical Mycology Govinda S. Visvesvara Saitama, Japan Department of Public Health – Department of Health and Human Microbiology – Virology Services Miklós Takó Università degli Studi di Milano Public Health Service Faculty of Science and Informatics Milan, Italy Centers for Disease Control and Department of Microbiology Prevention University of Szeged Ryoji Tsuboi Atlanta, Georgia Szeged, Hungary Department of Dermatology Tokyo Medical University Yi-Wei Tang Tokyo, Japan Maria Anna Viviani Departments of Pathology and Laboratory of Medical Mycology Medicine Hisae Tsubuku Department of Public Health – Vanderbilt University School of Department of Dermatology Microbiology – Virology Medicine Tokyo Medical University Università degli Studi di Milano Nashville, Tennessee Tokyo, Japan Milan, Italy Contributors xxv
Kerstin Voigt Nancy L. Wengenack Enshi Zhang Jena Microbial Resource Collection Division of Clinical Microbiology Department of Dermatology (JMRC) Mayo Clinic College of Medicine Tokyo Medical University Institute of Microbiology Rochester, Minnesota Tokyo, Japan University of Jena and P. Lewis White Yanan Zhao Department of Microbiology and Public Health Wales Public Health Research Institute Molecular Biology Microbiology—Cardiff New Jersey Medical School of New Leibniz-Institute for Natural Product University Hospital of Wales Jersey Research and Infection Biology e.V. Cardiff, United Kingdom University of Medicine and Dentistry Hans-Knöll-Institute (HKI) Newark, New Jersey Neugasse, Jena, Germany Lihua Xiao Department of Health and Human Lysett Wagner Services Institute of Microbiology Public Health Service School of Biology and Pharmacy Centers for Disease Control and University of Jena Prevention Jena, Germany Atlanta, Georgia
Song Weining Kyoko Yarita College of Agronomy Medical Mycology Research Center Northwest A&F University Chiba University Shaanxi, China Chuo-ku, Japan
1 Introductory Remarks
Dongyou Liu
CONTENTS 1.1 Preamble ...... 1 1.2 Classication, Biology, Genetics, and Clinical Presentation ...... 2 1.2.1 Classication ...... 2 1.2.2 Biology ...... 4 1.2.3 Genetics ...... 4 1.2.4 Clinical Presentation...... 5 1.3 Phenotypic Characterization...... 5 1.3.1 Sample Collection and Processing ...... 5 1.3.1.1 General Guidelines for Specimen Handling ...... 5 1.3.1.2 Sputum, Bronchial Washings, and Throat Swabs ...... 6 1.3.1.3 Blood, Bone Marrow, and Body Fluids ...... 6 1.3.1.4 Pus, Exudate, and Drainage ...... 6 1.3.1.5 Vaginal Swabs ...... 6 1.3.1.6 Urine ...... 6 1.3.1.7 Cerebrospinal Fluid ...... 6 1.3.1.8 Tissue Biopsies from Visceral Organs ...... 6 1.3.1.9 Nail, Hair, Skin Scraping, and Swabs ...... 6 1.3.2 Microscopic Examination ...... 7 1.3.3 In Vitro Cultivation ...... 7 1.3.4 Biochemical and Antifungal Testing ...... 15 1.4 Genotypic Characterization ...... 15 1.4.1 Nucleic Acid Purication ...... 15 1.4.2 Target Genes ...... 15 1.4.3 Template Amplication ...... 16 1.4.4 Product Detection ...... 19 1.5 Result Interpretation, Standardization, Quality Control, and Assurance ...... 20 1.5.1 Key Performance Characteristics ...... 20 1.5.2 Result Interpretation ...... 20 1.5.3 Standardization and Validation ...... 21 1.5.4 Quality Control and Assurance ...... 21 1.5.4.1 Quality Control ...... 21 1.5.4.2 Quality Assurance ...... 21 1.6 Conclusions ...... 22 References ...... 22
1.1 PREAMBLE (exons), possess membrane-bound cytoplasmic organelles (e.g., mitochondria), sterol-containing membranes, and 80S Fungi (singular fungus, meaning “mushroom” in Latin) are a ribosomes and produce a variety of soluble carbohydrates diverse group of eukaryotic organisms (ranging from yeasts, and storage compounds, including sugar alcohols, disac- molds, mushrooms, lichens, rusts, smuts to microsporidia) charides, and polysaccharides. Furthermore, Fungi resemble that constitute one of the ve kingdoms (i.e., Prokaryotae, Protista and Animalia by the lack of chloroplasts and thus Fungi, Protista, Plantae, and Animalia) in the current classi- the requirement of preformed organic compounds as energy cation system for living organisms. Similar to other eukary- sources. Although both Fungi and Plantae possess a cell wall otic kingdoms (Protista, Plantae, and Animalia), fungi harbor and vacuoles, reproduce by sexual as well as asexual means, membrane-bound nuclei with chromosomal DNA, which generate spores (as in ferns and mosses), and have haploid consists of noncoding regions (introns) and coding regions nuclei (as in mosses and algae), Fungi differ from Plantae
1 2 Molecular Detection of Human Fungal Pathogens by the presence of chitin (which also exists in the exoskel- Fungi consists of one subkingdom (Dikarya including phyla eton of arthropods), instead of cellulose in the cell walls, and Ascomycota and Basidiomycota), seven phyla (all with the the absence of chloroplasts. On the other hand, Fungi dif- sufx -mycota except Microsporidia; i.e., Ascomycota, fer from Prokaryotae by having nuclear membrane, plasma Basidiomycota, Chytridiomycota, Glomeromycota, Blasto membrane, and cell wall. cladiomycota, Neocallimastigomycota, and Microsporidia, In this introductory chapter, a brief overview is presented in addition to Fungi incertae sedis, which encompasses fungi on the classication, biology, and genetics of fungal organ- with indeterminate taxonomical status) (Table 1.1), 10 sub- isms, and clinical manifestations in human hosts resulting phyla (with the sufx -mycotina), 35 classes (with the sufx from their infections. This is followed by a summary of labo- -mycetes), 12 subclasses (with the sufx -mycetidae), and 129 ratory approaches that are useful for phenotypic character- orders (with the sufx -ales) [10–13]. A most notable feature ization of fungi, including sample collection and processing, of this taxonomical scheme is the reorganization of the for- microscopic examination, in vitro cultivation, biochemi- mer phylum Zygomycota into the phylum Glomeromycota cal and anti-fungal testing. The subsequent section focuses and four separate subphyla (Mucoromycotina, on key attributes relating to molecular characterization of Entomophthoromycotina, Zoopagomycotina, and Kick fungi, such as nucleic acid extraction, target gene selection, xellomycotina), which may form independent phyla upon fur- template amplication, and amplicon detection. Finally, the ther conrmation (Table 1.1). However, this scheme does not importance of rational result interpretation, standardization, take into account of organisms such as oomycetes and slime and quality control and assurance in the molecular fungal molds that were formerly included in the kingdom Fungi testing is emphasized. [12]. Also, the genera Caulochytrium, Olpidium, Rozella (formerly of Chytridiomycota), and Basidiobolus (formerly of Entomophthorales, Zygomycota) are not included in any 1.2 CLASSIFICATION, BIOLOGY, GENETICS, higher taxa in this scheme, pending further taxonomical AND CLINICAL PRESENTATION resolutions [12]. In addition, a clade (i.e., Symbiomycota) sharing similarity between Glomeromycota and Dikarya is 1.2.1 CLASSIFIcATION not included in the current scheme as Symbiomycota may Fungi are an extremely diverse and abundant group of possibly constitute a rank between kingdom and subking- eukaryotic organisms, whose sizes range from single-celled dom [12]. aquatic chytrids to large mushrooms and whose number has Most human pathogenic fungi are found in the phyla been estimated to be between 700,000 and 1.5 million spe- Ascomycota, Basidiomycota, and Microsporidia as well cies, with nearly 100,000 species being described to date as Fungi incertae sedis (principally Mucoromycotina [1–8]. However, fewer than 500 of the recognized fungal spe- and Entomophthoromycotina of the former phylum cies (including about 200 yeast species) have been shown to Zygomycota). From a medical mycologist’s perspec- cause human infections. tive, human pathogenic fungi are conveniently separated Based on morphological criteria, fungi are often divided into eight subgroups: (i) dermatophytes (represented by into two major categories: lamentous fungi (true fungi) Epidermophyton, Microsporum, and Trichophyton); (ii) and yeasts. Accounting for the bulk of fungal species, la- yeasts (represented by Blastoschizomyces, Candida, mentous fungi produce tubular, elongated, and thread-like Cryptococcus, Lacazia, Malassezia, Rhodotorula, (lamentous) cellular structures (known as hyphae), which Saccharomyces, and Trichosporon); (iii) dimorphic fungi contain multiple nuclei and extend at their tips. With about (represented by Blastomyces, Coccidioides, Histoplasma, 700 known species, yeasts are single-celled organisms that and Paracoccidioides); (iv) hyaline hyphomycetes (hyaline reproduce by budding or binary ssion. In addition, a few molds) (represented by Acremonium, Aspergillus, Beauveria, fungal species are able to switch between a yeast phase Chrysosporium, Cylindrocarpon, Fusarium, Geotrichum, and a hyphal phase in response to environmental condi- Gliocladium, Graphium, Madurella, Malbranchea, tions and are referred to as dimorphic fungi. Despite their Onychocola, Paecilomyces, Penicillium, Scedosporium, relatively insignicant proportion in relation to lamen- Scopulariopsis, Sepedonium, Trichoderma, Trichothecium, tous fungi, about 200 of the 700 recognized yeast species and Verticillium); (v) dematiaceous hyphomycetes (dematia- are responsible for a majority of clinical cases of human ceous molds) (represented by Acrophialophora, Alternaria, mycoses. Aureobasidium, Bipolaris, Cladophialophora, Cladosporium, Using a combination of morphological characteristics Curvularia, Drechslera, Exophiala, Exserohilum, Fonsecaea, and mechanisms of reproduction, fungi have been tradi- Hortaea, Lecythophora, Ochroconis, Phaeoacremonium, tionally separated into ve phyla: Ascomycota (sac fungi), Phialophora, Ramichloridium, Rhinocladiella, Scedosporium, Basidiomycota (club fungi), Mycophycophyta (lichens Sporothrix, Ulocladium, and Veronaea); (vi) coelomycetes fungi), Zygomycota (conjugation fungi), and Deuteromycota (represented by Colletotrichum, Lasiodiplodia, Nattrassia, and (imperfect fungi, or mitosporic fungi, which are fungi with Phoma); (vii) zygomycetes (represented by Apophysomyces, no known sexual cycle) [9]. Basidiobolus, Conidiobolus, Cunninghamella, Mortierella, Recent phylogenetic analyses of 18S rRNA, 28S rRNA, 5.8S Mucor, Absidia, Rhizomucor, Rhizopus, Saksenaea, and rRNA, rpb1, rpb2, and tef1 genes indicate that the kingdom Syncephalestrum); and (viii) basidiomycetes [7]. Introductory Remarks 3
TABLE 1.1 Classification of the Kingdom Fungi Subphylum (Former Phylum (Subkingdom) Classification) Brief Description Ascomycota (Dikarya) Pezizomycotina Ascomycota (commonly known as sac fungi) represents the largest phylum of Fungi, with over 64,000 species grouped under three subphyla (Taphrinomycotina, Saccharomycotina, and Pezizomycotina). Ascomycota produce ascus (from Greek askos, meaning “sac” or “wineskin”), in which nonmotile spores (a sexual structure also known as ascospores) are formed. However, some Ascomycota (formerly belonging to Deuteromycota) are asexual, do not have a sexual cycle, and thus do not form asci (or ascospores). Forming part of Ascomycota, Pezizomycotina consist of Orbiliomycetes, Pezizomycetes, Dothideomycetes, Arthoniomycetes, Eurotiomycetes, Laboulbeniomycetes, Lichinomycetes, Lecanoromycetes, Leotiomycetes, and Sordariomycetes, as well as three unassigned orders (Lahmiales, Medeolarials, and Triblidiales). Pezizomycotina cover all ascomycetes that produce ascocarps (fruiting bodies), except for Neolecta in Taphrinomycotina. Saccharomycotina Forming part of Ascomycota, Saccharomycotina consist of the “true” yeast class Saccharomycetes Taphrinomycotina Forming part of Ascomycota, Taphrinomycotina consist of four classes: Neolectomycetes (hyphal fungi), Pneumocystidomycetes (mammalian lung pathogen Pneumocystis), Schizosaccharomycetes (ssion yeasts), and Taphrinomycetes (hyphal fungi). Basidiomycota Pucciniomycotina Basidiomycota (commonly known as club fungi) is the second largest phylum of Fungi, with 31,515 (Dikarya) (Urediniomycetes) species grouped under three subphyla (Pucciniomycotina, Ustilaginomycotina, and Agaricomycotina, in addition to two separate classes Wallemiomycetes and Entorrhizomycetes). Forming part of Basidiomycota, Pucciniomycotina consist of eight classes of rust fungi (i.e., Classiculomycetes, Cryptomycocolacomycetes, Mixiomycetes, Atractiellomycetes, Agaricostilbomycetes, Cystobasidiomycetes, Pucciniomycetes, and Microbotryomycetes). Ustilaginomycotina Forming part of Basidiomycota, Ustilaginomycotina consist of two smut fungus classes (Ustilaginomycetes) Exobasidiomycetes and Ustilaginomycetes, as well as a separate smut fungus order Malasseziales. Agaricomycotina Forming part of Basidiomycota, Agaricomycotina consist of three classes: Agaricomycetes (hymenia- (Basidiomycetes) forming fungi), Dacrymycetes (hymenia-lacking fungi), and Tremellomycetes (jelly fungi). Chytridiomycota Consisting of two classes Chytridiomycetes (with three orders: Chytridiales, Spizellomycetales, and Rhizophydiales) and Monoblepharidomycetes (with one order Monoblephariales), Chytridiomycota include more than 1000 known species. Chytridion (meaning “little pot”) describes the structure containing unreleased spores. Chytrids are mostly primitive, aquatic, saprobic fungi involved in the degradation of chitin and keratin, have coenocytic thalli, and usually form rhizoids (instead of true mycelium). Neocallimastigomycota (Chytridiomycota) Consisting of Neocallimastigales, a traditional member of Chytridiomycota, Neocallimastigomycota include a small group of anaerobic fungi that inhabit the digestive system of larger herbivorous mammals and possibly other terrestrial and aquatic environments. Although lacking mitochondria, Neocallimastigomycota possess hydrogenosomes of mitochondrial origin. Similar to chrytrids, neocallimastigomycetes form zoospores with posteriorly uni¼agellate or poly¼agellate. However, neocallimastigomycetes are distinct from other chytrids on the basis of both morphology and molecular phylogeny. Blastocladiomycota (Chytridiomycota) Consisting of Blastocladiales, also a traditional member of Chytridiomycota, Blastocladiomycota are saprotrophs, and also parasites of all eukaryotic groups. Blastocladiomycota undergo sporic meiosis in contrast to chytrids, which mostly exhibit zygotic meiosis. Glomeromycota (Zygomycota) Forming part (commonly known as “sugar” and “pin” molds) of former Zygomycota, and consisting of one class Glomeromycetes (with four orders: Glomerales, Diversisporales, Paraglomerales, and Archaeosporales) with about 200 described species (all of which reproduce asexually), Glomeromycota produce arbuscular mycorrhizas with roots or thalli, and are obligate biotrophs, dependent on symbiosis with land plants for carbon and energy. Fungi incertae sedis Mucoromycotina Fungi that were placed in Zygomycota are now being reassigned to Glomeromycota, and Fungi (Zygomycota) incertae sedis (including four subphyla Mucoromycotina, Entomophthoromycotina, Zoopagomycotina, and Kickxellomycotina). Consisting part of Fungi incertae sedis, Mucoromycotina cover three orders: Mucorales, Endogonales, and Mortierellales. Entomophthoromycotina Consisting part of Fungi incertae sedis, Entomophthoromycotina (with one order Entomophthorales) (Zygomycota) are pathogens of insects, nematodes, and tardigrades, as well as free-living saprotrophs. (continued) 4 Molecular Detection of Human Fungal Pathogens
TABLE 1.1 (continued) Classification of the Kingdom Fungi Subphylum (Former Phylum (Subkingdom) Classification) Brief Description Zoopagomycotina Consisting part of Fungi incertae sedis, Zoopagomycotina (with one order Zoopagales) are (Zygomycota) pathogens of microscopic animals such as amoebae. Kickxellomycotina Consisting part of Fungi incertae sedis, Kickxellomycotina include four orders: Asellariales, (Zygomycota) Kickxellales, Dimargaritales, and Harpellales. Microsporidia Microsporidia cover about 150 genera (containing >1200 species) that were previously considered as protozoa, of which 12 species (representing 8 genera) have been shown to cause opportunistic infections in humans. Microsporidia lack mitochondria and motile structures (e.g., ¼agella) and produce highly resistant spores, the morphology (oval or pyriform, occasionally rod-shaped or spherical) of which is often used for their differentiation.
Sources: James, T.Y. et al., Nature, 443, 818, 2006; Hibbett, D.S. et al., Mycol. Res., 111, 509, 2007.
1.2.2 BIOLOGY reproduce both asexually and sexually. During the budding process, a small bud (or daughter cell) forms on the parent Filamentous fungi are characterized by the production of cell, and the nucleus of the parent cell splits into a daughter hyphae, which are cylindrical, thread-like structures of nucleus which migrates into the daughter cell. The growing 2–10 μm in diameter and up to several centimeters in length. bud eventually separates from the parent cell to become a Hyphae can be either septate (with two or more compart- new cell. ments separated by right-angled internal cell walls called Fungi are widespread in all environments and habitats, septa) or aseptate (or coenocytic, with each compartment including soil, plants, insects, animals, humans, air, deserts, containing one or more nuclei). Septa have pores that facili- and deep-sea sediments [14]. Most fungi are saprophytes that tate passage and interchange of cytoplasm, organelles, and at play an essential environmental role in the decomposition and times nuclei. Hyphae are important for penetration/invasion recycling of organic matters, and form symbiotic relationship into the host cells and for the uptake of nutrients from liv- with plants and animals; some have the capacity to cause ing hosts and other substrates. New hyphae typically emerge diseases in plants, animals, and humans. Furthermore, some from hyphal tips (apices), arise from existing hyphae by a fungi have other properties that can be exploited for bread/ process called branching, or occasionally grow hyphal tips beverage making, insect pest control, medicine, and scien- bifurcate (fork) giving rise to two parallel-growing hyphae. tic research. For instance, yeasts have been employed in (i) The combined effects of apical growth and branching/fork- the two-hybrid screening systems for the general detection of ing result in the formation of an interconnected network of protein–protein interactions; (ii) the yeast articial chromo- hyphae (with high surface area to volume ratios) known as somes (YACs) for cloning large fragments (200–800 kb) of mycelium (plural mycelia), which is also commonly called DNA; and (iii) expression systems for heterologous proteins. mold. Mycelia grown on solid agar media are referred to as colonies, which may exhibit a variety of sizes, shapes, and 1.2.3 GENETIcS colors (pigmentations) [9]. In general, fungi reproduce by means of microscopic Relative to other higher level eukaryotes (e.g., mam- propagules called spores (conidia) as a result of an asex- mals), fungal genomes are simple and compact, with sizes ual process. Near a third of all fungi reproduce by differ- ranging from 12,068 kb in Saccharomyces cerevisiae, ent modes of propagation, showing two well-differentiated 22,540 kb in Trichophyton verrucosum HKI 0517 (GenBank stages (i.e., the teleomorph or sexual stage and the anamorph ACYE00000000), 28,467 kb in Penicillium marneffei ATCC or asexual stage) within the life cycle of a species. Achieved 18224 (GenBank ABAR00000000), 32,228 kb in Penicillium via vegetative spores or mycelial fragmentation, asexual chrysogenum Wisconsin 54-1255 to 51,230 kb in Nectria reproduction helps clonal populations to adapt to a specic haematococca (anamorph Fusarium solani) (GenBank niche and allows more efcient dispersal than sexual repro- ACJF00000000). duction. Sexual reproduction through meiosis involves vari- The 12 Mb genome of baker’s yeast Saccharomyces cere- ous sexual structures (e.g., fruiting bodies) and reproductive visiae is clustered into 16 chromosomes (of 200–2200 kb strategies. Compatible fungi may fuse their hyphae into an in size), with a total of 6183 open-reading frames (ORFs), interconnected network in a process known as anastomosis, of which 5885 are predicated to be protein-coding genes. which is required for the initiation of the sexual cycle. Its ribosomal RNA (rRNA) genes are coded by about 140 Yeasts commonly undergo asexual reproduction (mitosis) genes of a single tandem array on chromosome XII; small by budding or ssion, although some have the capacity to nuclear RNAs are coded by 40 genes; and transfer RNAs Introductory Remarks 5
(tRNAs) are coded by 275 genes. S. cerevisiae mitochon- to Acremonium, Madurella, and Pseudallescheria; subcuta- drial DNA encodes components of the mitochondrial trans- neous zygomycosis due to Basidiobolus and Conidiobolus; lational machinery and about 15% of the mitochondrial rhinosporidiosis due to Rhinosporidium; and lacaziosis (or proteins [15]. lobomycosis) due to Lacazia loboi. Whereas the 22 Mb genome of Penicillium marnef- Systemic mycoses: Some fungi, especially dimorphic fei ATCC 18224 harbors 10,136 ORF; the 32 Mb genome fungi, have the capacity to breach the physical and immu- of Penicillium chrysogenum Wisconsin 54-1255 contains nological defenses of the human host, causing pulmo- 13,911 ORF, with 12,791 being protein-coding genes [16]. nary and other infections after the inhalation of conidia. As a member of the “Fusarium solani species complex” Examples of such systemic mycoses include histoplas- that encompasses >50 species, Nectria haematococca mosis due to Histoplasma capsulatum; coccidioidomy- MPVI (anamorph Fusarium solani) has been shown to cosis due to Coccidioides immitis; blastomycosis due to possess a 51 Mb genome, which is organized in 17 chromo- Blastomyces dermatitidis; and paracoccidioidomycosis due somes (of 530 kb–6.52 Mb in size) with 15,707 predicted to Paracoccidioides brasiliensis [7]. genes [17]. On the other hand, microsporidia possess extremely 1.3 PHENOTYPIC CHARACTERIZATION reduced eukaryotic genomes, which may be as small as 2.6 Mb with 2000 genes. These organisms have remnant Due to the fact that clinical presentations of human mycoses mitochondria and show unique morphologies related to para- caused by various fungal species are nonspecic and indis- sitism, including polar tube to penetrate host cells and initiate tinguishable, and that different fungal pathogens demonstrate infection. varied resistance to commonly used antifungal drugs, there is a need to identify the causative agents to genus and species 1.2.4 CLINIcAL PRESENTATION level in order to implement effective control and prevention strategies. Although most fungal species are saprophytic organisms Traditionally, laboratory identication and characteriza- with a very low inherent virulence, some have the ability to tion of fungi rely mainly on morphological (e.g., the size and take advantage of the weakened host defense (e.g., trauma shape of spores or fruiting structures), biochemical (e.g., the and immunosuppression) and invade the host cells, caus- ability to metabolize certain biochemicals, or the reaction ing a variety of clinical diseases, ranging from (i) super- to chemical tests), biological (e.g., the ability to mate), and cial, (ii) cutaneous, (iii) subcutaneous to (iv) systemic other phenotypic criteria. Apart from some mycotic/hyphal mycoses [18]. elements, most fungi present in the clinical samples are Super¡cial mycoses: As cosmetic fungal infections of the impossible to distinguish upon direct microscopic examina- skin or hair shaft, supercial mycoses do not invade the liv- tion. Therefore, in vitro cultivation is vital for isolation of the ing tissue nor elicit cellular response from the host. Patients fungal pathogens of interest, permitting subsequent deter- with supercial mycoses seeking medical advices are largely mination on the basis of distinct colonial (macroscopic) and for social or cosmetic reasons. Examples of such supercial microscopic features [19–21]. mycoses include pityriasis versicolor and seborrhoeic der- matitis due to Malassezia furfur, tinea nigra due to Hortaea 1.3.1 SAMpLE COLLEcTION AND PROcESSING werneckii, white piedra due to Trichosporon species, and black piedra due to Piedraia hortae. 1.3.1.1 General Guidelines for Specimen Handling Cutaneous mycoses: Being another form of supercial Fungal pathogens are capable of spreading through spores fungal infections of the skin, hair, or nails, cutaneous myco- and may pose danger to laboratory personnel if sufcient ses do not invade the living tissue but may cause a variety caution is not heeded. Therefore, when dealing with fungal of pathological changes in the host due to the presence of specimens in laboratory, it is essential to (i) wear a protec- the infectious agent and its metabolic products. Examples of tive gown or laboratory coat while in the laboratory, (ii) wear such cutaneous mycoses comprise dermatophytosis due to gloves when handling clinical and culture materials, (iii) Epidermophyton, Microsporum, and Trichophyton; candidi- transport cultures in a rack or canister, (iv) disinfect speci- asis (of skin, mucous membranes, and nails) due to Candida men containers contaminated on the outside by wiping with species; and dermatomycosis due to non-dermatophyte molds gauze before opening, (v) open specimens in laminar ¼ow such as Onychocola, Scopulariopsis, and Scytalidium. safety cabinet, (vi) use mechanical pipetting devices for any Subcutaneous mycoses: As chronic, localized infections material or reagent, and (vii) clean the work area with a 2% of the skin and subcutaneous tissue following the traumatic amphyl solution when work is completed. implantation of a soil saprophyte, subcutaneous mycoses A diverse range of clinical and environmental samples may present a variety of clinical symptoms. These range can be utilized for fungal testing. In order to ensure accu- from sporotrichosis due to Sporothrix; chromoblastomy- rate and consistent results, samples intended for mycological cosis due to Cladosporium, Fonsecaea, and Phialophora; investigations need to be collected and processed in such a phaeohyphomycosis due to Bipolaris, Cladosporium, way that offers the best chance for isolation and identication Curvularia, Exophiala, and Exserohilum; eumycetoma due of causative fungal agents. 6 Molecular Detection of Human Fungal Pathogens
1.3.1.2 Sputum, Bronchial Washings, (i) Centrifuge the urine for 10–15 min at 2000 rpm. Decant and Throat Swabs the supernatant and pool the sediment if necessary. (ii) Collection: (i) Collect sputum (5–10 mL, as a result of a deep Prepare a direct smear of the sediment in KOH for direct cough not saliva) in sterile container in the early morning. microscopy. PAS, Gram, or India ink preparations may also Patients are advised not to eat before sputum collection. be helpful. Thick sputum can be emulsied by the addition of l2–20 sterile glass beads and 3–5 mL of sterile distilled water fol- 1.3.1.7 Cerebrospinal Fluid lowed by shaking. (ii) Collect bronchial washings (tracheal Collection: (i) Collect 2–5 mL CSF aseptically by clinician. lavage or bronchial lavage) aseptically by physicians. (iii) (ii) Leave CSF at room temperature or incubate at 30°C if Obtain throat specimens by rolling a moist sterile swab there is a delay in processing. (iii) Centrifuge CSF and pro- over the affected area. For suspected Candida specimen, cess the sediment as follows. Processing: (i) Use 1 drop of scrape the affected area with a sterile tongue depressor. (iv) the sediment to make an India ink mount. (ii) Resuspend the Store samples at 4°C in case of short delays in processing. remaining sediment in 1–2 mL of CSF and inoculate onto Processing: (i) Make wet mounts in KOH (l drop) and Gram Sabouraud’s dextrose agar with chloramphenicol and genta- stained smears (l drop) for direct microscopy. Use periodic micin and incubate at 26°C and 35°C. (iii) Inoculate sediment acid-Schiff (PAS) stain if KOH preparation is unsatisfac- onto BHIA supplemented with 5% sheep blood and incubate tory. (ii) Inoculate sample onto Sabouraud’s dextrose agar at 35°C. Maintain cultures for at least 4 weeks. with chloramphenicol and gentamicin and incubate dupli- 1.3.1.8 Tissue Biopsies from Visceral Organs cate cultures at 26°C and 35°C. (iii) Inoculate sample onto brain heart infusion agar (BHIA) supplemented with 5% Collection: (i) Collect tissue from the center and edge of sheep blood and incubate at 35°C. Maintain cultures for 4 the lesion aseptically by clinician. Include normal tissue weeks. for comparison. (ii) Keep a portion of the tissue in forma- lin for rapid frozen sectioning with staining by hematoxy- 1.3.1.3 Blood, Bone Marrow, and Body Fluids lin and eosin (H&E), Grocott’s methenamine silver (GMS), Collection: (i) Collect blood (8–10 mL aseptically using and PAS. (iii) Keep tissue samples moist with sterile water, vacutainer tube [#4960, containing 1.7 mL of 0.35% sodium saline, or BHI broth. Do not refrigerate at 4°C for more than polyanethol sulfonate (SPS) as an anticoagulant]). Clean the 8–10 h. Processing: (i) Tease apart tissue specimens asepti- collection site with a disinfectant at the time of collection. cally in a sterile Petri dish. (ii) Perform a smear for direct (ii) Collect bone marrow and body ¼uids (pleural, synovial, microscopic examination with staining by H&E, GMS, and peritoneal) aseptically by physicians. Add SPS or hepa- and PAS (as well as Gram stain, Ziehl Neelsen stain, and rin as an anticoagulant. Processing: (i) Prepare smears for modied Ziehl Neelsen stain if necessary) and inoculate Giemsa, Gram, and PAS staining. (ii) Inoculate 0.5–1.0 mL directly onto the isolation media, if areas of pus and necro- of buffy coat (after centrifugation of 5–8 mL of blood) onto sis are present. (iii) Mince tissue specimen with a sterile the surface of culture media (Sabouraud’s dextrose agar scalpel blade, or grind in a sterile glass tissue grinder, if with chloramphenicol and gentamicin, and BHIA supple- no areas of pus or necrosis are present, and inoculate the mented with 5% sheep blood) with a loop, or 1 part blood to minced or homogenized material onto the isolation media. 10–20 parts brain/heart infusion broth. (iii) Inoculate bone (iv) Inoculate onto Sabouraud’s dextrose agar with chloram- marrow and body ¼uids (pleural, synovial, and peritoneal) phenicol and gentamicin and incubate duplicate cultures at on culture media. Maintain cultures at 26°C and 35°C for 4 26°C and 35°C; (v) Inoculate onto BHIA supplemented with weeks. 5% sheep blood and incubate at 35°C. Maintain cultures for 4 weeks. 1.3.1.4 Pus, Exudate, and Drainage Collection: (i) Aspirate material from undrained abscesses 1.3.1.9 Nail, Hair, Skin Scraping, and Swabs using a sterile needle and syringe. (ii) Express pus using a Collection: For nail, (i) clean nail with 70% alcohol. (ii) sterile, sharp-pointed scalpel. (iii) Place the material in a Scrape outer dorsal plate surface and discard. (iii) Scrape the sterile container. deeper portion and remove a portion of debris from under the nail with a scalpel. (iv) Collect whole nail or nail clip- 1.3.1.5 Vaginal Swabs pings. (v) Place all material in a clean envelope labeled with Collection: (i) Collect material from the vagina using several the patient’s data. For hair, (i) Select infected areas and with sterile swabs. (ii) Insert swabs into a sterile tube. Processing: forceps, epilate at least 10 hairs. (ii) Use a scalpel or a blade Smear swab onto heat-sterilized glass slide for Gram stain. knife for hairs broken off at the scalp level. (iii) Place hairs between two clean glass slides or in a clean envelope labeled 1.3.1.6 Urine with the patient’s data. For skin scraping and swabs, (i) wipe Collection: (i) Collect an early morning, mid-stream catch lesions and interspaces between the toes with alcohol sponge of >2.0 mL (do not process more than 50.0 mL) in a sterile or sterile water. (ii) Scrape the entire lesion and both sides of container when aspiration or cystoscopy cannot be done. (ii) interspaces with a sterile scalpel and place scrapings between Store urine at 4°C for up to 12–14 h if necessary. Processing: two clean glass slides or place in a clean envelope labeled Introductory Remarks 7 with the patient’s data. (iii) Swab the lesion with a sterile the adhesive glue holding the ¼ag to the applicator stick, (iv) swab (wetted in distilled water if necessary) and place the placing the ¼ag onto a small drop of lactophenol cotton blue swab into a clean tube. Processing: (i) For nail, hair, and skin on a clean glass slide, removing the applicator stick and dis- scrapings, make a wet mount preparation in KOH for direct carding, and (v) adding another drop of stain, covering with microscopy. Calco¼uor-stained mount may also be useful. a coverslip, gently pressing and moping up any excess stain (ii) For skin swabs, smear swab onto heat-sterilized glass before microscopy [7]. slide for Gram stain. (iii) Inoculate skin scraping and swab For macroscopic examination of colonial morphology, specimens onto Sabouraud’s dextrose agar slopes contain- attention should be paid to (i) surface texture (e.g., glabrous, ing chloramphenicol and gentamicin, but NO cycloheximide suede-like, powdery, granular, ¼uffy, downy, cottony, and and incubate at 35°C. (iv) For suspected secondary bacterial velvety); (ii) surface topography (e.g., ¼at, raised, heaped, infection, inoculate the swab onto a blood agar plate, fol- folded, domed, radial, and grooved); (iii) surface pigmen- lowed by the Sabouraud’s agar containing the antibiotics and tation (e.g., white, cream, yellow, brown, green, grey, and then place into brain heart infusion broth. Incubate at 35°C. black); (iv) reverse pigmentation (e.g., none, yellow, brown, Maintain the cultures for 4 weeks. red, and dark); (v) growth rate (e.g., fast, moderate, and slow); and (vi) growth temperature (e.g., 25°C, 37°C, 40°C, and 45°C). For microscopic assessment of cultured isolates, 1.3.2 MIcROScOpIc EXAMINATION the morphologic characteristics of conidia are recognized in In addition to macroscopic assessment of colonial size, shape, terms of septation, shape (e.g., spherical, pyriform, clavate, and color, direct microscopic observation of mycotic ele- and ellipsoidal), size, color (hyaline and darkly pigmented), ments in clinical specimens and subsequent examination of surface texture (e.g., smooth, rough, verrucose, and echinu- fungal structures of cultured isolates are critical for correct late), type (microconidia and macroconidia), and arrange- identication of causal fungal agents and accurate diagnosis ment (e.g., single, in mass) [7]. of mycoses. Direct microscopy not only facilitates the selec- tion of the proper portion of clinical specimen, the appropri- 1.3.3 IN VITRO CULTIvATION ate media, and inoculation techniques for enhanced recovery of the fungus, but also alerts the physician as to the likely eti- In vitro cultivation remains a critical step for the phenotypic ology of the disease. In general, all fungal specimens of suf- characterization of fungi. Macroscopic examination of colo- cient quantity are examined microscopically and inoculated nial size, shape, and color followed by microscopic inves- on culture media. However, when the quantity of a fungal tigation of nal structures of fungal isolates allows proper sample is insufcient, culture should take priority over direct determination of fungal organisms implicated in human microscopy due to its higher sensitivity. mycoses in most cases. Further characterization of fungal A number of stains (e.g., KOH and its derivatives, lacto- isolates is possible by using various biological and biochemi- phenol cotton blue, India ink, and Southgate’s mucicarmine cal techniques as well as antifungal drug resistance testing. stain) can be applied for improved identication and recogni- The composition, preparation, and application of common tion of mycotic elements in clinical samples and structural mycological media are summarized in Table 1.3. details of fungal isolates (Table 1.2) [22,23]. Ocular lens Slide culture preparation allows observation of the precise containing a micrometer disc may be employed on light arrangement of the conidiophores and conidial ontogeny (the microscope for the measurement of hyphae, conidia, and way the conidia are produced). This is conducted by (i) using other fungal structures. For detection of fungal elements a sterile blade to cut out an agar block (7 × 7 mm) from a plate in tissue biopsies, PAS stain, GMS stain, Fontana-Masson of cornmeal agar or Czapek dox agar that is small enough stain, Gridley’s stain, and H&E may be utilized. In particu- to t under a coverslip, (ii) ¼ipping the block up onto the lar, GMS stain represents an essential stain for detection of surface of the agar plate, (iii) inoculating the four sides of the fungal elements in tissue sections. Fontana-Masson stain is agar block with spores or mycelial fragments of the fungus, indispensable for detection of melanin in the cell walls of (iv) placing a ¼amed coverslip centrally upon the agar block, dematiaceous fungi. Besides standard light or phase-contrast (v) incubating the plate at 26°C until growth and sporula- microscopy, transmission electronic microscopy (TEM) tion occur, (vi) removing the cover slip from the agar block, enables visualization of ne structural details (e.g., the outer (vii) applying a drop of 95% alcohol as a wetting agent, (viii) wall layers of conidia and ascospores) of fungal organisms, gently lowering the coverslip onto a small drop of lactophe- leading to more accurate speciation. nol cotton blue on a clean glass slide, (ix) leaving the slide Cellotape ¼ag preparation may be utilized for rapid overnight to dry and resealing later with ngernail polish, mounting and keeping intact of the reproductive structures and (x) applying a coat of clear polish followed by one coat of of sporulating fungi. This is performed by (i) using clear red-colored polish before microscopy [7]. 2 cm wide cellotape and a wooden applicator stick (orange Apart from in vitro culture, in vivo animal models (e.g., stick) to make a small cellotape ¼ag (2 × 2 cm), (ii) using ster- rodents and rabbits) have been occasionally applied to com- ile technique to gently press the sticky side of the ¼ag onto pare diagnostic procedures for the estimation of fungal bur- the surface of the culture, (iii) applying a drop of 95% alco- dens in blood, bronchoalveolar lavage (BAL), and tissue hol to the ¼ag to act as a wetting agent and also to dissolve samples. 8 Molecular Detection of Human Fungal Pathogens of
other
elements.
and
fungal
examination nails,
for
hairs,
Application microscopic
specimens
scrapings,
direct
skin scrapings, hairs, nails, and other clinical specimens for fungal elements. skin scrapings, hairs, nails, and other clinical specimens for fungal elements. binds to cellulose and Blankophor) chitin and ¼uoresces blue-white or to apple-green when exposed light. ultraviolet skin clinical day to avoid the next reexamine Preparations reporting false-negative. until culture result is may be kept known. skin scrapings, hairs, and nails for elements. fungal preparations do not and clearing, but long. keep skin scrapings, hairs, nails, and other clinical specimens for fungal elements. of direct microscopic examination For of direct microscopic examination For 2B, Calco¼uor white (or Uvitex For specimens and negative Keep of direct microscopic examination For more rapid maceration DMSO gives of direct microscopic examination For The slide may be hours for min for skin scrapings to several Preparation min microscopically for unstained refractile fungal A and a drop of solution B on the center clean Place a portion of specimen onto clean glass microscope slide. to specimen and mix. Add a drop of 15% KOH the preparation. glass over a cover Pace slide at room temperature until the material is cleared. Leave for speedy clearing. warmed slide under microscopy. Observe day. the following for fungi may be reexamined Slides that appear negative Mix one drop of solution microscope slide. squash the preparation with a coverslip, Place specimen in the solution and cover ¼uid. the excess of the inoculation needle and then blot off with the butt microscopically for the presence of fungal Gently heat the slide and examine depending on elements that ¼uoresce a chalk-white or brilliant apple green color, the lter combination. a portion of specimen with an inoculation needle and mount in drop Remove on a clean microscope slide. KOH of the inoculation squash the preparation with butt with a coverslip, Cover ¼uid. the excess needle, and then blot off or three times. two Gently heat by passing through a ¼ame When the specimen is cleared (from 20 elements. blue-stained fungal microscopically for faintly nail scrapings), examine a small portion of the specimen with an inoculation needle and mount in Remove on a clean microscope slide. a drop of KOH-DMSO of the inoculation squash the preparation with butt with a coverslip, Cover ¼uid. Do not heat the preparation. the excess needle, and then blot off Examine the mount within 20 elements. overnight; the cotton blue in distilled water Dissolve and then mix to dissolve, Add phenol crystals to the lactic acid in a glass beaker, add glycerol; solution into the phenol/glycerol/lactic Filter the cotton blue and distilled water acid solution, mix, and store at room temperature. 1. 2. 3. 4. 5. 6. 1. 2. 3. 1. 2. 3. 4. 1. 2. 3. 1. 2. 3.
mL mL mL g g g ) 20 4 O 5 Composition mL H 6 mL mL mL 10 mL KOH mL CHOH COOH) 20 3 g mL mL mL mL A g g g crystallization of the The glycerol prevents Sigma) 0.1 ink. the specimen from drying out). reagent and prevents 15 KOH Glycerol 20 80 Distilled water Solution 10 KOH Glycerin 10 90 Distilled water Solution B Calco¼uor white (¼uorescent brightener 28, F6259, 100 Distilled water 10 KOH Glycerol 10 Quink permanent blue ink 10 Parker 80 Distilled water add glycerol and Parker in water; the KOH (dissolve sulfoxide (DMSO) 40 Dimethyl 60 Distilled water Cotton blue (Aniline blue) 0.05 Phenol crystals (C Glycerol 40 Lactic acid (CH 20 Distilled water Calco¼uor white preparation blue 1.2 TABLE Composition, Stains andCommon Preparation, of Application Mycological Stain 15% KOH with 10% KOH Ink with Parker KOH KOH-DMSO Lactophenol cotton Introductory Remarks 9 )
As As tissue continued ( and other . detail, cellular host Cryptococcus neoformans Cryptococcus neoformans encapsulated fungi in a cell suspension (e.g., CSF sediment). Cryptococcus neoformans pink. neutral mucins, and for detection of elements in tissue sections. fungal the reveals a counter stain, PAS background architecture, and in¼ammatory response. magenta; nuclei appear blue; PAS digest material appears colorless. elements in tissue sections. fungal the a counter stain, GMS removes ne details of background host cells a more provides and tissues, but stain for detecting small sensitive fragments of cell wall. to black; background stains brown pale green. fungi and in tissue sections. nuclei stain red; background stains pale pink. of direct microscopic examination For detection of capsular material in For Mucicarmine stains acidic mucins demonstration of glycogen and For material appears PAS-positive An essential stain for detection of stain Fungi stain black; cell walls of dematiaceous staining cell walls For cells stain black; Melanin, argentafn min. min (to and “blue min, wash, in water. min, wash min and rinse in distilled h, and rinse in distilled water. and unreduced silver min to remove min, and rinse in distilled water. in tap water. min, and wash for 10 in running tap water h and wash for 5 in running tap water min, wash min, rinse in water. min and rinse in distilled water. residual chromic acid, and any min to remove and rinse in distilled water. in tap water, min, wash sections to water. Take Stain nuclei with hematoxylin. in acid-alcohol and blue tap water. Differentiate mucicarmine solution for 30 Stain with Southgate’s water. and mount. clear, Dehydrate, sections to water. Take for 15 digest glycogen with saliva digest only, PAS For with 1% periodic acid for 5 Treat reagent for 10 with Schiff’s Treat the color). help develop hematoxylin for 1 Counterstain nuclei lightly with Mayer’s up” in Li2Co3. and mount. clear, Dehydrate, sections to water. Take Oxidize in 5% chromic acid for 1 with sodium bisulte for 1 Treat then distilled water. in tap water wash bath and rinse in solution at 60°C in a water silver Place section in the working distilled water. in 0.1% gold chloride for 5 Tone for 1–2 with 2% sodium thiosulfate Treat thoroughly. wash Counterstain with light green. and mount. clear, Dehydrate, to distilled water. and hydrate Deparafnize for 1 nitrate, place in 60°C oven Add 10% silver for 10 Add 0.1% gold chloride, leave for 5 leave Add 5% hypo, for 5 Red, leave Add nuclear-Fast and coverslip. clear, Dehydrate, with a coverslip. 1. 2. 3. 4. 5. 1. 2. 3. 4. 5. 6. 1. 2. 3. 4. 5. 6. 7. 8. 1. 2. 3. 4. 5. 6. Place a drop of India Ink on the specimen, mix well with sterilized loop, and cover mL, distilled mL of 3% g (boil in water The stain is stable for a mL) g g g (add basic fuchsin slowly g mL mL mL by shaking) mL (mix above mL up to original volume min, cool, make Add charcoal and lter through coarse g mL, 5% borax 1–2 nitrate to 100 mL of 5% silver bath for 2–3 with 50% alcohol and lter. months). few mix, and cool to 50°C. to boiling distilled water, Add potassium metabisulte, mix, and cool to room in the dark temperature before adding HCl. Keep overnight. Store in fridge). then ne lter paper. lter paper, at 4°C for 2 months). mix, and keep hexamine, solution (lter before use). silver Working 25 water India Ink (colloidal carbon) Carmine 1 1 Aluminium hydroxide 50% alcohol 100 0.5 Aluminium chloride (anhydrous) 1% periodic acid (50%) Periodic acid 2 98 Distilled water reagent Schiff’s Basic fuchsin (C.I. 42500) 1 Potassium metabisulte 2 200 Distilled water HCl concentrate 2 charcoal 1–2 Deactivated 5% aqueous chromic acid 1% aqueous sodium bisulte 5% borax 0.1% aqueous gold chloride 2% aqueous sodium thiosulfate solution Stock methenamine silver (add 5 solution 25 (stock methenamine silver nitrate 10% silver 0.1% gold chloride Red Nuclear-Fast 5% hypo Mucicarmine stain and PAS (PAS) digest stain methenamine silver stain (GMS) [or Grocott-Gomori stain] silver stain India Ink Southgate’s Periodic acid-Schiff Gomori’s Fontana-Masson 10 Molecular Detection of Human Fungal Pathogens Practical Practical Laboratory Application G.D., Roberts, and their morphology in tissue sections. yeasts stain rose to purple; capsules stain deep purple; background yellow. fungus in tissue sections. deposits stain dark blue; cytoplasm and other components stain shades of stain bright red. red; erythrocytes enhanced visualization of fungi For stain purple to magenta; Cell walls visualization of host response to For Nuclei stain blue, cartilage; calcium and E.W. Koneman, 1982; 519, 13, ., and rinse with with tap water, min, wash min, and rinse with distilled water. Human Pathol Preparation J., and rinse with 70% with tap water, min, wash min. with 95% ethanol, and wash excess min, rinse off with tap water. h, wash Schwarz, 1980; York, New via xylene and ethanol. Bring sections to water Place in chromic acid for 1 with the metabisulte bleach for 1 Treat distilled water. reagent for 20 Place in Schiff’s ethanol. fuchsin 30 Place in aldehyde with tap water. for 1 Counterstain with metanil yellow clear and mount in a resinous medium. Dehydrate, Bring sections to distilled water. Stain nuclei with alum hematoxylin, rinse in running tap water. tap then in Scott’s with 0.3% acid alcohol, rinse in running tap water, Differentiate in tap water. substitute, and again water Stain with eosin/phloxine for 2 and mount. clear, Dehydrate, Press, 1. 2. 3. 4. 5. 6. 7. 1. 2. 3. 4. 5.
Academic , Composition fuchsin Aldehyde Co., Baltimore, MD, 1985. Wilkins ) Laboratory Laboratory Handbook of Medical Mycology Chromic acid Metabisulte bleach reagent Schiff’s Metanil yellow Alum hematoxylin 0.3% acid alcohol substitute tap water Scott’s Eosin/phloxine and Williams M.R., The , continued Mycology McGinnis,
eosin 1.2 ( TABLE Composition, Stains andCommon Preparation, of Application Mycological Stain stain Gridley’s Hematoxylin and Sources: Introductory Remarks 11 ) continued ( Application of zygomycetes. recovery and identication of fungi. routine cultivation For and identication of fungi. routine cultivation For and identication of fungi. routine cultivation For and identication of fungi. routine cultivation For to bread and BHI broth for MEA is a useful alternative isolation of fungi and inhibition bacteria. For (adjust mL water min. min. min. min. mL water. min; slope or pour for plates as min; slope or pour for plates as min; slope or pour for plates as min, slope or pour for plates as Preparation mL water. mL water. Mix ingredients in 1000 Heat with frequent stirring, bring to boil for 1 Dispense for slopes as required. at 121°C for 15 Autoclave required. in 500 Mix agar Heat with frequent stirring, bring to boil for 1 Dispense for slopes as required. at 121°C for 10 Autoclave required. in 1000 Mix oatmeal and agar Heat with frequent stirring, bring to boil for 1 Dispense for slopes as required. at 121°C for 15 Autoclave required. in 1000 peptone and dextrose Mix malt extract, to pH 6.5 with NaOH if necessary). Heat with frequent stirring, bring to boil for 1 Dispense for slopes as required. at 121°C for 10 Autoclave required. 1. 2. 3. 4. 1. 2. 3. 4. 1. 2. 3. 4. 1. 2. 3. 4. salts, chloramphenicol, IMA is an enriched medium with inorganic and gentamicin can be obtained commercially.
mL mL g g g g mL g g g may be mL (oatmeal and agar mL g Difco 255210). g OA, Composition g g Oxoid CM139). g PDA, g g 1000 g Distilled water g 500 g Distilled water g g g g g g g g Oxoid L39) g malt extract, replaced with 39 replaced with 72.5 with 20 Potato infusion 200 20 Dextrose 15 Bacto agar may be and Bacto agar (potato infusion, dextrose, CA (BD) 8.5 Oatmeal (Difco) 60 12.5 Agar 1000 Distilled water 20 Malt extract Peptone 1 20 Dextrose 15 Bacto agar 1000 Distilled water may be replaced peptone and dextrose (malt extract, digest of casein 3.0 Pancreatic Sodium phosphate 2.0 Peptic digest of animal tissue 2.0 0.8 Magnesium sulfate 5.0 extract Yeast 0.04 Ferrous sulfate 5.0 Dextrose Sodium chloride 0.04 Starch 2.0 0.16 sulfate Manganese 1.0 Dextrin 15.0 Agar Chloramphenicol 0.125 to 1000 Distilled water (PDA) (MEA) (IMA) agar 1.3 TABLE Composition, Media andCommon Preparation, of Application Mycological Medium agar Potato dextrose (CA) Cornmeal agar (OA) Oatmeal agar agar Malt extract Inhibitory mould 12 Molecular Detection of Human Fungal Pathogens . . dermatophytes of species. well on agar grows Trichophyton rubrum Trichophyton nos. well on agar grows T. mentagrophytes T. nos. 3 well on agar grows differentiation from Trichophyton Application and T. rubrum T. cultivation Trichophyton mentagrophytes Trichophyton nos. 1,2,3, and 4 tonsurans Trichophyton nos. 1 and 2. (iii) and 4; poorly on agar verrucosum Trichophyton nos. 1 and 4. 2 and 3; poorly on agar the moulds. 1% glucose, chloramphenicol, and (containing SDA, are commercially available. cycloheximide) especially contaminated clinical specimens and for presumptive indication of the presence a dermatophyte. medium from pink to red. (i) of fungi. and differentiation cultivation For of yeasts and primary isolation and cultivation For of dermatophytes. primary isolation and cultivation For Mycosel (BBL) and mycobiotic (Difco) agars For from heavily of dermatophytes recovery For other fungi/bacteria turn and a few Dermatophytes of differentiation For (ii) production of pigment by For min, and slope. min. min. min. min. min. min. min. mL water. mL water. mL water. add other ingredients, and mL water, min; slope or pour for plates as min; slope, or pour for plates as min and cool to 50°C. min; slope or pour for plates as min. min, slope, or pour plates as required. mL water. Preparation mL water. mL water. and peptone in 500 Mix agar Heat with frequent stirring, bring to boil for 1 Dispense for slopes as required. at 121°C for 10 Autoclave required. and chloramphenicol in 1000 Mix SDA Heat with frequent stirring, bring to boil for 1 Add gentamicin, mix, dispense for slopes as required. at 121°C for 10 Autoclave required. Mix the rst four ingredients in 1000 Heat with frequent stirring, bring to boil for 1 at 121°C for 10 Autoclave Add gentamicin, dispense for slopes, or plates as required. and NaCl in 500 Mix agar Heat with frequent stirring, bring to boil for 1 Dispense for slopes as required. at 118°C for 10 Autoclave required. Mix ingredients to 1000 Heat with frequent stirring, bring to boil for 1 at 121°C for 15 Autoclave in water. Mix agar Heat with frequent stirring, bring to boil for 1 at 118°C for 10 Dispense for slopes, autoclave with 150 Mix milk powder 850 Heat with frequent stirring, bring to boil for 1 Dispense for slopes as required. at 115°C for 10 Autoclave 1. 2. 3. 4. 1. 2. 3. 4. 1. 2. 3. 4. 1. 2. 3. 4. 1. 2. 3. 1. 2. 3. 1. 2. 3. 4.
g g g g mL mL g mg capsule mg capsule mg capsule g g g g mL mL mL mL Composition g mL mL mL g mg/mL) 0.65 mg/mL) 0.65 g g g g 10 g Honey g g ) Bacto peptone (BD) 5 (BD) 10 Bacto agar 500 Distilled water (Oxoid CM41) 65 SDA Chloramphenicol 1× 250 1000 Distilled water Gentamicin (40 (Oxoid CM41) 65 SDA (actidione) 0.5 Cycloheximide Chloramphenicol 1× 250 5 extract Yeast 1000 Distilled water Gentamicin (40 (Oxoid CM41) 32.5 SDA NaCl 25 500 Distilled water meal 10.0 digest of soybean Papaic 10.0 Dextrose Phenol red 0.2 0.5 Cycloheximide 20.0 Agar 1000 Distilled water nos. 1–7 (BD) 11.8 agar Trichophyton 200 Distilled water 7 Dutch Jug skimmed milk powder Glycine 10 CA (BD) 17 Chloramphenicol 1× 250 1000 Distilled water continued (PA) with (SDA) agar chloramphenicol and gentamicin cycloheximide, chloramphenicol, gentamicin, and yeast extract. medium (DTM) nos. 1–7 1.3 ( TABLE Composition, Media andCommon Preparation, of Application Mycological Medium 1% Peptone agar dextrose Sabouraud’s with SDA with 5% NaCl SDA test Dermatophyte agar Trichophyton (LA) Lactrimel agar Introductory Remarks 13 )
. var. continued ( . from sterile Paracoccidioides produce and its variants M. distortum Cryptococcus neoformans and , and Cryptococcus neoformans does not. and Sporothrix Cryptococcus neoformans M. canis , T. rubrum T. . neoformans erosion localized areas of pitting and marked marked whereas M. audouinii etc. and hair, var. gattii and for yeast-mould specimens such as CSF, of conversions for isolation to chocolate agar BHIA is an alternative of fungi and bacteria, used routinely by some ophthalmologists for corneal scrapings. Ready-to-use BHIA is commercially available. zygomycetes. of dermatophytes. differentiation For mentagrophytes Trichophyton of dermatophytes. differentiation For of induction of sporulation and for differentiation For routine inoculation of specimens from skin, nails, For between differentiation For of recovery For BHI broth with penicillin is useful for isolation of mL of 10% min and cool to N NaOH. mL vials min. min. mL water. mL sterile water. mL of 0.01 min, and slope. A, mix, and dispense in m lter; store in refrigerator. μ min; slope or pour for plates as min, cool to 50°C. mL bottle at 115°C for 20 to 121°C for mL solution B, autoclave mL of sterile urea solution and 4 mL water. to each vial. mL distilled water mL of the ltered solution mL water. and 20 g agar A min, and cool to 48°C. hair in a vial containing 5 Place autoclaved Inoculate with small fragments of the test fungus and incubate at room temperature. up to 4 weeks and examine hairs at intervals individual Remove microscopically in lactophenol cotton blue. in 100 agar Autoclave 50°C. Add aseptically 5 sterile glucose solution. Dispense for slopes. Add 1/2 teaspoon rice grains into wide neck 20 containing 8 at 121°C for 15 Close lid, autoclave in 500 Mix agar Heat with frequent stirring, bring to boil for 1 Dispense for slopes as required. at 121°C for 10 Autoclave required. and adjust to pH 5.6. ingredients in beaker Dissolve blue in 64 the bromthymol Dissolve Add 36 Mix 20 15 Add 100 plates. and chloramphenicol in 1000 Mix BHI agar Heat with frequent stirring, bring to boil for 1 at 121°C for 15 Autoclave Add sheep blood and gentamicin, dispense for slopes, or plates as required. 1. 2. 3. 1. 2. 3. 1. 2. 1. 2. 3. 4. 1. 2. Filter sterilize solution using 0.22 1. 2. 1. 2. 1. 2. 3. 4. Aseptic addition of sterile penicillin to BHI broth inhibits bacteria. Solution Solution B CGB agar mL mL mL mL mg capsule mL mg mL in vial g g mL mL cm) g mL mL mL mL mL g mL mg U/mL) 1 g mg/mL) 0.65 mL mL mL g g g g A A 100 1 4 1 4 N NaOH 64 PO 2 into short pieces (1 30 sulfate -canavanine cut pre-pubital hair (blonde if available) Autoclaved 5 Sterile distilled water (BD) 1.5 Bacto agar 91 Distilled water Sterile urea solution (Oxoid SR20) 5 10% sterile glucose solution 4 8 Rice 1/2 teaspoon Distilled water (BD) 27.5 LOA 500 Distilled water Solution Glycine 10 KH MgSO Thiamine HCl 1 Ä 100 Distilled water Solution B blue 0.4 Bromthymol 0.01 36 Distilled water CGB agar 20 Bacto agar Solution B 20 880 Distilled water Solution BHIA (Oxoid) 52 Chloramphenicol 1× 250 1000 Distilled water Sheep blood 50 Gentamicin (40 (Oxoid) 52 BHI agar 1000 Distilled water Penicillin G (20 -canavanine, Ä (HPT) with 0.5% glucose (RGS) (LOA) glycine, 2 blue) bromthymol agar (BHIA) with agar 5% sheep blood (BHI) broth Hair perforation test (UA) Urease agar Rice grain slopes agar Littman oxgall CGB ( Brain-heart infusion Brain heart infusion 14 Molecular Detection of Human Fungal Pathogens , . Aspergillus Malassezia Practical Practical Laboratory . G.D., Cryptococcus neoformans Application Roberts, Apophysomyces and , and non-sporulating moulds. and E.W. . furfur Penicillium Saksenaea of zygomycetes from clinical media for recovery specimens. of primary isolation and cultivation For of fungi, especially routine cultivation For isolation of selective For sporulation of some zygomycetes, such as For is superior to other Sterile bread without preservatives Koneman, 1982; mL 519, 13, ., mL gentamicin to min. min. min. mm plastic Petri dishes. Human Pathol mL reagent bottle and autoclave J., mL water. min and then slope. min, slope or pour for plates as min and slope. seeds nely and add to 1000 Preparation mL water. mL Penicillin G and 0.5 Schwarz, mL water. min. 1980; to min, pass through lter paper and adjust volume York, mL, mix, and pour into 90 to each 500 g Bacto agar Guizotia abyssinica mL. New mL bottles. Mix ingredients in 500 Heat with frequent stirring, bring to boil for 1 Dispense for slopes. at 121°C for 10 Autoclave in 1000 Mix agar Heat with frequent stirring, bring to boil for 1 Dispense for slopes as required. at 121°C for 10 Autoclave required. Grind distilled water. 1000 to ltrate and Bacto agar Add the remaining ingredients except dissolve. Cool to room temperature, adjust pH 5.5, and dispense into 500 Add 7.5 at 110°C for 20 Cool to 48°C, add 0.5 each 500 Mix dry ingredients into 1000 Heat with frequent stirring, bring to boil for 1 Dispense for slopes. at 120°C for 10 Autoclave Sterilize a piece of bread in humidied glass Petri dish. Inoculate specimens from non-contaminated sites directly; treat contaminated specimens with antibacterial agents before inoculation. Press, 1. 2. 3. 4. 1. 2. 3. 4. 1. 2. Boil for 30 3. 4. 5. 6. 1. 2. 3. 4. 1. 2.
Academic , mL mL g g g ) 50 g mL per 500 mL per 500 g g mL g g mL mL mL Composition g mL U/mL) 0.5 mg/mL) 0.5 Co., Baltimore, MD, 1985. Wilkins g g Guizotia abyssinica mL (Difco) 1 extract Yeast g g g 1 4 PO ) 2 Laboratory Laboratory Handbook of Medical Mycology (Oxoid L39) 18 Malt extract Peptone (BDH 44075) 18 (BD) 7.25 Bacto agar Ox-bile desiccated (Oxoid L50) 10 40 5 Tween Glycerol monooleate 2.5 500 Distilled water (Oxoid CM97) 45.4 CDA 1000 Distilled water Niger seed ( Glucose 1 KH Creatinine 1 (BD) 15 Bacto agar 1000 Distilled water Penicillin G (20 Gentamicin (40 CA (BD) 17 (glucose) 2 Dextrose Sucrose 3 1000 Distilled water Bread Glass Petri dish and Williams M.R., The , continued Mycology McGinnis,
(CDA) sucrose yeast agar extract 1.3 ( TABLE Composition, Media andCommon Preparation, of Application Mycological Medium (DA) agar Dixon’s Czapek dox agar Bird seed agar Cornmeal glucose Sterile bread Sources: Introductory Remarks 15
1.3.4 BIOcHEMIcAL AND ANTIFUNGAL TESTING Grinding lyophilized or fresh mycelia in liquid nitrogen with a mortar and pestle represents a common way to dis- Many fungi demonstrate varied tolerance to temperature, rupt the fungal cell walls. Because of its time-consuming which can be exploited as a complementary tool in the dif- and laborious nature and its potential for cross-contam- ferentiation of dematiaceus fungi. Examination of primary ination between samples, this technique is not suitable for metabolites such as ubiquinones (coenzyme Q) has proven dealing with a large number of samples. Another means to useful for the taxonomy of black yeasts and lamentous mechanically break the fungal cell walls is through the use fungi. Secondary metabolites (e.g., steroids, terpenes, alka- of glass beads with a vortex mixer. In addition, sonicator may loids, cyclopeptides, and coumarins) produced by fungal be employed for disruption of fungal cell walls. Alternative organisms may be examined by thin-layer chromatography. methods to disrupt the fungal cell walls include enzymatic The resulting pattern of secondary-metabolite production digestion (using a combination of lyticase, zymolase, chitin- provides a reliable approach for identication and classica- ase, gluculase, and proteinase K), acid, and alkali treatments. tion of lichens. Using pyrolysis gas chromatography, pyroly- Subsequent treatment with organic solvents (e.g., phenol/ sis mass spectrometry, gas chromatography, and partition chloroform) and detergents (e.g., sodium dodecyl sulfate, aqueous polymer two-phase systems, the cellular fatty acid SDS; hexadecyltrimethylammonium bromide, CTAB; and composition of fungi can be determined, which represents N-lauroylsarcosine) denatures cytosolic proteins and lipid another useful means for differentiating lamentous fungi. membranes and inactivates endogenous DNase/RNAse, In addition, the structure and composition of the cell wall facilitating their removal. Subsequent precipitation using may be targeted for the denition of fungi. For example, chi- ethanol or isopropanol results in the isolation of high-purity tin and glucan are present in ascomycetes and basidiomyce- nucleic acids. tes whereas chitosan and polyglucuronic acid are found in The development of various easy-to-use commercial zygomycetes. The presence or absence of polysaccharides kits has eliminated the use of hazardous organic solvents (e.g., fucose, galactose, rhamnose, and xylose) in the walls in the isolation of DNA/RNA from fungi. For the prepa- of yeast cells allows their differentia on. Further, isoenzyme ration of fungal DNA, Qiagen DNeasy Plant Kit (Qiagen), patterns generated by electrophoretic techniques (zymo- UltraClean™ Microbial DNA kit (Mo Bio Laboratories), grams) enable the determination of generic relationships of DNAzol® (Invitrogen), and Whatman FTA cards (Whatman) fungi [9]. Various serological tests have been also described are highly efcient [39]. Furthermore, automated DNA for specic detection of fungal antigens in clinical speci- extraction systems have become increasingly sophisticated mens. Matrix-assisted laser desorption/ionization time-of- and affordable, contributing to the reduction of potential ¼ight intact cell mass spectrometry (MALDI-TOF ICMS) cross-contamination during manual handling. has been used to identify fungal organisms, including (i) the terverticillate penicillia, (ii) a¼atoxigenic, black, and other aspergilli, (iii) Fusarium, (iv) Trichoderma, (iv) wood rotting 1.4.2 TARGET GENES fungi (e.g., Serpula lacrymans), and (v) dermatophytes [24]. For accurate and efcient identication of fungal organisms, Moreover, assessment of the sensitivity of fungal isolates to a number of gene regions have been proven valuable. The various antifungal drugs offers an additional way to their dis- most versatile and widely used target is rRNA gene [40–42]. crimination as well as treatment [25–27]. This is followed by rpb1, rpb2, tef1a, and atp6 genes. Other genes of interest include those encoding β-tubulin, actin, chi- tin synthase, acetyl coenzyme A synthase, glyceraldehyde-3- 1.4 GENOTYPIC CHARACTERIZATION phosphate dehydrogenase, isoepoxydon dehydrogenase (idh), Phenotypic characterization of fungal organisms on the basis lignin peroxidase, and orotidine 5′-monophosphate decar- of morphological, biological, and biochemical features suf- boxylase genes [43,44]. fers from the drawbacks of laborious, time-consuming, and Ribosome is an essential cellular organelle that is involved variable, especially for poorly differentiated lamentous in protein synthesis in all living organisms. Being the key fungi. For improved taxonomic resolution and epidemiologi- component of the ribosome, rRNA molecules consists of two cal study of fungal organisms, molecular techniques detect- complex folded subunits of differing sizes (small and large), ing the nucleic acids have been increasingly utilized [28–38]. whose main functions are to provide a mechanism for decod- ing messenger RNA (mRNA) into amino acids (at the center of small ribosomal subunit) and to interact with tRNA during 1.4.1 NUcLEIc AcID PURIFIcATION translation by providing petidytransferase activity (large sub- Due to the presence of a tough cell wall in fungi, it is often nec- unit [LSU]). The two rRNA subunits in eukaryotes includ- essary to undertake several steps to purify the nucleic acids ing fungi have sedimentation coefciency values of 40S before molecular testing becomes feasible. These include (i) (Svedberg units) and 60S. The small rRNA subunit (40S) in disruption of cell walls, (ii) denaturation of nucleoprotein eukaryotes contains a single RNA species (i.e., 18S rRNA), complexes, (iii) inactivation of endogenous DNase/RNAse, whereas the large rRNA subunit (60S) in eukaryotes com- and (iv) removal of contaminating proteins, polysaccharides, prises three RNA species (5S, 5.8S, and 25S–28S rRNA). polyphenolic pigments, and other compounds. On the other hand, the two rRNA subunits in prokaryotes 16 Molecular Detection of Human Fungal Pathogens
18S RNA ITS1 5.8S ITS2 25S–28S RNA IGS1 5S IGS2 RNA RNA FIGURE 1.1 Organization of fungal ribosomal RNA (rRNA) genes. Considerable variations exist in the small and large subunits of rRNA genes among different fungal groups. Notably, the small subunit (SSU) of rRNA gene in lamentous fungi and yeasts is 18S in size, while that in microsporidia is 16S. Similarly, the large subunit (LSU) of rRNA gene in lamentous fungi is 28S in size, that in yeasts is 25S and that in microsporidia is 23S. ITS, internal transcribed spacer; IGS, intergenic spacer. measure 30S and 50S, respectively. While the small rRNA the end of 18S RNA) and ITS4 (located at the beginning of subunit (30S) in prokaryotes contains a single RNA species 28S RNA). The resulting product is sequenced with prim- (i.e., 16S rRNA), the large rRNA subunit (50S) in prokaryotes ers ITS1, ITS2, ITS3, and ITS4 (see Table 1.4) [43,51]. The contains two RNA species (5S and 23S rRNA). Interestingly, identity of the testing fungus is dened by its ITS sequence despite their recent redesignation as a phylum in the king- similarity (%) to the type strain or control isolate: species, dom Fungi, microsporidia possess rRNA subunits (30S and ≥99%; genus, 93%–99%; and inconclusive, ≤93%. 50S) and RNA species (16S and 23S) that are characteris- Similar to ITS1 and ITS2 regions, the rRNA IGS regions tic of prokaryotes, with a notable absence of 5.8S rRNA in (of 2–5 kb in length, depending on fungal taxa) also experi- microsporidia. ence more genetic drift and consequently are not as highly The fungal rRNA genes exist as a family of multiple-copy conserved. This makes the rRNA IGS regions another poten- genes that are arranged in a head-to-toe manner, with each tial target for fungal identication. The rRNA IGS regions copy (of 8–12 kb in size) consisting of 18S RNA (small sub- can be amplied with primers LR12R (located at the end unit [SSU]), ITS 1 (internal transcribed spacer 1), 5.8S RNA, of 28S RNA) and invSR1R (located at the beginning of ITS 2, 25S–28S RNA (LSU), IGS 1 (intergenic spacer), 5S, 18S RNA); the resulting product is sequenced with prim- and IGS 2 (Figure 1.1). The tandemly repeated copies of ers LR12R, 5SRNA, 5SRNAR, and invSR1R for all basid- rRNA genes have been homogenized by concerted evolution iomycetes and some ascomycetous yeasts, and with primers and contain highly similar nucleotide sequence. Therefore, LR12R and invSR1R plus other internal primers for lamen- they are almost always treated as a single-locus gene. Along tous ascomycetes (as 5S RNA is nonexistent in lamentous with ITS, the 18S, 5.8S, and 25S–28S rRNAs are transcribed ascomycetes) (see Table 1.4) [43,52]. as a 35S–40S precursor, with all spacers being later spliced out of the transcript. A nontranscribed or IGS region exists 1.4.3 TEMpLATE AMpLIFIcATION between the copies of the 18S, 5.8S, and 25S–28S rRNA repeats, serving to separate the repeats from one another on Prior to the advent of polymerase chain reaction (PCR) in the the chromosome. A 5S RNA gene takes a position within mid-1980s, molecular procedures for fungal identication the IGS region and is transcribed in the opposite direction. were insensitive and cumbersome. With the development of In lamentous ascomycetes, the 5S RNA gene is absent PCR and other nucleic acid amplication technologies (such [45–49]. as ligase chain reaction [LCR], nucleic acid sequence-based Much of the 25–28S RNA (LSU) gene is conserved across amplication [NASBA], transcription-mediated amplica- widely divergent taxa, and only the rst 600–900 bases con- tion [TMA], strand displacement amplication [SDA], roll- tain three divergent domains (D1, D2, and D3) that are use- ing circle amplication [RCA], cycling probe technology ful for phylogenetic study of fungal organisms. Typically, [CPT], branched DNA [bDNA], and loop-mediated isother- the rst 900 bases of LSU are amplied with primers 5.8SR mal amplication [LAMP]), it has become possible to rapidly (located in the 5.8S RNA) and LR7 (located in the 28S RNA), and specically detect a single copy of nucleic acid in a mat- and the resulting amplicon is sequenced with primers LR5, ter of hours [38]. LR16, LR0R, and LR3R (see Table 1.4) [43]. In yeasts, the Due to their efciency, simplicity, robustness, and ver- D1 and D2 variable regions of 25S rRNA regions are often satility, PCR and its derivatives have been widely adopted targeted [50]. in both research and clinical laboratories for identication The 18S rRNA (SSU) gene also includes alternating and determination of fungi and other microbial organisms. regions of sequence conservation and heterogeneity. The con- From the original version using a pair of primers and gel- served regions are often targeted for phylogenetic analysis of based detection, improvements have been made in the forms higher taxonomic orders (e.g., phylum, family, and genus), of nested PCR, multiplex PCR, reverse transcription-PCR while the regions of sequence diversity are valuable for char- (RT-PCR), real-time PCR, quantitative PCR (Q-PCR), and acterization of isolates to the genus or species level (with iso- arbitrarily primer PCR (or random amplied polymorphic lates showing sequence identity >97% in the 18S rRNA gene DNA, RAPD), etc. [38,53]. These developments have not being considered as the identical species). only enhanced the assay sensitivity (nested PCR) and ver- Compared to the rRNA genes, the rRNA ITS1 and ITS2 satility (multiplex PCR detecting multiple genes and/or regions are not as essential, and thus tend to be more variable, organisms and RT-PCR detecting RNA instead of DNA), offering extremely valuable targets for fungal speciation and but also enabled the accurate quantitation of fungal organ- identication. Frequently, the ITS1 and ITS2 regions together isms (Q-PCR) and elimination of manual handling post- with 5.8S RNA are amplied with primers ITS1 (located at amplication (real-time PCR). Introductory Remarks 17
TABLE 1.4 Identity and Sequence of Common rRNA, ITS, and IGS Primers for PCR Amplification and Sequencing Analysis of Fungal Organisms Nucleotide Positions in M. grisea Gene Region Primer Sequence (5′–3′) Orientation (Nucleotide Positions in S. cereviseae) 18S rRNA NS1 GTA GTC ATA TGC TTG TCT C Forward 413–422 18S rRNA NS1R GAG ACA AGC ATA TGA CTA C Reverse 413–422 18S rRNA NS2 GGC TGC TGG CAC CAG ACT TGC Reverse 943–963 18S rRNA NS3 GCAAGTCTGGTGCCAGCAGCC Forward 943–963 18S rRNA NS4 CTT CCG TCA ATT CCT TTA AG Reverse 1525–1544 18S rRNA NS5 AAC TTA AAG GAA TTG ACG GAA G Forward 1523–1544 18S rRNA NS6 GCA TCA CAG ACC TGT TAT TGC CTC Reverse 1806–1829 18S rRNA NS7 GAG GCA ATA ACA GGT CTG TGA TGC Forward 1806–1829 18S rRNA NS8 TCC GCA GGT TCA CCT ACG GA Reverse 2162–2181 18S rRNA NS17 CAT GTC TAA GTT TAA GCA A Forward 447–465 18S rRNA NS18 CTC ATT CCA ATT ACA AGA CC Reverse 887–906 18S rRNA NS19 CCG GAG AAG GAG CCT GAG AAA C Forward 771–792 18S rRNA NS20 CGT CCC TAT TAA TCA TTA CG Reverse 1243–1262 18S rRNA NS21 GAA TAA TAG AAT AGG ACG Forward 1193–1210 18S rRNA NS22 AAT TAA GCA GAC AAA TCA CT Reverse 1687–1706 18S rRNA NS23 GAC TCA ACA CGG GGA AAC TC Forward 1579–1598 18S rRNA NS24 AAA CCT TGT TAC GAC TTT TA Reverse 2143–2162 18S rRNA SR1R TAC CTG GTT GAT TCT GC Forward 394–410 (1–21) 18S rRNA SR1 ATT ACC GCG GCT GCT Reverse (578–564) 18S rRNA SR2 CGG CCA TGC ACC ACC Reverse (1277–1263) 18S rRNA SR3 GAA AGT TGA TAG GGC T Reverse 696–711 (318–302) 18S rRNA SR4 AAA CCA ACA AAA TAG AA Reverse (838–820) 18S rRNA SR5 GTG CCC TTC CGT CAA TT Reverse (1146–1130) 18S rRNA SR6 TGT TAC GAC TTT TAC TT Reverse (1760–1744) 18S rRNA SR6R AAG WAA AAG TCG TAA CAA GG Forward (1744–1763); similar to ITS 1 18S rRNA SR7 GTT CAA CTA CGA GCT TTT TAA Reverse (617–637) 18S rRNA SR7R AGT TAA AAA GCT CGT AGT TG Forward (637–617) 18S rRNA SR8R GAA CCA GGA CTT TTA CCT T Forward (732–749) 18S rRNA SR9R QAG AGG TGA AAT TCT Forward (896–910) 18S rRNA SR10R TTTG ACT CAA CAC GGG Forward (1181–1196) 18S rRNA SR11R GGA GCC TGA GAA ACG GCT AC Forward 779–798 18S rRNA SSU1Fd CTG CCA GTA GTC ATA TGC TTG TCT C Forward 407–431 18S rRNA SSU1Rd CTT TGA GAC AAG CAT ATG AC Reverse 416–435 18S rRNA SSU2Fd GAA CAA YTR GAG GGC AAG Forward 930–947 18S rRNA SSU2Rd TAT ACG CTW YTG GAG CTG Reverse 974–991 18S rRNA SSU3Fd ATC AGA TAC CGT YGT AGT C Forward 1389–1407 18S rRNA SSU3Rd TAY GGT TRA GAC TAC RAC GG Reverse 1397–1416 18S rRNA SSU4Fd CCG TTC TTA GTT GGT GG Forward 1670–1686 18S rRNA SSU4Rd CAG ACA AAT CAC TCC ACC Reverse 1682–1699 18S rRNA SSU5Fd TAC TAC CGA TYG AAT GGC Forward 2037–2054 18S rRNA SSU5Rd CGG AGA CCT TGT TAC GAC Reverse 2148–2165 18S rRNA SSU6Fm GCT TGT CTC AAA GAT TAA GCC ATG CAT GTC Forward 423–452 18S rRNA SSU6Rm GCA GGT TAA GGT CTC GTT CGT TAT CGC Reverse 1707–1733 18S rRNA SSU7Fm GAG TGT TCA AAG CAG GCC TNT GCT CG Forward 1153–1178 18S rRNA SSU7Rm CAA TGC TCK ATC CCC AGC ACG AC Reverse 1921–1943 18S rRNA SSU8Fm GCA CGC GCG CTA CAC TGA C Forward 1848–1866 18S rRNA V9G TTA CGT CCC TGC CCT TTG TA Forward 2002–2021 ITS ITS1 TCC GTA GGT GAA CCT GCG G Forward 2162–2180 ITS ITS1F CTT GGT CAT TTA GAG GAA GTA A Forward 2124–2145; similar to ITS 1 ITS ITS1Fd CGA TTG AAT GGC TCA GTG AGG C Forward 2043–2064 ITS ITS1Rd GAT ATG CTT AAG TTC AGC GGG Reverse 2671–2691 (continued) 18 Molecular Detection of Human Fungal Pathogens
TABLE 1.4 (continued) Identity and Sequence of Common rRNA, ITS, and IGS Primers for PCR Amplification and Sequencing Analysis of Fungal Organisms Nucleotide Positions in M. grisea Gene Region Primer Sequence (5′–3′) Orientation (Nucleotide Positions in S. cereviseae) ITS ITS2 GCT GCG TTC TTC ATC GAT GC Reverse ITS ITS3 GCA TCG ATG AAG AAC GCA GC Forward ITS ITS4 TCC TCC GCT TAT TGA TAT GC Reverse 2685–2704 ITS ITS4B CAG GAG ACT TGT ACA CGG TCC AG Reverse ITS ITS4S CCT CCG CTT ATT GAT ATG CTT AAG Reverse 2680–2703 ITS ITS5 GGA AGT AAA AGT CGT AAC AAG G Forward 2138–2159; similar to ITS 1 ITS ITS5R CCT TGT TAC GAC TTT TAC TTC C Reverse 5.8S rRNA 5.8S CGC TGC GTT CTT CAT CG Forward (51–35) 5.8S rRNA 5.8SR TCG ATG AAG AAC GCA GCG Reverse (34–51) 5.8S rRNA 5.8S1Fd CTC TTG GTT CBV GCA TCG Forward 2333–2350 5.8S rRNA 5.8S1Rd WAA TGA CGC TCG RAC AGG CAT G Reverse 2451–2472 28S rRNA F377 AGA TGA AAA GAA CTT TGA AAA GAG AA Forward 3005–3030 28S rRNA LR0R GTA CCC GCT GAA CTT AAG C Forward 2668–2686 28S rRNA LR1 GGT TGG TTT CTT TTC CT Reverse (73–57); similar to ITS 4 28S rRNA LR2 TTT TCA AAG TTC TTT TC Reverse 3009–3025 28S rRNA LR2R AAG AAC TTT GAA AAG AG Forward 3012–3028 28S rRNA LR3 GGT CCG TGT TTC AAG AC Reverse 3275–3291 28S rRNA LR3R GTC TTG AAA CAC GGA CC Forward 3275–3291 28S rRNA LR5 TCC TGA GGG AAA CTT CG Reverse 3579–3595 28S rRNA LR5R GAA GTT TCC CTC AGG AT Forward 3580–3596 28S rRNA LR6 CGC CAG TTC TGC TTA CC Reverse 3756–3772 28S rRNA LR7 TAC TAC CAC CAA GAT CT Reverse 4062–4078 28S rRNA LR8 CAC CTT GGA GAC CTG CT Reverse 4473–4489 28S rRNA LR8R AGC AGG TCT CCA AGG TG Forward 4473–4489 28S rRNA LR9 AGA GCA CTG GGC AGA AA Reverse 4799–4815 28S rRNA LR10 AGT CAA GCT CAA CAG GG Reverse 5015–5031 28S rRNA LR10R GAC CCT GTT GAG CTT GA Forward 5013–5029 28S rRNA LR11 GCC AGT TAT CCC TGT GGT AA Reverse 5412–5431 28S rRNA LR12 GAC TTA GAG GCG TTC AG Reverse 5715–5731 28S rRNA LR12R CTG AAC GCC TCT AAG TCA GAA Forward 5715–5735 28S rRNA LR13 CAT CGG AAC AAC AAT GC Reverse 5935–5951 28S rRNA LR14 AGC CAA ACT CCC CAC CTG Reverse 5206–5223 28S rRNA LR15 TAA ATT ACA ACT CGG AC Reverse 2780–2796 28S rRNA LR16 TTC CAC CCA AAC ACT CG Reverse 3311–3327 28S rRNA LR17R TAA CCT ATT CTC AAA CTT Forward 3664–3681 28S rRNA LR20R GTG AGA CAG GTT AGT TTT ACC CT Forward 5570–5592 28S rRNA LR21 ACT TCA AGC GTT TCC CTT T Reverse 3054–3072 28S rRNA LR22 CCT CAC GGT ACT TGT TCG CT Reverse 2982–3001 28S rRNA LSU1Fd GRA TCA GGT AGG RAT ACC CG Forward 2655–2674 28S rRNA LSU1Rd CTG TTG CCG CTT CAC TCG C Reverse 2736–2754 28S rRNA LSU2Fd GAA ACA CGG ACC RAG GAG TC Forward 3280–3299 28S rRNA LSU2Rd ATC CGA RAA CWT CAG GAT CGG TCG Reverse 3379–3402 28S rRNA LSU3Fd GTT CAT CYA GAC AGC MGG ACG Forward 3843–3863 28S rRNA LSU3Rd CAC ACT CCT TAG CGG ATT CCG AC Reverse 3876–3898 28S rRNA LSU4Fd CCG CAG CAG GTC TCC AAG G Forward 4469–4487 28S rRNA LSU4Rd CGG ATC TRT TTT GCC GAC TTC CC Reverse 4523–4545 28S rRNA LSU5Fd AGT GGG AGC TTC GGC GC Forward 3357–3373 28S rRNA LSU5Rd GGA CTA AAG GAT CGA TAG GCC ACA C Reverse 5355–5379 28S rRNA LSU6Fd CCG AAG CAG AAT TCG GTA AGC G Forward 5499–5520 28S rRNA LSU6Rd TCT AAA CCC AGC TCA CGT TCC C Reverse 5543–5564 28S rRNA LSU7Fd GTT ACG ATC TRC TGA GGG TAA GCC Forward 5943–5966 28S rRNA LSU7Rd GCA GAT CGT AAC AAC AAG GCT ACT CTA C Reverse 5927–5954 Introductory Remarks 19
TABLE 1.4 (continued) Identity and Sequence of Common rRNA, ITS, and IGS Primers for PCR Amplification and Sequencing Analysis of Fungal Organisms Nucleotide Positions in M. grisea Gene Region Primer Sequence (5′–3′) Orientation (Nucleotide Positions in S. cereviseae) 28S rRNA LSU8Fd CCA GAG GAA ACT CTG GTG GAG GC Forward 3469–3491 28S rRNA LSU8Rd GTC AGA TTC CCC TTG TCC GTA CC Reverse 4720–4742 28S rRNA LSU9Fm GGT AGC CAA ATG CCT CGT CAT C Forward 4882–4903 28S rRNA LSU9Rm GAT TYT GCS AAG CCC GTT CCC Reverse 4979–4999 28S rRNA LSU10Fm GGG AAC GTG AGC TGG GTT TAG A Forward 5543–5564 28S rRNA LSU10Rm CGC TTA CCG AAT TCT GCT TCG G Reverse 5499–5520 28S rRNA LSU11Fm TTT GGT AAG CAG AAC TGG CGA TGC Forward 3753–3776 28S rRNA LSU12Fd GTG TGG CCT ATC GAT CCT TTA GTC C Forward 5355–5379 IGS LR12R GAA CGC CTC TAA GTC AGA ATC C Forward IGS 5SRNA ATC AGA CGG GAT GCG GT Reverse IGS 5SRNAR ACQ GCA TCC CGT CTG AT Forward IGS invSR1R ACT GGC AGA ATC AAC CAG GTA Reverse
Sources: White, T.J. et al., Amplication and direct sequencing of fungal ribosomal RNA genes for phylogenetics, in Innis, M.A. et al. (eds.), PCR Protocols: A Guide to Methods and Applications, Academic Press, New York, 1990, pp. 315–322; Bruns, T.D. et al., Ann. Rev. Ecol. Syst., 22, 525, 1991; Bruns, T.D. et al., Mol. Phylog. Evol., 1, 231, 1992; Gardes, M. and Bruns, T.D., Mol. Ecol., 2, 113, 1993; Vilgalys, R. et al., Mycol. Helvet., 6, 73, 1994; Gargas, A. and DePriest, P.T., Mycologia, 88, 745, 1996; Crous, P.W. et al., Stud. Mycol., 64, S17, 2009. Notes: Primer names with a “d” ending denote degenerate primers, whereas those with an “m” ending denote specic primers. The nucleotide posi- tions of the primers refer to the rRNA gene sequence of Magnaporthe grisea (GenBank accession AB026819) or that of Saccharomyces cere- viseae in the 5′–3′ direction [43,61].
1.4.4 PRODUcT DETEcTION (either in the form of oligonucleotides or amplied DNA fragments with specicity for unique portions of the 18S In its standard form, the products generated by PCR are sepa- rRNA gene) are afxed to a solid surface (e.g., glass, plastic, rated by agarose gel electrophoresis with or without modica- or silicon chip) as probes, forming an array for simultaneous tion (e.g., enzymatic digestion), stained with a DNA-binding identication of fungal organisms. Universal 18S rRNA gene dye (e.g., ethidium bromide or gel star), and visualized under primers (one of which contains a ¼uorescent label) are used in UV light. For PCR products <100 bp or for distinction of PCR to amplify all the 18S rRNA genes present in a sample. products with minor size differences, polyacrylamide gel The resulting PCR products are added to the array and will electrophoresis and its derivatives (e.g., single-strand con- only bind to the probes for which they have a complementary formational polymorphism [SSCP] analysis, denaturing gra- sequence. Pathogens are identied by the pattern of ¼uoresc- dient gel electrophoresis [DGGE], and temperature DGGE ing spots in the array. Line probe assay (LiPA) is another [TGGE]) may be used. nucleic acid hybridization test that is modied from DNA To improve the sensitivity of PCR product detection, microarray. Instead of a glass, silicon, plastic chip, LiPA is enzymatic signal amplication (e.g., ELISA and ¼ow cytom- conducted on a nitrocellulose strip, on which specic oligo- etry) can be applied. In a common version of PCR-ELISA, nucleotide probes are attached at known positions as parallel streptavidin-coated microtiter plate is incubated with a bio- lines and are hybridized with biotin-labeled PCR products. tinylated capture probe (or oligonucleotide) with specicity Recent advances in instrument automation and ¼uores- for a fungal gene. Aliquots of a PCR products generated cent dye chemistry permit instant monitoring of PCR ampli- with digoxigenin-labeled primers (derived from the same cons (so-called real-time PCR) without additional manual gene) are denatured in NaOH and subsequently hybridized handling. In one form of real-time PCR, a double-stranded to the capture probe. Specic hybridization products are then DNA intercalating dye (e.g., SYBR Green) is used. SYBR visualized by a colorimetric detection system based on an Green increases its emission spectrum by 50- to 100-fold anti-digoxigenin horseradish peroxidase conjugate in the when binding to double-stranded DNA. As the double- presence of a chromogenic substrate solution. After stopping stranded DNA is synthesized during PCR, an increase in ¼u- the enzyme reaction with H2SO4, the absorbance is measured orescence correlates to an increasing concentration of PCR in an ELISA reader with a 450 nm lter. products, which can be determined real time with reference PCR amplicons can be also detected by DNA microar- to a standard sample. Discrimination of amplicons gener- ray (also known as DNA chip, gene or genome chip, or gene ated by multiplex PCR from different genes is also possible array). Typically, a collection of microscopic DNA spots if these gene products have sufciently different Tm values. 20 Molecular Detection of Human Fungal Pathogens
A melting curve analysis is performed post-PCR, using the time period; and (ii) reproducibility—the variation arising SYBR Green as a ¼uorescent marker. As the melting point is using the same measurement process among different instru- reached, the DNA denatures and the ¼uorescence decreases ments and operators from one run to another (i.e., inter-assay sharply. The plotting of ¼uorescence versus temperature in a precision) or over longer time periods. Linearity refers to the graph assists calculation of the melting temperature for each tendency of measurements by a quantitative assay to form product. Other forms of real-time PCR employ specically a straight line when plotted on a graph. Data from linearity designed probes that target a region of amplicon and incor- experiments may be subjected to linear regression analysis porate a ¼uorescent dye. Examples of these probes include with an ideal regression coefcient of 1. In case of a nonlin- hydrolysis dual-labeled probes (TaqMan®), hybridization ear curve, other objective, statistically valid methods may be probes (LightCycler), molecular beacons, peptide nucleic utilized. acid (PNA) probes, TaqMan minor groove-binding (MGB™) probes, locked nucleic acid (LNA®) primers and probes, and 1.5.2 RESULT INTERpRETATION scorpions™ [38]. DNA sequencing analysis provides a most accurate way A positive result by a molecular assay for a given patho- to ascertain the identity of PCR amplicons generated from gen normally conrms the etiologic relationship if the clini- fungi and other organisms. The classical chain termination cal syndrome is compatible with the pathogen identied. sequencing method (or Sanger method) utilizes primers or Considering the sensitive nature of the amplied methods dideoxynucleotides that are labeled with radioactive isotope such as PCR, it is important to rule out the possibility of a or ¼uorescent tag, and the sequencing products are detected false-positive result. Occasionally, false-positive results may by exposure to x-rays or UV light. More recently, pyrose- originate from the low diagnostic specicity of the assay, in quencing, Roche 454, and Illumina Solexa platforms have which primers bind to irrelevant sequences and occasion- been adopted for high-throughput sequencing analysis of ally a homologous sequence that is shared among related PCR products. The nucleotide sequences of the PCR ampli- or unknown bacteria. More often, false-positive results in con are then compared with those stored at reference data- the molecular testing come from contamination, which may bases such as GenBank, and the phylogenetic relationships of arise during manual handling of the samples in the testing related fungi are displayed in the form of trees, constructed laboratory either at the pre- or post-extraction (while set- with distance matrix methods (resulting in phenograms) and ting up the PCR) stages. This risk is heightened when a maximum-parsimony methods (resulting in cladograms) [54]. high copy-number polynucleotide (or plasmid) is used as a quantication standard and distributed around the labora- tory, contaminating reaction source. Additionally, contami- 1.5 RESULT INTERPRETATION, nation may be attributable to samples that are referred from STANDARDIZATION, QUALITY other laboratories, which do not utilize manipulation tech- CONTROL, AND ASSURANCE niques that are mandatory for the molecular testing. These may include the use of unplugged pipette tips, infrequent 1.5.1 KEY PERFORMANcE CHARAcTERISTIcS changing of gloves, and using pipette for long periods with- The performance of a diagnostic assay is often evaluated out decontamination. Another cause of contamination is by by using several key parameters, including detection limit, amplication products from previous tests. Contamination sensitivity, specicity, accuracy, intra-assay precision, inter- may also occur by leakage from tubes or microtiter plates assay precision, and linearity (as in the case of a quantitative with lids not tightly closed or by breakage of glass capillar- assay). Detection limit (or limit of detection) is the lowest ies leading to spillage of the amplication mixture. Besides concentration or quantity of bacteria that can be detected by a the adoption of stringent laboratory practice, the risk of con- given assay. Sensitivity is the percentage of samples contain- tamination with PCR products may be reduced by replac- ing bacteria of interest that are identied by the assay as posi- ing nucleotide dTTP with dUTP in PCR and implementing tive for the bacteria. Specicity is the percentage of samples a digestion step with uracil-DNA-glycosylase (UNG) to without bacteria of interest that are identied by the assay as remove previous PCR products containing dUTP prior to negative for the bacteria. Accuracy (or trueness) is the degree each amplication reaction. Furthermore, inclusion of mul- of conformity of an assay’s measurements to the actual (true) tiple negative controls, such as no-template controls (NTC) value. It is often estimated by analyses of reference materials and no-amplication controls (NAC), may help identify the or comparisons of results with those obtained by a reference likely source of contamination and prevent false-positive method. The closer an assay’s measurements to the accepted results. Moreover, microbial DNA may come with PCR value, the more accurate the assay is. Precision is the degree reagents. of mutual agreement among a series of assay’s individual Similarly, a negative result by a molecular assay for a measurements, values, or results. Usually characterized in given pathogen normally indicates the absence of the patho- terms of the standard deviation of the measurements, pre- gen. However, it is equally important to rule out the possibil- cision can be stratied into (i) repeatability—the variation ity of false-negative results. One possible cause is due to the arising using the same instrument and operator in a single low sensitivity of the assay employed. Alternatively, insuf- rune (i.e., intra-assay precision) or repeating during a short cient amount of bacteria may be present in the sample (due Introductory Remarks 21 to sample degradation or prior antibiotic treatment). Another accuracy, repeatability (intra-assay precision), reproducibil- may be due to the impurity of the processed sample. Enzymes ity (inter-assay precision), detection limit, and linearity (if (e.g., DNA polymerase, reverse transcriptase) used in PCR quantitative) of molecular tests. and RT-PCR are impeded by components in blood and feces Before validating a method, it is important to have all (e.g., heme, hemoglobulin, lactoferrin, immunoglobulin G, instruments calibrated and maintained throughout the testing leukocyte DNA, polysaccharides, and urea), in foods (e.g., process. The validation process may involve a series of steps phenolics, glycogen, calcium ions, fat, and other organic including (i) testing of dilution series of positive samples (or substances), in environmental specimens (e.g., phenolics, plasmid construct) to determine the limits of detection of humic acids, and heavy metals), and in added anticoagulants the assay and their linearity over concentrations to be mea- (e.g., EDTA and heparin) as well as nucleic acid purication sured in quantitative test (using minimal number of refer- reagents (e.g., detergents, lysozyme, NaOH, alcohol, EDTA, ence calibrators such as previously tested patient samples or EGTA, phenol, and high salt concentrations). Any impuri- pooled sera); (ii) evaluating the sensitivity and specicity of ties and contaminations present in the samples after nucleic the assay, along with the extent of cross-reactivity with other acid isolation may contribute to false-negative results. A use- genomic material; (iii) establishing the day-to-day variation ful way to determine the effective of nucleic acid purica- of the assay’s performance; (iv) assuring the quality of assem- tion procedure for removing inhibitory substances is to spike bled assays using quality control procedures that monitor the samples with well-dened DNA or RNA prior to and after performance of reagent batches; and (v) aligning the in-house sample preparation (as process and amplication internal primer and probe sequences with a genome sequence data- controls). In light of the high sensitivity of PCR, the occur- bank to avoid extended specicity testing [25–27,58]. rence of false-negative results is probably a truly underesti- mated problem [55]. 1.5.4 QUALITY CONTROL AND ASSURANcE Because few species-specic molecular assays are avail- able for fungal organisms, PCR amplication and DNA 1.5.4.1 Quality Control sequencing analysis of the rRNA genes, ITS and other gene Quality control strategies for nucleic acid-based tests include regions have remained a most useful tool for fungal identi- (i) designation of a “clean” area for reaction setup (e.g., room cation. As this approach is contingent on sequence compari- under negative air pressure; positive-displacement pipettes; son, inaccuracy of data deposited in reference databases may aerosol-block pipette tips; UV-equipped PCR cabinet); (ii) lead to incorrect identication. For example, a lack of pig- use of personal protective equipment (PPE) (e.g., dispos- mentation in Alternaria infectoria may contribute to its mis- able gloves and laboratory coats to prevent the introduction identication using macroscopic characteristics. Sequence of contaminating DNA or nucleases); (iii) use of uracil-N- data from the incorrectly identied isolates that are stored glycosylase (UNG) in real-time PCR (to eliminate cross-over in reference databases may result in erroneous determination amplicon contamination); (iv) use of a “hot-start” method (to of testing isolates. Indeed, de Hoog and Horré [56] demon- minimize false priming events by withholding a crucial reac- strated that about 14% of the Alternaria infectoria sequences tion component until appropriate temperature is reached); (v) deposited in GenBank were found to be misidentied. In a use of external positive and negative controls (to monitor separate study, Nilsson et al. [57] reported that about 20% reaction performance and contamination) and homologous of the entries related to fungi in the International Nucleotide or heterologous internal controls (to monitor presence of Sequence Database might have been incorrectly identied to inhibitors). species level. A variety of test controls may be considered for diagnostic PCR. These include (i) internal amplication control (IAC) (negative sample spiked with sufcient pathogen and pro- 1.5.3 STANDARDIZATION AND VALIDATION cessed throughout the entire protocol); (ii) processing posi- As molecular tests such as PCR and sequencing offer tive control (PPC) (negative sample spiked with sufcient improved sensitivity, specicity, accuracy, precision, and closely related, but non-target, strain processed throughout result availability for fungal identication and diagnosis, the entire protocol.); (iii) reagent control (blank) (contain- they have been increasingly adopted and applied in routine ing all reagents, but no nucleic acid apart from the primers.); diagnostic laboratories. Considering the possibility of false- (iv) premise control (tube containing the master mixture left positive and false-negative results that may occur in these open in the PCR setup room) to detect possible contaminat- highly sensitive tests, it is essential to properly standardize ing DNA in the environment (carried out at regular intervals and validate them prior to their adoption, and to put in place as part of the quality assurance program); (v) standard (three appropriate quality control measures to ensure their consis- to four samples containing 10-fold dilution series of known tent performance. number of target DNA copies in a range) [31,59]. Standardization of molecular tests addresses the need for standardized reagents and common units, contamina- 1.5.4.2 Quality Assurance tion control mechanisms, inhibition control mechanisms, One way to assess preparedness of the diagnostic labora- clinically relevant dynamic ranges and internal controls, tories is through the conduct of an external quality assur- etc. Validation helps to verify the sensitivity, specicity, ance (EQA) program providing characterized specimens 22 Molecular Detection of Human Fungal Pathogens containing pathogens of interest. The design of a quality changes for many fungal organisms in the past as well as assurance program has the following components: (i) internal in recent times represent another potential source of mis- quality control (IQC) materials are distributed every month identication if care is not taken. Therefore, future identi- and comprising three pools of clinical samples of known cation and characterization of novel taxon-specic gene pathogen status (typically one negative, one positive contain- markers will contribute to the increased accuracy in the ing 1 log 10 over the lower limit of detection of the assay, molecular determination of fungal species/varieties impli- and one low positive containing up to 1 log 10 of the lower cated in human mycoses. These gene markers may come in limit of detection of the assay). These are incorporated in the forms of previously uncharacterized, uniquely present test runs on a weekly basis. The purpose of IQC is to provide genes, or of taxon-specic probes recognizing distinct por- samples of known status for repeated testing in parallel with tions of the shared genes. The latter category is exemplied clinical samples to ensure reproducibility of the test system by the development of species-specic probes from the inter- in an individual laboratory. (ii) EQA distributions of panels nal transcribed spacer (ITS) regions that are common to all of ve unknown samples distributed quarterly. Results are dermatophytes [62]. returned to the QA laboratory for assessment. EQA compares the performance of different testing sites using specimens of REFERENCES known but undisclosed content. (iii) Aliquots of all samples sent from the reference laboratory are posted back to Site A 1. The Index Fungorum Partnership (CABI, CBS, Landcare for repeat testing to check for integrity of the pools and for Research-NZ). Available at http://www.indexfungorum.org/, transport problems. (iv) A nal element of the pilot program accessed on August 1, 2010. 2. International Mycology Association. Available at http://www. involves Sites B, C, and D sending an aliquot of every 50th mycobank.org/, accessed on August 1, 2010. sample to Site A to check for reproducibility. (v) A detailed 3. The ofcial website of the Mycoses Study Group. Available at record of distributions is kept to provide an audit trail. http://www.doctorfungus.org/, accessed on August 1, 2010. 4. The Assembling the Fungal Tree of Life (AFTOL) project. 1.6 CONCLUSIONS Available at http://aftol.org/, accessed on August 1, 2010. 5. The UniProt Consortium. Available at http://www.uniprot. Fungi are a diverse group of eukaryotic organisms that are org/, accessed on August 1, 2010. ubiquitously distributed in all environments. Although most 6. The Global Biodiversity Information Facility. Available at fungi are saprophytes involved in the decomposition and http://www.data.gbif.org/, accessed on August 1, 2010. recycling of organic matters as well as in the formation of 7. Mycology online, School of Molecular & Biomedical symbiotic relationship with plants and animals, some have the Science, The University of Adelaide, Australia. Available at capacity to infect plants, animals, and humans. Human myco- http://www.mycology.adelaide.edu.au/, accessed on August 1, 2010. ses often occur as a result of trauma or underlying immuno- 8. Crous, P.W. et al. 2009. Phylogeny and taxonomy of obscure suppression, with clinical symptoms ranging from supercial, genera of microfungi. Persoonia 22:139–161. cutaneous, subcutaneous, to systemic mycoses. Since human 9. Guarro, J., Gené, J., and A.M. Stchigel. 1999. Developments mycoses caused by various fungal species are almost impos- in fungal taxonomy. Clin. Microbiol. Rev. 12(3):454–500. sible to distinguish clinically, it is important to identify the 10. Hibbett, D.S. and R. Vilgalys. 1993. Phylogenetic relationships causative agents to genus and species level for implementa- of the Basidiomycete genus Lentinus inferred from molecular tion of appropriate treatment and prevention measures. and morphological characters. Syst. Bot. 18:409–433. 11. James, T.Y. et al. 2006. Reconstructing the early evolution of Due to their complex life cycle and their production of the fungi using a six gene phylogeny. Nature 443:818–822. morphologically similar structures, fungi are notoriously dif- 12. Hibbett, D.S. et al. 2007. A higher-level phylogenetic clas- cult to identify on the basis of macroscopic and microscopic sication of the Fungi. Mycol. Res. 111:509–547 features [60]. Use of biochemical, biological, and other phe- 13. McLaughlin, D.J. 2009. The search for the fungal tree of life. notypic procedures to assess cultured isolates adds further Trends Microbiol. 17:488. delay in the laboratory speciation of fungal organisms. With 14. Crous, P.W. et al. (eds.) 2009. Fungal biodiversity. recent development and application of molecular techniques, CBS Laboratory Manual Series 1. Centraalbureau voor especially PCR amplication and sequencing analysis of the Schimmelcultures, Utrecht, Netherlands. 15. Goffeau, A. et al. 1996. Life with 6000 genes. Science 274: rRNA gene, ITS, and other gene regions, rapid, sensitive, and 563–567. accurate determination of fungal organisms has become a 16. van den Berg, M.A. et al. 2008. Genome sequencing and anal- reality [61]. Moreover, molecular characterization of fungal ysis of the lamentous fungus Penicillium chrysogenum. Nat. organisms is much less technically demanding than pheno- Biotechnol. 26(10):1161–1168. typic procedures. 17. Coleman, J.J. et al. 2009. The genome of Nectria haemato- Considering that sequence-based approach for fungal cocca: Contribution of supernumerary chromosomes to gene identication is dependent on the reliability and accuracy of expansion. PLoS Genet. 5(8):e1000618. 18. Chandler, F.W. 1985. Pathology of the mycoses in patients reference databases for comparison with other related organ- with the acquired immunodeciency syndrome (AIDS). Curr. isms, it is critical to be aware that inaccuracy in reference Top. Med. Mycol. 1:1–23. databases that hold fungal nucleotide sequences may lead to 19. McGinnis, M.R. 1980. Laboratory Handbook of Medical incorrect identication. In addition, frequent taxonomical Mycology. Academic Press, New York. Introductory Remarks 23
20. Schwarz, J. 1982. The diagnosis of deep mycoses by morpho- 40. Bruns, T.D. et al. 1992. Evolutionary relationships within the logic methods. Human Pathol. 13:519–533. fungi: Analyses of nuclear small subunit rRNA sequences. 21. Dixon, D.M. and A. Polak-Wyss. 1991. The medically impor- Mol. Phylogenet. Evol. 1:231–241. tant dematiaceous fungi and their identication. Mycoses 41. Bruns, T.D., T.J. White, and J.W. Taylor, 1991. Fungal 34:1–18. molecular systematics. Ann. Rev. Ecol. Syst. 22:525–564. 22. Kaufman, L. 1992. Immunohistologic diagnosis of systemic 42. Borman, A.M. et al. 2009. Pyrosequencing analysis of 20 mycoses: An update. Eur. J. Epidemiol. 8:377–382. nucleotides of internal transcribed spacer 2 discriminates 23. Gonçalves, A.B. et al. 2006. FISH and Calco¼uor staining Candida parapsilosis, Candida metapsilosis, and Candida techniques to detect in situ lamentous fungal biolms in orthopsilosis. J. Clin. Microbiol. 47:2307–2310. water. Rev. Iberoam. Micol. 23:194. 43. Vilgalys, R., J.S. Hopple Jr., and D.S. Hibbett. 1994. Phylogenetic 24. Santos, C. et al. 2010. Filamentous fungal characterizations implications of generic concepts in fungal taxonomy: The by matrix-assisted laser desorption/ionization time-of-¼ight impact of molecular systematic studies. Mycol. Helvet. 6:73. mass spectrometry. J. Appl. Microbiol. 108:375. 44. Paterson, R.R. 2007. The isoepoxydon dehydrogenase gene 25. McGinnis, M.R. and M.G. Rinaldi. 1985. Antifungal drugs: PCR prole is useful in fungal taxonomy. Rev. Iberoam. Mechanisms of action, drug resistance, susceptibility testing, Micol. 24:289. and assays of activity in biological ¼uids. In V. Lorian (ed.), 45. Hillis, D.M. and M.T. Dixon, 1991. Ribosomal DNA: Antibiotics in Laboratory Medicine. The Williams & Wilkins Molecular evolution and phylogenetic inference. Quart. Rev. Co., Baltimore, MD, pp. 223–281. Biol. 66:411. 26. Rinaldi, M.G. and A.W. Howell. 1988. Antifungal anti- 46. Gardes, M. and T.D. Bruns, 1993. ITS primers with enhanced microbics: Laboratory evaluation. In B. Wentworth (ed.), specicity for basidiomycetes—Application to the identica- Diagnostic Procedures for Mycotic and Parasitic Infections, tion of mycorrhizae and rusts. Mol. Ecol. 2:113–118. 7th edn. American Public Health Association, Washington, 47. Gargas, A. and J.W. Taylor. 1992. Polymerase chain reaction DC, pp. 325–356.. (PCR) primers for amplifying and sequencing 18S rDNA 27. Pfaller, M.A. et al. 1995. Quality control guidelines for from lichenized fungi. Mycologia 84:589–592. National Committee for Clinical Laboratory Standards recom- 48. Gargas, A. and P.W. DePriest. 1996. A nomenclature for fun- mended broth macrodilution testing of amphotericin B, ¼uco- gal PCR primers with examples from intron-containing SSU nazole, and ¼ucytosine. J. Clin. Microbiol. 33:1104–1107. rDNA. Mycologia 88:745–748. 28. DePriest, P.T. and M.D. Been. 1992. Numerous group I 49. Hibbett, D.S. 1992. Ribosomal RNA and fungal systematics. introns with variable distributions in the ribosomal DNA of a Trans. Mycol. Soc. Jpn. 33:533–556. lichen fungus. J. Mol. Biol. 228:315–321. 50. Fell, J.W. et al. 2000. Biodiversity and systematics of basidio- 29. Hopple, J.S. Jr. and R. Vilgalys. 1994. Phylogenetic rela- mycetous yeasts as determined by large-subunit rDNA D1/D2 tionship among coprinoid taxa and allies based on data domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50:1351. from restriction site mapping of nuclear rDNA. Mycologia 51. White, T.J. et al. 1990. Amplication and direct sequencing 86:96–107. of fungal ribosomal RNA genes for phylogenetics. In M.A. 30. Bretagne, S. et al. 1995. Detection of Aspergillus species Innis et al. (eds.), PCR Protocols: A Guide to Methods and DNA in bronchoalveolar lavage samples by competitive PCR. Applications. Academic Press, New York, pp. 315–322. J. Clin. Microbiol. 33:1164–1168. 52. Vilgalys, R. and D. Gonzalez. (1990). Organization of ribo- 31. Bretagne, S. and J.-M. Costa. 2006. Towards a nucleic acid- somal DNA in the basidiomycete Thanatephorus praticola. based diagnosis in clinical parasitology and mycology. Clin. Curr. Genet. 18:277. Chim. Acta 363:221. 53. Liu, D. et al. 2000. Application of PCR to the identication of 32. de Hoog, G.S. and A.H.G. Gerrits van den Ende. 1998. dermatophyte fungi. J. Med. Microbiol. 49:493. Molecular diagnostics of clinical strains of lamentous 54. Shenoy, B.D., R. Jeewon, and K.D. Hyde. 2007. Impact of Basidiomycetes. Mycoses 41:183–189. DNA sequence-data on the taxonomy of anamorphic fungi. 33. Bougnoux, M. et al. 1999. Serum is more suitable than whole Fungal Divers. 26:1–54. blood for diagnosis of systemic candidiasis by nested PCR. J. 55. Wilson, I.G. 1997. Inhibition and facilitation of nucleic acid Clin. Microbiol. 37:925–930. amplication. Appl. Environ. Microbiol. 63:3741–3751. 34. Chen, S.C., C.L. Halliday, and W. Meyer. 2002. A review of 56. de Hoog, G.S. and R. Horré. 2002. Molecular taxonomy of nucleic acid-based diagnostic tests for systemic mycoses with the Alternaria and Ulocladium species from humans and their an emphasis on polymerase chain reaction-based assays. Med. identication in the routine laboratory. Mycoses 45:259. Mycol. 40:333–357. 57. Nilsson, R.H. et al. 2006. Taxonomic reliability of DNA 35. Yeo, S.F. and B. Wong. 2002. Current status of nonculture sequences in public sequence databases: A fungal perspective, methods for diagnosis of invasive fungal infections. Clin. PLoS One 1:e59. Microbiol. Rev. 15:465. 58. Kontoyiannis, D.P. and R.E. Lewis. 2002. Antifungal drug 36. Balajee, S.A., L. Sigler, and M.E. Brandt. 2007. DNA and the resistance of pathogenic fungi. Lancet 359:1135–1144. classical way: Identication of medically important molds in 59. Paterson, R.R. 2007. Internal amplication controls have not the 21st century. Med. Mycol. 45:475. been employed in fungal PCR hence potential false negative 37. Borman, A.M. et al. 2008. Molecular identication of patho- results. J. Appl. Microbiol. 102:1. genic fungi. J. Antimicrob. Chemother. 61:S7. 60. Koneman, E.W. and G.D. Roberts. 1985. Practical Laboratory 38. Wengenack, N.L. and M.J. Binnicker. 2009. Fungal molecular Mycology. The Williams and Wilkins Co., Baltimore, MD. diagnostics. Clin. Chest Med. 30:391. 61. Crous, P.W. et al. 2009. Phylogenetic lineages in the 39. Borman, A.M. et al. 2010. An improved protocol for the Capnodiales. Stud. Mycol., 64, S17. preparation of total genomic DNA from isolates of yeast and 62. Bergmans, A.M. et al. 2010. Evaluation of a single-tube real- mould using Whatman FTA lter papers. Mycopathologia time PCR for detection and identication of 11 dermatophyte 169:445–449. species in clinical material. Clin. Microbiol. Infect., 16, 704.
Part I
Ascomycota Pezizomycotina: Dothideomycetes
References
1 Chapter 1 - Introductory Remarks
20. Schwarz, J. 1982. The diagnosis of deep mycoses by morphologic methods. Human Pathol. 13:519–533.
21. Dixon, D.M. and A. Polak-Wyss. 1991. The medically important dematiaceous fungi and their identi�cation. Mycoses 34:1–18.
22. Kaufman, L. 1992. Immunohistologic diagnosis of systemic mycoses: An update. Eur. J. Epidemiol. 8:377–382.
23. Gonçalves, A.B. et al. 2006. FISH and Calco¼uor staining techniques to detect in situ �lamentous fungal bio�lms in water. Rev. Iberoam. Micol. 23:194.
24. Santos, C. et al. 2010. Filamentous fungal characterizations by matrix-assisted laser desorption/ionization time-of-¼ight mass spectrometry. J. Appl. Microbiol. 108:375.
25. McGinnis, M.R. and M.G. Rinaldi. 1985. Antifungal drugs: Mechanisms of action, drug resistance, susceptibility testing, and assays of activity in biological ¼uids. In V. Lorian (ed.), Antibiotics in Laboratory Medicine. The Williams & Wilkins Co., Baltimore, MD, pp. 223–281.
26. Rinaldi, M.G. and A.W. Howell. 1988. Antifungal antimicrobics: Laboratory evaluation. In B. Wentworth (ed.), Diagnostic Procedures for Mycotic and Parasitic Infections, 7th edn. American Public Health Association, Washington, DC, pp. 325–356..
27. Pfaller, M.A. et al. 1995. Quality control guidelines for National Committee for Clinical Laboratory Standards recommended broth macrodilution testing of amphotericin B, ¼uconazole, and ¼ucytosine. J. Clin. Microbiol. 33:1104–1107.
28. DePriest, P.T. and M.D. Been. 1992. Numerous group I introns with variable distributions in the ribosomal DNA of a lichen fungus. J. Mol. Biol. 228:315–321.
29. Hopple, J.S. Jr. and R. Vilgalys. 1994. Phylogenetic relationship among coprinoid taxa and allies based on data from restriction site mapping of nuclear rDNA. Mycologia 86:96–107.
30. Bretagne, S. et al. 1995. Detection of Aspergillus species DNA in bronchoalveolar lavage samples by competitive PCR. J. Clin. Microbiol. 33:1164–1168.
31. Bretagne, S. and J.-M. Costa. 2006. Towards a nucleic acidbased diagnosis in clinical parasitology and mycology. Clin. Chim. Acta 363:221.
32. de Hoog, G.S. and A.H.G. Gerrits van den Ende. 1998. Molecular diagnostics of clinical strains of �lamentous Basidiomycetes. Mycoses 41:183–189.
33. Bougnoux, M. et al. 1999. Serum is more suitable than whole blood for diagnosis of systemic candidiasis by nested PCR. J. Clin. Microbiol. 37:925–930.
34. Chen, S.C., C.L. Halliday, and W. Meyer. 2002. A review of nucleic acid-based diagnostic tests for systemic mycoses with an emphasis on polymerase chain reaction-based assays. Med. Mycol. 40:333–357.
35. Yeo, S.F. and B. Wong. 2002. Current status of nonculture methods for diagnosis of invasive fungal infections. Clin. Microbiol. Rev. 15:465.
36. Balajee, S.A., L. Sigler, and M.E. Brandt. 2007. DNA and the classical way: Identi�cation of medically important molds in the 21st century. Med. Mycol. 45:475.
37. Borman, A.M. et al. 2008. Molecular identi�cation of pathogenic fungi. J. Antimicrob. Chemother. 61:S7.
38. Wengenack, N.L. and M.J. Binnicker. 2009. Fungal molecular diagnostics. Clin. Chest Med. 30:391.
39. Borman, A.M. et al. 2010. An improved protocol for the preparation of total genomic DNA from isolates of yeast and mould using Whatman FTA �lter papers. Mycopathologia 169:445–449. 40. Bruns, T.D. et al. 1992. Evolutionary relationships within the fungi: Analyses of nuclear small subunit rRNA sequences. Mol. Phylogenet. Evol. 1:231–241. 41. Bruns, T.D., T.J. White, and J.W. Taylor, 1991. Fungal molecular systematics. Ann. Rev. Ecol. Syst. 22:525–564. 42. Borman, A.M. et al. 2009. Pyrosequencing analysis of 20 nucleotides of internal transcribed spacer 2 discriminates Candida parapsilosis, Candida metapsilosis, and Candida orthopsilosis. J. Clin. Microbiol. 47:2307–2310. 43. Vilgalys, R., J.S. Hopple Jr., and D.S. Hibbett. 1994. Phylogenetic implications of generic concepts in fungal taxonomy: The impact of molecular systematic studies. Mycol. Helvet. 6:73. 44. Paterson, R.R. 2007. The isoepoxydon dehydrogenase gene PCR pro�le is useful in fungal taxonomy. Rev. Iberoam. Micol. 24:289. 45. Hillis, D.M. and M.T. Dixon, 1991. Ribosomal DNA: Molecular evolution and phylogenetic inference. Quart. Rev. Biol. 66:411. 46. Gardes, M. and T.D. Bruns, 1993. ITS primers with enhanced speci�city for basidiomycetes—Application to the identi�cation of mycorrhizae and rusts. Mol. Ecol. 2:113–118. 47. Gargas, A. and J.W. Taylor. 1992. Polymerase chain reaction (PCR) primers for amplifying and sequencing 18S rDNA from lichenized fungi. Mycologia 84:589–592. 48. Gargas, A. and P.W. DePriest. 1996. A nomenclature for fungal PCR primers with examples from intron-containing SSU rDNA. Mycologia 88:745–748. 49. Hibbett, D.S. 1992. Ribosomal RNA and fungal systematics. Trans. Mycol. Soc. Jpn. 33:533–556. 50. Fell, J.W. et al. 2000. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50:1351. 51. White, T.J. et al. 1990. Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In M.A. Innis et al. (eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press, New York, pp. 315–322. 52. Vilgalys, R. and D. Gonzalez. (1990). Organization of ribosomal DNA in the basidiomycete Thanatephorus praticola. Curr. Genet. 18:277. 53. Liu, D. et al. 2000. Application of PCR to the identi�cation of dermatophyte fungi. J. Med. Microbiol. 49:493. 54. Shenoy, B.D., R. Jeewon, and K.D. Hyde. 2007. Impact of DNA sequence-data on the taxonomy of anamorphic fungi. Fungal Divers. 26:1–54. 55. Wilson, I.G. 1997. Inhibition and facilitation of nucleic acid ampli�cation. Appl. Environ. Microbiol. 63:3741–3751. 56. de Hoog, G.S. and R. Horré. 2002. Molecular taxonomy of the Alternaria and Ulocladium species from humans and their identi�cation in the routine laboratory. Mycoses 45:259. 57. Nilsson, R.H. et al. 2006. Taxonomic reliability of DNA sequences in public sequence databases: A fungal perspective, PLoS One 1:e59. 58. Kontoyiannis, D.P. and R.E. Lewis. 2002. Antifungal drug resistance of pathogenic fungi. Lancet 359:1135–1144. 59. Paterson, R.R. 2007. Internal ampli�cation controls have not been employed in fungal PCR hence potential false negative results. J. Appl. Microbiol. 102:1. 60. Koneman, E.W. and G.D. Roberts. 1985. Practical Laboratory Mycology. The Williams and Wilkins Co., Baltimore, MD. 61. Crous, P.W. et al. 2009. Phylogenetic lineages in the Capnodiales. Stud. Mycol., 64, S17. 62. Bergmans, A.M. et al. 2010. Evaluation of a single-tube realtime PCR for detection and identi�cation of 11 dermatophyte species in clinical material. Clin. Microbiol. Infect., 16, 704.
Part I
Ascomycota
Pezizomycotina: Dothideomycetes 2 Chapter 2 - Alternaria
24. Farina, C. et al., Phaehyphomycotic soft tissue disease caused by Alternaria alternata in a kidney transplant patient: A case report and literature review, Trans. Proc., 39, 1655, 2007.
25. Gilaberte, M. et al., Cutaneous alternariosis in transplant recipients: Clinicopathologic review of 9 cases, J. Am. Acad. Dermatol., 52, 653, 2005.
26. Fathallah, M. et al., Alternariose palatine et cutanèe à Alternaria infectoria chez une patiente immunocompetente tunisienne, J. Mycol. Med., 13, 145, 2003.
27. Kucan, J.O. and Hall, S., Alternaria burn wound sepsis, J. Burn Care Rehabil., 6, 501, 1985.
28. Revankar, S.G. et al., Disseminated phaeomycosis: Review of an emerging mycosis, Clin. Infect. Dis., 34, 467, 2002.
29. Chander, J. and Sharma, A., Prevalence of fungal corneal ulcers in Northern India, Infection, 22, 207, 1994.
30. Panda, A. et al., Mycotic keratitis in children: Epidemiologic and microbiologic evaluation, Cornea, 16, 295, 1997.
31. Tanure, M.A. et al., Spectrum of fungal keratitis at Wills Eye Hospital, Philadelphia, Pennsylvania, Cornea, 19, 307, 2000.
32. Chowdhary, A. and Singh, K., Spectrum of fungal keratitis in North India, Cornea, 1, 8, 2005.
33. Ferrer, C. et al., Polymerase chain reaction diagnosis in fungal keratitis caused by Alternaria alternate, Am. J. Ophthalmol., 133, 398, 2002.
34. Zahara, L.V. et al., Case report. Keratomycosis due to Alternaria alternate in a diabetic patient, Mycoses, 45, 512, 2002.
35. International Rhinosinusitis Advisory Board, Infectious rhinosinusitis in adults: Classi�cation, etiology and management, Ear Nose Throat J., 76, 5, 1997.
36. Pleis, J.R. and Lethbridge-Cejku, M., Summary health statistics for U.S. adults: National Health Interview survey, 2006, Vital Health Stat., 235, 1, 2007.
37. Chakrabarti, A. et al., Fungal rhinosinusitis: A categorization and de�nitional schema addressing current controversies, Laryngoscope, 119, 1809, 2009.
38. Gosepath, J. et al., Fungal DNA is present in tissue specimens of patients with chronic rhinosinusitis, Am. J. Rhinol., 18, 9, 2004.
39. Jiang, R.S. et al., Ethmoid sinus mycology of chronic rhinosinusitis, Eur. J. Clin. Microbiol. Infect. Dis., 27, 253, 2008.
40. Ponikau, J.U. et al., The role of ubiquitous airborne fungi in chronic rhinosinusitis, Clin. Rev. Allergy Immunol., 30,187, 2006.
41. Shin, S.H. et al., Chronic rhinosinusitis: An enhanced immune response to ubiquitous airborne fungi, J. Allergy Clin. Immunol., 114, 369, 2004.
42. Arrese, J.E., Piérard-Franchimont, C., and Piérard, G.E., Onychomicosis and keratomicosis caused by Alternaria spp, Am. J. Dermatophatol., 18, 611, 1996.
43. Singh, S.M., Naidu, J., and Pouranik M., Ungual and cutaneous phaeohyphomycosis caused by Alternaria alternate and Alternaria chlamydospora, J. Med. Vet. Mycol., 28, 275, 1990.
44. Gianni, C., Cerri, A., and Crosti, C., Ungual phaeohyphomycosis caused by Alternaria alternate, Mycoses, 40, 219, 1996.
45. Baykal, C. et al., Simultaneous cutaneous and ungula alternariosis in a renal transplant recipient, Br. J. Dermatol., 143, 910, 2000.
46. Romano, C., Paccagnini, E., and Difonzo, E.M., Onychomycosis caused by Alternaria spp. in Tuscani, Italy from 1985 to 1999, Mycoses, 44, 73, 2001.
47. Hilmioğlu-Polat, S. et al., Non-dermatophytic molds as agents of onychomycosis in Izmir, Turkey—A prospective study, Mycopathologia, 160, 125, 2005. 48. Male, O. and Pehamberger, H., Secondary cutaneous mucose caused by Alternaria species, Hautarzt, 37, 94, 1986. 49. Machet, L. et al., Cutaneous alternariosis: Role of corticosteroid-induced cutaneous fragility, Dermatology, 193, 342, 1996. 50. Wiest, P.M. et al., Alternaria infection in a patient with acquired immunode�ciency syndrome: A case report and review of invasive Alternaria infections, Rev. Infect. Dis., 9, 799, 1987. 51. Lerner, L.H., Lerner, E.A., and Bello, Y.M., Co-existence of cutaneous and presumptive pulmonary alternariosis, Int. J. Dermatol., 36, 276, 1997. 52. De Hoog, G.S. and Horré R., Molecular taxonomy of the Alternaria and Ulocladium species from humans and their identi�cation in the routine laboratory, Mycoses, 45, 259, 2001. 53. Pujol, I. et al., In vitro antifungal susceptibility of Alternaria spp. and Ulocladium spp., J. Antimicrob. Chemother., 46, 323, 2000. 54. Nosanchuk, J.D. and Casadevall, A., The contribution of melanin to microbial pathogenesis, Cell. Microbiol., 5, 203, 2003. 55. Walsh, T.J. et al., Infections due to emerging and uncommon medically important fungal pathogens, Clin. Microbiol. Infect., 10, 48, 2004. 56. Taylor, B., Wheeler, M.H., and Szaniszlo, P.J., Evidence for pentaketide melanin biosynthesis in dematiaceous human pathogenic fungi, Mycologia, 79, 320–322. 1987. 57. Mironeko, N.V. et al., Intraspeci�c variation in gamma-radiation resistance and genomic structure in the �lamentous fungus Alternaria alternata: A case study of strains inhabiting Chernobyl reactor, 4, Ecotoxicol. Environ. Saf., 45, 177, 2000. 58. Van Duin, D., Casadeval. A., and Nosanchuk, J.D., Melanization of Cryptococcus neoformans and Histoplasma capsulatum reduces their susceptibility to amphotericin B and caspofungin, Antimicrob. Agents Chemother., 46, 3394, 2002. 59. Szaniszlo, P.J., Virulence factors in Black Molds with emphasis on melanin, chitin, and Wangiella as a molecularly tractable model, in Molecular Principles of Fungal Pathogenesis, p. 407, Heitman, J. et al. (eds.), ASM Press, Washington, DC, 2006. 60. Szaniszlo, P.J. and Momany M., Chitin, chitin synthase and chitin synthase conserved region homologues in Wangiella dermatitidis, in NATO Workshop Proceedings on Molecular Biology and its Application to Medical Mycology, p. 229, Maresca, G., Kobayashi, G., and Yamaguchi, H. (eds.), Springer-Verlag, New York, 1993. 61. Schell, W.A., Salkin, I.F., and McGinnis M.R., Bipolaris, Exophiala, Scedosporium, Sporothrix, and other dematiaceous fungi, in Manual of Clinical Microbiology, 8th edn., p. 1820, Murray, P.R. et al. (eds.), ASM Press, Washington, DC, 2003. 62. Simmons, E.G., Alternaria. An identi�cation manual. CBS Fungal Biodiversity Centre, Utrecht, the Netherlands, 2007. 63. Steadham, J.E., Geis, P.A., and Simmank, J.L., Use of carbohydrate and nitrate assimilations in the identi�cation of dematiaceous fungi, Diagn. Microbiol. Infect. Dis., 5, 71, 1986. 64. Fothergill, A.W., Identi�cation of dematiaceous fungi and their role in human disease, Clin. Infect. Dis., 22, 179, 1996. 65. de Hoog, G.S. et al., Phaeoanamorphic life cycle of Exophiala (Wangiella) dermatitidis, Anton. van Leeuwenh., 65, 143, 1994. 66. White, T.J. et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics, in PCR Protocols: A Guide to Methods and Applications, p. 315, Innis N., Gelfand J., White T. (eds.), Academic Press, New York, 1990.
67. Fredricks, D.N, Smith, C., and Meier, A., Comparison of six DNA extraction methods for recovery of fungal DNA as assessed by quantitative PCR, J. Clin. Microbiol., 43, 5122, 2005.
68. Bharathi, M.J. et al., Microbiological diagnosis of infective keratitis: Comparative evaluation of direct microscopy and culture results, Br. J. Ophthalmol., 90, 1271, 2006.
69. Montero, C.I. et al., Evaluation of pyrosequencing technology for the identi�cation of clinically relevant non-dematiaceous yeasts and related species, Eur. J. Clin. Microbiol. Infect. Dis., 27, 821, 2008.
70. Hinrikson, H.P. et al., Assessment of ribosomal large-subunit D1–D2, internal transcribed spacer 1, and internal transcribed spacer 2 regions as targets for molecular identi�cation of medically important Aspergillus species, J. Clin. Microbiol., 43, 2092, 2005. 71. Vahey, M.T., Wong, M.T., and Michael, N.L., A standard PCR protocol: Rapid isolation of DNA and PCR assay for beta-globin, in PCR Primers: Laboratory Manual, p. 17, Dieffenbacher, C.W. and Dvesksler, G.S. (eds.), Cold Spring Harbor Laboratory Press, New York, 1995. 72. Thompson, J.D., Higgins, D.G., and Gibson, T.J., CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-speci�c gap penalties and weight matrix choice, Nucleic Acids Res., 22, 4673, 1994. 73. Zhang, J. and Madden, T.L., PowerBLAST: A new network BLAST application for interactive or automated sequence analysis and annotation, Genome Res., 7, 649, 1997. 3 Chapter 3 - Aureobasidium
1. de Hoog, G.S., Guarro, J., Gené, J., and Figuerras, M.J., Atlas of Clinical Fungi, Centraalbureau voor Schimmelcultures/ Universitat Rovira I Virgili, Utrecht, the Netherlands, 2000.
2. Hermanides-Nijhof, E.J., Aureobasidium and allied genera, Stud. Mycol., 15, 141, 1977.
3. Kirk, P.M. et al., Dictionary of the Fungi, CAB International, Wallingford, U.K., 2008.
4. Yurlova, N.A., Uijthof, J.M., and de Hoog, G.S., Distinction of species in Aureobasidium and related genera by PCRribotyping, Anton. Van. Leeuwen., 69, 323, 1996.
5. de Hoog, G.S. and Yurlova, N.A., Conidiogenesis, nutritional physiology and taxonomy of Aureobasidium and Hormonema, Anton. Van. Leeuwen., 65, 41, 1994.
6. Yurlova, N.A., de Hoog, G.S., and Gerrits van den Ende, A.H.G., Taxonomy of Aureobasidium and allied genera, Stud. Mycol., 43, 63, 1999.
7. Zalar, P. et al., Rede�nition of Aureobasidium pullulans and its varieties, Stud. Mycol., 61, 21, 2008.
8. Spatafora, J.W., Mitchell, T.G., and Vilgalys, R., Analysis of genes coding for small-subunit rRNA sequences in studying phylogenetics of dematiaceous fungal pathogens, J. Clin. Microbiol., 33, 1322, 1995.
9. de Hoog, G.S. et al., Relationships of dothideaceous black yeasts and meristematic fungi based on 5.8S and ITS2 rDNA sequence comparison, Stud. Mycol., 43, 31, 1999.
10. Abliz, P. et al., Identi�cation of pathogenic dematiaceous fungi and related taxa based on large subunit ribosomal DNA D1/D2 domain sequence analysis, FEMS Immunol. Med. Microbiol., 40, 41, 2004.
11. Schoch, C.L. et al., A multigene phylogeny of the Dothideomycetes using four nuclear loci, Mycologia, 98, 1041, 2006.
12. Alvarez-Rodriguez, M.L. et al., Degradation of vanillic acid and production of guaiacol by microorganisms isolated from cork samples, FEMS Microbiol. Lett., 220, 49, 2003. 13. Manitchotpisit, P. et al., Multilocus phylogenetic analyses, pullulan production and xylanase activity of tropical isolates of Aureobasidium pullulans, Mycol. Res., 113, 1107, 2009.
14. Rinaldi, M.G., McCoy, E.L., and Winn, D.F., Gluteal abscess caused by Phialophora hoffmannii and review of the role of this organism in human mycoses, J. Clin. Microbiol., 16, 181, 1982.
15. McGinnis, M.R., Human pathogenic species of Exophiala, Phialophora, and Wangiella. PAHO Sci. Publ., 356, 37, 1978.
16. Marriott, D.J. et al., Scytalidium dimidiatum and Lecythophora hoffmannii: Unusual causes of fungal infections in a patient with AIDS, J. Clin. Microbiol., 35, 2949, 1997. 17. de Hoog, G.S., Guarro, J., Gené, J., and Figueras, M.J., Atlas of Clinical Fungi, a pilot CD-ROM version of the 3rd edition, Centraalbureau voor Schimmelcultures, Baarn, the Netherlands, 2009. 18. Svobodova, Y., Chmelia slovaca gen. nov. a dematiaceous fungus, pathogenic for man and animals, Biologia (Bratisl), 21, 81, 1966. 19. Cooke, W.B., An ecological life history of Aureobasidium pullulans (De Bary) Arnaud, Mycopathologia, 12, 1, 1959. 20. Taylor, P.E. et al., Identi�cation and possible disease mechanisms of an under-recognized fungus, Aureobasidium pullulans, Int. Arch. Allergy Immunol., 139, 45, 2006. 21. Vesper, S.J. et al., Relative moldiness index as predictor of childhood respiratory illness, J. Expo. Sci. Environ. Epidemiol., 17, 88, 2007. 22. Haase, G. et al., Phylogenetic analysis of ten black yeast species using nuclear small subunit rRNA gene sequences, Anton. Van Leeuwen., 68, 19, 1995. 23. Coldiron, B.M., Wiley, E.L., and Rinaldi, M.G., Cutaneous phaeohyphomycosis caused by a rare fungal pathogen, Hormonema dematioides: Successful treatment with ketoconazole, J. Am. Acad. Dermatol., 23, 363, 1990. 24. Shin, J.H. et al., Fatal Hormonema dematioides peritonitis in a patient on continuous ambulatory peritoneal dialysis: Criteria for organism identi�cation and review of other known fungal etiologic agents, J. Clin. Microbiol., 36, 2157, 1998. 25. Kent, D. et al., Fungemia due to Hormonema dematioides following intense avian exposure, Clin. Infect. Dis., 26, 759, 1998. 26. Hawkes, M. et al., Aureobasidium pullulans infection: Fungemia in an infant and a review of human cases, Diagn. Microbiol. Infect. Dis., 51, 209, 2005. 27. Rinaldi, M.G., Phaeohyphomycosis, Dermatol. Clin., 14, 147, 1996. 28. Richardson, M. D. and Warnock, D. W., Fungal Infection: Diagnosis and Management, Blackwell Publishing, Oxford, 2003. 29. Stark, P.C. et al., Fungal levels in the home and lower respiratory tract illnesses in the �rst year of life, Am. J. Respir. Crit. Care Med., 168, 232, 2003. 30. Woodcock, A.A. et al., Fungal contamination of bedding, Allergy, 61, 140, 2006. 31. Niedoszytko, M. et al., Association between sensitization to Aureobasidium pullulans (Pullularia sp) and severity of asthma, Ann. Allergy Asthma Immunol., 98, 153, 2007. 32. Woodard, E.D. et al., Outbreak of hypersensitivity pneumonitis in an industrial setting, JAMA, 259, 1965, 1988. 33. Temprano, J. et al., Hypersensitivity pneumonitis secondary to residential exposure to Aureobasidium pullulans in 2 siblings, Ann. Allergy Asthma Immunol., 99, 562, 2007. 34. Engelhart, S. et al., Childhood hypersensitivity pneumonitis associated with fungal contamination of indoor hydroponics, Int. J. Hyg. Environ. Health, 212, 18, 2009. 35. Maverick, K.J. and Conners, M.S., Aureobasidium pullulans fungal keratitis following LASEK, J. Refract. Surg., 23, 727, 2007. 36. Joshi, A. et al., Subcutaneous mycosis and fungemia by Aureobasidium pullulans: A rare pathogenic fungus in a post allogeneic BM transplant patient, Bone Marrow Transplant., 45, 203, 2009. 37. Bolignano, G. and Criseo, G., Disseminated nosocomial fungal infection by Aureobasidium pullulans var. melanigenum: A case report, J. Clin. Microbiol., 41, 4483, 2003. 38. Huang, Y.T. et al., Catheter-related septicemia due to Aureobasidium pullulans, Int. J. Infect. Dis., 12, e137, 2008.
39. Evans, E.G.V. and Richardson, M.D., Medical Mycology: A Practical Approach, IRL Press at Oxford University Press, Oxford, 1989.
40. Yurlova, N.A., Mokrousov, I.V., and de Hoog, G.S., Intraspeci�c variability and exopolysaccharide production in Aureobasidium pullulans, Anton. Van Leeuwen., 68, 57, 1995.
41. Loncaric, I. et al., Phenotypic and genotypic diversity among strains of Aureobasidium pullulans in comparison with related species, Anton. Van Leeuwen., 95, 165, 2009.
42. Bulat, S.A. and Mironenko, N.V., Polymorphism of the yeastlike fungus Aureobasidium pullulans (de Bary) detected with universally primed-polymerase reaction: Species divergence, Genetics, 28, 19, 1992.
43. Schena, L. et al., Genetic diversity and biocontrol activity of Aureobasidium pullulans isolates against postharvest rots, Postharvest Biol. Technol., 17, 189, 1999.
44. Urzì, C. et al., Intra-speci�c diversity of Aureobasidium pullulans strains isolated from rocks and other habitats assessed by physiological methods and by random ampli�ed polymorphic DNA (RAPD), J. Microbiol. Methods, 36, 95, 1999.
45. De Curtis, F. et al., Use of ¼uorescent ampli�ed fragment length polymorphism (fAFLP) to identify speci�c molecular markers for the biocontrol agent Aureobasidium pullulans strain LS30, Postharvest Biol. Technol., 34, 179, 2004.
46. Schena, L., Finetti Sialer, M.M., and Gallitelli, D., Molecular detection of strain L47 of Aureobasidium pullulans, a biocontrol agent of postharvest diseases, Plant Dis., 86, 54, 2002.
47. Loncaric, I. et al., Strain-speci�c detection of two Aureobasidium pullulans strains, fungal biocontrol agents of �re blight by new, developed multiplex-PCR, J. Appl. Microbiol., 104, 1433, 2008.
48. Li, S. et al., Development of an oligonucleotide probe for Aureobasidium pullulans based on the small-subunit rRNA gene, Appl. Environ. Microbiol., 62, 1514, 1996.
49. Martini, M. et al., DNA-dependent detection of the grapevine fungal endophytes Aureobasidium pullulans and Epicoccum nigrum, Plant Dis., 93, 993, 2009.
50. Meklin, T. et al., Quantitative PCR analysis of house dust can reveal abnormal mold conditions, J. Environ. Monit., 6, 615, 2004.
51. Vilgalys, R. and Hester, M., Rapid genetic identi�cation and mapping of enzymatically ampli�ed ribosomal DNA from several Cryptococcus species, J. Bacteriol., 172, 4238, 1990.
52. Li, S., Spear, R.N., and Andrews, J.H., Quantitative ¼uorescence in situ hybridization of Aureobasidium pullulans on microscope slides and leaf surfaces, Appl. Environ. Microbiol., 63, 3261, 1997.
53. Wittwer, C.T. et al., Continuous ¼uorescence monitoring of rapid cycle DNA ampli�cation, BioTechniques, 22, 130, 1997.
54. Chen, Y.C. et al., Polymorphic internal transcribed spacer region 1 DNA sequences identify medically important yeasts, J. Clin. Microbiol., 39, 4042, 2001. 55. Iwen, P.C., Hinrichs, S.H., and Rupp, M.E., Utilization of the internal transcribed spacer regions as molecular targets to detect and identify human fungal pathogens, Med. Mycol., 40, 87, 2002. 56. Rakeman, J.L. et al., Multilocus DNA sequence comparisons rapidly identify pathogenic molds, J. Clin. Microbiol., 43, 3324, 2005. 57. Leaw, S.N. et al., Identi�cation of medically important yeast species by sequence analysis of the internal transcribed spacer regions, J. Clin. Microbiol., 44, 693, 2006. 58. Ciardo, D.E. et al., Identi�cation of moulds in the diagnostic laboratory—An algorithm implementing molecular and phenotypic methods, Diagn. Microbiol. Infect. Dis., 59, 49, 2007. 59. Borman, A.M. et al., Molecular identi�cation of pathogenic fungi, J. Antimicrob. Chemother., 61, S7, 2008. 60. Vollmer, T. et al., Evaluation of novel broad-range real-time PCR assay for rapid detection of human pathogenic fungi in various clinical specimens, J. Clin. Microbiol., 46, 1919, 2008. 61. Kurtzman, C.P. and Robnett, C.J., Identi�cation of clinically important ascomycetous yeasts based on nucleotide divergence in the 5′ end of the large-subunit (26S) ribosomal DNA gene, J. Clin. Microbiol., 35, 1216, 1997. 62. Kurtzman, C.P. and Robnett, C.J., Identi�cation and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences, Anton. Van Leeuwen., 73, 331, 1998. 63. Voigt, K., Cigelnik, E., and O’donnell, K., Phylogeny and PCR identi�cation of clinically important Zygomycetes based on nuclear ribosomal-DNA sequence data, J. Clin. Microbiol., 37, 3957, 1999. 64. Spear, R.N. et al., Quantitative imaging and statistical analysis of ¼uorescence in situ hybridization (FISH) of Aureobasidium pullulans, J. Microbiol. Methods, 35, 101, 1999. 65. Hall, L., Wohl�el, S., and Roberts, G.D., Experience with the MicroSeq D2 large-subunit ribosomal DNA sequencing kit for identi�cation of commonly encountered, clinically important yeast species, J. Clin. Microbiol., 41, 5099, 2003. 66. Hebart, H., Loef¼er, J., and Einsele, H., Molecular diagnostics: Present and future, in Diagnosis of Fungal Infections, 1st edn., p. 133, Maertens, J.A. and Marr, K.A. (Eds.), Informa Health Care, New York, 2007. 67. Gerrits vd Ende, H.G. and de Hoog, G.S., Variability and molecular diagnostics of the neurotropic species Cladophialophora bantiana, Stud. Mycol., 43, 162, 1999. 68. Borman, A.M. et al., Ultra-rapid preparation of total genomic DNA from isolates of yeast and mould using Whatman FTA �lter paper technology—A reusable DNA archiving system, Med. Mycol., 44, 389, 2006. 69. White, T.J. et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics, in PCR Protocols: A Guide to Methods and Applications, p. 315, Gelfand, D.H., Sninsky, J.J., and White, T.J. (Eds.), Academic Press, New York, 1990. 70. Andreoni, S., Farina, C., and Lombardi, G., Medical Mycology Atlas, 2004. 4 Chapter 4 - Bipolaris and Drechslera
1. The UniProt Consortium. Available at http://www.uniprot. org/taxonomy/, accessed on August 1, 2010.
2. McGinnis, M.R., Rinaldi, M.G., and Winn, R.E. Emerging agents of phaeohyphomycosis: Pathogenic species of Bipolaris and Exserohilum. J Clin Microbiol. 1986;24(2):250–259. 3. Kwon-Chung, K.J. and Bennett, J.E. Medical Mycology. Lea & Febiger, Philadelphia, PA, 1992. 4. Domsch, K.H., Gams, W., and Anderson, T.H. Compendium of Soil Fungi, Vol. 1. Academic Press, London, U.K., 1980. 5. Zapater, R.C., Albesi, E.J., and Garcia, G.H. Mycotic keratitis by Drechslera spicifera. Sabouraudia. 1975;13(3):295–298. 6. Yoshimori, R.N. et al. Phaeohyphomycosis of brain: Granulomatous encephalitis caused by Drechslera spicifera. Am J Clin Pathol. 1982;77(3):363–370. 7. Rolston, K.V., Hopfer, R.L., and Larson, D.L. Infections caused by Drechslera species: Case report and review of the literature. Rev Infect Dis. 1985;7(4):525–529. 8. Adam, R.D. et al. Phaeohyphomycosis caused by the fungal genera Bipolaris and Exserohilum: A report of 9 cases and review of the literature. Medicine (Baltimore). 1986;65(4):203–217. 9. Ruben, S.J., Scott, T.E. Jr., and Seltzer, H.M. Intracranial and paranasal sinus infection due to Drechslera. South Med J. 1987;80(8):1057–1058. 10. Pratt, M.F. and Burnett, J.R. Fulminant Drechslera sinusitis in an immunocompetent host. Laryngoscope. 1988;98(12):1343–1347. 11. McGinnis, M.R. et al. Phaeohyphomycosis caused by Bipolaris spicifera: An informative case. Eur J Epidemiol. 1992;8(3):383–386. 12. Ogden, P.E., Hurley, D.L., and Cain, P.T. Fatal fungal endarteritis caused by Bipolaris spicifera following replacement of the aortic valve. Clin Infect Dis. 1992;14(2):596–598. 13. Karim, M. et al. Disseminated bipolaris infection in an asthmatic patient: Case report. Clin Infect Dis. 1993;17(2):248–253. 14. Gadallah, M.F. et al. Peritoneal dialysis complicated by Bipolaris hawaiiensis peritonitis: Successful therapy with catheter removal and oral itraconazol without the use of amphotericin-B. Am J Nephrol. 1995;15(4):348–352. 15. Douer, D. et al. Human Exserohilum and Bipolaris infections: Report of Exserohilum nasal infection in a neutropenic patient with acute leukemia and review of the literature. J Med Vet Mycol. 1987;25(4):235–241. 16. Flanagan, K.L. and Bryceson, A.D. Disseminated infection due to Bipolaris australiensis in a young immunocompetent man: Case report and review. Clin Infect Dis. 1997;25(2):311–313. 17. Pauzner, R. et al. Phaeohyphomycosis following cardiac surgery: Case report and review of serious infection due to Bipolaris and Exserohilum species. Clin Infect Dis. 1997;25(4):921–923. 18. Walsh, T.J. and Groll, A.H. Emerging fungal pathogens: Evolving challenges to immunocompromised patients for the twenty-�rst century. Transpl Infect Dis. 1999;1:247. 19. Khan, J.A. et al. Disseminated bipolaris infection in an immunocompetent host: An atypical presentation. J Pak Med Assoc. 2000;50(2):68–71. 20. Latham, R.H. Bipolaris spicifera meningitis complicating a neurosurgical procedure. Scand J Infect Dis. 2000;32(1):102–103. 21. Groll, A.H. and Walsh, T.J. Uncommon opportunistic fungi: New nosocomial threats. Clin Microbiol Infect. 2001;7:S8–S24. 22. Moore, M.L. et al. Disseminated Bipolaris spicifera in a neonate. J Perinatol. 2001;21:399. 23. Saenz, R.E., Brown, W.D., and Sanders, C.V. Allergic bronchopulmonary disease caused by Bipolaris hawaiiensis presenting as a necrotizing pneumonia: Case report and review of literature. Am J Med Sci. 2001;321:209–212.
24. Fleming, R.V., Walsh, T.J., and Anaissie, E.J. Emerging and less common fungal pathogens. Infect Dis Clin North Am. 2002;16:915–933.
25. Tomsiková, A. Causative agents of nosocomial mycoses. Folia Microbiol (Praha). 2002;47(2):105–112.
26. Filizzola, M.J., Martinez, F., and Rauf, S.J. Phaeohyphomycosis of the central nervous system in immunocompetent hosts: Report of a case and review of the literature. Int J Infect Dis. 2003;7:282–286.
27. Chander, J. et al. Keratomycosis in and around Chandigarh: A �ve-year study from a north Indian tertiary care hospital. Indian J Pathol Microbiol. 2008;51:304–306.
28. Romano, C., Ghilardi, A., and Massai, L. Subungual hyperkeratosis of the big toe due to Bipolaris hawaiiensis. Acta Derm Venereol. 2004;84:476.
29. El Khizzi, N., Bakheshwain, S., and Parvez, S., Bipolaris: A plant pathogen causing human infections: An emerging problem in Saudi Arabia. Res J Microbiol, 2010;5:212.
30. Estes, S.A., Merz, W.G., and Maxwell, L.G. Primary cutaneous phaeohyphomycosis caused by Drechslera spicifera. Arch Dermatol. 1977;113:813–815.
31. Chalet, M. et al. Isolation of Bipolaris australiensis from a lesion of viral vesicular dermatitis on the scalp. J Med Vet Mycol. 1986;24(6):461–465.
32. Straka, B.F., Cooper, P.H., and Body, B.A. Cutaneous Bipolaris spicifera infection. Arch Dermatol. 1989;125: 1383–1386.
33. Costa, A.R. et al. Subcutaneous phaeohyphomycosis caused by Bipolaris hawaiiensis: A case report. Rev Inst Med Trop Sao Paulo. 1991;33:74–79.
34. Robb, C.W., Malouf, P.J., and Rapini, R.P. Four cases of dermatomycosis: Super�cial cutaneous infection by Alternaria or Bipolaris. Cutis. 2003;72:313–316, 319.
35. Bilu, D. et al. Cutaneous Bipolaris infection in a neutropenic patient with acute lymphoblastic leukemia. J Cutan Med Surg. 2004;8:446–449.
36. Anandi, V. et al. Corneal ulcer caused by Bipolaris hawaiiensis. J Med Vet Mycol. 1988;26(5):301–306.
37. Hemashettar, B.M. et al. Mycotic keratitis caused by Bipolaris spicifera. Indian J Pathol Microbiol. 1992; 35(3):274–277.
38. Jacobson, M. et al. Bipolaris-induced orbital cellulitis. J Clin Neuroophthalmol. 1992;12:250.
39. Pavan, P.R. and Margo, C.E. Endogenous endophthalmitis caused by Bipolaris hawaiiensis in a patient with acquired immunode�ciency syndrome. Am J Ophthalmol. 1993;116:644–645.
40. Gopalakrishnan, K. et al. Bilateral Bipolaris keratomycosis in a borderline lepromatous patient. Int J Lepr Other Mycobact Dis. 2003;71:14–17.
41. Saha, R. and Das, S. Bipolaris keratomycosis. Mycoses. 2005;48:453–455.
42. Newell, C.K., Steinmetz, R.L., and Brooks, H.L. Jr. Chronic postoperative endophthalmitis caused by Bipolaris australiensis. Retina. 2006;26(1):109–110.
43. Durkin, S.R. et al. Successful treatment of phaeohyphomycotic keratitis caused by Bipolaris australiensis. Clin Experiment Ophthalmol. 2008;36(7):697–699.
44. Bashir, G., Hussain, W., and Rizvi, A. Bipolaris hawaiiensis keratomycosis and endophthalmitis. Mycopathologia. 2009;167(1):51–53.
45. Torres, C. et al. Allergic fungal sinusitis: A clinicopathologic study of 16 cases. Hum Pathol. 1996;27(8):793–799.
46. Schubert, M.S. Allergic fungal sinusitis: Pathophysiology, diagnosis and management. Med Mycol. 2009;47:S324–S330. 47. Koshi, G. et al. Nasal phaeohyphomycosis caused by Bipolaris hawaiiensis. J Med Vet Mycol. 1987;25:397–402. 48. Antoine, G.A. and Raterink, M.H. Bipolaris: A serious new fungal pathogen of the paranasal sinus. Otolaryngol Head Neck Surg. 1989;100:158–162. 49. Rao, A. et al. Phaeohyphomycosis of the nasal sinuses caused by Bipolaris species. Pathology. 1989;21:280–281. 50. Chang, C.Z., Hwang, S.L., and Howng, S.L. Allergical fungal sinusitis with intracranial abscess—A case report and literature review. Kaohsiung J Med Sci. 1997;13(11):685–689. 51. Klapper, S.R. et al. Orbital involvement in allergic fungal sinusitis. Ophthalmology. 1997;104(12):2094–2100. 52. Fryen, A. et al. Allergic fungal sinusitis caused by Bipolaris (Drechslera) hawaiiensis. Eur Arch Otorhinolaryngol. 1999;256(7):330–334. 53. Castelnuovo, P. et al. Invasive fungal sinusitis due to Bipolaris hawaiiensis. Mycoses. 2004;47:76–81. 54. Ambrosetti, D. et al. An expansive paranasal sinus tumourlike lesion caused by Bipolaris spicifera in an immunocompetent patient. Histopathology. 2006;49:660–662. 55. Toul, P. et al. A pseudo tumoral sinusitis caused by Bipolaris sp. J Infect. 2006;53:e235–e237. 56. Aribandi, M. and Bazan, C. 3rd. CT and MRI features in Bipolaris fungal sinusitis. Australas Radiol. 2007;51:127–132. 57. Taguchi, K. et al. Allergic fungal sinusitis caused by Bipolaris spicifera and Schizophyllum commune. Med Mycol. 2007;45(6):559–564. 58. El-Morsy, S.M. et al. Allergic fungal rhinosinusitis: Detection of fungal DNA in sinus aspirate using polymerase chain reaction. J Laryngol Otol. 2010;124:152. 59. Buzina, W. et al. Bipolaris spicifera causes fungus balls of the sinuses and triggers polypoid chronic rhinosinusitis in an immunocompetent patient. J Clin Microbiol. 2003;41:4885. 60. Dyer, Z.A. et al. Back pain associated with endobronchial mucus impaction due to Bipolaris australiensis colonization representing atypical allergic bronchopulmonary mycosis. Med Mycol. 2008;46(6):589–594. 61. Kobayashi, H. et al. Disseminated infection by Bipolaris spicifera in an immunocompetent subject. Med Mycol. 2008;46(4):361–365. 62. Brandt, M.E. and Warnock, D.W. Epidemiology, clinical manifestations, and therapy of infections caused by dematiaceous fungi. J Chemother. 2003;15:S36–S47. 63. Revankar, S.G. Phaeohyphomycosis. Infect Dis Clin North Am. 2006;20(3):609–620. 64. Pratt, R.G. Enhancement of sporulation in species of Bipolaris, Curvularia, Drechslera, and Exserohilum by growth on cellulose-containing substrates. Mycopathologia, 2006;162:133. 65. Dixon, D.M. and Polak-Wyss, A. The medically important dematiaceous fungi and their identi�cation. Mycoses. 1991;34(1–2):1–18. 66. Green, B.J. et al, Surveillance of fungal allergic sensitization using the ¼uorescent halogen immunoassay. J Mycol Med. 2009;19:253–261. 67. Kumar, M., Mishra, N.K., and Shukla, P.K. Sensitive and rapid polymerase chain reaction based diagnosis of mycotic keratitis through single stranded conformation polymorphism. Am J Ophthalmol. 2005;140:851–857. 68. Shin, E.J. et al. Screening of middle ear effusion for the common sinus pathogen Bipolaris. Eur Arch Otorhinolaryngol. 2003;260:78–80.
69. Bagyalakshmi, R. et al. Newer emerging pathogens of ocular non-sporulating molds (NSM) identi�ed by polymerase chain reaction (PCR)-based DNA sequencing technique targeting internal transcribed spacer (ITS) region. Curr Eye Res. 2008;33:139–147.
70. Pounder, J.I. et al. Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J Clin Microbiol. 2007;45:568–571.
71. Zeng, J.S. et al. Spectrum of clinically relevant Exophiala species in the United States. J Clin Microbiol. 2007;45:3713–3720. 72. White, T.J. et al. Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In M.S. Innis and D.H. Gelfand (Eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press, New York, pp. 315–322. 1990. 73. Leaw, S.N. et al. Identi�cation of medically important yeast species by sequence analysis of the internal transcribed spacer regions. J Clin Microbiol. 2006;44:693–699. 74. Rosow, L. et al. Cerebral phaeohyphomycosis caused by Bipolaris spicifera after heart transplantation. Transpl. Infect. Dis. February 15, 2011: [Epub ahead of print] 5 Chapter 5 - Botryomyces
8. Carapeto, F.J. et al., Dermatomycosis in plaques caused by Botryomyces caespitosus. A new causative agent. Med. Cutan. Ibero. Lat. Am., 13, 71, 1985.
9. Benoldi, D. et al., Botryomyces caespitosus as an agent of cutaneous phaeohyphomycosis. J. Med. Vet. Mycol., 29, 9, 1991.
10. Martins, R.H. et al., Actinomycosis and botryomycosis of the tonsil. Auris Nasus Larynx., 18, 377, 1991.
11. de Hoog, S. et al., Relationships of dothideaceous black yeasts and meristematic fungi based on 5.8S and ITS2 rDNA sequence comparison. Stud. Mycol., 43, 31, 1999.
12. White, T.J. et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols: A Guide to Methods and Applications (Eds.: Innis, M.A. et al.), pp. 315–322, Academic Press, San Diego, CA, 1990. 13. Pounder, J.I. et al., Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J. Clin. Microbiol., 45, 568, 2007. 14. Bagyalakshmi, R. et al., Newer emerging pathogens of ocular non-sporulating molds (NSM) identi�ed by polymerase chain reaction (PCR)-based DNA sequencing technique targeting internal transcribed spacer (ITS) region. Curr. Eye Res., 33, 139, 2008. 15. Leaw, S.N. et al., Identi�cation of medically important yeast species by sequence analysis of the internal transcribed spacer regions. J. Clin. Microbiol., 44, 693, 2006. 6 Chapter 6 - Botryosphaeria and Lasiodiplodia
13. Borderie, V.M. et al., Endophthalmitis after Lasiodiplodia theobromae corneal abscess. Graefe’s Arch. Clin. Exp. Opthalmol., 235, 259, 1997.
14. Thomas, P.A., Current perspectives on ophthalmic mycoses. Clin. Microbiol. Rev., 16, 730, 2003.
15. Summerbell, R.C. et al., Subcutaneous phaeohyphomycosis caused by Lasiodiplodia theobromae and successfully treated surgically. Med. Mycol., 42, 543, 2004.
16. Bhartiya, P. et al., Fungal keratitis in Melbourne. Clin. Exp. Ophthalmol., 35, 124, 2007.
17. Thew, M.R. and Todd, B., Fungal keratitis in far north Queensland, Australia. Clin. Exp. Ophthalmol., 36, 721, 2008.
18. Kindo, A.J. et al., Maxillary sinusitis caused by Lasiodiplodia theobromae. Indian J. Med. Microbiol., 28, 167, 2010.
19. Woo, P.C.Y. et al., Lasiodiplodia theobromae pneumonia in a liver transplant recipient. J. Clin. Microbiol., 46, 380, 2008.
20. Thomas, O.A. et al., Use of lactophenol cotton blue mounts of corneal scraping as an aid to the diagnosis of mycotic keratitis. Diagn. Microbiol. Infect. Dis., 14, 219, 1991. 21. Denman, S. et al., Circumscription of Botryosphaeria species associated with Proteaceae based on morphology and DNA sequence data. Mycologia, 95, 294, 2003. 22. Pounder, J.I. et al., Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J. Clin. Microbiol., 45, 568, 2007. 23. Bagyalakshmi, R. et al., Newer emerging pathogens of ocular non-sporulating molds (NSM) identi�ed by polymerase chain reaction (PCR)-based DNA sequencing technique targeting internal transcribed spacer (ITS) region. Curr. Eye Res., 33, 139, 2008. 24. White, T.J. et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics, pp. 315–322. In Innis, M.A. et al. (Eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990. 7 Chapter 7 - Corynespora
14. Leaw, S.N. et al., Identi�cation of medically important yeast species by sequence analysis of the internal transcribed spacer regions. J. Clin. Microbiol., 44, 693, 2006.
15. Pounder, J.I. et al., Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J. Clin. Microbiol., 45, 568, 2007.
16. Zeng, J.S. et al., Spectrum of clinically relevant Exophiala species in the United States. J. Clin. Microbiol., 45, 3713, 2007. 17. Bagyalakshmi, R. et al., Newer emerging pathogens of ocular non-sporulating molds (NSM) identi�ed by polymerase chain reaction (PCR)-based DNA sequencing technique targeting internal transcribed spacer (ITS) region. Curr. Eye Res., 33, 139, 2008. 18. Lv, G.X. et al., Phaeohyphomycosis caused by a plant pathogen, Corynespora cassiicola. Med. Mycol., posted online on January 31, 2011. 8 Chapter 8 - Curvularia
21. Rout, N., Nanda, B.K., and Gangopadhyaya, S., Experimental phaeohyphomycosis and mycotoxicosis by Curvularia lunata in albino rats. Indian J. Pathol. Microbiol., 32, 1, 1989.
22. Ortega, J., Production of extracellular cell wall degrading enzymes by Curvularia senegalensis. Texas J. Sci., 45, 335, 1993.
23. Jacobson, E.S., Pathogenic roles for fungal melanins. Clin. Microbiol. Rev., 13, 708, 2000.
24. Butler, M.J. and Day, A.W., Fungal melanins: A review. Can. J. Microbiol., 44, 1115, 1998.
25. Hamilton, A.J. and Gomez, B.L., Melanins in fungal pathogens. J. Med. Microbiol., 51, 189, 2002.
26. Diskin, C.J. et al., Case report and review: Is the tendency for Curvularia tubular obstruction signi�cant in pathogenesis? Perit. Dial. Int., 28, 678, 2009.
27. Herrera, L.K. et al., Biodeterioration of peridotite and other constructional materials in a building of the Colombian cultural heritage. Int. Biodeterior. Biodegrad., 54, 135, 2004.
28. Wallstrom, S. and Karlsson, S., Bio�lms on silicone rubber insulators; microbial composition and diagnostics of removal by use of ESEM/EDS: Composition of bio�lms infecting silicone rubber insulators. Polym. Degrad. Stabil., 85, 841, 2004.
29. Simmons, R.B., Zhang, S.T., and Ahearn, D.H., Fungi associated with hydrogel contact lenses. Microsc. Microanal., 13, S312, 2007.
30. Kaiser, C. et al., In vitro inhibition of mycelia growth of several pathogenic fungi including Phytophthora cinnamomi by soluble silicon. South Afr. Growers Assoc. Yearbook, 28, 60, 2005.
31. Chakraborty, S., Sen, S.K., and Battacharya, K., Indoor and outdoor aeromycological survery in Burdwan, West Bengal, India. Aerobiologia, 16, 211, 2000.
32. Chew, F.T. et al., Evaluation of the allergenicity of tropical pollen and airborne spores in Singapore. Allergy, 55, 340, 2000.
33. Adhikari, A. et al., Airborne viable, non-viable, and allergenic fungi in a rural agricultural area of India: A 2-year study at �ve outdoor sampling stations. Sci. Total Environ., 326, 123, 2004.
34. Gupta, R. et al., Allergenic cross-reactivity of Curvularia lunata with other airborne fungal species. Allergy, 57, 636, 2002.
35. Gupta, R. et al., Identi�cation of cross-reactive proteins amongst different Curvularia species. Int. Arch. Allergy Immunol., 127, 38, 2002.
36. Gupta, R. et al., Identi�cation of serine protease as a major allergen of Curvularia lunata. Allergy, 59, 421, 2004.
37. Sharma V. et al., Cloning, recombinant expression and activity studies of a major allergen “enolase” from the fungus Curvularia lunata. J. Clin. Immunol., 26, 360, 2006.
38. Tripathi, P. et al., Serine protease activity of Cur 1 1 from Curvularia Iunata augments Th2 response in mice. J. Clin. Immunol., 29, 292, 2009.
39. Gupta, R. et al., Allergens of Curvularia lunata during cultivation in different media. J. Allergy Clin. Immunol., 104, 857, 1999.
40. Chander, J. and Sharma, A., Prevalence of fungal corneal ulcers in northern India. Infection, 22, 207, 1994.
41. Panda, A. et al., Mycotic keratitis in children: Epidemiologic and microbiologic evaluation. Cornea, 16, 295, 1997.
42. Chander, J. et al., Keratomycosis in and around Chandigarh: A �ve-year study from a north Indian tertiary care hospital. Indian J. Pathol. Microbiol., 51, 304, 2008. 43. Qiu, W.Y. et al., Fungal spectrum identi�ed by a new slide culture and in vitro drug susceptibility using Etest in fungal keratitis. Curr. Eye Res., 30, 1113, 2005. 44. Dunlop, A.A. et al., Suppurative corneal ulceration in Bangladesh: A study of 142 cases examining the microbiological diagnosis, clinical and epidemiological features of bacterial and fungal keratitis. Aust. N. Z. J. Ophthalmol., 22, 105, 1994. 45. Garg, P. et al., Keratomycosis: Clinical and microbiologic experience with dematiaceous fungi. Ophthalmol., 107, 574, 2000. 46. Gopinathan, U. et al., The epidemiological features and laboratory results of fungal keratitis: A 10-year review at a referral eye care center in South India. Cornea, 21, 555, 2002. 47. Chowdhary, A. and Singh, K., Spectrum of fungal keratitis in North India. Cornea, 24, 8, 2005. 48. Liesegang, T.J. and Forster, R.K., Spectrum of microbial keratitis in south Florida. Am. J. Ophthalmol., 90, 38, 1980. 49. Rosa, R.H., Miller, D., and Alfonso, E.C., The changing spectrum of fungal keratitis in south Florida. Ophthalmology, 101, 1005, 1994. 50. Poria, V.C. et al., Study of mycotic keratitis. Indian J. Ophthalmol., 33, 229, 1985. 51. Forster, R.K., Rebell, G., and Wilson, L.A., Dematiaceous fungal keratitis. Clinical isolates and management. Br. J. Ophthalmol., 59, 372, 1975. 52. Boonpasart, S. et al., Infectious keratitis at King Chulalongkorn Memorial Hospital: A 12-year retrospective study of 391 cases. J. Med. Assoc. Thai., 85 (Suppl. 1), S217, 2002. 53. Thew, M. and Franzco, B.T., Fungal keratitis in far north Queensland, Australia. Clin. Exp. Ophthalmol., 36, 721, 2008. 54. Wilson, L.A. and Ahearn, D.G., Association of fungi with extended wear soft contact lenses. Am. J. Ophthalmol., 101, 434, 1986. 55. Tuli, S. and Yoo, S.H., Curvularia keratitis after laser in situ keratomileusis from a feline source. J. Cataract Refract. Surg., 29, 1019, 2003. 56. Chung, M.S. et al., Fungal keratitis after laser in situ keratomileusis: A case report. Cornea, 19, 236, 2000. 57. Wilson, L.A. et al., Fungi from the normal outer eye. Am. J. Ophthalmol., 67, 52, 1969. 58. Iyer, S.A., Tuli, S.S., and Wagoner, R.C., Fungal keratitis: Emerging trends and treatment outcomes. Eye Contact Lens, 32, 267, 2006. 59. Sodhi, P.K. and Kaur, R., Curvularia dacryocystitis: Report of two cases. Orbit, 19, 45, 2000. 60. Kaushik, S. et al., Curvularia lunata endophthalmitis with secondary keratitis. Am. J. Ophthalmol., 131, 140, 2001. 61. Pathengay, A. et al., Curvularia lunata endophthalmitis presenting with a posterior capsule plaque. Indian J. Ophthalmol., 54, 65, 2009. 62. Thomas, P.A., Fungal infections of the cornea. Eye, 17, 852, 2003. 63. deShazo, R.D., Chapin, K., and Swain, R.E., Fungal sinusitis. N. Engl. J. Med., 337, 254, 1997. 64. Corey, J.P., Delsupehe, K.G., and Ferguson, B.J., Allergic fungal sinusitis: Allergic, infectious, or both? Otolaryngol. Head Neck Surg., 13, 110, 1995. 65. Corey, J.P., Allergic fungal sinusitis. Otolaryngol. Clin. North Am., 25, 225, 1992. 66. Taj-Aldeen, S.J., Hilal, A.A., and Schell, W.A., Allergic fungal rhinosinusitis: A report of 8 cases. Am. J. Otolaryngol., 25, 213, 2004.
67. Schubert, M.S., Allergic fungal sinusitis: Pathophysiology, diagnosis and management. Med. Mycol., 47, S324, 2009.
68. Houser, S.M. and Corey, J.P., Allergic fungal rhinosinusitis. Otolaryngol. Clin. North Am., 33, 251, 2000.
69. Asero, R. and Bottazi, G., Nasal polyposis: A study of its association with airborne allergen hypersensitivity. Ann. Allergy Asthma Immunol., 86, 283, 2001.
70. Schubert, M.S. and Goetz, D.W., Evaluation and treatment of allergic fungal sinusitis. I. Demographics and diagnosis. J. Allergy Clin. Immunol., 102, 387, 1998.
71. Schubert, M.S. and Goetz, D.W., Evaluation and treatment of allergic fungal sinusitis. II. Treatment and follow-up. J. Allergy Clin. Immunol., 102, 395, 1998.
72. Chakrabarti, A. and Sharma, S.C., Paranasal sinus mycoses. Indian J. Chest Dis. Allied Sci., 42, 293, 2000.
73. Ismail, Y. et al., Invasive sinusitis with intracranial extension caused by Curvularia lunata. Arch. Intern. Med., 153, 1604, 1993.
74. Bonduel, M. et al., Atypical skin lesions caused by Curvularia sp. and Pseudallescheria boydii in two patients after allogeneic bone marrow transplantation. Bone Marrow Transplant., 27, 1311, 2001.
75. Lopes, J.O. and Jobim, N.M., Dermatomycosis of the toe web caused by Curvularia lunata. Rev. Inst. Med. Trop. Sao Paulo, 40, 327, 1998.
76. Rowen, J.L. et al., Invasive fungal dermatitis in the < or = 1000-gram neonate. Pediatrics, 95, 682, 1995.
77. Gupta, M. et al., Onychomycosis: Clinic-mycologic study of 130 patients from Himachal Pradesh, India. Indian J. Dermatol. Venereol. Leprol., 73, 389, 2007.
78. Veer, P., Patwardhan, N.S., and Damie, A.S., Study of onychomycoses: Prevailing fungi and pattern of infection. Indian J. Med. Microbiol., 25, 53, 2007.
79. Ramani, R. et al., Molds in onychomycosis. Int. J. Dermatol., 32, 877, 1993.
80. Brandt, M.E. and Warnock, D.W., Epidemiology, clinical manifestations, and therapy of infections caused by dematiaceous fungi. J. Chemother., 15(Suppl. 2), 36, 2003.
81. Janaki, C. et al., Case report. Eumycetoma due to Curvularia lunata. Mycoses, 42, 345, 1999.
82. Garg, A. et al., Eumycetoma due to Curvularia lunata. Indian J. Dermatol. Venereol. Leprol., 74, 515, 2008.
83. Yau, Y.C.W. et al., Fungal sternal wound infection due to Curvularia lunata in a neonate with congenital heart disease: Case report and review. Clin. Infect. Dis., 19, 735, 1994.
84. Lampert, R.P. et al., Pulmonary and cerebral mycetoma caused by Curvularia pallescens. J. Pediatr., 91, 603, 1977.
85. De la Monte, S.M. and Hutchins, G.M., Disseminated Curvularia infection. Arch. Pathol. Lab. Med., 109, 872, 1985.
86. Smith, T. et al., Optic atrophy due to Curvularia lunata mucocoele. Pituitary, 10, 295, 2007.
87. Carter, E. and Boudreaux, C., Fatal cerebral phaeohyphomycosis due to Curvularia lunata in an immunocompetent patient. J. Clin. Microbiol., 42, 5419, 2004.
88. DeVault, G.A. Jr. et al., Tenchkoff catheter obstruction resulting from invasion by Curvularia lunata in the absence of peritonitis. Am. J. Kidney Dis., 6, 124, 1985.
89. Ebright, J.R. et al., Invasive sinusitis and cerebritis due to Curvularia clavata in an immunocompetent adult. Clin. Infect. Dis., 28, 687, 1999.
90. Parva, P., Rojas, R., and Palacios, E., Unusual rhinosinusitis caused by Curvularia fungi. Ear Nose Throat J., 84, 270, 2005. 91. Lopes, J.O. et al., Cuvularia lunata peritonitis complicating peritoneal dialysis. Mycopathologia, 127, 65, 1994. 92. Robson, A.M. and Craver, R.D., Curvularia urinary tract infection: A case report. Pediatr. Nephrol., 8, 83, 1994. 93. Shigemori, M. et al., Hepatosplenic abscess caused by Curvularia boedijn in a patient with acute monocytic leukemia. Pediatr. Infect. Dis. J., 12, 1128, 1996. 94. Torda, A.J. and Jones, P.D., Necrotizing cutaneous infection caused by Curvularia brachyspora in an immunocompetent host. Australas. J. Dermatol., 38, 85, 1997. 95. Georg, L.K., Curvularia geniculata, a cause of mycotic keratitis. J. Med. Assoc. State Ala., 33, 234, 1964. 96. Kaufman, S.M., Curvularia endocarditis following cardiac surgery. Am. J. Clin. Pathol., 56, 466, 1971. 97. Harris, J.J. and Downham, T.F., Unusual fungal infections associated with immunological hyposensitivity. Int. J. Derm., 17, 323, 1978. 98. Vachharajani, T.J. et al., Curvularia geniculata fungal peritonitis: A case report with review of literature. Int. Urology Nephrol., 37, 781, 2005. 99. Singh, H. et al., Curvularia fungi presenting as a large cranial base meningioma: Case report. Neurosurgery, 63, E177, 2008. 100. Pimentel, J.D. et al., Peritonitis due to Curvularia inaequalis in an elderly patient undergoing peritoneal dialysis and a review of six cases of peritonitis associated with other Curvularia spp. J. Clin. Microbiol., 43, 4288, 2005. 101. Posteraro, B. et al., Eosinophilic fungal rhinosinusitis due to the unusual pathogen Curvularia inaequalis. Mycoses, 15, 36, 2009. 102. Berg, D. et al., Cutaneous infection caused by Curvularia pallescens: A case report and review of the spectrum of disease. J. Am. Acad. Dermatol., 32, 375, 1995. 103. Agrawal, A. and Singh, S.M., Two cases of cutaneous phaeohyphomycosis caused by Curvularia pallescens. Mycoses, 38, 301, 1995. 104. Guarro, J. et al., Mycotic keratitis due to Curvularia senegalensis and in vitro antifungal susceptibilities of Curvularia spp. J. Clin. Microbiol., 37, 4170, 1999. 105. de Hoog, G.S., Guarro, J., Gene, J., and Figueras, M.J., Atlas of Clinical Fungi, 2nd edn., Vol. 1. Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands, 2000. 106. De Luna-Alvea and Maia, L.C., Morphological, cytological, and cultural aspects of Curvularia pallescens. Rev. Microbiol., 29, 197, 1998. From Wilhelmus, K.R. and Jones, D.B., Curvularia keratitis. Trans. Am. Ophthalmol. Soc., 99, 111, 2001. 107. Salfelder, K., Atlas of Fungal Pathology. Kluwer Academic Publishers, Hingham, MA, 1990, p. 56. 108. Kimura, M. and McGinnis, M.R., Fontana-Masson—Stained tissue from culture-proven mycoses. Arch. Pathol. Lab. Med., 122, 1107, 1998. 109. Iwen, P.C., Hinrichs, S.H., and Rupp, M.E., Utilization of the internal transcribed spacer region as molecular targets to detect and identify human fungal pathogens. Med. Mycol., 40, 87, 2002. 110. Kumar, M., Mishra, N.K., and Shukla, P.K., Sensitive and rapid polymerase chain reaction based diagnosis of mycotic keratitis through single stranded conformation polymorphism. Am. J. Ophthalmol., 140, 851, 2005. 111. Jackson, C.J. et al., Species identi�cation and strain differentiation of dermatophyte fungi by analysis of ribosomalDNA intergenic spacer regions. J. Clin. Microbiol., 37, 931, 1999.
112. Kowalchuk, G.A., Gerards, S., and Woldendorp, J.W., Detection and characterization of fungal infections of Ammophila arenaria (Marram Grass) roots by denaturing gradient gel electrophoresis of speci�cally ampli�ed 18S rDNA. Appl. Environ. Microbiol., 63, 3858, 1997.
113. Smit, E. et al., Analysis of fungal diversity in the wheat rhizosphere by sequencing of cloned PCR-ampli�ed genes encoding 18S rRNA and temperature gradient gel electrophoresis. Appl. Environ. Microbiol., 65, 2614, 1999.
114. Kumar, M. and Shukla, P.K., Use of PCR targeting of internal transcribed spacer regions and single-stranded conformation polymorphism analysis of sequence variation in different regions of rRNA genes in fungi for rapid diagnosis of mycotic keratitis. J. Clin. Microbiol., 43, 662, 2005. 115. Desnos-Ollivier, M. et al., Molecular identi�cation of blackgrain mycetoma agents. J. Clin. Microbiol., 44, 3517, 2006. 116. Hall, L., Wohl�el, S., and Roberts, G.D., Experience with the MicroSeq D2 large-subunit ribosomal DNA sequencing kit for identi�cation of �lamentous fungi encountered in the clinical laboratory. J. Clin. Microbiol., 42, 622, 2004. 117. Sanguinetti, M. et al., Evaluation of VITEK 2 and RapID yeast plus systems for yeast species identi�cation: Experience at a large clinical microbiology laboratory. J. Clin. Microbiol., 45, 1343, 2007. 118. Gerrits van den Ende, A.H.G. and de Hoog, G.S., Variability and molecular diagnostics of the neurotropic species Cladophialophora bantiana. Stud. Mycol., 43, 151, 1999. 9 Chapter 9 - Exserohilum
1. Leonard, K.J. and Suggs, E.G., Exserohilum rostratum (Drechsler). Mycologia, 66, 290, 1974.
2. Shoemaker, R.A., Drechslera Ito. Can. J. Bot., 40, 809, 1962.
3. Alcorn, J.L., Generic concepts in Drechslera, Bipolaris, and Exserohilum. Mycotaxon, 17, 1, 1983.
4. Levy, I. et al., Ecthyma gangrenosum caused by disseminated Exserohilum in a child with leukemia: A case report and review of the literature. Pediatr. Dermatol., 20, 495, 2003.
5. Steiman, R., Exserohilum israeli, a new species isolated from soil from Timma Park (Israel), and its physiological properties. Anton. Van Leeuwen., 78,153, 2000.
6. Ferguson, B.J. et al., Geographic variation in allergic fungal sinusitis. Otolaryng. Clin. North Am., 33, 441, 2000.
7. Padhye, A.A. et al., Phaeohyphomycosis of the nasal sinuses caused by a new species of Exserohilum. J. Clin. Microbiol., 24, 245, 1986.
8. McGinnis, M.R., Rinaldi, M.G., and Winn, R.E., Emerging agents of phaeohyphomycosis: Pathogenic species of Bipolaris and Exserohilum. J. Clin. Microbiol., 24, 250, 1986.
9. Saint-Jean, M. et al., Hospital acquired phaeohyphomycosis due to Exserohilum rostratum in a child with leukemia. Can. J. Infect. Dis. Med. Microbiol., 18, 200, 2007.
10. Rolston, K.V.I., Hopfer, R.L., and Larson, D.L., Infections caused by Drechslera species: Case report and review of the literature. Rev. Infect. Dis., 7, 525–529, 1985.
11. Adler, A. et al., Exserohilum: An emerging human pathogen. Eur. J. Clin. Microbiol. Infect. Dis., 25, 254, 2006.
12. Adam, R.D. et al., Phaeohyphomycosis caused by the fungal genera Bipolaris and Exserohilum. A report of 9 cases and review of the literature. Medicine (Baltimore) 65, 203, 1986. 13. Aquino, V.M. et al., Fatal disseminated infection due to Exserohilum rostratum in a patient with aplastic anemia: Case report and review. Clin. Infect. Dis., 20, 176, 1994. 14. Rinaldi, M.G., Phaeohyphomycosis. Dermatol. Clin., 14, 147, 1996. 15. Lasala, P.R. et al., Invasive Exserohilum sinusitis in a patient with aplastic anemia. Pediatr. Infect. Dis. J., 24, 939, 2005. 16. Morpeth, J.F. et al., Fungal sinusitis: An update. Ann. Allergy Asthma Immunol., 76, 128, 1996. 17. Revankar, S.G. et al., Disseminated phaeohyphomycosis: Review of an emerging mycosis. Clin. Infect. Dis., 34, 467, 2002. 18. Stevens, D.A. et al., Practice guidelines for diseases caused by Aspergillus. Clin. Infect. Dis., 30, 696, 2000. 19. Netea, M. et al., Aspergillus fumigatus evades immune recognition during germination through loss of tolllike receptor-4mediated signal transduction. J. Infect. Dis., 188, 320, 2003. 20. Rolides, E. et al., Tumor necrosis factor alpha enhances antifungal activities of polymorphonuclear and mononuclear phagocytesagainst Aspergillus fumigatus. Infect. Immunol., 66, 5999, 1998. 21. Iwen, P.C., Hinriche, H., and Rupp, M.E., Utilization of ITS regions as molecular targets to detect and identify fungal pathogens. Med. Mycol., 40, 87, 2001. 22. Lau, A. et al., Development and clinical application of a panfungal PCR assay to detect and identify fungal DNA in tissue specimens. J. Clin. Microbiol., 45, 380, 2007. 23. Tang, C.M. et al., The detection of Aspergillus spp. by the PCR and its evaluation in bronchoalveolar lavage ¼uid. Am. Rev. Respir. Dis., 148, 1313, 1993. 24. Loef¼er, J., Henke, N., and Hebart, H., Quanti�cation of fungal DNA by using ¼uorescence resonance energy transfer and the Light cycler system. J. Clin. Microbiol., 38, 2902, 2000. 25. Fujita, S.I. et al., Microtitration plate enzyme immunoassay to detect PCR-ampli�ed DNA from Candida species in blood. J. Clin. Microbiol., 33, 962, 1995. 26. Bagyalakshmi, R. et al., Newer emerging pathogens of ocular non-sporulating moulds (NSM) identi�ed by polymerase chain reaction (PCR)-based DNA sequencing technique targeting internal transcribed spacer (ITS) region. Curr. Eye Res., 33, 139, 2008. 27. Ajello, L. et al., Drechslera rostrataas an agent of phaeohyphomycosis. Micologia, 72, 1094, 1980. 28. Drouhet, E. and Dupont, B., Laboratory and clinical assessment of ketoconazole in deep-seated mycoses. Am. J. Med., 24(Suppl 1), 30, 1983. 29. McGinnis, M.R., Laboratory Handbook of Medical Mycology, Academic Press, New York, 1980. 30. Moneymaker, C.S. et al., Primary cutaneous phaeohyphomycosis due to Exserohilum rostratum (Drechslera rostrata) in a child with leukemia. Pediatr. Infect. Dis., 5, 380, 1986. 31. Sharkey, P.K. et al., Itraconazole treatment of phaeohyphomycosis. J. Am. Acad. Dermatol., 23, 577, 1990. 32. McGinnis, M.R. and Pasarell, L., In vitro testing of susceptibilities of �lamentous ascomycetes to voriconazole, itraconazole, and amphotericin B, with consideration of phylogenetic implications. J. Clin. Microbiol., 36, 2353, 1998. 10 Chapter 10 - Fusicoccum and Scytalidium
1. De Hoog, G.S. et al., Atlas of Clinical Fungi, 2nd edn., Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands, 2004.
2. Hay, R.J., Scytalidium infections, Curr. Op. Infect. Dis., 15, 99, 2002.
3. Nattrass, R.M., A new species of Hendersonula (H. toruloidea) on deciduous trees in Egypt, Br. Mycol. Soc. Trans., 18, 189, 1933.
4. Gentles, J.C. and Evans, E.G., Infection of the feet and nails with Hendersonula totuloidea, Sabouraudia, 8, 72, 1970.
5. Campbell, C.K. and Mulder, J.L., Skin and nail infection by Scytalidium hyalinum sp. nov., Sabouraudia, 15, 161, 1977.
6. Sutton, B.C. and Dyko, B.J., Revision of Hendersonula, Mycol. Res., 93, 466, 1989.
7. Farr, D.F. et al., Fusicoccum arbuti sp. nov. causing cankers on Paci�c madrone in western North America with notes on Fusicoccum dimidiatum, the correct name for Scytalidium dimidiatum and Nattrassia mangiferae, Mycologia, 97, 730, 2005.
8. Crous, P.W. et al., Phylogenetic lineages in the Botryosphaeriaceae, Stud. Mycol., 55, 235, 2006.
9. Sigler, L. et al., Invasive Nattrassia mangiferae infections: Case report, literature review and therapeutic and taxonomic appraisal, J. Clin. Microbiol., 35, 433, 1997.
10. Roeijmans, H.J. et al., Molecular taxonomy and GC/MS of metabolites of Scytalidium hyalinum and Nattrassia mangiferae (Hendersonula toruloidea), J. Med. Vet. Mycol., 35, 81, 1997.
11. Machouart, M. et al., Polymorphisms and intronic structures in the 18S subunit ribosomal RNA gene of the fungi Scytalidium dimidiatum and Scytalidium hyalinum. Evidence of an IC1 intron with an His-Cys endonuclease gene. FEMS Microbiol. Lett., 238, 455, 2004.
12. Madrid, H. et al., Genotyping and in vitro antifungal susceptibility of Neoscytalidium dimidiatum isolates from different origins, Int. J. Antimicrob. Agents, 34, 351, 2009.
13. Lacroix, C. et al., Scytalidiosis in Paris, J. Am. Acad. Dermatol., 48, 852, 2002.
14. Punithalingam, E. and Waterston, J.M., Hendersonula toruloidea, CMI Descript. Pathol. Fungi Bact., 274, 1, 1970.
15. Natour, R.M. and Ahmed, J.M., Control of branch wilt disease of grape, Plant Dis. Rep., 53, 152, 1969.
16. Wangikar, P.D., Raut, J.G., and Gopalkrishna, N., Drying grape vines caused by Hendersonula toruloidea, Indian Phytopathol., 22, 403, 1969. 17. Alizadeh, A., Heidarian, A., and Farrokhi-Nejad, R., Citrus branch wilt, decline, and death caused by Nattrassia mangiferae and its other hosts in Khuzestan province, Iranian J. Plant Pathol., 36, 21, 2000. 18. Chandra, S., Some new leaf-spot diseases from Allahabad (India), Nova Hedw Beih, 47, 35, 1974. 19. Pandey, R.S. et al., A new leaf spot disease of mango, Plant Dis., 65, 441, 1981. 20. Reckhaus, P. and Adamous, I., Hendersonula dieback of mango in Niger, Plant Dis., 71, 1045, 1987. 21. Meredith, D.S., Tip rot of banana fruits in Jamaica, Trans. Brit. Mycol. Soc., 46, 473, 1963. 22. Meredith, D.S., Fungal diseases of bananas in Hawai, Plant Dis. Rep., 53, 63, 1969. 23. Wilson, E.E., The branch wilt of Persian Walnut trees and its cause, Hilgardia, 17, 413, 1947. 24. Calavan, E.C. and Wallace, J.M., Hendersonula toruloidea Nattrass on citrus in California, Phytopathology, 44, 635,1954. 25. Matheron, M.E. and Sigler, L. First report of Eucalyptus dieback caused by Nattrassia mangiferae in North America, Plant Dis., 78, 432, 1993. 26. English, H., Davis, J.R., and deVay, J.E., Relationship of Botryosphaeria dothidea and Hendersonula toruloidea to a canker disease of almond, Phytopathology, 65, 114, 1975. 27. Tsahouridou, P.C. and Thanassoulopoulos, C.C., First report of Hendersonula toruloidea as a foliar pathogen of strawberrytree (Arbutus unedo) in Europe, Plant Dis., 84, 187, 2000. 28. Kane, J. et al., An autochtonous phaeohyphomycotic nail infection in Canada caused by Hendersonula toruloidea, Mycoses, 33, 37, 1990. 29. Dunn, J.J. et al., Invasive fungal sinusitis caused by Scytalidium dimidiatum in a lung transplant recipient, J. Clin. Microbiol., 41, 5817, 2003. 30. Moore, M.K., Hendersonula toruloidea and Scytalidium hyalinum infections in London, England, J. Met. Vet. Mycol., 24, 219, 1986. 31. Belloeuf, L. et al., Onychomycoses à Scytalidium en Martinique, Ann. Dermatol. Venereol., 131, 245, 2004. 32. Hay, R.J. and Moore, M.K., Clinical features of super�cial fungal infections caused by Hendersonula toruloidea and Scytalidium hyalinum, Br. J. Dermatol., 110, 677, 1984. 33. Curtis, J.W., The two foot-one hand disease, Bull. Assoc. Milit. Dermatol., 13, 1, 1964. 34. Levi, M.E. and Smith, J.W., Postraumatic infection due to Scytalidium dimidiatum, Clin. Infect. Dis., 18, 127, 1994. 35. Marriott, D.J. et al., Scytalidium dimidiatum and Lecythophora hoffmani: Unusual causes of fungal infections in a patient with AIDS, J. Clin. Microbiol., 35, 2949, 1997. 36. Dhindsa, M.K., Naidu, J., and Singh, S.M., A case of subcutaneous infection in a patient with discoid lupus erythematosus caused by a Scytalidium synanamorph of Nattrassia mangiferae and its treatment, Med. Mycol., 36, 425, 1998. 37. Gumbo, T. et al., Case report. Nattrassia mangiferae endophtalmitis, Mycoses, 45, 118, 2002. 38. Geramishoar, M. et al., First case of cerebral phaeohyphomycosis caused by Nattrassia mangiferae in Iran, Jpn. J. Infect. Dis., 57, 285, 2004. 39. Jabbarvand, M. et al., Nattrassia mangiferae keratitis after laser in situ keratomileusis, J. Cataract. Refract. Surg., 30, 268, 2004. 40. Morris-Jones, R. et al., Scytalidium dimidiatum causing recalcitrant subcutaneous lesions produces melanin, J. Clin. Microbiol., 42, 3789, 2004.
41. Willinger, B. et al., Disseminated infection with Nattrassia mangiferae in an immunosuppressed patient, J. Clin. Microbiol., 42, 478, 2004.
42. Sadeghi Tari, A. et al., Post-traumatic fatal Nattrassia mangiferae orbital infection, Int. Ophtalmol., 26, 247, 2005.
43. Tan, D.H.S. et al., Disseminated fungal infection in a renal transplant recipient involving Macrophomina phaseolina and Scytalidium dimidiatum: Case report and review of taxonomic changes among medically important members of the Botryosphaeriaceae, Med. Mycol., 46, 285, 2008.
44. Benne, C.A. et al., Disseminating infection with Scytalidium dimidiatum in a granulocytopenic child, Eur. J. Clin. Microbiol. Infect. Dis., 12, 118, 1993.
45. Mani, R.S. et al., Cerebral phaeohyphomycosis caused by Scytalidium dimidiatum: A case report from India, Med. Mycol., 46, 705, 2008. 46. Al-Rajhi, A. et al., Scytalidium dimidiatum fungal endophtalmitis, Br. J. Ophtalmol., 77, 388, 1993.
47. Elinav, H. et al., Invasive Scytalidium dimidiatum infection in an immunocompetent adult, J. Clin. Microbiol., 47, 1259, 2009.
48. Zaatari, G.S., Reed, G., and Morewessel, R., Subcutaneous hyphomycosis caused by Scytalidium hyalinum, Am. J. Clin. Pathol., 82, 252, 1984.
49. Sriaroon, C. et al., Successful treatment of subcutaneous Scytalidium hyalinum infection with voriconazole and topical terbina�ne in a cardiac transplant patient, Transplantation, 85, 780, 2008.
50. Oyeka, C.A. and Gugnani, H.C., Keratin degradation by Scytalidium species and Fusarium solani, Mycoses, 41, 73, 1998.
51. Elewski, B.E., Onychomycosis caused by Scytalidium dimidiatum, J. Am. Acad. Dermatol., 35, 336, 1996.
52. Dunand, J. and Paugam, A., In vitro susceptibility of isolates of Scytalidium spp. from super�cial lesions against posaconazole, Pathol. Biol., 56, 268, 2008.
53. Dunand, J. and Paugam, A., In vitro ef�cacy of voriconazole against clinical isolates of Scytalidium spp. from clinical lesions. Int. J. Antimicrob. Agents, 31, 176, 2008.
54. Lacroix, C. and Feuilhade de Chauvin, M., In vitro activity of amphotericin B, itraconazole, voriconazole, posaconazole, caspofungin and terbina�ne against Scytalidium dimidiatum and Scytalidium hyalinum clinical isolates, J. Antimicrob. Chemother., 61, 835, 2008.
55. Downs, A.M., Lear, J.T., and Archer, C.B., Scytalidium hyalinum onychomycosis successfully treated with 5% amorol�ne nail lacquer, Br. J. Dermatol., 140, 555, 1999.
56. Avner, S., Nir, N., and Henri, T., Combination of oral terbina�ne and topical ciclopirox compared to oral terbina�ne for the treatment of onychomycosis, J. Dermatolog. Treat., 16, 327, 2005. 57. Scot Malay, D. et al., Ef�cacy of debridement alone versus debridement combined with topical antifungal nail lacquer for the treatment of pedal onychomycosis: A randomized controlled trial, J. Foot Ankle Surg., 48, 295, 2009. 58. Hay, R., Literature review. Onychomycosis, J. Eur. Acad. Dermatol. Venereol., 19, 1, 2007. 59. Fletcher, C.L., Hay, R.J., and Smeeton, N.C., Onychomycosis: The development of a clinical diagnostic aid for toenail disease. Part I. Establishing discriminating historical and clinical features, Br. J. Dermatol., 150, 701, 2004. 60. Moore, M.K., The infection of human skin and nail by Scytalidium species, Curr. Top. Med. Mycol., 4, 1, 1992. 61. White, T. J. et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics, In: PCR Protocols: A Guide to Methods and Applications, pp. 315– 322, Innis, M.A., Gelfand, D.H., Sninsky, J.J., and White, T.J. (eds.), Academic Press, San Diego, CA, 1990. 62. Machouart, M. et al., Rapid discrimination among dermatophytes, Scytalidium spp., and other fungi with a PCRrestriction fragment length polymorphism ribotyping method, J. Clin. Microbiol., 39, 685, 2001. 63. Menotti, J. et al., Polymerase chain reaction for diagnosis of dermatophyte and Scytalidium spp. onychomycosis, Br. J. Dermatol., 151, 518, 2004. 64. Möller, E.M. et al., A simple and ef�cient protocol for isolation of high molecular weight DNA from �lamentous fungi, fruit bodies, and infected plant tissues, Nucleic Acids Res., 20, 6115, 1992. 65. Lacaz, C.S. et al., Onychomycosis caused by Scytalidium dimidiatum. Report of two cases. Review of the taxonomy of the synanamorph and anamorph forms of this coelomycete, Rev. Inst. Med. Trop. Sao Paulo, 41, 319, 1999. 66. Machouart, M. et al., Nucleotide structure of the Scytalidium hyalinum and Scytalidium dimidiatum 18S subunit ribosomal RNA gene: Evidence for the insertion of a group IE intron in the rDNA gene of S. dimidiatum, FEMS Microbiol. Lett., 208, 187, 2002. 67. Machouart, M. et al., Caractéristiques moléculaires des espèces du genre Scytalidium spp.: Aspects phylogéniques et descriptions de structures introniques, Congress of the French Society of Medical Mycology, Fort-de-France, Martinique, France, January 2010. 68. Soler, C.P. et al., Scytalidium dimidiatum pseudodermatophyte, agent of super�cial mycoses and phaehyphomycosis, Med. Trop., 59, 375, 1999. 69. Savin, C. et al., Multicenter evaluation of a commercial PCR-enzyme-linked immunosorbent assay diagnostic kit (Onychodiag) for diagnosis of dermatophytic onychomycosis, J. Clin. Microbiol., 45, 1205, 2007. 11 Chapter 11 - Hortaea
3. Nishimura, K. and Miyaji, M., Further studies on the phylogenesis of genus Exophiala and Hortaea. Mycophathologia, 92, 101, 1985.
4. Rippon, J.W., Medical Mycology, 3rd edn. W.B. Saunders Co., Philadelphia, PA, 1988.
5. de Hoog, G.S. et al., Atlas of Clinical Fungi, 2nd edn. Centraalbureau voor Schimmelcultures/Universitat Rovira i Virgili, Utrecht/Reus, 2000.
6. Holker, U. et al., Hortaea acidophila, a new acid-tolerant black yeast from lignite. Anton. van Leeuwen., 86, 287, 2004.
7. Kane, J. and Summerbell, R.C., Sodium chloride as aid in identi�cation of Phaeoannellomyces werneckii and other medically important dematiaceous fungi. J. Clin. Microbiol., 25, 944, 1987.
8. Mok, W.Y., Nature and identi�cation of Exophiala werneckii. J. Clin. Microbiol., 16, 976, 1982.
9. de Hoog, G.S. and Gerrits van den Ende, A.H., Nutritional pattern and eco-physiology of Hortaea werneckii, agent of human tinea nigra. Anton. van Leeuwen., 62, 321, 1992.
10. Ng, K.P. et al., The mycological and molecular study of Hortaea werneckii isolated from blood and splenic abscess. Mycopathologia, 159, 495, 2005.
11. Iwatsu, T. and Udagawa, S., Hortaea werneckii isolated from sea-water. Jpn. J. Med. Mycol., 29, 142, 1988.
12. Petrovic, U., Role of oxidative stress in the extremely salt-tolerant yeast Hortaea werneckii. FEMS Yeast Res., 6, 16, 2006.
13. Plemenitaš, A. et al., Adaptation of extremely halotolerant black yeast Hortaea werneckii to increased osmolarity: A molecular perspective at a glance. Stud. Mycol., 61, 67, 2008.
14. Perez, C. et al., Tinea nigra: Report of twelve cases in Venezuela. Mycopathologia, 160, 235, 2005.
15. Crous, P.W., Braun, U., and Groenewald, J.Z., Mycosphaerella is polyphyletic. Stud. Mycol., 58, 1, 2007.
16. Crous, P.W. et al., Delimiting Cladosporium from morphologically similar genera. Stud. Mycol., 58, 33, 2007.
17. Hughes, J.R., Moore, M.K., and Pembroke, A.C., Tinea nigra palmaris. Clin. Exp. Dermatol., 18, 481, 1993.
18. Kogej, T. et al., Osmotic adaptation of the halophilic fungus Hortaea werneckii: Role of osmolytes and melanization. Microbiology, 153, 4261, 2007.
19. Göttlich, E. et al., Cell surface hydrophobicity and lipolysis as essential factors in human tinea nigra. Mycoses, 38, 489, 1995.
20. Schwartz, P.R.A., Super�cial fungal infections. Lancet, 364, 1173, 2004; Kerdel-Vegas, F. and Bastardo de Albornoz, M.C., Tinea Nigra. Report of �ve cases seen in Venezuela. Dermatologica, 132, 320, 1966.
21. Uezato, H. et al., A case of tinea nigra palmaris in Okinawa, Japan. J. Dermatol., 33, 23, 1989.
22. Severo, L.C., Bassanesi, M.C., and Londero, A.T., Tinea nigra: Report of four cases observed in Rio Grande do Sul (Brazil) and a review of Brazilian literature. Mycophathologia, 126, 157, 1994.
23. Reid, B.J., Exophiala werneckii causing tinea nigra in Scotland. Brit. J. Dermatol., 139, 157, 1998.
24. Maldonado, I. et al. Tinea nigra palmaris: Presentation of a clinical case in the Argentine Republic. Rev. Argent. Microbiol., 39, 218, 2007.
25. Bonifaz, A. et al., Tinea nigra by Hortaea werneckii, a report of 22 cases from Mexico. Stud. Mycol., 61, 77, 2008.
26. Gunde-Cimerman, N. et al., Hypersaline waters in salterns: Natural ecological niches for halophilic black yeasts. FEMS Microbiol. Ecol., 32, 235, 2000.
27. Rosen, T. and Lingappan, A., Rapid treatment of tinea nigra palmaris with cilopirox olamine gel, 0.77%. Skinmed, 5, 201, 2006.
28. Marks, J.G., King, R.D., and Davis, B.M., Treatment of tinea nigra palmaris with miconazole topically. Arch. Dermatol., 116, 321, 1980. 29. Meisel, C., Treatment of tinea palmaris with Mycospor. Dermatologica, 169, S121, 1984. 30. Sayegh-Carreno, R., Abramovits-Ackerman, W., and Giron, G.P., Therapy of tinea nigra plantaris. Int. J. Dermatol., 28, 46, 1989. 31. Burke, W.A., Tinea nigra: Treatment with topical ketoconazole. Cutis, 52, 209, 1993. 32. Gupta, G. et al., Tinea nigra secondary to Exophiala werneckii responding to itraconazole. Brit. J. Dermatol., 137, 483, 1997. 33. Shannon, P.L. et al., Treatment of tinea nigra with terbina�ne. Cutis, 64, 199, 1999. 34. Babel, D.E., Pelachyk, J.M., and Hurley, J.P., Tinea nigra masquerading as acral lentiginous melanoma. J. Dermatol. Surg. Oncol., 12, 502, 1986. 35. Hall, J. and Perry, V.E., Tinea nigra palmaris: Differentiation from malignant melanoma or junctional nevi. Cutis, 62, 45, 1998. 36. Tseng, S.S. et al., Bilateral tinea nigra plantaris and tinea nigra plantaris mimicking melanoma. Cutis, 64, 265, 1999. 37. Smith, S.B. et al., Dermoscopy in the diagnosis of tinea nigra plantaris. Cutis, 68, 377, 2001. 38. Standard, P.G., Kaufman, L., and Padhye, A.A., An immunological procedure for the rapid identi�cation of Phaeoannellomyces werneckii. Diagn. Clin. Immunol., 5, 367, 1988. 39. Gupta, A.K., Chaudhry, M., and Elewski, B., Tinea corporis, tinea cruris, tinea nigra, and piedra. Dermatol. Clin., 21, 395, 2003. 40. Ster¼inger, K., Temperature and NaCl-tolerance of rock-inhabiting meristematic fungi. Anton. van Leeuwen., 74, 271, 1998. 41. Zalar, P., de Hoog, G.S., and Gunde-Cimerman, N., Ecology of halotolerant dothideaceous black yeasts. Stud. Mycol., 43, 38, 1999. 42. Steadham, J.E., Geis, P.A., and Simmank, J.L., Use of carbohydrate and nitrate assimilations in the identi�cation of dematiaceous fungi. Diagn. Microbiol. Infect. Dis., 5, 71, 1986. 43. Espinel-Ingroff, A. et al., Evaluation of the API 20C yeast identi�cation system for the differentiation of some dematiaceous fungi. J. Clin. Microbiol., 27, 2565, 1989. 44. Uijthof, J.M. et al., Polymerase chain reaction-mediated genotyping of Hortaea werneckii, causative agent of tinea nigra. Mycoses, 37, 307, 1994. 45. Chen, Y. et al., Polymorphic internal transcribed spacer region 1 DNA sequences identify medically important yeasts. J. Clin. Microbiol., 39, 4042, 2001. 46. Iwen, P.C., Hinrichs, S.H., and Rupp, M.E., Utilization of the internal transcribed spacer regions as molecular targets to detect and identify human fungal pathogens. Med. Mycol., 40, 87, 2002. 47. Abliz, P. et al., Identi�cation of pathogenic dematiaceous fungi and related taxa based on large subunit ribosomal DNA D1/D2 domain sequence analysis. FEMS Immunol. Med. Microbiol., 40, 41–49, 2004. 48. Abliz, P. et al., Speci�c oligonucleotide primers for identi�cation of Hortaea werneckii, a causative agent of tinea nigra. Diagn. Microbiol. Infect. Dis., 46, 89, 2003. 49. de Cock, A.W., Population biology of Hortaea werneckii based on restriction patterns of mitochondrial DNA. Anton. van Leeuwen., 65, 21, 1994. 50. Makimura, K., Murayama, S.Y., and Yamaguchi, H., Detection of a wide range of medically important fungi by the polymerase chain reaction. J. Med. Microbiol., 40, 358, 1994. 51. White, T.J. et al., 1990. Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., Gelfand, J.J., Eds., PCR Protocols: A Guide to Methods and Applications, Academic Press, Inc., New York, pp. 315–322. 12 Chapter 12 - Leptosphaeria
14. Iwen, P.C., Hinrichs, S.H., and Rupp, M.E., Utilization of the internal transcribed spacer regions as molecular targets to detect and identify human fungal pathogens. Med Mycol. 2002;40:87–109.
15. Kaczmarek, J. et al., Analyses of air samples for ascospores of Leptosphaeria maculans and L. biglobosa by light microscopy and molecular techniques. J Appl Genet. 2009;50(4):411–419.
16. Ahmed, A.O. et al., Molecular detection and identi�cation of agents of eumycetoma: Detailed report of two cases. J Clin Microbiol. 2003;41:5813–5816. 17. Desnos-Ollivier, M. et al., Molecular identi�cation of black-grain mycetoma agents. J Clin Microbiol. 2006;44(10):3517–3523. 18. White, T.J. et al., 1990. Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics, in M.S. Innis and D.H. Gelfand (eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press, New York, pp. 315–322. 19. Machmachi, H. et al., Black grain mycetoma caused by Leptosphaeria tompkinsil, Medi. Mycol., 2011:49, 186. 13 Chapter 13 - Macrophomina
1. Crous, P.W. et al., Phylogenetic lineages in the Botryosphaeriaceae, Stud. Mycol., 55, 235, 2006.
3. Holliday, P. and Punithalingam, E., Macrophomina phaseolina, CMI Descriptions of Pathogenic Fungi and Bacteria No. 275, 1988.
4. Ndiaye, M., Ecology and management of charcoal rot (Macrophomina phaseolina) on cowpea in the Sahel, PhD thesis, Wageningen University, the Netherlands, 2007.
5. Purkayastha, S. et al., Characterization of Macrophomina phaseolina, the charcoal rot pathogen of cluster bean, using conventional techniques and PCR-based molecular markers, Plant Pathol., 55, 106, 2006.
6. Nag Raj, T.R., Coelomycetous Anamorphs with AppendageBearing Conidia, Mycologue Publications, Waterloo, Ontario, Canada, 1993. 7. von Arx, J.A., The Genera of Fungi Sporulating in Pure Culture, 3rd edn., J. Cramer, Berlin, Germany, 1981. 8. Agarwal, D.K., Gangopadhyay, S., and Sarbbhoy, A.K., Effect of temperature on the charcoal rot disease of soybean, Indian Phytopathol., 26, 587, 1973. 9. Ghaffar, A. and Erwin, D.C., Effect of soil water stress on root rot of cotton caused by Macrophomina phaseoli, Phytopathology, 59, 795, 1969. 10. Afouda, L., Wolf, G., and Wydra, K., Development of a sensitive serological method for speci�c detection of latent infection of Macrophomina phaseolina in cowpea, J. Phytopathol., 157, 15, 2009. 11. Slippers, B. and Wing�eld, M.J., Botryosphaeriaceae as endophytes and latent pathogens of woody plants: Diversity, ecology and impact, Fungal Biol. Rev., 21, 90, 2007. 12. Sutton, D.A., Coelomycetous fungi in human disease. A review: Clinical entities, pathogenesis, identi�cation and therapy, Rev. Iberoam. Micol., 16, 171, 1999. 13. Tan, D.H. et al., Disseminated fungal infection in a renal transplant recipient involving Macrophomina phaseolina and Scytalidium dimidiatum: Case report and review of taxonomic changes among medically important members of the Botryosphaeriaceae, Med. Mycol., 46, 285, 2008. 14. Srinivasan, A. et al., Cutaneous infection caused by Macrophomina phaseolina in a child with acute myeloid leukemia, J. Clin. Microbiol., 47, 1969, 2009. 15. Bagyalakshmi, R. et al., Newer emerging pathogens of ocular non-sporulating molds (NSM) identi�ed by polymerase chain reaction (PCR)-based DNA sequencing technique targeting internal transcribed spacer (ITS) region, Curr. Eye Res., 33, 139, 2008. 16. Hasegawa, T. et al., Subcutaneous granuloma associated with Macrophomina species infection in a cat, Vet. Rec., 156, 23, 2005. 17. van Baarlen, P. et al., Molecular mechanisms of pathogenicity: How do pathogenic microorganisms develop crosskingdom host jumps?, FEMS Microbiol. Rev., 31, 239, 2007. 18. McGinnis, M.R. and Pfaller, M.A., The laboratory and clinical mycology. In: Anaissie, E.J., McGinnis, M.R., and Pfaller, M.A. (Eds), Clinical Mycology, pp. 55–78, 2nd edn., Chap. 4, Churchill Livingstone Inc., New York, 2009. 19. Guarro, J., Gené, J., and Stchigel, A.M., Developments in fungal taxonomy, Clin. Microbiol. Rev., 12, 454, 1999. 20. Sutton, B.C., The Coelomycetes, CMI, Kew, England, 696pp., 1980. 21. Alves, A. et al., Botryosphaeria corticola sp. nov. on Quercus species, with notes and description of Botryosphaeria stevensii and its anamorph Diplodia mutila, Mycologia, 96, 598, 2004. 22. Dhingra, O.D. and Sinclair, J.B., Basic Plant Pathology Methods, 2nd edn., CRC Press, Boca Raton, FL, 1995. 23. Dhingra, O.D. and Sinclair, J.B., Location of Macrophomina phaseoli on soybean plants related to culture characteristics and virulence, Phytopathology, 63, 934, 1973. 24. Babu, K.B. et al., Identi�cation and detection of Macrophomina phaseolina by using species-speci�c oligonucleotide primers and probe, Mycologia, 99, 797, 2007. 25. Papavizas, G.C. and Klag, N.G., Isolation and quantitative determination of Macrophomina phaseolina from soil, Phytopathology, 65, 182, 1975. 26. Cloud, G.L. and Rupe, J.C., Comparison of three media for enumeration of sclerotia of Macrophomina phaseolina, Plant Disord., 75, 771, 1991.
27. Rakeman, J.L. et al., Multilocus DNA sequence comparisons rapidly identify pathogenic molds, J. Clin. Microbiol., 43, 3324, 2005.
28. Pounder, J.I. et al., Discovering potential pathogens among fungi identi�ed as nonsporulating molds, J. Clin. Microbiol., 45, 568, 2007.
29. Srivastava, A.K. and Arora K., Evaluation of a polyclonal antibody immunoassay for detection and quanti�cation of Macrophomina phaseolina, Plant Pathol., 46, 785, 1997.
30. Ferrer, C. et. al., Detection and identi�cation of fungal pathogens by PCR and by ITS2 and 5.8S ribosomal DNA typing in ocular infections, J. Clin. Microbiol., 39, 2873, 2001.
31. Lau, A. et al., Development and clinical application of a panfungal PCR assay to detect and identify fungal DNA in tissue specimens, J. Clin. Microbiol., 45, 380, 2007.
32. Kumar, M. and Shukla, P.K., Use of PCR targeting of internal transcribed spacer regions and single-stranded conformation polymorphism analysis of sequence variation in different regions of rRNA genes in fungi for rapid diagnosis of mycotic keratitis, J. Clin. Microbiol., 43, 662, 2005.
33. Balajee, S.A. et al., Sequence-based identi�cation of Aspergillus, Fusarium, and Mucorales species in the clinical mycology laboratory: Where are we and where should we go from here?, J. Clin. Microbiol., 47, 877, 2009.
34. Balajee, S.A., Sigler, L., and Brandt, M.E., DNA and the classical way: Identi�cation of medically important molds in the 21st century, Med. Mycol., 45, 475, 2007.
35. Purkayastha, S. et al., Molecular genotyping of Macrophomina phaseolina isolates: Comparison of microsatellite primed PCR and repetitive element sequence-based PCR, J. Phytopathol., 156, 372, 2008.
36. Das, I.K., Fakrudin, B., and Arora, D.K., RAPD cluster analysis and chlorate sensitivity of some Indian isolates of Macrophomina phaseolina from sorghum and their relationships with pathogenicity, Microbiol. Res., 163, 215, 2008. 37. Alves, A. et al., Morphological and molecular data reveal cryptic speciation in Lasiodiplodia theobromae, Fungal Divers., 28, 1, 2008. 38. Gaudio, P.A. et al., Polymerase chain reaction based detection of fungi in infected corneas, Br. J. Ophthalmol., 86, 755, 2002. 39. Jaeger, E.E.M. et al., Rapid detection and identi�cation of Candida, Aspergillus, and Fusarium species in ocular samples using nested PCR, J. Clin. Microbiol., 38, 2902, 2000. 40. Khot, P.D., Ko, D.L., and Fredricks, D.N., Sequencing and analysis of fungal rRNA operons for development of broadrange fungal PCR assays, Appl. Environ. Microbiol., 75, 1559, 2009. 41. White, T.J. et al., 1990. Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A. et al. (Eds.), PCR Protocols: A Guide to Methods and Applications, pp. 315–322, Academic Press, San Diego, CA. 42. O’Donnell, K., 1993. Fusarium and its near relatives. In: Reynolds, D.R. and Taylor, J.W. (Eds), The Fungal Holomorph: Mitotic, Meiotic and Pleomorphic Speciation in Fungal Systematics, pp. 225–233, CAB International, Wallingford, U.K. 43. Alves, A. et al., Evaluation of ampli�ed ribosomal DNA restriction analysis (ARDRA) as a method for the identi�cation of Botryosphaeria species, FEMS Microbiol. Lett., 245, 221, 2005. 44. Phillips, A.J.L. et al., Resolving the phylogenetic and taxonomic status of dark-spored teleomorph genera in the Botryosphaeriaceae, Persoonia, 21, 29, 2008. 45. Alves, A., Phillips, A.J.L., and Correia, A., Multi-gene genealogies and morphological data support Diplodia cupressi sp. nov., previously recognized as D. pinea f. sp. cupressi, as a distinct species, Fungal Divers., 23, 1, 2006. 46. Nilsson, R.H. et al., Taxonomic reliability of DNA sequences in public sequence databases: A fungal perspective, PLoS One, 1, e59, 2006. 14 Chapter 14 - Madurella
1. Ellis, D., Davis, S., Alexiou, H., Handke, R., and Bartley, R., Descriptions of Medical Fungi, 2nd edn., Adelaide, 2007.
2. Ahmed, A.O. et al., Mycetoma caused by Madurella mycetomatis: A neglected infectious burden. Lancet Infect. Dis., 4, 566, 2004.
3. McGinnis, M.R., Mycetoma. Dermatol. Clin., 14, 97, 1996.
4. de Hoog, G.S. et al., Phylogeny and typi�cation of Madurella mycetomatis, with a comparison of other agents of eumycetoma. Mycoses, 47, 121, 2004.
5. Desnos-Ollivier, M. et al., Molecular identi�cation of black-grain mycetoma agents. J. Clin. Microbiol., 44, 3517, 2006.
6. Borman, A.M. et al., Molecular characterisation of the Madurella grisea complex reveals at least three new taxa associated with human mycetomas. In: ISHAM 2009, Tokyo, 2009.
7. Mackinnon, J.E., Characteristics of four cultures of Mycetomi (Laveran) Brumpt isolated in Sudan and British Somaliland. An. Facult. Med. Montevideo, 36, 197, 1951.
8. van de Sande, W.W. et al., Melanin biosynthesis in Madurella mycetomatis and its effect on susceptibility to itraconazole and ketoconazole. Microb. Infect., 9, 1114, 2007.
9. Kwon-Chung, K.J. and Bennet, J.E., Medical Mycology. Lea and Febiger, Philadelphia, PA, 1992.
10. Rajendran, C. et al., An evaluation of straw-extract agar media for the growth and sporulation of Madurella mycetomatis. Mycopathologia, 115, 9, 1991.
11. El-hassan, A.M., Fahal, A., and El-hag, I., The pathology of mycetoma. Sudan Med. J., 32(Suppl.), 23, 1994.
12. CLSI, Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi: Approved Standard. National Committee for Clinical Laboratory Standards, Wayne, Pennsylvania, PA, 2002. 13. van de Sande, W.W. et al., In vitro susceptibility of Madurella mycetomatis, prime agent of Madura foot, to tea tree oil and artemisinin, J. Antimicrob. Chemother., 59, 553, 2007. 14. van de Sande, W.W. et al., Testing of the in vitro susceptibilities of Madurella mycetomatis to six antifungal agents by using the sensititre system in comparison with a viability-based
33. Ahmed, A. et al., Management of mycetoma: Major challenge in tropical mycoses with limited international recognition. Curr. Opin. Infect. Dis., 20, 146, 2007.
34. Fahal, A.H. et al., Blood supply and vasculature of mycetoma. J. Med. Vet. Mycol., 35, 101, 1997.
35. Lupi, O., Tyring, S.K., and McGinnis, M.R., Tropical dermatology: Fungal tropical diseases. J. Am. Acad. Dermatol., 53, 931, quiz 952, 2005.
36. Lichon, V. and Khachemoune, A., Mycetoma: A review. Am. J. Clin. Dermatol., 7, 315, 2006.
37. Fahal, A.H., Hassan, M., and Sanhouri, M., Surgical treatment of mycetoma. Sudan Med. J., 32, S98, 1994.
38. Restrepo, A., Treatment of tropical mycoses. J. Am. Acad. Dermatol., 31, S91, 1994.
39. Rios-Fabra, A., Moreno, A.R., and Isturiz, R.E., Fungal infection in Latin American countries. Infect. Dis. Clin. North Am., 8, 129, 1994.
40. Hay, R.J. et al., Mycetoma. J. Med. Vet. Mycol., 30(Suppl.), 41, 1992.
41. Borelli, D., A clinical trial of itraconazole in the treatment of deep mycoses and leishmaniasis. Rev. Infect. Dis., 9(Suppl.), S57, 1987.
42. Diaz, M. et al., A Pan-American 5-year study of ¼uconazole therapy for deep mycoses in the immunocompetent host. PanAmerican Study Group. Clin. Infect. Dis., 14(Suppl.), S68, 1992.
43. Van Cutsem, J., The in-vitro antifungal spectrum of itraconazole. Mycoses, 32(Suppl.), 7, 1989.
44. Mahgoub, E.S. and Gumaa, S.A., Ketoconazole in the treatment of eumycetoma due to Madurella mycetomi. Trans. R. Soc. Trop. Med. Hyg., 78, 376, 1984. 45. Venugopal, P.V. and Venugopal, T.V., Treatment of eumycetoma with ketoconazole. Aust. J. Dermatol., 34, 27, 1993.
46. Develoux, M. et al., Management of mycetoma in WestAfrica. Bull. Soc. Pathol. Exot., 96, 376, 2003.
47. Welsh, O., Salinas, M.C., and Rodriguez, M.A., Treatment of eumycetoma and actinomycetoma. Curr. Top. Med. Mycol., 6, 47, 1995.
48. Richardson, M.D. and Warnock, D.W., Fungal Infection: Diagnosis and Management, 3rd edn., Blackwell Publishing Ltd., Oxford, U.K., 2003.
49. N’Diaye, B. et al., Clinical ef�cacy and safety of oral terbina�ne in fungal mycetoma. Int. J. Dermatol., 45, 154, 2006.
50. Negroni, R. et al., Posaconazole treatment of refractory eumycetoma and chromoblastomycosis. Rev. Inst. Med. Trop. Sao Paulo, 47, 339, 2005.
51. Kumar, J. et al., The dot-in-circle sign of mycetoma on MRI. Diag. Intervent. Radiol. (Ankara, Turkey), 13, 193, 2007.
52. Cherian, R.S. et al., The “dot-in-circle” sign—A characteristic MRI �nding in mycetoma foot: A report of three cases. Br. J. Radiol., 82, 662, 2009.
53. Sarris, I. et al., MRI of mycetoma of the foot: Two cases demonstrating the dot-in-circle sign. Skelet. Radiol., 32, 179, 2003.
54. Fahal, A.H. et al., Ultrasonographic imaging of mycetoma. Br. J. Surg., 84, 1120, 1997.
55. Fahal, A.H. et al., The host tissue reaction to Madurella mycetomatis: New classi�cation. J. Med. Vet. Mycol., 33, 15, 1995.
56. El Hag, I.A., Fine needle aspiration cytology of mycetoma. Acta Cytol., 40, 461, 1996.
57. Gabhane, S.K. et al., Cytodiagnosis of eumycotic mycetoma: A case report. Acta Cytol., 52, 354, 2008. 58. Suliman, E.-N., Laboratory diagnosis of mycetoma. Sudan Med. J., 32, S67, 1994. 59. Mahgoub, E.-S., Mycetoma. In: Mahgoub E.-S., ed., Tropical Mycoses, pp. 58–74. Janssen Research Council, Beerse, Belgium, 1990. 60. Taha, A., A serological survey of antibodies to Streptomyces somaliensis and Actinomadura madurae in the Sudan enzyme linked immunosorbent assay (ELISA). Trans. R. Soc. Trop. Med. Hyg., 77, 49, 1983. 61. McLaren, M.L., Mahgoub, E.S., and Georgakopoulos, E., Preliminary investigation of the use of the enzyme linked immunosorbent assay (ELISA) in the serodiagnosis of mycetoma. Sabouraudia, 16, 225, 1978. 62. Wethered, D.B. et al., Humoral immune responses to mycetoma organisms: Characterization of speci�c antibodies by the use of enzyme-linked immunosorbent assay and immunoblotting. Trans. R. Soc. Trop. Med. Hyg., 82, 918, 1988. 63. van de Sande, W.W. et al., Translationally controlled tumor protein from Madurella mycetomatis, a marker for tumorous mycetoma progression. J. Immunol., 177, 1997, 2006. 64. Mahgoub, E.S., Mycoses of the Sudan. Trans. R. Soc. Trop. Med. Hyg., 71, 184, 1977. 65. Padhye, A.A. and McGinnis, M.R., Fungi causing eumycotic mycetoma. In: Murray P.R. et al., eds., Manual of Clinical Microbiology, 7th edn., pp. 1318–1326. American Society for Microbiology, Washington, DC, 1999. 66. de Hoog, G.S. et al., Diagnostic problems with imported cases of mycetoma in The Netherlands. Mycoses, 36, 81, 1993. 67. Ahmed, A.O. et al., Development of a species-speci�c PCRrestriction fragment length polymorphism analysis procedure for identi�cation of Madurella mycetomatis. J. Clin. Microbiol., 37, 3175, 1999. 68. Ahmed, A.O. et al., Molecular detection and identi�cation of agents of eumycetoma: Detailed report of two cases. J. Clin. Microbiol., 41, 5813, 2003. 69. Lopes, M.M., Freitas, G., and Boiron, P., Potential utility of random ampli�ed polymorphic DNA (RAPD) and restriction endonuclease assay (REA) as typing systems for Madurella mycetomatis. Curr. Microbiol., 40, 1, 2000. 70. Ahmed, A. et al., Madurella mycetomatis strains from mycetoma lesions in Sudanese patients are clonal. J. Clin. Microbiol., 41, 4537, 2003. 71. van de Sande, W.W. et al., Genotyping of Madurella mycetomatis by selective ampli�cation of restriction fragments (ampli�ed fragment length polymorphism) and subtype correlation with geographical origin and lesion size. J. Clin. Microbiol., 43, 4349, 2005. 72. Ahmed, A. et al., Eumycetoma caused by Madurella mycetomatis identi�ed by PCR and sequencing: A report of two cases. J. Clin. Microbiol., 41, 1813, 2003. 73. Vos, P. et al., AFLP: A new technique for DNA �ngerprinting. Nucleic Acids Res., 23, 4407, 1995. 74. Abbott, P., Mycetoma in the Sudan, Trans. R. Soc. Trop. Med. Hyg., 50, 11; discussion, 50, 24, 1956. 75. Bendl, B.J. et al., Mycetoma in Saudi Arabia. J. Trop. Med. Hyg., 90, 51, 1987. 76. Castro, L.G. et al., Mycetoma: A retrospective study of 41 cases seen in Sao Paulo, Brazil, from 1978 to 1989. Mycoses, 36, 89, 1993. 77. Destombes, P. et al., Mycetoma in Somalia—Results of a survey done from 1959 to 1964. Acta Trop., 34, 355, 1977.
78. Develoux, M. et al., Mycetoma in the Republic of Niger: Clinical features and epidemiology. Am. J. Trop. Med. Hyg., 38, 386, 1988.
79. Dieng, M.T. et al., Mycetoma: 130 cases. Ann. Dermatol. Venereol., 130, 16, 2003.
80. Klokke, A.H. et al., The causal agents of mycetoma in South India. Trans. R. Soc. Trop. Med. Hyg., 62, 509, 1968. 81. Lopez Martinez, R. et al., Epidemiology of mycetoma in Mexico: Study of 2105 cases. Gac. Med. Mex., 128, 477, 1992. 82. Negroni, R. et al., Clinical and microbiological study of mycetomas at the Muniz hospital of Buenos Aires between 1989 and 2004. Rev. Argent. Microbiol., 38, 13, 2006. 15 Chapter 15 - Neodeightonia
11. Phillips, A.J.L. et al., Resolving the phylogenetic and taxonomic status of dark-spored teleomorph genera in the Botryosphaeriaceae, Persoonia, 21, 29, 2008.
12. Krishnamurthy, Y.L., Naik, S.B., and Jayaram, S., Fungal communities in herbaceous medicinal plants from the Malnad Region, Southern India, Microb. Environ., 23, 24, 2008.
13. Sutton, D.A., Coelomycetous fungi in human disease. A review: Clinical entities, pathogenesis, identi�cation and therapy, Rev. Iberoam. Micol., 16, 171, 1999.
14. Guarro, J., Gené, J., and Stchigel, A.M., Developments in fungal taxonomy, Clin. Microbiol. Rev., 12, 454, 1999.
15. Sutton, B.C., The Coelomycetes, Kew, England: CMI, 1980, 696 pp.
16. Alves, A. et al., Botryosphaeria corticola sp. nov. on Quercus species, with notes and description of Botryosphaeria stevensii and its anamorph Diplodia mutila, Mycologia, 96, 598, 2004.
17. Denman, S. et al., An overview of the taxonomic history of Botryosphaeria, and a re-evaluation of its anamorphs based on morphology and ITS rDNA phylogeny, Stud. Mycol., 45, 129, 2000.
18. Jacobs, K.A. and Rehner, S.A., Comparison of cultural and morphological characters and ITS sequences in anamorphs of Botryosphaeria and related taxa, Mycologia, 90, 601, 1998.
19. Ferrer, C. et al., Detection and identi�cation of fungal pathogens by PCR and by ITS2 and 5.8S ribosomal DNA typing in ocular infections, J. Clin. Microbiol., 39, 2873, 2001.
20. Mancini, N. et al., Rapid molecular identi�cation of fungal pathogens in corneal samples from suspected keratomycosis cases, J. Med. Microbiol., 55, 1505, 2006.
21. Gaudio, P.A. et al., Polymerase chain reaction based detection of fungi in infected corneas, Br. J. Ophthalmol., 86, 755, 2002.
22. Lau, A. et al., Development and clinical application of a panfungal PCR assay to detect and identify fungal DNA in tissue specimens, J. Clin. Microbiol., 45, 380, 2007.
23. Ferrer, C. et al., Polymerase chain reaction diagnosis in fungal keratitis caused by Alternaria alternata, Am. J. Ophthalmol., 133, 398, 2002.
24. Kumar, M. and Shukla, P.K., Use of PCR targeting of internal transcribed spacer regions and single-stranded conformation polymorphism analysis of sequence variation in different regions of rRNA genes in fungi for rapid diagnosis of mycotic keratitis, J. Clin. Microbiol., 43, 662, 2005. 25. Bagyalakshmi, R. et al., Newer emerging pathogens of ocular non-sporulating molds (NSM) identi�ed by polymerase chain reaction (PCR)-based DNA sequencing technique targeting internal transcribed spacer (ITS) region, Curr. Eye Res., 33, 139, 2008. 26. Rakeman, J.L. et al., Multilocus DNA sequence comparisons rapidly identify pathogenic molds, J. Clin. Microbiol., 43, 3324, 2005. 27. Pounder, J.I. et al., Discovering potential pathogens among fungi identi�ed as nonsporulating molds, J. Clin. Microbiol., 45, 568, 2007. 28. Balajee, S.A. et al., Sequence-based identi�cation of Aspergillus, Fusarium, and Mucorales species in the clinical mycology laboratory: Where are we and where should we go from here?, J. Clin. Microbiol., 47, 877, 2009. 29. Balajee, S.A., Sigler, L., and Brandt, M.E., DNA and the classical way: Identi�cation of medically important molds in the 21st century, Med. Mycol., 45, 475, 2007. 30. Alves, A. et al., Rapid differentiation of species of Botryosphaeriaceae by PCR �ngerprinting, Res. Microbiol., 158, 112, 2007. 31. Alves, A. et al., Morphological and molecular data reveal cryptic speciation in Lasiodiplodia theobromae, Fungal Divers., 28, 1, 2008. 32. Jaeger, E.E.M. et al., Rapid detection and identi�cation of Candida, Aspergillus, and Fusarium species in ocular samples using nested PCR, J. Clin. Microbiol., 38, 2902, 2000. 33. White, T.J. et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In Innis, M.A. et al. (eds.), PCR Protocols: A Guide to Methods and Applications, pp. 315–322. Academic Press, San Diego, CA, 1990. 34. O’Donnell, K., Fusarium and its near relatives. In Reynolds, D.R. and Taylor, J.W. (eds.), The Fungal Holomorph: Mitotic, Meiotic and Pleomorphic Speciation in Fungal Systematics, pp. 225–233. CAB International, Wallingford, U.K., 1993. 35. Alves, A. et al., Evaluation of ampli�ed ribosomal DNA restriction analysis (ARDRA) as a method for the identi�cation of Botryosphaeria species, FEMS Microbiol. Lett., 245, 221, 2005. 36. Alves, A., Phillips, A.J.L., and Correia, A., Multi-gene genealogies and morphological data support Diplodia cupressi sp. nov., previously recognized as D. pinea f. sp. cupressi, as a distinct species, Fungal Divers., 23, 1, 2006. 37. Nilsson, R.H. et al., Taxonomic reliability of DNA sequences in public sequence databases: A fungal perspective, PLoS One, 1, e59, 2006. 16 Chapter 16 - Phoma and Phomopsis
1. The UniProt Consortium. Available at http://www.uniprot. org/taxonomy/, accessed on August 1, 2010.
2. Aveskamp MM et al. DNA phylogeny reveals polyphyly of Phoma section Peyronellaea and multiple taxonomic novelties. Mycologia 2009;101:363–382.
3. de Gruyter J et al. Molecular phylogeny of Phoma and allied anamorph genera: Towards a reclassi�cation of the Phoma complex. Mycol. Res. 2009;113:508–519.
4. http://mycology.adelaide.edu.au/, accessed on August 1, 2010.
5. Sutton DA et al. Human phaeohyphomycotic osteomyelitis caused by the coelomycete Phomopsis saccardo 1905: Criteria for identi�cation, case history, and therapy. J. Clin. Microbiol. 1999;37(3):807–811.
6. Young NA, Kwon-Chung KJ, Freeman J. Subcutaneous abscess caused by Phoma sp. resembling Pyrenochaeta romeroi: Unique fungal infection occurring in immunosuppressed recipient of renal allograft. Am. J. Clin. Pathol. 1973;59:810–816.
7. Shukla N, Agarwal GP, Gupta DK. Phoma as a human pathogen. Mykosen 27, 255, 1984.
8. Rai MK. Phoma sorghina infection in human being. Mycopathologia 1989;105(3):167–170.
9. Montel E, Bridge PD, Sutton BC. An integrated approach to Phoma systematics. Mycopathologia 1991;115(2):89–103.
10. Morris JT et al. Lung mass caused by Phoma species. Infect. Dis. Clin. Pract. 1995;4:58–59. 11. Hirsh AH, Schiff TA. Subcutaneous phaeohyphomycosis caused by an unusual pathogen: Phoma species. J. Am. Acad. Dermatol. 1996;34:679–680. 12. Rosen T et al. Cutaneous lesions due to Pleurophoma (Phoma) complex. South Med. J. 1996;89(4):431–433. 13. Zaitz C et al. Subcutaneous phaeohyphomycosis caused by Phoma cava. Report of a case and review of the literature. Rev. Inst. Med. Trop. Sao Paulo 1997;39(1):43–48. 14. Oh CK et al. Subcutaneous pheohyphomycosis caused by Phoma species. Int. J. Dermatol. 1999;38(11):874–876. 15. Suh MK. Phaeohyphomycosis in Korea. Nippon Ishinkin Gakkai Zasshi 2005;46(2):67–70. 16. Baker J et al. First report of subcutaneous phaeohyphomycosis of the foot caused by Phoma minutella. J. Clin. Microbiol. 1987;25:2395–2397. 17. Rishi K, Font RL. Keratitis caused by an unusual fungus, Phoma species. Cornea 2003;22(2):166–168. 18. Everett JE et al. A deeply invasive Phoma species infection in a renal transplant recipient. Transplant. Proc. 2003;35:1387–1389. 19. Balis E et al. Lung mass caused by Phoma exigua. Scand. J. Infect. Dis. 2006;38:552–555. 20. Mandell KJ, Colby KA. Penetrating keratoplasty for invasive fungal keratitis resulting from a thorn injury involving Phomopsis species. Cornea 28, 1167, 2009. 21. Dooley DP et al. Phaeohyphomycotic cutaneous disease caused by Pleurophoma in a cardiac transplant patient. J. Infect. Dis. 159, 503, 1989. 22. Vengayil S et al. Polymerase chain reaction-guided diagnosis of mycotic keratitis: A prospective evaluation of its ef�cacy and limitations. Invest. Ophthalmol. Vis. Sci. 50, 152, 2009. 23. Hietala AM, Solheim H, Fossdal CG. Real-time PCR-based monitoring of DNA pools in the tri-trophic interaction between Norway spruce, the rust Thekopsora areolata, and an opportunistic ascomycetous Phomopsis sp. Phytopathology 98, 51, 2008. 24. Pounder JI et al. Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J. Clin. Microbiol. 45, 568, 2007. 17 Chapter 17 - Piedraia
6. Adam, B.A., Soo-Hoo, T.S., and Chong, K.C., Black piedra in West Malaysia. Aust J Derm. 1977;18:45–47.
7. Venugopal, P.V. and Venugopal, T.V., Super�cial mycoses in Saudi Arabia. Australas J Dermatol. 1992;33:45–48.
8. Kanitakis, J. et al., Black piedra: Report of a French case associated with Trichosporon asahii. Int J Dermatol. 2006;45:1258–1260.
9. Coimbra, C.E.A. and Santos, R.V., Black piedra among zoro Indians from Amazonia (Brazil). Mycopathologia 1989;107:57–60.
10. Gip, L., Black piedra: The �rst case treated with terbina�ne (Lamisil). Br J Dermatol. 1994;130(Suppl 43):26–28.
11. Figueras, M.J., Guarro, J., and Zaror, L., New �ndings in black piedra infection. Br J Dermatol. 1996;135:157–158.
12. Youker, S.R. et al., White piedra: Further evidence of a synergistic infection, J Am Acad Dermatol. 2003;49:46–49.
13. McBride, M.E. et al., A new Brevibacterium species isolated from infected genital hair of patients with white piedra, J Med Microbiol. 1993;39:255–261.
14. Figueras, M.J., Guarro, J., and Zaror, L., Ultrastructural aspects of hair digestion in black piedra infection. J Med Vet Mycol. 1997a;35:1–6. 15. de Almeida, H.L. Jr., Rivitti, E.A., and Jaeger, R.G., White piedra: Ultrastructure and a new microecological aspect, Mycoses 1990;33:491–497. 16. de Almeida, H.L. Jr., Salebian, A., and Rivitti, E.A., Ultrastructure of black piedra, Mycoses 1991;34:447–451. 17. Ellner, K.M. et al., White piedra: Evidence for a synergistic infection, Br J Dermatol. 1990;123:355–363. 18. Abliz, P. et al., Identi�cation of pathogenic dematiaceous fungi and related taxa based on large subunit ribosomal DNA D1/D2 domain sequence analysis. FEMS Immunol Med Microbiol. 2004;40:41–49. 19. Pounder, J.I. et al., Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J Clin Microbiol. 2007;45:568–571. 20. Gip, L., Terbina�ne for black piedra. Lancet 1993;341:1164. 21. Drake, L.A. et al., Guidelines of care for super�cial mycotic infections of the skin: Piedra—Guidelines/Outcomes Committee, J Am Acad Dermatol. 1996;34:122–124. 22. Desnos-Ollivier, M. et al., Molecular identi�cation of black-grain mycetoma agents. J Clin Microbiol. 2006;44(10):3517–3523. 18 Chapter 18 - Pyrenochaeta
1. The UniProt Consortium. Available at http://www.uniprot. org/, accessed on August 1, 2010.
2. Ferrer, C. et al., New Pyrenochaeta species causing keratitis. J Clin Microbiol. 2009;47:1596.
3. Verkley, G.J.M., Pyrenochaeta keratinophila sp. nov., isolated from an ocular infection in Spain. Rev Iberoam Micol. 2010;27:22–24.
4. Desnos-Ollivier, M. et al., Molecular identi�cation of black-grain mycetoma agents. J Clin Microbiol. 2006;44(10):3517–3523.
5. Kwon-Chung, K.J. and Bennett, J.E., Medical Mycology. Lea & Febiger, Philadelphia, PA, 1992.
6. de Hoog, G.S. et al., Atlas of Clinical Fungi. Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands, 2000.
7. de Hoog, G.S. et al., Diagnostic problems with imported cases of mycetoma in The Netherlands. Mycoses 1993;36:81–87.
8. Thomas, P.A., Fungal infections of the cornea. Eye 2003;17:852–862.
9. Andre, M. et al., Fungal mycetoma with black grains due to Pyrenochaeta romeroi in Cambodia. Bull Soc Pathol Exot Fil. 1968;61:108–112.
10. English, M.P., Infection of the �nger-nail by Pyrenochaeta unguis-hominis. Br J Dermatol. 1980;103:91–93.
11. Thammayya, A., Sanyal, M., and Basu, N., Pyrenochaeta romeroi causing mycetoma pedis in India. J Indian Med Assoc. 1979;73:66–67. 12. Rinaldi, M.G., Phaeohyphomycosis. Dermatol Clin. 1996;14:147–153. 13. Cerar, D. et al., Isolation, identi�cation and susceptibility of Pyrenochaeta romeroi in a case of eumycetoma of the foot in the UK. Int J Antimicrob Agents 2009;34(6):617–618. 14. Girard, C. et al., Subcutaneous phaeohyphomycosis due to Pyrenochaeta romeroi in a patient with leprosy. Acta Derm Venereol. 2004;84(2):154–155. 15. Badali, H. et al., Subcutaneous phaeohyphomycotic cyst caused by Pyrenochaeta romeroi. Med Mycol. 2010;48(5):763–768. 16. Chen, Y.-C. et al., Identi�cation of medically important yeasts using PCR-based detection of DNA sequence polymorphisms in the internal transcribed spacer region 2 of the rRNA genes. J Clin Microbiol. 2000;38:2302–2310. 17. Chen, Y.-C. et al., Polymorphic internal transcribed spacer region 1 DNA sequences identify medically important yeasts. J Clin Microbiol. 2001;39:4042–4051. 18. Ferrer, C. et al., Detection and identi�cation of fungal pathogens by PCR and by ITS2 and 5.8S ribosomal DNA typing in ocular infections. J Clin Microbiol. 2001;39:2873–2879. 19. Ahmed, A.O. et al., Molecular detection and identi�cation of agents of eumycetoma: Detailed report of two cases. J Clin Microbiol. 2003;41:5813–5816. 20. Schwarz, P. et al., Molecular identi�cation of zygomycetes from culture and experimentally infected tissues. J Clin Microbiol. 2006;44:340–349. 21. Linton, C.J. et al., Molecular identi�cation of unusual pathogenic yeast isolates by large ribosomal subunit gene sequencing: 2 years experience at the UK Mycology Reference Laboratory. J Clin Microbiol. 2007;5:1152–1158. 22. Iwen, P.C., Hinrichs, S.H., and Rupp, M.E., Utilization of the internal transcribed spacer regions as molecular targets to detect and identify human fungal pathogens. Med Mycol. 2002;40:87–109. 23. Pounder, J.I. et al., Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J Clin Microbiol. 2007;45(2):568–571. 24. Borman, A.M. et al., Molecular identi�cation of pathogenic fungi. J Antimicrob Chemother. 2008;61:S7. 25. Borman, A.M. et al., An improved protocol for the preparation of total genomic DNA from isolates of yeast and mould using Whatman FTA �lter papers. Mycopathologia 2010;169:445. 26. González-Mendoza, D. et al., A rapid method for isolation of total DNA from pathogenic �lamentous plant fungi. Genet Mol Res. 2010;9(1):162–166. 27. White, T.J. et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In M.S. Innis and D.H. Gelfand (Eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press, New York, 1990, pp. 315–322. 19 Chapter 19 - Ramichloridium
9. Taj-Aldeen SJ et al., Cerebral phaeohyphomycosis due to Rhinocladiella mackenziei (formerly Ramichloridium mackenziei): A taxonomic update and review of the literature. Med Mycol. 2010;48(3):546–556.
10. Arzanlou M et al., Phylogenetic and morphotaxonomic revision of Ramichloridium and allied genera. Stud Mycol. 2007;58:57–93.
11. Cheewangkoon R et al., Species of Mycosphaerella and related anamorphs on Eucalyptus leaves from Thailand. Persoonia 2008;21:77–91.
12. Fader RC, McGinnis MR, Infections caused by dematiaceous fungi: Chromoblastomycosis and phaeohyphomycosis. Infect Dis Clin North Am. 1988;2:925–938.
13. Rinaldi MG, Phaeohyphomycosis. Dermatol Clin. 1996;14:147–153.
14. Revankar SD et al., Disseminated phaeohyphomycosis: Review of an emerging mycosis. Clin Infect Dis. 2002;34:467–476.
15. Brandt ME, Warnock DW, Epidemiology, clinical manifestations, and therapy of infections caused by dematiaceous fungi. J Chemother. 2003;15(Suppl 2):36–47. 16. Chakrabarti A, Epidemiology of central nervous system mycoses. Neurol India 2007;55:191. 17. Rippon JW et al., “Golden tongue” syndrome caused by Ramichloridium schulzeri. Arch Dermatol. 1985;121:892–894. 18. Untereiner WA, Naveau FA, Molecular systematics of the Herpotrichiellaceae with an assessment of the phylogenetic positions of Exophiala dermatitidis and Phialophora americana. Mycologia 1999;91:67–83. 19. Caligiorne RB et al., Internal transcribed spacer rRNA genebased phylogenetic reconstruction using algorithms with local and global sequence alignment for black yeasts and their relatives. J Clin Microbiol. 2005;43(6):2816–2823. 20. Zeng JS, De Hoog GS, Exophiala spinifera and its allies: Diagnostics from morphology to DNA barcoding. Med Mycol. 2008;46:193–208. 21. White TJ et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols: A Guide to Methods and Applications, M.S. Innis and D.H. Gelfand (Eds.), Academic Press, New York, 1990, pp. 315–322. 20 Chapter 20 - Ulocladium
1. The UniProt Consortium. Available at http://www.uniprot.org/, accessed on August 1, 2010. 2. Simmons, E. G. 1997. Multiplex conidium morphology in species of the Ulocladium atrum group. Can J Bot. 76:1533–1539. 3. de Hoog, G. S. et al. (eds.). 2000. Atlas of Clinical Fungi, 2nd edn. Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands. 4. Srinivasan, M. et al. 1997. Epidemiology and aetiological diagnosis of corneal ulceration in Madurai, south India. Br J Ophthalmol. 81:965–971. 5. Magina, S. et al. 2000. Cutaneous alternariosis by Alternaria chartarum in a renal transplanted patient. Br J Dermatol. 142:1261–1262. 6. Williamson, E. C. et al. 2000. Diagnosis of invasive aspergillosis in bone marrow transplant recipients by polymerase chain reaction. Br J Haematol. 108:132–139. 7. Duran, M. T. et al. 2003. Cutaneous infection caused by Ulocladium chartarum in a heart transplant recipient: Case report and review. Acta Derm Venereol. 83:218–221. 8. Romano, C. et al. 2004. Onychomycosis due to Ulocladium botrytis. Mycoses 47:346–348. 9. Badenoch, P. R. et al. 2006. Ulocladium atrum keratitis. J Clin Microbiol. 44, 1190–1193. 10. Ajello, L. 1986. Hyalohyphomycosis and phaeohyphomycosis: Two global disease entities of public health importance. Eur J Epidemiol. 2:243–251. 11. Rinaldi, M. G. 1996. Phaeohyphomycosis. Dermatol Clin. 14:147–153. 12. Thomas, P. A. 2003. Current perspectives on ophthalmic mycoses. Clin Microbiol Rev. 16:730–797. 13. de Hoog, G. S. and R. Horré. 2002. Molecular taxonomy of the Alternaria and Ulocladium species from humans and their identi�cation in the routine laboratory. Mycoses 45:259–276. 14. Simmons, E. G. 1967. Typi�cation of Alternaria, Stemphylium, and Ulocladium. Mycologia 59:67–92. 15. Pryor, B. M. and D. M. Bigelow. 2003. Molecular characterization of Embellisia and Nimbya species and their relationship to Alternaria, Ulocladium, and Stemphylium. Mycologia 95:1141–1154. 16. Pryor, B. M. and R. L. Gilbertson. 2000. Molecular phylogenetic relationships amongst Alternaria species and related fungi based upon analysis of nuclear ITS and mtSSU rDNA sequences. Mycol Res. 104:1312–1321. 17. Meklin, T. et al. 2004. Quantitative PCR analysis of house dust can reveal abnormal mold conditions. J Environ Monit. 6:615–620. 18. Pounder, J. I. et al. 2007. Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J Clin Microbiol. 45(2):568–571. 19. Bagyalakshmi, R. et al. 2008. Newer emerging pathogens of ocular non-sporulating molds (NSM) identi�ed by polymerase chain reaction (PCR)-based DNA sequencing technique targeting internal transcribed spacer (ITS) region. Curr Eye Res. 33(2):139–147. 20. Thomas, O. A. et al. 1991. Use of lactophenol cotton blue mounts of corneal scraping as an aid to the diagnosis of mycotic keratitis. Diagn Microbiol Infect Dis. 14:219–224. 21. Pujol, I. et al. 2000. In vitro antifungal susceptibility of Alternaria spp. and Ulocladium spp. J Antimicrob Chemother. 46:337–338. 22. White, T. J. et al. 1990. Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In Innis, M.A. et al. (eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press, New York, pp. 315–322.
Pezizomycotina: Eurotiomycetes 21 Chapter 21 - Acrophialophora
1. The UniProt Consortium. Available at http://www.uniprot. org/, accessed on August 1, 2010.
2. Al-Mohsen, I. Z. et al., 2000. Acrophialophora fusispora brain abscess in a child with acute lymphoblastic leukemia: Review of cases and taxonomy. J Clin Microbiol. 38:4569–4576.
3. Shukla, P. K. et al., 1983. Clinical and experimental keratitis caused by the Colletotrichum state of Glomerella cingulata and Acrophialophora fusispora. Sabouraudia. 21:137–147.
4. Sutton, D. A. et al., 1997. Pulmonary Acrophialophora fusispora: Case history, literature, review and mycology. In: Proceedings of the 13th International Society for Human and Animal Mycology Congress, 1997, Salsomaggiore Terme, Italy, Abstract 363.
5. Arthur, S. et al., 2001. Scedosporium proli¡cans keratouveitis in association with a contact lens retained intraocularly over a long term. J Clin Microbiol. 39(12):4579–4582.
6. Cimon, B. et al., 2005. Airway colonization by Acrophialophora fusispora in patients with cystic �brosis. J Clin Microbiol. 43(3):1484–1487.
7. Pihet, M. et al., 2009. Occurrence and relevance of �lamentous fungi in respiratory secretions of patients with cystic �brosis—A review. Med Mycol. 47(4):387–397.
8. Guarro, J. and J. Gene, 2002. Acrophialophora fusispora misidenti�ed as Scedosporium proli¡cans. J Clin Microbiol. 40:3544.
9. Sigler, L. and D. A. Sutton, 2002. Acrophialophora fusispora misidenti�ed as Scedosporium proli¡cans. J Clin Microbiol. 40:3544–3545.
10. Guarro, J. et al., 2007. Acrophialophora fusispora: An emerging agent of human mycoses. A report of 3 new clinical cases. Diagn Microbiol Infect Dis. 59(1):85–88.
11. Welsh, R. D. and R. W. Ely, 1999. Scopulariopsis chartarum systemic mycosis in a dog. J Clin Microbiol. 37:2102–2103. 12. de Hoog, G. S. et al., 2000. Atlas of Clinical Fungi, 2nd edn., vol. 1. Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands.
13. Pounder, J. I. et al., 2007. Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J. Clin Microbiol. 45(2):568–571.
14. White, T. J. et al., 1990. Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In Innis, M. A. et al. (eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press, New York, pp. 315–322. 22 Chapter 22 - Arthrographis
1. The UniProt Consortium. Available at http://www.uniprot. org/, accessed on August 1, 2010.
2. Sigler, L. and J. W. Carmichael. 1983. Redisposition of some fungi referred to Oidium microspermum and a review of Arthrographis. Mycotaxon. 18:495–507.
3. Sigler, L., Y. Yamaoka, and Y. Hiratsuka. 1990. Taxonomy and chemistry of a new fungus from bark beetle infected Pinus contorta var. latifolia. Part 1. Arthrographis pinicola sp. nov. Can J Microbiol. 36:77–82.
4. de Hoog, G. S. et al. 2000. Atlas of Clinical Fungi, 2nd edn., vol. 1. Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands.
5. Gené, J. et al. 1996. Studies on keratinophilic fungi. X. Arthrographis alba sp. nov. Can J Microbiol. 42:1185–1189.
6. Perlman, E. M. and L. Binns. 1997. Intense photophobia caused by Arthrographis kalrae in a contact lens-wearing patient. Am J Ophthalmol. 123(4):547–549.
7. Degavre, B., J. M. Joujoux, M. Dandurand, and B. Guillot. 1997. First report of mycetoma caused by Arthrographis kalrae: Successful treatment with itraconazole. J Am Acad Dermatol. 37:318–320.
8. Chin-Hong, P. V. et al. 2001. Invasive fungal sinusitis and meningitis due to Arthrographis kalrae in a patient with AIDS. J Clin Microbiol. 39:804–807.
9. Xi, L. et al. 2004. First case of Arthrographis kalrae ethmoid sinusitis and ophthalmitis in the People’s Republic of China. J Clin Microbiol. 42:4828–4831.
10. Pichon, N. et al. 2008. Fatal-stroke syndrome revealing fungal cerebral vasculitis due to Arthrographis kalrae in an immunocompetent patient. J Clin Microbiol. 46:3152.
11. Biser, S. A. et al. 2004. Arthrographis keratitis mimicking Acanthamoeba keratitis. Cornea. 23(3):314–317.
12. Sugiura, Y. and M. Hironaga. 2010. Arthrographis kalrae, a rare causal agent of onychomycosis, and its occurrence in natural and commercially available soils. Med Mycol. 48(2):384–389.
13. Pounder, J. I. et al. 2007. Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J Clin Microbiol. 45(2):568–571.
14. Bagyalakshmi, R. et al. 2008. Newer emerging pathogens of ocular non-sporulating molds (NSM) identi�ed by polymerase chain reaction (PCR)-based DNA sequencing technique targeting internal transcribed spacer (ITS) region. Curr Eye Res. 33(2):139–147.
15. White, T. J. et al. 1990. Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In Innis, M. A. et al. (Eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press, New York, pp. 315–322.
16. de Diego Candelo, J. et al. 2010. Endocarditis caused by Arthrographis kalare. The Annals of Thoracic surgery. 90:e4–e5.
17. Thomas, B. C. et al. 2011. Severe Arthrographis kalrae Kerato mycosis in an Immunocompetent Patient. Cornea. 30(3):364–366. 23 Chapter 23 - Aspergillus
1. Hicks, J. B. et al., Fungal types and concentrations from settled dust in normal residences, J. Occup. Environ. Hyg., 2, 481, 2005.
2. Horner, W. E. et al., Air- and dustborne myco¼ora in houses free of water damage and fungal growth, Appl. Environ. Microbiol., 70, 6394, 2004.
3. Sautour, M. et al., Pro�les and seasonal distribution of airborne fungi in indoor and outdoor environments at a French hospital, Sci. Total Environ., 407, 3766, 2009.
4. Snelders, E. et al., Possible environmental origin of resistance of aspergillus fumigatus to medical triazoles, Appl. Environ. Microbiol., 75, 4053, 2009.
5. Zuk, J. A. et al., Locally invasive pulmonary aspergillosis occurring in a gardener: An occupational hazard? Thorax, 44, 678, 1989.
6. Marr, K. A. et al., Aspergillosis. Pathogenesis, clinical manifestations, and therapy, Infect. Dis. Clin. North Am., 16, 875, 2002.
7. Denning, D. W. et al., The link between fungi and severe asthma: A summary of the evidence, Eur. Respir. J., 27, 615, 2006.
8. Thia, L. P. and Balfour Lynn, I. M., Diagnosing allergic bronchopulmonary aspergillosis in children with cystic �brosis, Paediatr. Respir. Rev., 10, 37, 2009.
9. Pagano, L. et al., The epidemiology of fungal infections in patients with hematologic malignancies: The SEIFEM-2004 study, Haematologica, 91, 1068, 2006.
10. Pagano, L. et al., Fungal infections in recipients of hematopoietic stem cell transplants: Results of the SEIFEM b-2004 study—Sorveglianza epidemiologica infezioni fungine nelle emopatie maligne, Clin. Infect. Dis., 45, 1161, 2007.
11. Marr, K. A., Fungal infections in hematopoietic stem cell transplant recipients, Med. Mycol., 46, 293, 2008.
12. Horn, D. L. et al., Presentation of the path alliance ® registry for prospective data collection and analysis of the epidemiology, therapy, and outcomes of invasive fungal infections, Diagn. Microbiol. Infect. Dis., 59, 407, 2007.
13. Hammerman, K. J. et al., The incidence of hospitalized cases of systemic mycotic infections, Sabouraudia, 12, 33, 1974.
14. Fraser, D. W. et al., Aspergillosis and other systemic mycoses. The growing problem, JAMA, 242, 1631, 1979.
15. Dasbach, E. J. et al., Burden of aspergillosis-related hospitalizations in the United States, Clin. Infect. Dis., 31, 1524, 2000.
16. Berenguer, J. et al., Pathogenesis of pulmonary aspergillosis. Granulocytopenia versus cyclosporine and methylprednisolone-induced immunosuppression, Am. J. Respir. Crit. Care Med., 152, 1079, 1995.
17. Balloy, V. et al., Differences in patterns of infection and in¼ammation for corticosteroid treatment and chemotherapy in experimental invasive pulmonary aspergillosis, Infect. Immun., 73, 494, 2005.
18. Hope, W. W. et al., The invasive and saprophytic syndromes due to Aspergillus spp., Med. Mycol., 43(Suppl 1), S207, 2005.
19. Fraser, R. S., Pulmonary aspergillosis: Pathologic and pathogenetic features, Pathol. Annu., 28(Pt 1), 231, 1993.
20. Denning, D. W., Invasive aspergillosis, Clin. Infect. Dis., 26, 781, 1998.
21. Meziane, M. A. et al., High resolution CT of the lung parenchyma with pathologic correlation, Radiographics, 8, 27, 1988. 22. Caillot, D. et al., Improved management of invasive pulmonary aspergillosis in neutropenic patients using early thoracic computed tomographic scan and surgery, J. Clin. Oncol., 15, 139, 1997. 23. Caillot, D. et al., Increasing volume and changing characteristics of invasive pulmonary aspergillosis on sequential thoracic computed tomography scans in patients with neutropenia, J. Clin. Oncol., 19, 253, 2001. 24. Denning, D. W. et al., Chronic cavitary and �brosing pulmonary and pleural aspergillosis: Case series, proposed nomenclature change, and review, Clin. Infect. Dis., 37(Suppl 3), S265, 2003. 25. Cordonnier, C. et al., Correlation between galactomannan antigen levels in serum and neutrophil counts in haematological patients with invasive aspergillosis, Clin. Microbiol. Infect., 15, 81, 2009. 26. Riscili, B. P. and Wood, K. L., Noninvasive pulmonary aspergillus infections, Clin. Chest Med., 30, 315, 2009. 27. Dagenais, T. R. and Keller, N. P., Pathogenesis of aspergillus fumigatus in invasive aspergillosis, Clin. Microbiol. Rev., 22, 447, 2009. 28. Bulpa, P. et al., Invasive pulmonary aspergillosis in patients with chronic obstructive pulmonary disease, Eur. Respir. J., 30, 782, 2007. 29. Segal, B. H., Aspergillosis, N. Engl. J. Med., 360, 1870, 2009. 30. Segal, B. H. and Romani, L. R., Invasive aspergillosis in chronic granulomatous disease, Med. Mycol., 47(Suppl 1), S282, 2009. 31. Herbrecht, R. et al., Voriconazole versus amphotericin b for primary therapy of invasive aspergillosis, N. Engl. J. Med., 347, 408, 2002. 32. Greene, R. E. et al., Imaging �ndings in acute invasive pulmonary aspergillosis: Clinical signi�cance of the halo sign, Clin. Infect. Dis., 44, 373, 2007. 33. Caillot, D. et al., Role of early diagnosis and aggressive surgery in the management of invasive pulmonary aspergillosis in neutropenic patients, Clin. Microbiol. Infect., 7(Suppl 2), 54, 2001. 34. Meersseman, W. et al., Galactomannan in bronchoalveolar lavage ¼uid: A tool for diagnosing aspergillosis in intensive care unit patients, Am. J. Respir. Crit. Care Med., 177, 27, 2008. 35. Walsh, T. J. et al., Treatment of aspergillosis: Clinical practice guidelines of the Infectious Diseases Society of America, Clin. Infect. Dis., 46, 327, 2008. 36. Maertens, J. et al., Galactomannan and computed tomography-based preemptive antifungal therapy in neutropenic patients at high risk for invasive fungal infection: A prospective feasibility study, Clin. Infect. Dis., 41, 1242, 2005. 37. Cordonnier, C. et al., Empirical versus preemptive antifungal therapy for high-risk, febrile, neutropenic patients: A randomized, controlled trial, Clin. Infect. Dis., 48, 1042, 2009. 38. Chamilos, G. et al., Invasive fungal infections in patients with hematologic malignancies in a tertiary care cancer center: An autopsy study over a 15-year period (1989–2003), Haematologica, 91, 986, 2006. 39. Howard, S. J. et al., Azole resistance in aspergillus fumigatus associated with treatment failure, Emerg. Infect. Dis., 15, 1068, 2009. 40. Verweij, P. E. et al., Multiple-triazole-resistant aspergillosis, N. Engl. J. Med., 356, 1481, 2007. 41. Snelders, E. et al., Emergence of azole resistance in aspergillus fumigatus and spread of a single resistance mechanism, PLoS Med., 5, e219, 2008.
42. Ascioglu, S. et al., De�ning opportunistic invasive fungal infections in immunocompromised patients with cancer and hematopoietic stem cell transplants: An international consensus, Clin. Infect. Dis., 34, 7, 2002. 43. De Pauw, B. et al., Revised de�nitions of invasive fungal disease from the European Organization for Research and Treatment of Cancer/Invasive Fungal Infections Cooperative Group and the National Institute of Allergy and Infectious Diseases Mycoses Study Group (EORTC/MSG) consensus group, Clin. Infect. Dis., 46, 1813, 2008.
44. Cornillet, A. et al., Comparison of epidemiological, clinical, and biological features of invasive aspergillosis in neutropenic and nonneutropenic patients: A 6-year survey, Clin. Infect. Dis., 43, 577, 2006.
45. Vandewoude, K. H. et al., Clinical relevance of aspergillus isolation from respiratory tract samples in critically ill patients, Crit. Care, 10, R31, 2006.
46. Jantunen, E. et al., Central nervous system aspergillosis in allogeneic stem cell transplant recipients, Bone Marrow Transplant., 31, 191, 2003.
47. Jain, K. K. et al., Imaging features of central nervous system fungal infections, Neurol. India, 55, 241, 2007.
48. Almutairi, B. M. et al., Invasive aspergillosis of the brain: Radiologic-pathologic correlation, Radiographics, 29, 375, 2009.
49. Miaux, Y. et al., MR of cerebral aspergillosis in patients who have had bone marrow transplantation, AJNR Am. J. Neuroradiol., 16, 555, 1995.
50. Dietrich, U. et al., Cerebral aspergillosis: Comparison of radiological and neuropathologic �ndings in patients with bone marrow transplantation, Eur. Radiol., 11, 1242, 2001.
51. DeLone, D. R. et al., Disseminated aspergillosis involving the brain: Distribution and imaging characteristics, AJNR Am. J. Neuroradiol., 20, 1597, 1999.
52. Denning, D. W. et al., British society for medical mycology proposed standards of care for patients with invasive fungal infections, Lancet Infect. Dis., 3, 230, 2003.
53. Pagano, L. et al., The role of bronchoalveolar lavage in the microbiological diagnosis of pneumonia in patients with haematological malignancies, Ann. Med., 29, 535, 1997.
54. Levy, H. et al., The value of bronchoalveolar lavage and bronchial washings in the diagnosis of invasive pulmonary aspergillosis, Respir. Med., 86, 243, 1992.
55. Lass-Florl, C. et al., The value of computed tomographyguided percutaneous lung biopsy for diagnosis of invasive fungal infection in immunocompromised patients, Clin. Infect. Dis., 45, e101, 2007.
56. Ruchel, R. and Schaffrinski, M., Versatile ¼uorescent staining of fungi in clinical specimens by using the optical brightener blankophor, J. Clin. Microbiol., 37, 2694, 1999.
57. Ruchel, R. and Margraf, S., Rapid microscopical diagnosis of deep-seated mycoses following maceration of fresh specimens and staining with optical brighteners, Mycoses, 36, 239, 1993.
58. Reichenberger, F. et al., Diagnostic yield of bronchoscopy in histologically proven invasive pulmonary aspergillosis, Bone Marrow Transplant., 24, 1195, 1999.
59. Maertens, J. et al., Use of circulating galactomannan screening for early diagnosis of invasive aspergillosis in allogeneic stem cell transplant recipients, J. Infect. Dis., 186, 1297, 2002.
60. Horvath, J. A. and Dummer, S., The use of respiratory-tract cultures in the diagnosis of invasive pulmonary aspergillosis, Am. J. Med., 100, 171, 1996. 61. Clinical Laboratory Standards Institute, Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi; Approved Standard—Second Edition. NCCLS document m38-a2, Clinical Laboratory Standards Institute, Wayne, PA, 2008. 62. Subcommittee on Antifungal Susceptibility Testing, o. t. E. C. f. A. S. T., EUCAST technical note on the method for the determination of broth dilution minimum inhibitory concentrations of antifungal agents for conidia-forming moulds, Clin. Microbiol. Infect., 14, 982, 2008. 63. Odds, F. C. et al., Interlaboratory comparison of results of susceptibility testing with caspofungin against candida and aspergillus species, J. Clin. Microbiol., 42, 3475, 2004. 64. Arendrup, M. C. et al., Establishing in vitro-in vivo correlations for aspergillus fumigatus: The challenge of azoles versus echinocandins, Antimicrob. Agents Chemother., 52, 3504, 2008. 65. Rodriguez-Tudela, J. L. et al., Epidemiological cutoffs and cross-resistance to azole drugs in aspergillus fumigatus, Antimicrob. Agents Chemother., 52, 2468, 2008. 66. Pfaller, M. A. et al., Wild type MIC distribution and epidemiological cutoff values for aspergillus fumigatus and three triazoles as determined by the clinical and laboratory standards institute broth microdilution methods, J. Clin. Microbiol., 47(10), 3142–3146, 2009. 67. Pfaller, J. B. et al., In vitro susceptibility testing of Aspergillus spp.: Comparison of Etest and reference microdilution methods for determining voriconazole and itraconazole MICs, J. Clin. Microbiol., 41, 1126, 2003. 68. Espinel-Ingroff, A., Comparison of three commercial assays and a modi�ed disk diffusion assay with two broth microdilution reference assays for testing zygomycetes, Aspergillus spp., candida spp., and cryptococcus neoformans with posaconazole and amphotericin b, J. Clin. Microbiol., 44, 3616, 2006. 69. Maertens, J. et al., Autopsy-controlled prospective evaluation of serial screening for circulating galactomannan by a sandwich enzyme-linked immunosorbent assay for hematological patients at risk for invasive aspergillosis, J. Clin. Microbiol., 37, 3223, 1999. 70. Marr, K. A. et al., Antifungal therapy decreases sensitivity of the aspergillus galactomannan enzyme immunoassay, Clin. Infect. Dis., 40, 1762, 2005. 71. Herbrecht, R. et al., Aspergillus galactomannan detection in the diagnosis of invasive aspergillosis in cancer patients, J. Clin. Oncol., 20, 1898, 2002. 72. Mennink-Kersten, M. A. S. H. et al., Bi�dobacterium lipoteichoic acid and false ELISA reactivity in aspergillus antigen detection, Lancet, 363, 325, 2004. 73. Mennink-Kersten, M. A. S. H. et al., Bi�dobacterial lipoglycan as a new cause for false-positive platelia aspergillus enzyme-linked immunosorbent assay reactivity, J. Clin. Microbiol., 43, 3925, 2005. 74. Husain, S. et al., Performance characteristics of the platelia aspergillus enzyme immunoassay for detection of aspergillus galactomannan antigen in bronchoalveolar lavage ¼uid, Clin. Vac. Immunol., 15, 1760, 2008. 75. Clancy, C. J. et al., Bronchoalveolar lavage galactomannan in diagnosis of invasive pulmonary aspergillosis among solidorgan transplant recipients, J. Clin. Microbiol., 45, 1759, 2007. 76. Senn, L. et al., 1,3-Beta-d-glucan antigenemia for early diagnosis of invasive fungal infections in neutropenic patients with acute leukemia, Clin. Infect. Dis., 46, 878, 2008.
77. Obayashi, T. et al., Reappraisal of the serum (1–>3)-beta-dglucan assay for the diagnosis of invasive fungal infections— A study based on autopsy cases from 6 years, Clin. Infect. Dis., 46, 1864, 2008.
78. Ellis, M. et al., Assessment of the clinical utility of serial betad-glucan concentrations in patients with persistent neutropenic fever, J. Med. Microbiol., 57, 287, 2008.
79. Persat, F. et al., Contribution of the (1->3)-{beta}-d-glucan assay for diagnosis of invasive fungal infections, J. Clin. Microbiol., 46, 1009, 2008.
80. Khan, Z. U. et al., Detection of aspergillus fumigatus-speci�c DNA, (1–3)-beta-d-glucan and galactomannan in serum and bronchoalveolar lavage specimens of experimentally infected rats, Mycoses, 51, 129, 2008.
81. Kawazu, M. et al., Prospective comparison of the diagnostic potential of real-time PCR, double-sandwich enzymelinked immunosorbent assay for galactomannan, and a (1->3)-{beta}-d-glucan test in weekly screening for invasive aspergillosis in patients with hematological disorders, J. Clin. Microbiol., 42, 2733, 2004.
82. Ahmad, S. et al., Diagnostic value of DNA, (1–3)-betad-glucan, and galactomannan detection in serum and bronchoalveolar lavage of mice experimentally infected with aspergillus terreus, Diagn. Microbiol. Infect. Dis., 59, 165, 2007.
83. Hope, W. W. et al., Laboratory diagnosis of invasive aspergillosis, Lancet Infect. Dis., 5, 609, 2005.
84. Hafen, G. M. et al., Allergic bronchopulmonary aspergillosis: The hunt for a diagnostic serological marker in cystic �brosis patients, Expert Rev. Mol. Diagn., 9, 157, 2009.
85. Lambourne, J. et al., Association of mannose-binding lectin de�ciency with acute invasive aspergillosis in immunocompromised patients, Clin. Infect. Dis., 49, 1486, 2009.
86. Vekemans, M. et al., Low mannose-binding lectin concentration is associated with severe infection in patients with hematological cancer who are undergoing chemotherapy, Clin. Infect. Dis., 44, 1593, 2007.
87. Buranawuti, K. et al., Variants in mannose-binding lectin and tumour necrosis factor alpha affect survival in cystic �brosis, J. Med. Genet., 44, 209, 2007.
88. Van Burik, J. A. et al., Panfungal PCR assay for detection of fungal infection in human blood specimens, J. Clin. Microbiol., 36, 1169, 1998.
89. Hebart, H. et al., Prospective screening by a panfungal polymerase chain reaction assay in patients at risk for fungal infections: Implications for the management of febrile neutropenia, Br. J. Haematol., 111, 635, 2000.
90. Jordanides, N. E. et al., A prospective study of real-time panfungal PCR for the early diagnosis of invasive fungal infection in haemato-oncology patients, Bone Marrow Transplant., 35, 389, 2005.
91. Loef¼er, J. et al., Nucleic acid sequence-based ampli�cation of aspergillus RNA in blood samples, J. Clin. Microbiol., 39, 1626, 2001.
92. Zhao, Y. et al., Rapid real-time nucleic acid sequence-based ampli�cation-molecular beacon platform to detect fungal and bacterial bloodstream infections, J. Clin. Microbiol., 47, 2067, 2009.
93. Lott, T. J. et al., Nucleotide sequence analysis of the 5.8S rDNA and adjacent ITS 2 region of Candida albicans and related species, Yeast, 9, 1199, 1993.
94. Gaskell, G. J. et al., Analysis of the internal transcribed spacer regions of ribosomal DNA in common airborne allergenic fungi, Electrophoresis, 18, 1567, 1997. 95. Borazjani, R. N. et al., Comparison of 5.8s and ITS2 rDNA RFLP patterns among isolates of acremonium obclavatum, A. kiliense, and A. strictum from diverse sources, Curr. Microbiol., 36, 70, 1998. 96. Turenne, C. Y. et al., Rapid identi�cation of fungi by using the ITS2 genetic region and an automated ¼uorescent capillary electrophoresis system, J. Clin. Microbiol., 37, 1846, 1999. 97. Chen, Y. C. et al., Identi�cation of medically important yeasts using PCR-based detection of DNA sequence polymorphisms in the internal transcribed spacer 2 region of the rRNA genes, J. Clin. Microbiol., 38, 2302, 2000. 98. Henry, T. et al., Identi�cation of aspergillus species using internal transcribed spacer regions 1 and 2, J. Clin. Microbiol., 38, 1510, 2000. 99. Kulik, T. et al., Development of PCR assay based on ITS2 rDNA polymorphism for the detection and differentiation of fusarium sporotrichioides, FEMS Microbiol. Lett., 239, 181, 2004. 100. Hinrikson, H. P. et al., Assessment of ribosomal large-subunit d1-d2, internal transcribed spacer 1, and internal transcribed spacer 2 regions as targets for molecular identi�cation of medically important aspergillus species, J. Clin. Microbiol., 43, 2092, 2005. 101. Lau, A. et al., Development and clinical application of a panfungal PCR assay to detect and identify fungal DNA in tissue specimens, J. Clin. Microbiol., 45, 380, 2007. 102. Herrera, M. L. et al., Strain-dependent variation in 18s ribosomal DNA copy numbers in aspergillus fumigatus, J. Clin. Microbiol., 47, 1325, 2009. 103. Walsh, T. J. et al., PCR and single-strand conformational polymorphism for recognition of medically important opportunistic fungi, J. Clin. Microbiol., 33, 3216, 1995. 104. Hui, M. et al., Rapid identi�cation of medically important candida to species level by polymerase chain reaction and single-strand conformational polymorphism [in process citation], Diagn. Microbiol. Infect. Dis., 38, 95, 2000. 105. Aufauvre-Brown, A. et al., Use of randomly ampli�ed polymorphic DNA markers to distinguish isolates of aspergillus fumigatus, J. Clin. Microbiol., 30, 2991, 1992. 106. Brandt, M. E. et al., Utility of random ampli�ed polymorphic DNA PCR and TaqMan automated detection in molecular identi�cation of aspergillus fumigatus, J. Clin. Microbiol., 36, 2057, 1998. 107. Lass-Florl, C. et al., Aspergillus terreus infections in haematological malignancies: Molecular epidemiology suggests association with in-hospital plants, J. Hosp. Infect., 46, 31, 2000. 108. Martin, C. et al., Development of a PCR-based line probe assay for identi�cation of fungal pathogens [in process citation], J. Clin. Microbiol., 38, 3735, 2000. 109. Hopfer, R. L. et al., Detection and differentiation of fungi in clinical specimens using polymerase chain reaction (PCR) ampli�cation and restriction enzyme analysis, J. Med. Vet. Mycol., 31, 65, 1993. 110. Morace, G. et al., Identi�cation of various medically important candida species in clinical specimens by PCR-restriction enzyme analysis, J. Clin. Microbiol., 35, 667, 1997. 111. Bowman, J. C. et al., Quantitative PCR assay to measure aspergillus fumigatus burden in a murine model of disseminated aspergillosis: Demonstration of ef�cacy of caspofungin acetate, Antimicrob. Agents Chemother., 45, 3474, 2001. 112. Costa, C. et al., Development of two real-time quantitative TaqMan PCR assays to detect circulating aspergillus fumigatus DNA in serum, J. Microbiol. Methods, 44, 263, 2001.
113. Gonzalez-Salgado, A. et al., Speci�c detection of aspergillus carbonarius by SYBR green and TaqMan quantitative PCR assays based on the multicopy ITS2 region of the rRNA gene, FEMS Microbiol. Lett., 295, 57, 2009.
114. Imhof, A. et al., Rapid detection of pathogenic fungi from clinical specimens using LightCycler real-time ¼uorescence PCR, Eur. J. Clin. Microbiol. Infect. Dis., 22, 558, 2003.
115. Spiess, B. et al., Development of a LightCycler PCR assay for detection and quanti�cation of aspergillus fumigatus DNA in clinical samples from neutropenic patients, J. Clin. Microbiol., 41, 1811, 2003.
116. Klingspor, L. and Jalal, S., Molecular detection and identi�cation of candida and Aspergillus spp. From clinical samples using real-time PCR, Clin. Microbiol. Infect., 12, 745, 2006.
117. Park, S. et al., Rapid identi�cation of candida dubliniensis using a species-speci�c molecular beacon, J. Clin. Microbiol., 38, 2829, 2000.
118. Balashov, S. V. et al., Assessing resistance to the echinocandin antifungal drug caspofungin in candida albicans by pro�ling mutations in fks1, Antimicrob. Agents Chemother., 50, 2058, 2006.
119. Garcia-Effron, G. et al., Rapid detection of triazole antifungal resistance in aspergillus fumigatus, J. Clin. Microbiol., 46, 1200, 2008.
120. Cuenca-Estrella, M. et al., Value of serial quanti�cation of fungal DNA by a real-time PCR-based technique for early diagnosis of invasive aspergillosis in patients with febrile neutropenia, J. Clin. Microbiol., 47, 379, 2009.
121. Mengoli, C. et al., Use of PCR for diagnosis of invasive aspergillosis: Systematic review and meta-analysis, Lancet Infect. Dis., 9, 89, 2009.
122. Perlin, D. S., Application of real-time PCR to the diagnosis of invasive fungal infections. In Real-Time PCR: Current Technology and Applications, J. Logan, K. Edwards, and N. Saunders (eds.), Caister Academic Press, London, U.K., 2009.
123. Buchheidt, D. et al., Prospective clinical evaluation of a LightCycler-mediated polymerase chain reaction assay, a nested-PCR assay and a galactomannan enzyme-linked immunosorbent assay for detection of invasive aspergillosis in neutropenic cancer patients and haematological stem cell transplant recipients, Br. J. Haematol., 125, 196, 2004. 124. Verweij, P. E. et al., Validating PCR for detecting invasive aspergillosis, Br. J. Haematol., 127, 235, 2004.
125. Suarez, F. et al., Detection of circulating aspergillus fumigatus DNA by real-time PCR assay of large serum volumes improves early diagnosis of invasive aspergillosis in highrisk adult patients under hematologic surveillance, J. Clin. Microbiol., 46, 3772, 2008.
126. Bougnoux, M. et al., Serum is more suitable than whole blood for diagnosis of systemic candidiasis by nested PCR, J. Clin. Microbiol., 37, 925, 1999.
127. Perlin, D. S., Multiplex detection of mutations. In Multiplex Detection of Mutations., Seitz., A. M. A. O. (ed.), The Humana Press Inc., Totowa, NJ, 2007.
128. Stevenson, J. et al., Effect of sequence polymorphisms on performance of two real-time PCR assays for detection of herpes simplex virus, J. Clin. Microbiol., 43, 2391, 2005.
129. Vora, G. J. et al., Comparison of detection and signal ampli�cation methods for DNA microarrays, Mol. Cell. Probes, 22, 294, 2008.
130. Baskova, L. et al., The Pan-AC assay: A single-reaction realtime PCR test for quantitative detection of a broad range of aspergillus and candida species, J. Med. Microbiol., 56, 1167, 2007. 131. Perlin, D. S. and Zhao, Y., Molecular diagnostic platforms for detecting aspergillus, Med. Mycol., 47(1), S223–232, 2008. 132. Marty, F. M. and Koo, S., Role of (1–>3)-beta-d-glucan in the diagnosis of invasive aspergillosis, Med. Mycol., 47(1), S223–240, 2008. 133. Sanglard, D. and Odds, F. C., Resistance of candida species to antifungal agents: Molecular mechanisms and clinical consequences, Lancet Infect. Dis., 2, 73, 2002. 134. White, T. C. et al., Resistance mechanisms in clinical isolates of candida albicans, Antimicrob. Agents Chemother., 46, 1704, 2002. 135. Coste, A. et al., A mutation in Tac1p, a transcription factor regulating CDR1 and CDR2, is coupled with loss of heterozygosity at chromosome 5 to mediate antifungal resistance in candida albicans, Genetics, 172, 2139, 2006. 136. Coste, A. et al., Genotypic evolution of azole resistance mechanisms in sequential candida albicans isolates, Eukaryot. Cell, 6, 1889, 2007. 137. Selmecki, A. et al., An isochromosome confers drug resistance in vivo by ampli�cation of two genes, Erg11 and Tac1, Mol. Microbiol., 68, 624, 2008. 138. Selmecki, A. et al., Aneuploidy and isochromosome formation in drug-resistant candida albicans, Science, 313, 367, 2006. 139. Vermitsky, J. P. and Edlind, T. D., Azole resistance in candida glabrata: Coordinate upregulation of multidrug transporters and evidence for a Pdr1-like transcription factor, Antimicrob. Agents Chemother., 48, 3773, 2004. 140. Chamilos, G. and Kontoyiannis, D. P., Update on antifungal drug resistance mechanisms of aspergillus fumigatus, Drug Resist. Updates, 8, 344, 2005. 141. Lupetti, A. et al., Molecular basis of resistance to azole antifungals, Trends Mol. Med., 8, 76, 2002. 142. Alcazar-Fuoli, L. et al., Aspergillus section fumigati: Antifungal susceptibility patterns and sequence-based identi�cation, Antimicrob. Agents Chemother., 52, 1244, 2008. 143. Balajee, S. A. et al., Molecular studies reveal frequent misidenti�cation of aspergillus fumigatus by morphotyping, Eukaryot. Cell, 5, 1705, 2006. 144. Geiser, D. M. et al., The current status of species recognition and identi�cation in aspergillus, Stud. Mycol., 59, 1, 2007. 145. Balajee, S. A. et al., Aspergillus species identi�cation in the clinical setting, Stud. Mycol., 59, 39, 2007. 146. Hong, S. B. et al., Polyphasic taxonomy of aspergillus fumigatus and related species, Mycologia, 97, 1316, 2005. 147. Staab, J. F. et al., Aspergillus section fumigati typing by PCRrestriction fragment polymorphism, J. Clin. Microbiol., 47, 2079, 2009. 148. Bain, J. M. et al., Multilocus sequence typing of the pathogenic fungus aspergillus fumigatus, J. Clin. Microbiol., 45, 1469, 2007. 149. Klaassen, C. H., MLST versus microsatellites for typing aspergillus fumigatus isolates, Med. Mycol., 47(Suppl 1), S27, 2009. 150. Vanhee, L. M. et al., Comparison of multiple typing methods for aspergillus fumigatus, Clin. Microbiol. Infect., 15, 643, 2009. 151. Klingspor, L. and Loef¼er, J., Aspergillus PCR formidable challenges and progress, Med. Mycol., 47(Suppl 1), S241, 2009. 152. Loef¼er, J. et al., Contaminations occurring in fungal PCR assays, J. Clin. Microbiol., 37, 1200, 1999. 153. Rimek, D. et al., Identi�cation of contaminating fungal DNA sequences in zymolyase, J. Clin. Microbiol., 37, 830, 1999.
154. Muller, F. M. et al., Rapid extraction of genomic DNA from medically important yeasts and �lamentous fungi by highspeed cell disruption, J. Clin. Microbiol., 36, 1625, 1998.
155. Costa, C. et al., Real-time PCR coupled with automated DNA extraction and detection of galactomannan antigen in serum by enzyme-linked immunosorbent assay for diagnosis of invasive aspergillosis, J. Clin. Microbiol., 40, 2224, 2002.
156. Loef¼er, J. et al., Comparison between plasma and whole blood specimens for detection of aspergillus DNA by PCR, J. Clin. Microbiol., 38, 3830, 2000.
157. Einsele, H. et al., Detection and identi�cation of fungal pathogens in blood by using molecular probes, J. Clin. Microbiol., 35, 1353, 1997.
158. Kami, M. et al., Use of real-time PCR on blood samples for diagnosis of invasive aspergillosis, Clin. Infect. Dis., 33, 1504, 2001.
159. Ramirez, M. et al., Molecular detection and identi�cation of Aspergillus spp. From clinical samples using real-time PCR, Mycoses, 52, 129, 2009.
160. Lass-Florl, C. et al., Diagnosing invasive aspergillosis during antifungal therapy by PCR analysis of blood samples, J. Clin. Microbiol., 42, 4154, 2004.
161. Schulz, B. et al., Effect of different sample volumes on the DNA extraction of aspergillus fumigatus from whole blood, Clin. Microbiol. Infect., 15, 686, 2009.
162. Sheppard, D. C. et al., Comparison of three methodologies for the determination of pulmonary fungal burden in experimental murine aspergillosis, Clin. Microbiol. Infect., 12, 376, 2006.
163. Vallor, A. C. et al., Assessment of aspergillus fumigatus burden in pulmonary tissue of guinea pigs by quantitative PCR, galactomannan enzyme immunoassay, and quantitative culture, Antimicrob. Agents Chemother., 52, 2593, 2008.
164. Clemons, K. V. and Stevens, D. A., Conventional or molecular measurement of aspergillus load, Med. Mycol., 47(Suppl 1), S132, 2009.
165. Bonin, S. et al., PCR analysis in archival postmortem tissues, Mol. Pathol., 56, 184, 2003.
166. Sandhu, G. S. et al., Molecular probes for diagnosis of fungal infections, J. Clin. Microbiol., 33, 2913, 1995.
167. Hata, D. J. et al., Real-time PCR method for detection of zygomycetes, J. Clin. Microbiol., 46, 2353, 2008. 168. Zhao, Y. et al., Presented at the 49th Interscience Conference on Antimicrobial Agents and Chemotherapy, San Francisco, CA, 2009. 169. Yoo, J. H. et al., Comparison of the real-time nucleic acid sequence-based ampli�cation (RTI-NASBA) with conventional NASBA, and galactomannan assay for the diagnosis of invasive aspergillosis, J. Korean Med. Sci., 22, 672, 2007. 170. Faber, J. et al., Rapid detection of common pathogenic aspergillus species by a novel real-time PCR approach, Mycoses, 52, 228, 2008. 171. Landlinger, C. et al., Species-speci�c identi�cation of a wide range of clinically relevant fungal pathogens by use of luminex xmap technology, J. Clin. Microbiol., 47, 1063, 2009. 172. Perlin, D. S., Resistance to echinocandin-class antifungal drugs, Drug Resist. Updates, 10, 121, 2007. 173. Katiyar, S. et al., Candida albicans and candida glabrata clinical isolates exhibiting reduced echinocandin susceptibility, Antimicrob. Agents Chemother., 50, 2892, 2006. 174. Garcia-Effron, G. et al., Effect of candida glabrata FKS1 and FKS2 mutations on echinocandin sensitivity and kinetics of 1,3-beta-d-glucan synthase: Implication for the existing susceptibility breakpoint, Antimicrob. Agents Chemother., 53, 3690, 2009. 175. Loef¼er, J. et al., Quanti�cation of fungal DNA by using ¼uorescence resonance energy transfer and the light cycler system, J. Clin. Microbiol., 38, 586, 2000. 176. Williamson, E. C. et al., Diagnosis of invasive aspergillosis in bone marrow transplant recipients by polymerase chain reaction, Br. J. Haematol., 108, 132, 2000. 177. White, P. L. et al., The evolution and evaluation of a whole blood polymerase chain reaction assay for the detection of invasive aspergillosis in hematology patients in a routine clinical setting, Clin. Infect. Dis., 42, 479, 2006. 178. Pham, A. S. et al., Diagnosis of invasive mold infection by real-time quantitative PCR, Am. J. Clin. Pathol., 119, 38, 2003. 179. White, P. L. et al., A consensus on fungal polymerase chain reaction diagnosis?: A United Kingdom-Ireland evaluation of polymerase chain reaction methods for detection of systemic fungal infections, J. Mol. Diagn., 8, 376, 2006. 24 Chapter 24 - Blastomyces
10. Bradsher, R.W. Jr., Pulmonary blastomycosis. Semin. Respir. Crit. Care Med., 29, 174, 2008.
11. McDonough, E.S. and Lewis, A.L., Blastomyces dermatitidis: Production of the sexual stage. Science, 156, 528, 1967.
12. McDonough, E.S. and Lewis, A.L., The ascigerous stage of Blastomyces dermatitidis. Mycologia, 60, 76, 1968.
13. McDonough, E.S. et al., Geographic distribution of “plus” and “minus” isolates of Blastomyces (Ajellomyces) dermatitidis in North America. Am. J. Epidemiol., 98, 63, 1973.
14. McDonough, E.S., Chan, D.M., and McNamara, W.J., Dual infection by “+” and “−” mating types of Ajellomyces (Blastomyces) dermatitidis. Am. J. Epidemiol., 106, 67, 1977.
15. Garrison, R.G., Lane, J.W., and Johnson, D.R., Ultrastructural studies on the cleistothecium of Ajellomyces dermatitidis. Sabouraudia, 11, 131, 1973.
16. Glick, A.D. and Kwon-Chung, K.J., Ultrastructural comparison of coils and ascospores of Emmonsiella capsulata and Ajellomyces dermatitidis. Mycologia, 65, 216, 1973.
17. McGinnis, M.R. and Katz, B., Ajellomyces and its synonym Emmonsiella. Mycotaxon, 8, 157, 1979.
18. Kaufman, L. et al., Detection of two Blastomyces dermatitidis serotypes by exoantigen analysis. J. Clin. Microbiol., 18, 110, 1983.
19. Klein, B.S., Aizenstein, B.D., and Hogan, L.H., African strains of Blastomyces dermatitidis that do not express surface adhesin WI-1. Infect. Immun., 65, 1505, 1997.
20. Axtell, R.C. and Scalarone, G.M., Serological differences in two Blastomyces dermatitidis isolates from different geographical regions of North America. Mycopathologia, 153, 141, 2001.
21. Yates-Siilata, K.E., Sander, D.M., and Keath, E.J., Genetic diversity in clinical isolates of the dimorphic fungus Blastomyces dermatitidis detected by a PCR-based random ampli�ed polymorphic DNA assay. J. Clin. Microbiol., 33, 2171, 1995.
22. McCullough, M.J. et al., Molecular epidemiology of Blastomyces dermatitidis. Clin. Infect. Dis., 30, 328, 2000.
23. Meece, J.K. et al., Genetic diversity in Blastomyces dermatitidis: Implications for PCR detection in clinical and environmental samples. Med. Mycol., 22, 1–7, 2009.
24. Drutz, D.J. and Frey, C.L., Intracellular and extracellular defenses of human phagocytes against Blastomyces dermatitidis conidia and yeasts. J. Lab. Clin. Med., 105, 737, 1985.
25. San-Blas, G. and San-Blas, F., Molecular aspects of fungal dimorphism. Crit. Rev. Microbiol., 11, 101, 1984.
26. Hogan, L.H. and Klein, B.S., Altered expression of surface alpha-1,3-glucan in genetically related strains of Blastomyces dermatitidis that differ in virulence. Infect. Immun., 62, 3543, 1994.
27. Klimpel, K.R. and Goldman, W.E., Cell walls from avirulent variants of Histoplasma capsulatum lack alpha-(1,3)-glucan. Infect. Immun., 56, 2997, 1988.
28. Rappleye, C.A., Engle, J.T., and Goldman, W.E., RNA interference in Histoplasma capsulatum demonstrates a role for alpha-(1,3)-glucan in virulence. Mol. Microbiol., 53, 153, 2004.
29. Reese, A.J. et al., Loss of cell wall alpha(1–3) glucan affects Cryptococcus neoformans from ultrastructure to virulence. Mol. Microbiol., 63, 1385, 2007. 30. Rappleye, C.A., Eissenberg, L.G., and Goldman, W.E., Histoplasma capsulatum alpha-(1,3)-glucan blocks innate immune recognition by the beta-glucan receptor. Proc. Natl. Acad. Sci. U.S.A., 104, 1366, 2007. 31. Rooney, P.J., Sullivan, T.D., and Klein, B.S., Selective expression of the virulence factor BAD-1 upon morphogenesis to the pathogenic yeast form of Blastomyces dermatitidis: Evidence for transcriptional regulation by a conserved mechanism. Mol. Microbiol., 39, 875, 2001. 32. Klein, B.S. and Newman, S.L., Role of cell-surface molecules of Blastomyces dermatitidis in host-pathogen interactions. Trends Microbiol., 4, 246, 1996. 33. Brandhorst, T.T. et al., Targeted gene disruption reveals an adhesin indispensable for pathogenicity of Blastomyces dermatitidis. J. Exp. Med., 189, 1207, 1999. 34. Finkel-Jimenez, B. et al., The WI-1 adhesin blocks phagocyte TNF-alpha production, imparting pathogenicity on Blastomyces dermatitidis. J. Immunol., 166, 2665, 2001. 35. Finkel-Jimenez, B., Wuthrich, M., and Klein, B.S., BAD-1, an essential virulence factor of Blastomyces dermatitidis, suppresses host TNF-alpha production through TGF-betadependent and -independent mechanisms. J. Immunol., 168, 5746, 2002. 36. Rappleye, C.A. and Goldman, W.E., De�ning virulence genes in the dimorphic fungi. Ann. Rev. Microbiol., 60, 281, 2006. 37. Klein, B.S. et al., Altered expression of surface protein WI-1 in genetically related strains of Blastomyces dermatitidis that differ in virulence regulates recognition of yeasts by human macrophages. Infect. Immun., 62, 3536, 1994. 38. Arceneaux, K.A., Taboada, J., and Hosgood, G., Blastomycosis in dogs: 115 cases (1980–1995). J. Am. Vet. Med. Assoc., 213, 658, 1998. 39. Bromel, C. and Sykes, J.E., Epidemiology, diagnosis, and treatment of blastomycosis in dogs and cats. Clin. Tech. Small Anim. Pract., 20, 233, 2005. 40. Blondin, N. et al., Blastomycosis in indoor cats: Suburban Chicago, Illinois, USA. Mycopathologia, 163, 59, 2007. 41. Wilson J.H. et al., Systemic blastomycosis in a horse. J. Vet. Diagn. Invest., 18, 615, 2006. 42. Zwick, L.S. et al., Disseminated blastomycosis in two California sea lions (Zalophus californianus). J. Zoo Wildl. Med., 31, 211, 2000. 43. Furcolow, M.L. et al., Prevalence and incidence studies of human and canine blastomycosis. II. Yearly incidence studies in three selected states, 1960–1967. Am. J. Epidemiol., 92, 121, 1970. 44. Storms, T.N. et al., Blastomycosis in nondomestic felids. J. Zoo Wildl. Med., 34, 231, 2003. 45. Denton, J.F. et al., Isolation of Blastomyces dermatitidis from soil. Science, 133, 1126, 1961. 46. Klein, B.S., Vergeront, J.M., and Davis, J.P., Epidemiologic aspects of blastomycosis, the enigmatic systemic mycosis. Semin. Respir. Infect., 1, 29, 1986. 47. Chick, E.W. et al., Scienti�c Assembly statement. The use of skin tests and serologic tests in histoplasmosis, coccidioidomycosis, and blastomycosis, 1973. Am. Rev. Respir. Dis., 108, 156, 1973. 48. Klein, B.S. et al., Isolation of Blastomyces dermatitidis in soil associated with a large outbreak of blastomycosis in Wisconsin. N. Engl. J. Med., 314, 529, 1986. 49. Morris, S.K. et al., Blastomycosis in Ontario, 1994–2003. Emerg. Infect. Dis., 12, 274, 2006. 50. Blastomycosis—Wisconsin, 1986–1995. MMWR, 45, 601, 1996.
51. Hannah, E.L. et al., Public health response to 2 clinical cases of blastomycosis in Colorado residents. Clin. Infect. Dis., 32, E151, 2001. 52. Veligandla, S.R. et al., Delayed diagnosis of osseous blastomycosis in two patients following environmental exposure in nonendemic areas. Am. J. Clin. Pathol., 118, 536, 2002.
53. Klein, B.S. et al., Two outbreaks of blastomycosis along rivers in Wisconsin. Isolation of Blastomyces dermatitidis from riverbank soil and evidence of its transmission along waterways. Am. Rev. Respir. Dis., 136, 1333, 1987.
54. Cockerill, F.R. 3rd et al., Epidemic of pulmonary blastomycosis (Namekagon fever) in Wisconsin canoeists. Chest, 86, 688, 1984.
55. Baumgardner, D.J. et al., An outbreak of blastomycosis on a United States Indian reservation. Wilderness Environ. Med., 13, 250, 2002.
56. Baumgardner, D.J. et al., Geographic information system analysis of blastomycosis in northern Wisconsin, USA: Waterways and soil. Med. Mycol., 43, 117, 2005.
57. Baumgardner, D.J. and Laundre, B., Studies on the molecular ecology of Blastomyces dermatitidis. Mycopathologia, 152, 51, 2001.
58. Baumgardner, D.J., Microecology of Blastomyces dermatitidis: The ammonia hypothesis. Med. Mycol., 47, 745, 2009.
59. Kauffman, C.A., Endemic mycoses: Blastomycosis, histoplasmosis, and sporotrichosis. Infect. Dis. Clin. North Am., 20, 645, 2006.
60. Benenson, A.S. (ed.), Control of Communicable Diseases Manual. American Public Health Association, Washington, DC, 1995.
61. Wallace, J., Pulmonary blastomycosis: A great masquerader. Chest, 121, 677, 2002.
62. Areno, J.P., Campbell, G.D. Jr., and George, R.B., Diagnosis of blastomycosis. Semin. Respir. Infect., 12, 252, 1997.
63. Tosh, F.E. et al., A common source epidemic of North American blastomycosis. Am. Rev. Respir. Dis., 109, 525, 1974. 64. Recht, L.D. et al., Self-limited blastomycosis: A report of thirteen cases. Am. Rev. Respir. Dis., 120, 1109, 1979.
65. Kwon-Chung, J. and Bennett, J.E., Medical Mycology. Lea and Febiger, Melvern, PA, 1994.
66. Bradsher, R.W., Histoplasmosis and blastomycosis. Clin. Infect. Dis., 22 (Suppl 2), S102, 1996.
67. Lemos, L.B., Guo, M., and Baliga, M., Blastomycosis: Organ involvement and etiologic diagnosis. A review of 123 patients from Mississippi. Ann. Diagn. Pathol., 4, 391, 2000.
68. Bariola, J.R. et al., Blastomycosis of the central nervous system: A multicenter review of diagnosis and treatment in the modern era. Clin. Infect. Dis., 50, 797, 2010.
69. Sung, V.W., Blastomycosis. Headache, 49, 461, 2009.
70. Mahiquez, M. et al., Nonsurgical treatment of lumbosacral blastomycosis involving L2-S1: A case report. Spine, 33, E442, 2008.
71. Monsanto, E.H., Johnston, A.D., and Dick, H.M., Isolated blastomycotic osteomyelitis: A case simulating a malignant tumor of the distal radius. J. Hand. Surg. Am., 11, 896, 1986.
72. Neal, P.M. and Nikolai, A., Systemic blastomycosis diagnosed by prostate needle biopsy. Clin. Med. Res., 6, 24, 2008.
73. Graham, W.R. Jr. and Callaway, J.L., Primary inoculation blastomycosis in a veterinarian. J. Am. Acad. Dermatol., 7, 785, 1982.
74. Sewell, D.L., Laboratory-associated infections and biosafety. Clin. Microbiol. Rev., 8, 389, 1995. 75. Gnann, J.W. Jr. et al., Human blastomycosis after a dog bite. Ann. Intern. Med., 98, 48, 1983. 76. Silveira, F.P. and Husain, S., Fungal infections in solid organ transplantation. Med. Mycol., 45, 305, 2007. 77. Serody, J.S. et al., Blastomycosis in transplant recipients: Report of a case and review. Clin. Infect. Dis., 16, 54, 1993. 78. Marques, S.A. et al., Mycoses associated with AIDS in the Third World. Med. Mycol., 38(Suppl 1), 269, 2000. 79. Pappas, P.G., Blastomycosis in the immunocompromised patient. Semin. Respir. Infect., 12, 243, 1997. 80. Chapman, S.W. et al., Clinical practice guidelines for the management of blastomycosis: 2008 update by the Infectious Diseases Society of America. Clin. Infect. Dis., 46, 1801, 2008. 81. Freifeld, A. et al., Voriconazole use for endemic fungal infections. Antimicrob. Agents Chemother., 53, 1648, 2009. 82. Gonzalez, G.M., In vitro activities of isavuconazole against opportunistic �lamentous and dimorphic fungi. Med. Mycol., 47, 71, 2009. 83. Musial, C.E. et al., Recovery of Blastomyces dermatitidis from blood of a patient with disseminated blastomycosis. J. Clin. Microbiol., 25, 1421, 1987. 84. Seo, R., Oyasu, R., and Schaeffer, A., Blastomycosis of the epididymis and prostate. Urology, 50, 980, 1997. 85. Chosewood, L.C. and Wilson, D.E. (eds.), Biosafety in Microbiological and Biomedical Laboratories. US Government Printing Of�ce, Washington, DC, 2007. 86. Green, J.H. et al., Isolation of an antigen from Blastomyces dermatitidis that is speci�c for the diagnosis of blastomycosis. Curr. Mcrobiol., 4, 293, 1980. 87. Kaufman, L., Kovacs, J.A., and Reiss, E., Clinical immunomycology. In: Manual of Clinical Laboratory Immunology, Rose N.R. et al. (eds.). ASM Press, Washington, DC, p. 585, 1997. 88. Lambert, R.S. and George, R.B., Evaluation of enzyme immunoassay as a rapid screening test for histoplasmosis and blastomycosis. Am. Rev. Respir. Dis., 136, 316, 1987. 89. Turner, S. and Kaufman, L., Immunodiagnosis of blastomycosis. Semin. Respir. Infect., 1, 22, 1986. 90. Turner, S., Kaufman, L., and Jalbert, M., Diagnostic assessment of an enzyme-linked immunosorbent assay for human and canine blastomycosis. J. Clin. Microbiol., 23, 294, 1986. 91. Sekhon, A.S. et al., The value of the Premier enzyme immunoassay for diagnosing Blastomyces dermatitidis infections. J. Med. Vet. Mycol., 33, 123, 1995. 92. Klein, B.S. and Jones, J.M., Isolation, puri�cation, and radiolabeling of a novel 120-kD surface protein on Blastomyces dermatitidis yeasts to detect antibody in infected patients. J. Clin. Invest., 85, 152, 1990. 93. Klein, B.S. and Jones, J.M., Puri�cation and characterization of the major antigen WI-1 from Blastomyces dermatitidis yeasts and immunological comparison with A antigen. Infect. Immun., 62, 3890, 1994. 94. Klein, B.S. et al., Serological tests for blastomycosis: Assessments during a large point-source outbreak in Wisconsin. J. Infect. Dis., 155, 262, 1987. 95. Hurst, S.F. and Kaufman, L., Western immunoblot analysis and serologic characterization of Blastomyces dermatitidis yeast form extracellular antigens. J. Clin. Microbiol., 30, 3043, 1992. 96. Durkin, M. et al., Antigen assay with the potential to aid in diagnosis of blastomycosis. J. Clin. Microbiol., 42, 4873, 2004.
97. Hage, C.A. et al., Diagnosis of pulmonary histoplasmosis and blastomycosis by detection of antigen in bronchoalveolar lavage ¼uid using an improved second-generation enzymelinked immunoassay. Respir. Med., 101, 43, 2007.
98. Tarr, M. et al., Blastomyces antigen detection for monitoring progression of blastomycosis in a pregnant adolescent. Infect. Dis. Obstet. Gynecol., 2007, 89059, 2007.
99. Mongkolrattanothai, K. et al., Urine antigen detection of blastomycosis in pediatric patients. Pediatr. Infect. Dis. J., 25, 1076, 2006.
100. Spector, D. et al., Antigen and antibody testing for the diagnosis of blastomycosis in dogs. J. Vet. Intern. Med., 22, 839, 2008.
101. Kelley, W.H., A study of the cell and colony variations of Blastomyces dermititidis, J. Infect. Med., 64, 293, 1939.
102. Weeks, R.J., A rapid, simpli�ed medium for converting the mycelial phase of Blastomyces dermatitidis to the yeast phase. Mycopathol. Mycol. Appl., 22, 153, 1964.
103. Chandler, F.W. and Watts, J.C., Pathologic Diagnosis of Fungal Infections. ASCP Press, Chicago, IL, 1987.
104. Padhye, A.A. et al., Comparative evaluation of chemiluminescent DNA probe assays and exoantigen tests for rapid identi�cation of Blastomyces dermatitidis and Coccidioides immitis. J. Clin. Microbiol., 32, 867, 1994.
105. Stockman, L. et al., Evaluation of commercially available acridinium ester-labeled chemiluminescent DNA probes for culture identi�cation of Blastomyces dermatitidis, Coccidioides immitis, Cryptococcus neoformans, and Histoplasma capsulatum. J. Clin. Microbiol., 31, 845, 1993.
106. Iwen, P.C. et al., Pulmonary infection caused by Gymnascella hyalinospora in a patient with acute myelogenous leukemia. J. Clin. Microbiol., 38, 375, 2000.
107. Scalarone, G.M. et al., Evaluation of a commercial DNA probe assay for the identi�cation of clinical isolates of Blastomyces dermatitidis from dogs. J. Med. Vet. Mycol., 30, 43, 1992.
108. Woods, C.R. Jr. et al., Analysis of relationships among isolates of Citrobacter diversus by using DNA �ngerprints generated by repetitive sequence-based primers in the polymerase chain reaction. J. Clin. Microbiol., 30, 2921, 1992.
109. Redkar, R.J. et al., DNA �ngerprinting of Candida rugosa via repetitive sequence-based PCR. J. Clin. Microbiol., 34, 1677, 1996.
110. Pounder, J.I., Hansen, D., and Woods, G.L., Identi�cation of Histoplasma capsulatum, Blastomyces dermatitidis, and Coccidioides species by repetitive-sequence-based PCR. J. Clin. Microbiol., 44, 2977, 2006.
111. Wengenack, N.L. and Binnicker, M.J., Fungal molecular diagnostics. Clin. Chest Med., 30, 391, 2009.
112. Lau, A. et al., Current status and future perspectives on molecular and serological methods in diagnostic mycology. Future Microbiol., 4, 1185, 2009.
113. Sandhu, G.S. et al., Molecular probes for diagnosis of fungal infections. J. Clin. Microbiol., 33, 2913, 1995.
114. Lindsley, M.D. et al., Rapid identi�cation of dimorphic and yeast-like fungal pathogens using speci�c DNA probes. J. Clin. Microbiol., 39, 3505, 2001.
115. Hayden, R.T. et al., In situ hybridization for the identi�cation of yeastlike organisms in tissue section. Diagn. Mol. Pathol., 10, 15, 2001.
116. Bialek, R. et al., Nested PCR assays for detection of Blastomyces dermatitidis DNA in paraf�n-embedded canine tissue. J. Clin. Microbiol., 41, 205, 2003. 117. Burgess, J.W., Schwan, W.R., and Volk, T.J., PCR-based detection of DNA from the human pathogen Blastomyces dermatitidis from natural soil samples. Med. Mycol., 44, 741, 2006. 118. Karakousis, A. et al., An assessment of the ef�ciency of fungal DNA extraction methods for maximizing the detection of medically important fungi using PCR. J. Microbiol. Methods, 65, 38, 2006. 119. Rogers, S.O. and Bendich, A.J., Extraction of DNA from milligram amounts of fresh, herbarium and mummi�ed plant tissues. Plant Mol. Biol., 5, 69, 1985. 120. Li, R. et al., A reliable and inexpensive method of nucleic acid extraction for the PCR-based detection of diverse plant pathogens. J. Virol. Methods, 154, 48, 2008. 121. Saad, D.S. et al., Extraction of genomic DNA from �lamentous fungi in bio�lms of water-based paint coatings. Int. Biodete. Biodegrad., 54, 99, 2004. 122. Paterson, P.J. et al., Development of molecular methods for the identi�cation of aspergillus and emerging moulds in paraf�n wax embedded tissue sections. Mol. Pathol., 56, 368, 2003. 123. Gardes, M. and Bruns, T.D., ITS primers with enhanced speci�city for basidiomycetes—Application to the identi�cation of mycorrhizae and rusts. Mol. Ecol., 2, 113, 1993. 124. Allen, G.C. et al., A modi�ed protocol for rapid DNA isolation from plant tissues using cetyltrimethylammonium bromide. Nat. Protoc., 1, 2320, 2006. 125. Murray, M.G. and Thompson, W.F., Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res, 8, 4321, 1980. 126. Zhou, J., Bruns, M.A., and Tiedje, J.M., DNA recovery from soils of diverse composition. Appl. Environ. Microbiol., 62, 316, 1996. 127. Park, D., Genomic DNA isolation from different biological materials. Methods Mol. Biol., 353, 3, 2007. 128. Brandfass, C. and Karlovsky, P., Upscaled CTAB-based DNA extraction and real-time PCR assays for Fusarium culmorum and F. graminearum DNA in plant material with reduced sampling error. Int. J. Mol. Sci., 9, 2306, 2008. 129. Clarke, J.D., Cetyltrimethyl ammonium bromide (CTAB) DNA miniprep for plant DNA isolation. CSH Protoc, 2009, pdb prot5177, 2009. 130. Filion, M., St-Arnaud, M., and Jabaji-Hare, S.H., Direct quanti�cation of fungal DNA from soil substrate using real-time PCR. J. Microbiol. Methods, 53, 67, 2003. 131. Interpretive criteria for identi�cation of bacteria and fungi by DNA target sequencing: Approved guideline. Document MM18-A. Clinical and Laboratory Standards Institute, Wayne, PA, 2008. 132. Larena, I. et al., Design of a primer for ribosomal DNA internal transcribed spacer with enhanced speci�city for ascomycetes. J. Biotechnol., 75, 187, 1999. 133. Bertini, L. et al., A new pair of primers designed for ampli�cation of the ITS region in Tuber species. FEMS Microbiol. Lett., 173, 239, 1999. 134. Greer, C.E. et al., PCR ampli�cation from paraf�n-embedded tissues. Effects of �xative and �xation time. Am. J. Clin. Pathol., 95, 117, 1991. 135. Sanger, F., Nicklen, S., and Coulson, A.R., DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. U.S.A., 74, 5463, 1977. 136. Olsson. M. et al., A rapid and simple nested PCR assay for the detection of Pneumocystis carinii in sputum samples. Scand. J. Infect. Dis., 28, 597, 1996.
137. Bell, J., A simple way to treat PCR products prior to sequencing using ExoSAP-IT. Biotechniques, 44, 834, 2008.
138. Edwards, L.B., et al., An atlas of sensitivity to tuberculin, PPD-B, and histoplasmin in the United States. Am. Rev. Respir. Dis., 99, S132, 1969.
139. Furcolow, M.L., Tests of immunity in histoplasmosis. N. Engl. J. Med., 268, 357, 1963. 140. Emmett, J., Coccidioidin sensitivity among school children in Phoenix (skin test and x-ray survey). Am. J. Public Health Nations Health, 42, 241, 1952. 141. White, T.J. et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols. A Guide to Methods and Applications, Innis, M.A., Gelfand, D.H., Sninsky, J.J., and White, T.J. (eds.). Academic Press, San Diego, CA, p. 315, 1990. 25 Chapter 25 - Chrysosporium
16. Levy FE et al., Invasive Chrysosporium infection of the nose and paranasal sinuses in an immunocompromised host. Otolaryngol Head Neck Surg. 1991;104(3):384–388.
17. Warwick A et al., Presumptive invasive Chrysosporium infection in a bone marrow transplant recipient. Bone Marrow Transplant. 1991;8(4):319–322.
18. Peterson SW, Sigler L. Molecular genetic variation in Emmonsia crescens and Emmonsia parva, etiologic agents of adiaspiromycosis, and their phylogenetic relationship to Blastomyces dermatitidis (Ajellomyces dermatitidis) and other systemic fungal pathogens. J Clin Microbiol. 1998;36(10):2918–2925. 19. Pounder JI et al., Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J Clin Microbiol. 2007;45(2):568–571. 20. De Baere T et al., Evaluation of internal transcribed spacer 2-RFLP analysis for the identi�cation of dermatophytes. J Med Microbiol. 2010;59:48–54. 26 Chapter 26 - Cladophialophora
12. Mehta, B. et al., Aspergillus nidulans. A rare etiological agent of eumycetoma. Int. J. Infect. Dis., 12, e282, 2008.
13. Zoutman, D.E. and Sigler, L., Mycetoma of the foot caused by Cylindrocarpon destructans. J. Clin. Microbiol., 29, 1855, 1991.
14. Bonifaz, A. et al., Eumycetomas caused by Cladophialophora bantiana successfully treated with itraconazole. Med. Mycol., 47, 111, 2009.
15. Lee, M.W. et al., Spores and mycelia in cutaneous chromomycosis. J. Am. Acad. Dermatol., 39, 850, 1998.
16. Gams, W. et al., CBS Course of Mycology, 4th edn. Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands, 1998.
17. Oberto-Perdigon, L. et al., An ELISA test for the study of the therapeutic evolution of chromoblastomycosis by Cladophialophora carrionii in the endemic area of Falcon State, Venezuela. Rev. Iberoam. Micol., 22, 39, 2005.
18. Esterre, P. et al., Humoral immune response in chromoblastomycosis during and after therapy. Clin. Diagn. Lab. Immunol., 7, 497, 2000.
19. Vidal, M.S. et al., Immunoprecipitation techniques and ELISA in the detection of anti-Fonsecaea pedrosoi antibodies in chromoblastomycosis. Rev. Inst. Med. Trop. Sao Paulo, 45, 315, 2003.
20. Vidal, M.S. et al., Highly speci�c and sensitive, immunoblot-detected 54 kDa antigen from Fonsecaea pedrosoi. Med. Mycol., 42, 511, 2004.
21. Correa, G.P. et al., The cell-mediated immune reaction in the cutaneous lesion of chromoblastomycosis and their correlation with different clinical form the disease. Mycopathologia, 156, 51, 2002.
22. López-Martínez, R. and Méndez-Tovar, L.J., Chromoblastomycosis. Clin. Dermatol., 25, 188, 2007.
23. Caligiorne, R.B. et al., Dematiaceous fungal pathogens: Analysis of ribosomal DNA gene polymorphism by polymerase chain reaction–restriction fragment length polymorphism. Mycoses, 42, 609, 1999.
24. Masclaux, F. et al., Phylogenetic relationships of humanpathogenic Cladosporium (Xylohypha) species inferred from partial LS rRNA sequences. J. Med. Vet. Mycol., 33, 327, 1995.
25. De Hoog, G.S. et al., Molecular analysis and pathogenicity of the Cladophialophora carrionii complex, with the description of a novel species. Stud. Mycol., 58, 219, 2007. 26. Abliz, P. et al., Speci�c oligonucleotide primers for identi�cation of Cladophialophora carrionii, a causative agent of chromoblastomycosis. J. Clin. Microbiol., 42, 404, 2004. 27. Abliz, P. et al., Identi�cation of pathogenic dematiaceous fungi and related taxa based on large subunit ribosomal DNA D1/D2 domain sequence analysis. FEMS Immunol. Med. Microbiol., 40, 41, 2004. 28. Makimura, K., Murayama, S.Y., and Yamaguchi, H., Detection of a wide range of medically important fungi by the polymerase chain reaction. J. Med. Microbiol., 40, 358, 1994. 29. Lau, A. et al., Development and clinical application of a panfungal PCR assay to detect and identify fungal DNA in tissue specimens. J. Clin. Microbiol., 45, 380, 2007. 30. Cenis, J.L., Rapid extraction of fungal DNA for PCR ampli�cation. Nucleic Acids Res., 20, 2380, 1992. 31. Edwards, K., Johnstone, C., and Thompson, C., A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids Res., 19, 1349, 1991. 32. Maarou�, Y., Comparison of different methods of isolation of DNA of commonly encountered Candida species and its quantitation by using a real-time PCR-based assay. J. Clin. Microbiol., 42, 3159, 2004. 33. Fredricks, D.N., Smith, C., and Meier, A., Comparison of six DNA extraction methods for recovery of fungal DNA as assessed by quantitative PCR. J. Clin. Microbiol., 43, 5122, 2005. 34. Borman, A.M. et al., Ultra-rapid preparation of total genomic DNA from isolates of yeast and mould using Whatman FTA �lter paper technology—A reusable DNA archiving system. Med. Mycol., 44, 389, 2006. 35. Borman, A.M. et al., Molecular identi�cation of pathogenic fungi. J. Antimicrob. Chemother., 61 (Suppl. 1), 7, 2008. 36. Nuchprayoon, S. et al., Flinders Technology Associates (FTA) �lter paper-based DNA extraction with polymerase chain reaction (PCR) for detection of Pneumocystis jirovecii from respiratory specimens of immunocompromised patients. J. Clin. Lab. Anal., 21, 382, 2007. 37. Atkins, S.D. and Clark, I.M., Fungal molecular diagnostics: A mini review. J. Appl. Genet., 45, 3, 2004. 38. Moreira, M., Ef�cient removal of PCR inhibitors using agarose-embedded DNA preparations. Nucleic Acids Res., 26, 3309, 1998.
27 Chapter 27 - Coccidioides
17. Negroni, R., Historical evolution of some clinical and epidemiological knowledge of coccidioidomycosis in the Americas, Rev. Argent. Microbiol., 40, 246, 2008.
18. Baird, R.W. et al., A ¼uffy white traveller: Imported Coccidiodes immitis infection in an Australian tourist, Pathology, 31, 47, 1999.
19. Osaki, T. et al., Pulmonary coccidioidomycosis that formed a fungus ball with 8-years duration, Intern. Med., 44, 141, 2005.
20. Verghese, S. et al., Coccidioidomycosis in India: Report of a second imported case, Med. Mycol., 40, 307, 2002.
21. Chandesris, M.O. et al., Coccidioidomycosis: An imported invasive fungal disease in France, Med. Mal. Infect., 38, 336, 2008.
22. Galgiani, J.N. et al., Coccidioidomycosis, Clin. Infect. Dis., 41, 1217–1223, 2005.
23. Laniado-Laborin, R., Expanding understanding of epidemiology of coccidioidomycosis in the Western hemisphere, Ann. N.Y. Acad. Sci., 1111, 19, 2007.
24. McCurdy, S., Agricultural respiratory infections, Am. J. Respir. Crit. Care Med., 158, S46, 1998.
25. Bissell, S.R. and Weiss, E.C., Increase in Coccidioidomycosis—California, 2000–2007, MMWR Morb. Mortal. Wkly. Rep., 58, 105, 2009.
26. Schneider, E. et al., A coccidioidomycosis outbreak following the Northridge, Calif, earthquake, JAMA, 277, 904, 1997.
27. Pappagianis, D. and Einstein, H., Tempest from Tehachapi takes toll or Coccidioides conveyed aloft and afar, West. J. Med., 129, 527, 1978.
28. Cordeiro, R.A. et al., Twelve years of coccidioidomycosis in Ceará State, Northeast Brazil: Epidemiologic and diagnostic aspects, Diagn. Microbiol. Infect. Dis., 66, 65, 2010.
29. Cordeiro, R.A. et al., Serologic detection of coccidioidomycosis antibodies in northeast Brazil, Mycopathologia, 167, 187, 2009.
30. Chiller, T.M., Galgiani, J.N., and Stevens, D.A., Coccidioidomycosis, Infect. Dis. Clin. North Am., 17, 41, 2003.
31. Crum, N.F. et al., Coccidioidomycosis: A descriptive survey of a reemerging disease. Clinical characteristics and current controversies, Medicine (Baltimore), 83, 149, 2004.
32. Louie, L. et al., In¼uence of host genetics on the severity of coccidioidomycosis, Emerg. Infect. Dis., 5, 672, 1999.
33. Logan, J.L., Blair, J.E., and Galgiani, J.N., Coccidioidomycosis complicating solid organ transplantation, Semin. Respir. Infect., 16, 251, 2001.
34. Diógenes, M.J.N. et al., Inquérito epidemiológico com esferulina em Jaguaribara-CE, Brasil, 1993. An. Bras. Dermatol., 70, 525, 1995.
35. Shubitz, L.F., Comparative aspects of coccidioidomycosis in animals and humans, Ann. N.Y. Acad. Sci., 1111, 395, 2007.
36. Timm, K.I., Sonn, R.J., and Hultgren, B.D., Coccidioidomycosis in a Sonoran gopher snake, Pituophis melanoleucus af¡nis, J. Med. Vet. Mycol., 26, 101, 1988.
37. Blair, J.E., Coccidioidomycosis in patients who have undergone transplantation, Ann. N.Y. Acad. Sci., 1111, 365, 2007.
38. Charlton, V., Ramsdell, K., and Sehring, S., Intrauterine transmission of coccidioidomycosis, Pediatr. Infect. Dis. J., 18, 561, 1999.
39. Arnold, C.A. et al., Unsuspected, disseminated coccidioidomycosis without maternofetal morbidity diagnosed by placental examination: Case report and review of the literature, Clin. Infect. Dis., 46, e119, 2008. 40. Kohn, G.J. et al., Acquisition of coccidioidomycosis at necropsy by inhalation of coccidioidal endospores, Diagn. Microbiol. Infect. Dis., 15, 527, 1992. 41. Gaidici, A. and Saubolle, M.A., Transmission of coccidioidomycosis to a human via a cat bite, J. Clin. Microbiol., 47, 505, 2009. 42. Drutz, D.J. and Huppert, M., Coccidioidomycosis: Factors affecting the host-parasite interaction, J. Infect. Dis., 147, 372, 1983. 43. Hung, C.Y., Xue, J., and Cole, G.T., Virulence mechanisms of coccidioides, Ann. N.Y. Acad. Sci., 1111, 225, 2007. 44. Cutler, J.E. et al., Advances in combating fungal diseases: Vaccines on the threshold, Nat. Rev. Microbiol., 5, 13, 2007. 45. Ampel, N.M., The complex immunology of human coccidioidomycosis, Ann. N.Y. Acad. Sci., 1111, 245, 2007. 46. Yuan, L. and Cole, G.T., Isolation and characterization of an extracellular proteinase of Coccidioides immitis, Infect. Immun., 55, 1970, 1987. 47. Nosanchuk, J.D. et al., Coccidioides posadasii produces melanin in vitro and during infection, Fungal Genet. Biol., 44, 517, 2007. 48. Hung, C.Y., A metalloproteinase of Coccidioides posadasii contributes to evasion of host detection, Infect. Immun., 73, 6689, 2005. 49. Guevara-Olvera, L. et al., Sequence, expression and functional analysis of the Coccidioides immitis ODC (ornithine decarboxylase) gene, Gene, 25, 242, 2000. 50. Schneider, E. et al., A coccidioidomycosis outbreak following the Northridge, Calif, earthquake, JAMA, 19, 277, 1997. 51. Cairns, L., Outbreak of coccidioidomycosis in Washington state residents returning from Mexico, Clin. Infect. Dis., 30, 61, 2000. 52. Valdivia, L. et al., Coccidioidomycosis as a common cause of community-acquired pneumonia, Emerg. Infect. Dis., 12, 958, 2006. 53. DiCaudo, D.J., Coccidioidomycosis: A review and update, J. Am. Acad. Dermatol., 55, 929, 2006. 54. de Aguiar Cordeiro, R. et al., In vitro inhibitory effect of antituberculosis drugs on clinical and environmental strains of Coccidioides posadasii, J. Antimicrob. Chemother., 58, 575, 2006. 55. Blair, J.E., Coccidioidal meningitis: Update on epidemiology, clinical features, diagnosis, and management, Curr. Infect. Dis. Rep., 11, 289, 2009. 56. Arsura, E.L., Bobba, R.K., and Reddy, C.M., Coccidioidal pericarditis: A case presentation and review of the literature, Int. J. Infect. Dis., 9, 104, 2005. 57. Brilhante, R.S. et al., Coccidioidal pericarditis: A rapid presumptive diagnosis by an in-house antigen con�rmed by mycological and molecular methods, J. Med. Microbiol., 57, 1288, 2008. 58. DiCaudo, D.J. et al., Sweet syndrome (acute febrile neutrophilic dermatosis) associated with pulmonary coccidioidomycosis, Arch. Dermatol., 141, 881, 2005. 59. Parish, J.M. and Blair, J.E., Coccidioidomycosis, Mayo Clin. Proc., 83, 343, 2008. 60. Galgiani, J.N., Practice guideline for the treatment of coccidioidomycosis. Infectious Diseases Society of America, Clin. Infect. Dis., 30, 658, 2000. 61. Cortez, K.J., Walsh, T.J., and Bennett, J.E., Successful treatment of coccidioidal meningitis with voriconazole, Clin. Infect. Dis., 36, 1619, 2003. 62. Anstead, G.M., Refractory coccidioidomycosis treated with posaconazole, Clin. Infect. Dis., 40, 1770, 2005.
63. Catanzaro, A. et al., Safety, tolerance, and ef�cacy of posaconazole therapy in patients with nonmeningeal disseminated or chronic pulmonary coccidioidomycosis, Clin. Infect. Dis., 45, 562, 2007.
64. Antony, S., Use of the echinocandins (caspofungin) in the treatment of disseminated coccidioidomycosis in a renal transplant recipient, Clin. Infect. Dis., 39, 879, 2004.
65. Hsue, G., Treatment of meningeal coccidioidomycosis with caspofungin, J. Antimicrob. Chemother., 54, 292, 2004.
66. González, G.M. et al., Therapeutic ef�cacy of caspofungin alone and in combination with amphotericin B deoxycholate for coccidioidomycosis in a mouse model, J. Antimicrob. Chemother., 60, 1341, 2007.
67. Blair, J.E., Douglas, D.D., and Mulligan, D.C., Early results of targeted prophylaxis for coccidioidomycosis in patients undergoing orthotopic liver transplantation within an endemic area, Transpl. Infect. Dis., 5, 3, 2003.
68. Sutton, D.A., Diagnosis of coccidioidomycosis by culture: Safety considerations, traditional methods, and susceptibility testing, Ann. N.Y. Acad. Sci., 1111, 315, 2007.
69. Cordeiro, R.A. et al., In vitro activities of caspofungin, amphotericin B and azoles against Coccidioides posadasii strains from Northeast, Brazil, Mycopathologia, 161, 21, 2006.
70. Ramani, R. and Chaturvedi, V., Antifungal susceptibility pro�les of Coccidioides immitis and Coccidioides posadasii from endemic and non-endemic areas, Mycopathologia, 163, 315, 2007.
71. Kriesel, J.D. et al., Persistent pulmonary infection with an azole-resistant Coccidioides species, Med. Mycol., 46, 607, 2008.
72. Saubolle, M.A., Laboratory aspects in the diagnosis of coccidioidomycosis, Ann. N.Y. Acad. Sci., 1111, 301, 2007.
73. Cordeiro, R.A. et al., In vitro synergistic effects of antituberculous drugs plus antifungals against Coccidioides posadasii, Int. J. Antimicrob. Agents, 34, 278, 2009.
74. Kaufman, L., Valero, G., and Padhye, A.A., Misleading manifestations of Coccidioides immitis in vivo, J. Clin. Microbiol., 36, 3721, 1998.
75. DiTomasso, J.P. et al., Bronchoscopic diagnosis of pulmonary coccidioidomycosis. Comparison of cytology, culture, and transbronchial biopsy, Diagn. Microbiol. Infect. Dis., 18, 83, 1994.
76. Muñoz, B. et al., Parasitic mycelial forms of Coccidioides species in Mexican patients, J. Clin. Microbiol., 42, 1247, 2004.
77. Ampel, N.M. et al., An archived lot of coccidioidin induces speci�c coccidioidal delayed-type hypersensitivity and correlates with in vitro assays of coccidioidal cellular immune response, Mycopathologia, 161, 67, 2006.
78. Papagianis, D., Serologic studies in coccidioidomycosis, Semin. Respir. Infect., 16, 242, 2001. 79. Blair, J.E. et al., Serologic testing for symptomatic coccidioidomycosis in immunocompetent and immunosuppressed hosts, Mycopathologia, 162, 317, 2006. 80. Murthy, M.H. and Blair, J.E., Coccidioidomycosis, Curr. Fungal Infect. Rep., 3, 7, 2009. 81. Pappagianis, D. and Zimmer, B.L., Serology of coccidioidomycosis, Clin. Microbiol. Rev., 3, 247, 1990. 82. Durkin, M. et al., Diagnosis of coccidioidomycosis with use of the Coccidioides antigen enzyme immunoassay, Clin. Infect. Dis., 15, 47, 2008. 83. Johnson, S.M., Simmons, K.A., and Pappagianis, D. Ampli�cation of coccidioidal DNA in clinical specimens by PCR, J. Clin. Microbiol., 42, 1982, 2004. 84. de Aguiar, C.R. et al., Rapid diagnosis of coccidioidomycosis by nested PCR assay of sputum, Clin. Microbiol. Infect., 13, 449, 2007. 85. Stockman, L. et al., Evaluation of commercially available acridinium ester-labeled chemiluminescent DNA probes for culture identi�cation of Blastomyces dermatitidis, Coccidioides immitis, Cryptococcus neoformans, and Histoplasma capsulatum, J. Clin. Microbiol., 31, 845, 1993. 86. Gromadzki, S.G. and Chaturvedi, V., Limitation of the AccuProbe Coccidioides immitis culture identi�cation test: False-negative results with formaldehyde-killed cultures, J. Clin. Microbiol., 38, 2427, 2000. 87. Pan, S and Cole, G.T., Molecular and biochemical characterization of a Coccidioides immitis-speci�c antigen, Infect. Immun., 63, 3994, 1995. 88. Binnicker, M.J. et al., Detection of Coccidioides species in clinical specimens by real-time PCR, J. Clin. Microbiol., 45, 173, 2007. 89. Umeyama, T. et al., Novel approach to designing primers for identi�cation and distinction of the human pathogenic fungi Coccidioides immitis and Coccidioides posadasii by PCR ampli�cation, J. Clin. Microbiol., 44, 1859, 2006. 90. Tintelnot, K., Taxonomic and diagnostic markers for identi�cation of Coccidioides immitis and Coccidioides posadasii, Med. Mycol., 45, 385, 2007. 91. Burt, A. et al., A safe method of extracting DNA from Coccidioides immitis, Fungal Genet. Newsl., 42, 23, 1995. 92. Castañón-Olivares, L.R. et al. Molecular identi�cation of Coccidioides isolates from Mexican patients, Ann. N.Y. Acad. Sci., 1111, 326, 2007. 93. Fisher, M.C., White, T.J., and Taylor, J.W., Primers for genotyping single nucleotide polymorphisms and microsatellites in the pathogenic fungus Coccidioides immitis. Mol. Ecol., 8, 1082, 1999. 94. Jewell, K., Cheshier, R., and Cage, G.D., Genetic diversity among clinical Coccidioides spp. isolates in Arizona, Med. Mycol., 46, 449, 2008. 28 Chapter 28 - Cyphellophora
1. The UniProt Consortium. Available at http://www.uniprot. org/, accessed on August 1, 2010.
2. De Vries, G.A., Elders, M.C.C., and Luykx, M.H.F., Description of Cyphellophora pluriseptata sp. nov. Anton Leeuwen. 1986;52:141–143.
3. Walz, A. and de Hoog, G.S., A new species of Cyphellophora. Anton Leeuwen. 1987;53:143–146.
4. Decock, C. et al., A new species and three new combinations in Cyphellophora, with a note on the taxonomic af�nities of the genus, and its relation to Kumbhamaya and Pseudomicrodochium. Anton Leeuwen. 2003;84(3):209–216.
5. Crous, P.W. et al., Opportunistic, human-pathogenic species in the Herpotrichiellaceae are phenotypically similar to saprobic or phytopathogenic species in the Venturiaceae. Stud Mycol. 2007;58:185–217.
6. Crous, P.W. et al., Phylogeny and taxonomy of obscure genera of microfungi. Persoonia. 2009;22:139–161.
7. Cheewangkoon, R. et al., Myrtaceae, a cache of fungal biodiversity. Persoonia. 2009;23:55–85.
8. Kwon-Chung, K.J. and Bennett, J.E., Medical Mycology, Lea & Febiger, Philadelphia, PA, 1992.
9. McGinnis, M.R., Chromoblastomycosis and phaeohyphomycosis: New concepts, diagnosis, and mycology. J Am Acad Dermatol. 1983;8:1–16. 10. Rinaldi, M.G., Phaeohyphomycosis. Dermatol Clin. 1996;14:147–153. 11. Ziefer, A. and Connor, D.H., Phaeohyphomycotic cyst. A clinicopathologic study of twenty-�ve patients. Am J Trop Med Hyg. 1980;29:901–911. 12. O’Donnell, P.J. and Hutt, M.S.R., Subcutaneous phaeohyphomycosis: A histopathological study of nine cases from Malawi. J Clin Pathol. 1985;38:288–292. 13. Ronan, S.G. et al., Primary cutaneous phaeohyphomycosis: Report of seven cases. J Cutan Pathol. 1993;20:223–228. 14. Bittencourt, A.L. et al., Discovering potential pathogens among fungi identi�ed as nonsporulating subcutaneous phaeohyphomycosis caused by Cyphellophora pluriseptata. Eur J Dermatol. 2002;12:103–106. 15. Pounder, J.I. et al., Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J Clin Microbiol. 2007;45:568–571. 16. Bagyalakshmi, R. et al., Newer emerging pathogens of ocular non-sporulating molds (NSM) identi�ed by polymerase chain reaction (PCR)-based DNA sequencing technique targeting internal transcribed spacer (ITS) region. Curr Eye Res. 2008;33:139–147. 29 Chapter 29 - Emmonsia
1. The UniProt Consortium. Available at http://www.uniprot. org/, accessed on August 1, 2010.
2. Untereiner, W.A. et al., The Ajellomycetaceae, a new family of vertebrate-associated Onygenales. Mycologia. 2004; 96:812–821.
3. Sigler, L., Ajellomyces crescens sp. nov., taxonomy of Emmonsia spp., and relatedness with Blastomyces dermatitidis (teleomorph Ajellomyces dermatitidis). J Med Vet Mycol. 1996;34(5):303–314.
4. Peterson, S.W., Sigler, L., Molecular genetic variation in Emmonsia crescens and Emmonsia parva, etiologic agents of adiaspiromycosis, and their phylogenetic relationship to Blastomyces dermatitidis (Ajellomyces dermatitidis) and other systemic fungal pathogens. J Clin Microbiol. 1998;36(10):2918–2925.
5. Krivanec, K., Otcenásek, M., Importance of free living mustelid carnivores in circulation of adiaspiromycosis. Mycopathologia. 1977;60(3):139–144.
6. Drouhet, E., Huerre, M., Yeast tissue phase of Emmonsia pasteuriana inoculated in golden hamster by intratesticular way. Mycoses. 1999;42(Suppl 2):11–18.
7. Hubálek, Z., Emmonsiosis of wild rodents and insectivores in Czechland. J Wildl Dis. 1999;35(2):243–249.
8. Chantrey, J.C. et al., Emmonsia crescens infection in a British water vole (Arvicola terrestris). Med Mycol. 2006;44:375–378.
9. Borman, A.M. et al., Adiaspiromycosis due to Emmonsia crescens is widespread in native British mammals. Mycopathologia. 2009;168(4):153–163.
10. Cueva, J.A., Little MD. Emmonsia crescens infection (adiaspiromycosis) in man in Honduras. Report of a case. Am J Trop Med Hyg. 1971;20(2):282–287.
11. Kodousek, R. et al., Pulmonary adiaspiromycosis in man caused by Emmonsia crescens. Report of a unique case. Am J Clin Pathol. 1971;56:394–399.
12. Kamalam, A., Thambiah, A.S., Adiaspiromycosis of human skin caused by Emmonsia crescens. Sabouraudia. 1979;17(4):377–381.
13. Bambirra, E.A., Nogueira, A.M., Human pulmonary granulomas caused by Chrysosporium parvum var. crescens (Emmonsia crescens). Am J Trop Med Hyg. 1983;32:1184–1185.
14. Barbas Filho, J.V. et al., Respiratory failure caused by adiaspiromycosis. Chest. 1990;97:1171–1175.
15. Watts, J.C., Chandler, F.W., Adiaspiromycosis. An uncommon disease caused by an unusual pathogen. Chest. 1990;97:1030–1031. 16. England, D.M., Hochholzer, L., Adiaspiromycosis: An unusual fungal infection of the lung. Report of 11 cases. Am J Surg Pathol. 1993;17:876–886. 17. Turner, D. et al., Pulmonary adiaspiromycosis in a patient with acquired immunode�ciency syndrome. Eur J Clin Microbiol Infect Dis. 1999;18(12):893–895. 18. dos Santos, V.M. et al., Pulmonary adiaspiromycosis: Report of two cases. Rev Soc Bras Med Trop. 2000;33(5):483–488. 19. Wellinghausen, N. et al., Chronic granulomatous lung infection caused by the dimorphic fungus Emmonsia sp. Int J Med Microbiol. 2003;293(6):441–445. 20. Sun, Y. et al., Fine needle aspiration of pulmonary adiaspiromycosis: A case report. Acta Cytol. 2007;51(2):217–221. 21. Denson, J.L. et al., Adiaspiromycosis mimicking widespread malignancy in a patient with pulmonary adenocarcinoma. J Clin Pathol. 2009;62(9):837–839. 22. de Almeida Barbosa, A. et al., Acute pulmonary adiaspiromycosis. Report of three cases and a review of 16 other cases collected from the literature. Rev Iberoam Micol. 1997;14(4):177–180. 23. Nuorva, K. et al., Pulmonary adiaspiromycosis in a two year old girl. J Clin Pathol. 1997;50:82–85. 24. Dot, J.M. et al., Molecular diagnosis of disseminated adiaspiromycosis due to Emmonsia crescens. J Clin Microbiol. 2009;47(4):1269–1273. 25. Mendes, M.O. et al., Acute conjunctivitis with episcleritis and anterior uveitis linked to adiaspiromycosis and freshwater sponges, Amazon region, Brazil, 2005. Emerg Infect Dis. 2009;15(4):633–639. 26. Barbosa, A.d.A. et al., Acute pulmonary adiaspiromycosis. Report of three cases and a review of 16 other cases collected from the literature. Rev Iberoam Micol. 1997;14:177–180. 27. Peterson, S.W., Kurtzman, C.P., Ribosomal RNA sequence divergence among sibling species of yeasts. Syst Appl Microbiol. 1991;14:124–129. 28. Borman, A.M. et al., An improved protocol for the preparation of total genomic DNA from isolates of yeast and mould using Whatman FTA �lter papers. Mycopathologia. 2010 February 18;169(6):445–449. 29. Peres, L.C. et al., Fulminant disseminated pulmonary adiaspiromycosis in humans. Am J Trop Med Hyg. 1992;46:146–150. 30. Echevarria, E., Cano, E.L., Restrepo, A., Disseminated adiaspiromycosis in a patient with AIDS. J Med Vet Mycol. 1993;31:91–97. 31. Pelegrín, I. et al., Disseminated adiaspiromycosis: A case report of a liver transplant patient with human immunode�ciency infection and literature review. Transpl. Infect. Dis., 2011, Feb 15 [Epub ahead of print]. 30 Chapter 30 - Epidermophyton
1. The UniProt Consortium. Available at http://www.uniprot. org/, accessed on August 1, 2010.
2. Larone, D.H., 1995. Medically Important Fungi—A Guide to Identi¡cation, 3rd edn., ASM Press, Washington, DC.
3. De Hoog, G.S. et al., 2000. Atlas of Clinical Fungi, 2nd edn., vol. 1. Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands.
4. Weitzman, I. and R.C. Summerbell, 1995. The dermatophytes. Clin Microbiol Rev. 8:240–259.
5. Ogawa, H. et al., 1998. Dermatophytes and host defence in cutaneous mycoses. Med Mycol. 36:166–173.
6. Aman, S. et al., 2001. Tinea unguium in Lahore, Pakistan. Med Mycol. 39:177–180.
7. Hay, R.J. et al., 2001. Tinea capitis in Europe: New perspective on an old problem. J Eur Acad Dermatol Venereol. 15:229–233.
8. Aly, R., 1994. Ecology and epidemiology of dermatophyte infections. J Am Acad Dermatol. 31:S21–S25.
9. Andrews, M.D. and M. Burns, 2008. Common tinea infections in children. Am Fam Physician. 77:1415.
10. Jung, S.W. et al., 2009. Epidermophyton fungal keratitis following laser-assisted subepithelial keratectomy. J Cataract Refract Surg. 35(12):2157–2160.
11. Seddon, M.E. and M.G. Thomas, 1997. Invasive disease due to Epidermophyton ¼occosum in an immunocompromised patient with Behçet’s Syndrome. Clin Infect Dis. 25:153–154.
12. Macura, A.B., 1993. In vitro susceptibility of dermatophytes to antifungal drugs: A comparison of two methods. Int J Dermatol. 32:533–536.
13. Degreef, J.H. and P.R.G. DeDoncker, 1994. Current therapy of dermatophytosis. J Am Acad Dermatol. 31:S25–S30.
14. Venugopal, P.V. and T.V. Venugopal, 1994. Disk diffusion susceptibility testing of dermatophytes with allylamines. Int J Dermatol. 33:730–732.
15. Boonk, W. et al., 1998. Itraconazole in the treatment of tinea corporis and tinea cruris: Comparison of two treatment schedules. Mycoses. 41:509–514.
16. Weinberg, J.M. et al., 2003. Comparison of diagnostic methods in the evaluation of onychomycosis. J Am Acad Dermatol. 49(2):193–197. 17. Karimzadegan-Nia, M. et al., 2007. Comparison of direct smear, culture and histology for the diagnosis of onychomycosis. Aust J Dermatol. 48(1):18–21. 18. Uchida, T. et al., 2009. Comparative study of direct polymerase chain reaction, microscopic examination and culturebased morphological methods for detection and identi�cation of dermatophytes in nail and skin samples. J Dermatol. 36(4):202–208. 19. Liu, D. et al., 1997. Molecular determination of dermatophyte fungi using the arbitrarily primed polymerase chain reaction. Br J Dermatol. 137:351–355. 20. Liu, D. et al., 2000 Jun. Application of PCR to the identi�cation of dermatophyte fungi. J Med Microbiol. 49(6):493–497. 21. Mochizuki, T., N. Sugie, and M. Uehara, 1997. Random ampli�cation of polymorphic DNA is useful for the differentiation of several anthropophilic dermatophytes. Mycoses. 40:405–409. 22. Baek, S.C. et al., 1998. Detection and differentiation of causative fungi of onychomycosis using PCR ampli�cation and restriction enzyme analysis. Int J Dermatol. 37(9):682–686. 23. De Hoog, G.S. et al., 1998. Molecular phylogeny and taxonomy of medically important fungi. Med Mycol. 36:52–56. 24. Graser, Y. et al., 1998. Identi�cation of common dermatophytes (Trichophyton, Microsporum Epidermophyton) using polymerase chain reactions. Br J Dermatol. 138:576. 25. Jackson, C.J., R.C. Barton, and E.G.V. Evans, 1999. Species identi�cation and strain differentiation of dermatophyte fungi by analysis of ribosomal-DNA intergenic spacer regions. J Clin Microbiol. 37:931–936. 26. Howell, S.A., R.J. Barnard, and F. Humphreys, 1999. Application of molecular typing methods to dermatophyte species that cause skin and nail infections. J Med Microbiol. 48(1):33–40. 27. Faggi, E. et al., 2001. Application of PCR to distinguish common species of dermatophytes. J Clin Microbiol. 39:3382–3385. 28. Machouart-Dubach, M. et al., 2001. Rapid discrimination among dermatophytes, Scytalidium spp., and other fungi with a PCR-restriction fragment length polymorphism ribotyping method. J Clin Microbiol. 39(2):685–690. 29. Ding, J. et al., 2004. Clinical identi�cation of common species of dermatophytes by PCR and PCR-RFLP. J Huazhong Univ Sci Technol Med Sci. 24(6):642–644. 30. Gutzmer, R. et al., 2004. Rapid identi�cation and differentiation of fungal DNA in dermatological specimens by LightCycler PCR. J Med Microbiol. 53:1207–1214. 31. He, G. et al., 2005. Identi�cation of common species of dermatophytes by PCR-RFLP. J Huazhong Univ Sci Technol Med Sci. 25(4):458–460. 32. Pounder, J.I. et al., 2005. Repetitive-sequence-PCR-based DNA �ngerprinting using the Diversilab system for identi�cation of commonly encountered dermatophytes. J Clin Microbiol. 43:2141–2147. 33. Dobrowolska, A. et al., 2006. PCR–RFLP analysis of the dermatophytes isolated from patients in Central Poland. J Dermatol Sci. 42:71. 34. Monod, M. et al., 2006. Fast and reliable PCR/sequencing/ RFLP assay for identi�cation of fungi in onychomycoses. J Med Microbiol. 55:1211–1216. 35. Arabatzis, M. et al., 2007. Diagnosis of common dermatophyte infections by a novel multiplex real-time polymerase chain reaction detection/identi�cation scheme. Br J Dermatol. 157(4):681–689.
36. Garg, J. et al., 2007. Evaluation of pan-dermatophyte nested PCR in diagnosis of onychomycosis. J Clin Microbiol. 45(10):3443–3445.
37. Garg, J. et al., 2009. Rapid detection of dermatophytes from skin and hair. BMC Res Notes. 2:60.
38. Li, H.C. et al., 2007. Identi�cation of dermatophytes by an oligonucleotide array. J Clin Microbiol. 45(10):3160–3166.
39. Bergmans, A.M. et al., 2008. Validation of PCR-reverse line blot, a method for rapid detection and identi�cation of nine dermatophyte species in nail, skin and hair samples. Clin Microbiol Infect. 14(8):778–788.
40. Bergmans, A.M. et al., 2010. Evaluation of a single-tube real-time PCR for detection and identi�cation of 11 dermatophyte species in clinical material. Clin Microbiol Infect. 16:704.
41. Erhard, M. et al., 2008. Identi�cation of dermatophyte species causing onychomycosis and tinea pedis by MALDI-TOF mass spectrometry. Exp Dermatol. 17:356–361.
42. Shehata, A.S. et al., 2008. Single-step PCR using (GACA)4 primer: Utility for rapid identi�cation of dermatophyte species and strains. J Clin Microbiol. 46(8):2641–2645.
43. Yang, G. et al., 2008. Direct species identi�cation of common pathogenic dermatophyte fungi in clinical specimens by seminested PCR and restriction fragment length polymorphism. Mycopathologia. 166(4):203–208.
44. Beifuss, B. et al., 2011. Direct detection of �ve common dermatophyte species in clinical samples using a rapid and sensitive 24-h PCR-ELISA technique open to protocol transfer. Mycoses. 54:137.
45. Bontems, O., P.M. Hauser, and M. Monod, 2009. Evaluation of a polymerase chain reaction-restriction fragment length polymorphism assay for dermatophyte and nondermatophyte identi�cation in onychomycosis. Br J Dermatol. 161(4):791–796.
46. Kano, R. et al., 1997. Phylogenetic analysis of 8 dermatophyte species using chitin synthase 1 gene sequences. Mycoses. 40(11–12):411–414. 47. Kano, R. et al., 1999. Phylogenetic relation of Epidermophyton ¼occosum to the species of Microsporum and Trichophyton in chitin synthase 1 (CHS1) gene sequences. Mycopathologia. 146(3):111–113. 48. Makimura, K. et al., 1999. Phylogenetic classi�cation and species identi�cation of dermatophyte strains based on DNA sequences of nuclear ribosomal internal transcribed spacer 1 regions. J Clin Microbiol. 37(4):920–924. 49. Hirai, A. et al., 2003. Molecular taxonomy of dermatophytes and related fungi by chitin synthase 1 (CHS1) gene sequences. Anton Leeuwen. 83(1):11–20. 50. Kanbe, T. et al., 2003a. PCR-based identi�cation of common dermatophyte species using primer sets speci�c for the DNA topoisomerase II genes. J Dermatol Sci. 32:151–161. 51. Kanbe, T. et al., 2003b. Species-identi�cation of dermatophytes Trichophyton, Microsporum, Epidermophyton by PCR and PCR–RFLP targeting of the DNA topoisomerase II genes. J Dermatol Sci. 33:41–54. 52. Ninet, B. et al., 2003. Identi�cation of dermatophyte species by 28S ribosomal DNA sequencing with a commercial kit. J Clin Microbiol. 41(2):826–830. 53. Kamiya, A. et al., 2004. PCR and PCR–RFLP techniques targeting the DNA topoisomerase II gene for rapid clinical diagnosis of the etiologic agent of dermatophytosis. J Dermatol Sci. 34:35. 54. Li, H.C. et al., 2008. Identi�cation of dermatophytes by sequence analysis of the rRNA gene internal transcribed spacer regions. J Med Microbiol. 57(Pt 5):592–600. 55. Ebihara, M. et al., 2009. Molecular detection of dermatophytes and nondermatophytes in onychomycosis by nested polymerase chain reaction based on 28S ribosomal RNA gene sequences. Br J Dermatol. 61(5):1038–1044. 56. De Baere, T. et al., 2010. Evaluation of internal transcribed spacer 2-RFLP analysis for the identi�cation of dermatophytes. J Med Microbiol. 59:48–54.
31 Chapter 31 - Exophiala
1. UniProt Consortium. Exophiala http://www.uniprot.org/ 5583, viewed June 27, 2010.
2. Li, D.M. et al. Exophiala asiatica, a new species from a fatal case in China. Med. Mycol., 47, 101, 2009.
3. Untereiner, W.A. Capronia and its anamorphs: Exploring the value of morphological and molecular characters in the systematics of the Herpotrichiellaceae. Stud. Mycol., 45, 141, 2000.
4. Matsuda, M. et al. Deoxyribonucleic acid hybridization studies of Exophiala dermatitidis and Exophiala jeanselmei. Microbiol. Immunol., 33, 631, 1989
5. Kawasaki, M. et al. Mitochondrial DNA analysis of Exophiala jeanselmei var. lecanii-corni and Exophiala castellanii. Mycopathologia, 146, 75, 1999.
6. Zeng, J.S. et al. Exophiala spinifera and its allies: Diagnostics from morphology to DNA barcoding. Med. Mycol., 46, 193, 2008.
7. De Hoog, G.S. et al. Exophiala xenobiotica sp. nov., an opportunistic black yeast inhabiting environments rich in hydrocarbons. Antonie Leeuwenhoek, 90, 257, 2006.
8. De Hoog, G.S. et al. Taxonomy of Exophiala spinifera and its relationship to E. jeanselmei. Stud. Mycol., 43, 133, 1999.
9. De Hoog, G.S. et al. Species diversity and polymorphism in the Exophiala spinifera clade containing opportunistic black yeast-like fungi. J. Clin. Microbiol., 41, 4767, 2003.
10. De Hoog G.S. et al. (eds.). Atlas of Clinical Fungi, 2nd edn. Centraalbureau voor Schimmelcultures/Universitat Rovira i Virgili, Utrecht, the Netherlands, Reus, Spain, p. 51, 2000.
11. Takeo, K. et al. Karyology and hyphal characters as taxonomic criteria in ascomycetous black yeasts and related fungi. Antonie Leeuwenhoek, 60, 35, 1991.
12. Kwon-Chung, K.J. et al. Medical Mycology. Lea & Febiger, Philadelphia, PA, 1992. 13. Matsumoto, T. et al. Critical review of human isolates of Wangiella dermatitidis. Mycologia, 76, 232, 1984.
14. Matsumoto, T. et al. Clinical and mycological spectra of Wangiella dermatitidis infections. Mycoses, 36, 145, 1993.
15. Kawasaki, M. et al. Mitochondrial DNA analysis of Exophiala jeanselmei and Exophiala dermatitidis. Mycopathologia, 110, 107, 1990.
16. McKemy, J.M. et al. Emendation of the genus Wangiella and a new combination, W. heteromorpha. Mycologia, 91, 200, 1999.
17. De Hoog, G.S. et al. Pleoanamorphic life cycle of Exophiala (Wangiella) dermatitidis. Antonie Leeuwenhoek, 65, 143, 1994.
18. De Hoog, G.S. et al. Intestinal prevalence of the neurotropic black yeast Exophiala (Wangiella) dermatitidis in healthy and impaired individuals. Mycoses, 48, 142, 2005.
19. De Hoog, G.S. et al. Nutritional physiology and selective isolation of Exophiala dermatitidis. Antonie Leeuwenhoek, 64, 17, 1993.
20. De Hoog, G.S. et al. Nutritional physiology of type isolates of currently accepted species of Exophiala and Phaeococcomyces. Antonie Leeuwenhoek, 68, 43, 1995.
21. Untereiner, W.A. et al. Nutritional physiology of species of Capronia. Stud. Mycol., 43, 98, 1999.
22. Matos, T. et al. High prevalence of the neurotropic Exophiala dermatitidis and related oligotrophic black yeasts in sauna facilities. Mycoses, 45, 373, 2002.
23. Prenaefeta-Boldu, F.X. et al. Fungi growing on aromatic hydrocarbons: Biotechnology’s unexpected encounter with biohazard? FEMS Microbiol. Rev., 30, 109, 2006. 24. Vicente, V.A. et al. Environmental isolation of black yeastlike fungi involved in human infection. Stud. Mycol., 61, 137, 2008. 25. Zeng, J.S. et al. Spectrum of clinically relevant Exophiala species in the United States. J. Clin. Microbiol., 45, 3713, 2007. 26. Padhye, A.A. et al. Chromoblastomycosis caused by Exophiala spinifera. Clin. Infect. Dis., 22, 331, 1996. 27. Rajendran, C. et al. Phaeohyphomycosis caused by Exophiala spinifera in India. Med. Mycol., 41, 437, 2003. 28. Tomson, N. et al. Chromomycosis caused by Exophiala spinifera. Clin. Exp. Dermatol., 31, 239, 2006. 29. Martínez-González, M.C. et al. Three cases of cutaneous phaeohyphomycosis by Exophiala jeanselmei. Eur. J. Dermatol., 18, 313, 2008. 31. Parente, J.N. et al. Subcutaneous phaeohyphomycosis in immunocompetent patients: Two new cases caused by Exophiala jeanselmei and Cladophialophora carrionii. Mycoses, 2009 Webaddress: http://onlinelibrary.wiley.com/ doi/10.1111/j.1439-0507.2009.01795.x/pdf, Last accessed on June 14, 2010. 32. Hague, J. et al. Subcutaneous phaeohyphomycosis caused by Exophiala jeanselmei in an immunocompromised host. Cutis, 72, 132, 2003. 33. Agger, W.A. et al. Exophiala jeanselmei infection in a heart transplant recipient successfully treated with oral terbina�ne. Clin. Infect. Dis., 38, e112, 2004. 34. De Monbrison, F. et al., Two cases of subcutaneous phaeohyphomycosis due to Exophiala jeanselmei, in cardiac transplant and renal transplant patients. Br. J. Dermatol., 150, 597, 2004. 35. Silva Mdo, R. et al. Subcutaneous phaeohyphomycosis by Exophiala jeanselmei in a cardiac transplant recipient. Rev. Inst. Med. Trop. Sao Paulo, 47, 55, 2005. 36. González-López, M.A. et al. Subcutaneous phaeohyphomycosis caused by Exophiala oligosperma in a renal transplant recipient. Br. J. Dermatol., 156, 762, 2007. 37. Galor, A. et al. Subconjunctival mycetoma after sub-Tenon’s corticosteroid injection. Cornea, 28, 933, 2009. 38. Hohl, P.E. et al. Infections due to Wangiella dermatitidis in humans: Report of the �rst documented case from the United States and a review of the literature. Rev. Infect. Dis., 5, 854, 1983. 39. Naka, W. et al. A case of chromoblastomycosis: With special reference to the mycology of the isolated Exophiala jeanselmei. Mykosen, 29, 445, 1986. 40. Tintelnot, K. et al. Cerebral phaeohyphomycosis caused by an Exophiala species. Mycoses, 34, 239, 1991. 41. Kusenbach, G. et al. Exophiala dermatitidis pneumonia in cystic �brosis. Eur. J. Pediatr., 151, 344, 1992. 42. Hiruma, M. et al. Systemic phaeohyphomycosis caused by Exophiala dermatitidis. Mycoses, 36, 1, 1993. 43. Campos-Takaki, G.M. et al. Report of chronic subcutaneous abscesses caused by Exophiala spinifera. Mycopathologia, 127, 73, 1994. 44. Kabel, P.J. et al. Nosocomial intravascular infection with Exophiala dermatitidis. Lancet, 344, 1167, 1994. 45. Horré, R. et al. Primary cerebral infections by melanized fungi: A review. Stud. Mycol., 45, 176, 1999. 46. Chang, C.L. et al. Acute cerebral phaeohyphomycosis due to Wangiella dermatitidis accompanied by cerebrospinal ¼uid eosinophilia. J. Clin. Microbiol. 38, 1965, 2000. 47. Nucci, M. et al. Nosocomial fungemia due to Exophiala jeanselmei var. jeanselmei and a Rhinocladiella species: Newly described causes of bloodstream infection. J. Clin. Microbiol., 39, 514, 2001.
48. Nucci, M. et al. Nosocomial outbreak of Exophiala jeanselmei fungemia associated with contamination of hospital water. Clin. Infect. Dis., 34, 1475, 2002.
49. Ben-Simon, G.J. et al. More than tears in your eyes (Exophiala jeanselmei keratitis). Cornea, 21, 230, 2002.
50. Boisseau-Garsaud, A.M. et al. Onychomycosis due to Exophiala jeanselmei. Dermatology, 204, 150, 2002.
51. Engemann, J. et al. Exophiala infection from contaminated injectable steroids prepared by a compounding pharmacy— United States, July–November 2002. MMWR, 51, 1109, 2002.
52. Calista, D. et al. Subcutaneous Exophiala jeanselmei infection in a heart transplant patient. Eur. J. Dermatol., 13, 489, 2003.
53. Greig, J. et al. Peritonitis due to the dematiaceous mold Exophiala dermatitidis complicating continuous ambulatory peritoneal dialysis. Clin. Microbiol. Infect., 9, 713, 2003.
54. Murayama, N. et al. A case of subcutaneous phaeohyphomycotic cyst due to Exophiala jeanselmei complicated with systemic lupus erythematosus. Mycoses, 46, 145, 2003.
55. Myoken, Y. et al. Successful treatment of invasive stomatitis due to Exophiala dermatitidis in a patient with acute myeloid leukemia. J. Oral Pathol. Med., 32, 51, 2003.
56. Negroni, R. et al. Case study: Posaconazole treatment of disseminated phaeohyphomycosis due to Exophiala spinifera. Clin. Infect. Dis., 38, 15, 2004.
57. Tseng, P.H. et al. Central venous catheter-associated fungemia due to Wangiella dermatitidis. J. Formos. Med. Assoc., 104, 123, 2005.
58. Al-Obaid, I. et al. Catheter-associated fungemia due to Exophiala oligosperma in a leukemic child and review of fungemia cases caused by Exophiala species. Eur. J. Clin. Microbiol. Infect. Dis., 25, 729, 2006.
59. Patel, S.R. et al. Exophiala dermatitidis keratitis after laser in situ keratomileusis. J. Cataract Refract. Surg., 32, 681, 2006.
60. Khan, S.A. Calcaneal osteomyelitis caused by Exophiala jeanselmei in an immunocompetent child. J. Bone Joint Surg. Am., 89, 2547, 2007.
61. Leung, E.H. et al. Exophiala jeanselmei keratitis after laser in situ keratomileusis. J. Cataract Refract. Surg., 34, 1809, 2008.
62. Harris, J.E. et al. Exophiala spinifera as a cause of cutaneous phaeohyphomycosis: Case study and review of the literature. Med. Mycol., 47, 87, 2009.
63. Fahal, A.H. Mycetoma: A thorn in the ¼esh. Trans. R. Soc. Trop. Med. Hyg., 98, 3, 2004.
64. Thammayya, A. et al. Exophiala jeanselmei causing mycetoma pedis in India. Sabouraudia, 18, 91, 1980.
65. Hemashettar, B.M. et al. Mycetoma due to Exophiala jeanselmei (a case report with description of the fungus). Indian J. Pathol. Microbiol., 29, 75, 1986.
66. Neumeister, B. et al. Mycetoma due to Exophiala jeanselmei and Mycobacterium chelonae in a 73-year-old man with idiopathic CD 4+ T lymphocytopenia. Mycoses, 38, 271, 1995.
67. Brownell, I. et al. Eumycetoma. Dermatol. Online J., 11, 10, 2005.
68. Capoor, M.R. et al., Eumycetoma pedis due to Exophiala jeanselmei. Indian J. Med. Microbiol., 25, 155, 2007.
69. Al-Taw�q, J.A. et al. Madura leg due to Exophiala jeanselmei successfully treated with surgery and itraconazole therapy. Med. Mycol., 47, 648, 2009.
70. Desnos-Olliver, M. et al. Molecular identi�cation of blackgrain mycetoma agents. J. Clin. Microbiol., 44, 3517, 2006. 71. Ahmed, A.O. et al. Molecular detection and identi�cation of agents of eumycetoma: Detailed report of two cases. J. Clin. Microbiol., 41, 5813, 2003. 72. Bossler, A.D. et al. Exophiala oligosperma causing olecranon bursitis. J. Clin. Microbiol., 41, 4779, 2003. 73. Aoyama, Y. et al. Subcutaneous phaeohyphomycosis caused by Exophiala xenobiotica in a non-Hodgkin lymphoma patient. Med. Mycol., 47, 95, 2009. 74. Badali, H. et al. The clinical spectrum of Exophiala jeanselmei, with a case report and in vitro antifungal susceptibility of the species. Med. Mycol., 29, 1, 2009. 75. Haase, G. et al. Exophiala dermatitidis infection in cystic �brosis. Lancet, 336, 188, 1990. 76. Rath, P.M. et al. A comparison of methods of phenotypic and genotypic �ngerprinting of Exophiala dermatitidis isolated from sputum samples of patients with cystic �brosis. J. Med. Microbiol., 46, 757, 1997. 77. Diemert, D. et al. Sputum isolation of Wangiella dermatitidis in patients with cystic �brosis. Scand. J. Infect., 33, 777, 2001. 78. Horré, R. et al. Isolation of fungi, especially Exophiala dermatitidis, in patients suffering from cystic �brosis. A prospective study. Respiration, 71, 360, 2004. 79. Mukaino, T. et al. Exophiala dermatitidis infection in noncystic �brosis bronchiectasis. Respir. Med., 100, 2069, 2006. 80. Nagano, Y. et al. Development of a novel PCR assay for the identi�cation of the black yeast, Exophiala (Wangiella) dermatitidis from adult patients with cystic �brosis (CF). J. Cyst. Fibros., 7, 576, 2008. 81. Porteous, N.B. et al. Identi�cation of Exophiala mesophila isolated from treated dental unit waterlines. J. Clin. Microbiol., 41, 3885, 2003. 82. Phillips, G. et al. Black pigmented fungi in the water pipework supplying endoscope washer disinfectors. J. Hosp. Infect., 40, 250, 1998. 83. Cox, H.H. J. et al. Growth of the black yeast Exophiala jeanselmei on styrene and styrene-related compounds. Appl. Microbiol. Biotechnol., 39, 372, 1993. 84. Umemoto, N. et al. Two cases of cutaneous phaeohyphomycosis due to Exophiala jeanselmei: Diagnostic signi�cance of direct microscopical examination of the purulent discharge. Clin. Exp. Dermatol., 34, e351, 2009. 85. De Hoog, G.S. et al. Comparative rDNA diversity in medically signi�cant fungi. Microbiol. Cult. Collect., 13, 39, 1997. 86. Iwen, P. C. et al. Utilization of the internal transcribed spacer regions as molecular targets to detect and identify human fungal pathogens. Med. Mycol., 40, 87, 2002. 87. Abliz, P. et al. Identi�cation of pathogenic dematiaceous fungi and related taxa based on large subunit ribosomal DNA D1/D2 domain sequence analysis. FEMS Immunol. Med. Microbiol., 40, 41, 2004. 88. Wang, L. et al. Identi�cation, classi�cation, and phylogeny of the pathogenic species Exophiala jeanselmei and related species by mitochondrial cytochrome b gene analysis. J. Clin. Microbiol., 39, 4462, 2001. 89. Pounder, J.I. Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J. Clin. Microbiol., 45, 568, 2007. 90. White, T.J. et al. Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In M.S. Innis and D.H. Gelfand (eds.), PCR Protocols: A Guide to Methods and Applications, Academic Press, New York, 1990, p. 315. 32 Chapter 32 - Fonsecaea
22. Iwatsu, T. et al., Evaluation of skin test for chromoblastomycosis using antigens prepared from culture �ltrates of Fonsecaea pedrosoi, Phialophora werrucosa, Wangiella dermatitidis and Exophiala jeanselmei, Mycopathologia, 77, 59, 1982.
23. Iwatsu, T. et al., Skin test-active substance prepared from culture �ltrate of Fonsecaea pedrosoi, Mycopathologia, 67, 101, 1979.
24. Espinel-ingroff, A. et al., Evaluation of the API 20C yeast identi�cation system for the differentiation of some dematiaceous fungi, J. Clin. Microbiol., 27, 2565, 1989.
25. Steadham, J.E., Geis, P.A., and Simmank, J.L., Use of carbohydrate and nitrate assimilations in the identi�cation of dematiaceous fungi, Diagn. Microbiol. Infect. Dis., 5, 71, 1986.
26. Yaguchi, T. et al., Molecular phylogenetics of strains morphologically identi�ed as Fonsecaea pedrosoi from clinical specimens, Mycoses, 50, 255, 2007. 27. Abliz, P. et al., Rapid identi�cation of the genus Fonsecaea by PCR with speci�c oligonucleotide primers, J. Clin. Microbiol., 41, 873, 2003. 28. Andrade, T.S. et al., Rapid identi�cation of Fonsecaea by duplex polymerase chain reaction in isolate from patients with chromoblastomycosis, Diagn. Microbiol. Infect. Dis., 57, 267, 2007. 29. White, T.J. et al., Ampli¡cation and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics, PCR: A Guide to Methods and Applications, Academic Press, Inc., New York, 1990, pp. 315–322. 30. Miyagi, H. et al., Case of chromoblastomycosis appearing in an Okinawa patient with a medical history of Hansen’s disease, J. Dermatol., 35, 354, 2008. 33 Chapter 33 - Histoplasma
20. Klite, P.D. and Diercks, F.H., Histoplasma capsulatum in fecal contents and organs of bats in the Canal Zone, Am. J. Trop. Med. Hyg., 14, 433, 1965.
21. Julg, B. et al., Bat-associated histoplasmosis can be transmitted at entrances of bat caves and not only inside the caves, J. Travel Med., 15, 133, 2008.
22. Wheat L.J. et al., A large urban outbreak of histoplasmosis: Clinical features, Ann. Intern. Med., 94, 331, 1981.
23. Zancope-Oliveira, R.M., Tavares, P.M.S., and Muniz, M.M., Genetic diversity of Histoplasma capsulatum strains in Brazil, FEMS Immunol. Med. Microbiol., 45, 443, 2005.
24. Reyes-Montes, M.R. et al., Relatedness analyses of Histoplasma capsulatum isolates from Mexican patients with AIDS-associated histoplasmosis by using histoplasmin electrophoretic pro�les and randomly ampli�ed polymorphic DNA patterns, J. Clin. Microbiol., 37, 1404, 1999.
25. Hamrick, J.L., Lichtwardt, R.W., and Lan, C., Levels of isozyme variation within and among Histoplasma capsulatum localities, Trans. Kans. Acad. Sci., 89, 49, 1986.
26. Zarnowski, R. et al., Typing of Histoplasma capsulatum strains by fatty acid pro�le analysis, J. Med. Microbiol., 56, 788, 2007.
27. Spitzer, E.D. et al., Use of mitochondrial and ribosomal DNA polymorphisms to classify clinical and soil isolates of Histoplasma capsulatum, Infect. Immun., 57, 1409, 1989.
28. Keath, E.J. et al., DNA probe for the identi�cation of Histoplasma capsulatum, J. Clin. Microbiol., 27, 2369, 1989.
29. Sandhu, G.S. et al., Molecular probes for diagnosis of fungal infections, J. Clin. Microbiol., 33, 2913, 1995.
30. Keath, E.J., Kobayashi G.S., and Medoff G., Typing of Histoplasma capsulatum by restriction fragment length polymorphisms in a nuclear gene, J. Clin. Microbiol., 30, 2104, 1992.
31. Canteros, C.E. et al., Electrophoresis karyotype and chromosome-length polymorphism of Histoplasma capsulatum clinical isolates from Latin America, FEMS Immunol. Med. Microbiol., 45, 423, 2005.
32. Kersulyte, D. et al., Diversity among clinical isolates of Histoplasma capsulatum detected by polymerase chain reaction with arbitrary primers, J. Bacteriol., 174, 7075, 1992.
33. Poonwan, N.T. et al., Genetic analysis of Histoplasma capsulatum strains isolated from clinical specimens in Thailand by a PCR-based random ampli�ed polymorphic DNA method, J. Clin. Microbiol., 36, 3073, 1998.
34. Reyes-Montes, M.R. et al., Relatedness analyses of Histoplasma capsulatum isolates from Mexican patients with AIDS-associated histoplasmosis by using histoplasmin electrophoretic pro�les and randomly ampli�ed polymorphic DNA patterns, J. Clin. Microbiol., 35, 1404, 1999.
35. Woods, J.P. et al., Fast DNA isolation from Histoplasma capsulatum: Methodology for arbitrary primer polymerase chain reaction-based epidemiological and clinical studies, J. Clin. Microbiol., 31, 463, 2003.
36. Muniz, M.M. et al., Genetic diversity of Histoplasma capsulatum strains isolated from soil, animals, and clinical specimens in Rio de Janeiro State, Brazil, by a PCR-based random ampli�ed polymorphic DNA assay, J. Clin. Microbiol., 39, 4487, 2001.
37. Jiang, B. et al., Typing Histoplasma capsulatum isolates based on nucleotide sequence variation in the internal transcribed spacer regions of rRNA genes, J. Clin. Microbiol., 38, 241, 2000. 38. Kasuga, T. et al., Phylogeography of the fungal pathogen Histoplasma capsulatum, Mol. Ecol., 12, 3383, 2003. 39. Carter D.A. et al., Ampli�ed single-nucleotide polymorphisms and a (GA) n microsatellite marker reveal genetic differentiation between populations of Histoplasma capsulatum from the Americas, Fungal Genet. Biol., 34, 37, 2001. 40. Woods, J.P., Knocking on the right door and making a comfortable home: Histoplasma capsulatum intracellular pathogenesis, Curr. Opin. Microbiol., 6, 327, 2003. 41. Long, K.H. et al., Identi�cation of heat shock protein 60 as the ligand on Histoplasma capsulatum that mediates binding to CD18 receptors on human macrophages, J. Immunol., 170, 487, 2003. 42. Retallack, D.M. and Woods, J.P., Molecular epidemiology, pathogenesis, and genetics of the dimorphic fungus Histoplasma capsulatum, Microbes Infect., 1, 817, 1999. 43. Rappley, C.A. and Goldman, W.E., De�ning virulence genes in the dimorphic fungi, Annu. Rev. Microbiol., 60, 281, 2006. 44. Nosanchuk, J.D. and Gacser, A., Histoplasma capsulatum at the host–pathogen interface, Microbes Infect., 10, 973, 2008. 45. Gomez, F.J., Allendoerfer, R., and Deepe, G.S. Jr., Vaccination with recombinant heat shock protein 60 from Histoplasma capsulatum protects mice against pulmonary histoplasmosis, Infect. Immun., 63, 2587, 1995. 46. Guimarães, A.J. et al., Monoclonal antibodies to heat shock protein 60 alter the pathogenesis of Histoplasma capsulatum, Infect. Immun., 77, 1357, 2009. 47. Zancope-Oliveira, R.M. et al., Molecular cloning, characterization, and expression of the M antigen of Histoplasma capsulatum, Infect. Immun., 67, 1947, 1999. 48. Guimarães, A.J. et al., Biological function and molecular mapping of M antigen in yeast phase of Histoplasma capsulatum, PLOS One, 3, e3449, 2008. 49. Fisher, K.L. and Woods, J.P., Determination of beta- glucosidase enzymatic function of the Histoplasma capsulatum H antigen using a native expression system, Gene, 247, 191, 2000. 50. Sebghati, T.S. et al., Intracellular parasitism by Histoplasma capsulatum: Fungal virulence and calcium dependence, Science, 290, 1368, 2000. 51. Bohse, M.L. and Woods, J.P., RNA interference-mediated silencing of the YPS3 gene of Histoplasma capsulatum reveals virulence defects, Infect. Immun., 75, 2811, 2007. 52. Kauffman, C.A., Histoplasmosis, Clin. Chest Med., 30, 217, 2009. 53. Smithm J.A. and Kauffman, C.A., Endemic fungal infections in patients receiving tumour necrosis factor-alpha inhibitor therapy, Drugs, 69, 1403, 2009. 54. Kauffman, C.A., Histoplasmosis: A clinical and laboratory update, Clin. Microbiol. Rev., 20, 115, 2007. 55. Kauffman, C.A., Pulmonary histoplasmosis, Curr. Infect. Dis. Rep., 3, 279, 2001. 56. Leimann, B.C.Q. et al., Histoplasmosis in a Brazilian center: Clinical forms and laboratory tests, Rev. Iberoam. Micol., 22, 141, 2005. 57. Pietrobon, D. et al., Disseminated histoplasmosis and AIDS in an Argentine hospital: Clinical manifestations, diagnosis and treatment, Enferm. Infecc. Microbiol. Clin., 22, 156, 2004. 58. Subramanian, S. et al., Disseminated histoplasmosis, J. Assoc. Physicians India, 53, 185, 2005. 59. Williams, B. et al., Diagnosis of histoplasmosis by antigen detection during an outbreak in Indianapolis, Ind., Arch. Pathol. Lab. Med., 118, 1205, 1994.
60. Wheat, L.J., Improvements in diagnosis of histoplasmosis, Expert Opin. Biol. Ther., 6, 1207, 2006.
61. Costa, M.R.E. et al., Conventional versus molecular diagnostic tests, Med. Mycol., 38, 139, 2000.
62. Deepe, G.S. Jr. and Durose, G.G., Immunobiological activity of recombinant H antigen from Histoplasma capsulatum, Infect. Immun., 63, 3151, 1995.
63. Johnson, J.E., Jeffrey, B., and Huppert M., Evaluation of �ve commercially available immunodiffusion kits for detection of Coccidioides immitis and Histoplasma capsulatum antibodies, J. Clin. Microbiol., 20, 530, 1984.
64. Wheat, L.J., Laboratory diagnosis of histoplasmosis: Update 2000, Semin. Respir. Infect., 16, 131, 2001.
65. Kaufman, L., Laboratory methods for the diagnosis and con�rmation of systemic mycoses, Clin. Infect. Dis., 14, S23, 1992.
66. Torres, M. et al., Evaluation of enzyme linked immunosorbent-assay and western blot for diagnosis of histoplasmosis, Rev. Invest. Clin., 45, 155, 1993.
67. Zancope-Oliveira, R.M. et al., Evaluation of cation exchange chromatography for the isolation of M glycoprotein from histoplasmin, J. Med. Vet. Mycol., 31, 29, 1993.
68. Zancope-Oliveira, R.M. et al., Immunochemical analysis of the H and M glycoproteins from Histoplasma capsulatum, Clin. Diagn. Lab. Immunol., 1, 563, 1994.
69. Zancope-Oliveira, R.M. et al., Effects of histoplasmin M antigen chemical and enzymatic deglycosylation on cross-reactivity in the enzyme-linked immunoelectrotransfer blot method, Clin. Diagn. Lab. Immunol., 1, 390, 1994.
70. Pizzini, C.V. et al., Evaluation of a western blot test in an outbreak of acute pulmonary histoplasmosis, Clin. Diagn. Lab. Immunol., 6, 20, 1999.
71. Guimarães, A.J. et al., ELISA for early diagnosis of histoplasmosis, J. Med. Microbiol., 53, 509, 2004.
72. Wheat, J. et al., Evaluation of cross-reactions in Histoplasma capsulatum serologic tests, J. Clin. Microbiol., 23, 493, 1986.
73. Wheat, L.J. et al., Diagnosis of histoplasmosis by antigen detection based upon experience at the histoplasmosis reference laboratory, Diagn. Microbiol. Infect. Dis., 43, 29, 2002.
74. Durkin, M.M., Connolly, P.A., and Wheat, L.J., Comparison of radioimmunoassay and enzyme-linked immunoassay methods for detection of Histoplasma capsulatum var. capsulatum antigen, J. Clin. Microbiol., 35, 2252, 1997.
75. Gomez, B.L. et al., Development of a novel antigen detection test for histoplasmosis, J. Clin. Microbiol., 35, 2618, 1997.
76. Gomez, B.L. et al., Detection of the 70-kilodalton Histoplasma capsulatum antigen in serum of histoplasmosis patients: Correlation between antigenemia and therapy during followup, J. Clin. Microbiol., 37, 675, 1999.
77. Scheel, C.M. et al., Development and evaluation of an enzyme-linked immunosorbent assay to detect Histoplasma capsulatum antigenuria in immunocompromised patients, Clin. Vacc. Immunol., 16, 852, 2009.
78. Rickerts, V. et al., Rapid PCR-based diagnosis of disseminated histoplasmosis in an AIDS patient, Eur. J. Clin. Microbiol. Infect. Dis., 21, 821, 2002.
79. Guedes, H.L.M. et al., PCR assay for identi�cation of Histoplasma capsulatum based on the nucleotide sequence of the M antigen, J. Clin. Microbiol., 41, 535, 2003.
80. Chemaly, R.F. et al., Rapid diagnosis of Histoplasma capsulatum endocarditis using the AccuProbe on an excised valve, J. Clin. Microbiol., 39, 2640, 2001. 81. Abbott, J.J., Hamacher, K.L., and Ahmed I., In situ hybridization in cutaneous deep fungal infections: A valuable diagnostic adjunct to fungal morphology and tissue cultures, J. Cutan. Pathol., 33, 426, 2006. 82. Bialek, R. et al., Evaluation of two nested PCR assays for detection of Histoplasma capsulatum DNA in human tissue, J. Clin. Microbiol., 40, 1644, 2002. 83. Maubon, D., Simon, S., and Aznar, C., Histoplasmosis diagnosis using a polymerase chain reaction method. Application on human samples in French Guiana, South America, Diagn. Microbiol. Infect. Dis., 58, 441, 2007. 84. Toranzo, A.I. et al., Molecular diagnosis of human histoplasmosis in whole blood samples, Rev. Argent. Microbiol., 41, 20, 2009. 85. Bialek, R. et al., Diagnosis and monitoring of murine histoplasmosis by a nested PCR assay, J. Clin. Microbiol., 39, 1506, 2001. 86. Spencer, W.H. et al., Detection of Histoplasma capsulatum DNA in lesions of chronic ocular histoplasmosis syndrome, Arch. Ophthalmol., 121, 1551, 2003. 87. Bracca, A. et al., Molecular detection of Histoplasma capsulatum var. capsulatum in human clinical samples, J. Clin. Microbiol., 41, 1753, 2003. 88. Tang, Y.W. et al., Urine polymerase chain reaction is not as sensitive as urine antigen for the diagnosis of disseminated histoplasmosis, Diagn. Microbiol. Infect. Dis., 54, 283, 2006. 89. Martagon-Villamil, J. et al., Identi�cation of Histoplasma capsulatum from culture extracts by real-time PCR, J. Clin. Microbiol., 41, 1295, 2003. 90. Buitrago, M.J. et al., Detection of imported histoplasmosis in serum of HIV-infected patients using a real-time PCRbased assay, Eur. J. Clin. Microbiol. Infect. Dis., 25, 665, 2006. 91. Cenis, J.L., Rapid extraction of fungal DNA for PCR ampli�cation, Nucleic Acids Res., 20, 2380, 1992. 92. Woods J.P. et al., Fast DNA isolation from Histoplasma capsulatum: Methodology for arbitrary primer polymerase chain reaction-based epidemiological and clinical studies, J. Clin. Microbiol., 31, 463, 1993. 93. Lof¼er, J. et al., Comparison of different methods for extraction of fungal pathogens from culture and blood, J. Clin. Microbiol., 35, 3311, 1997. 94. Borman, A.M. et al., Molecular identi�cation of pathogenic fungi, J. Antimicrob. Chem., 61, i7, 2008. 95. Pounder, J.I., Hansen, D., and Woods, G.L., Identi�cation of Histoplasma capsulatum, Blastomyces dermatitidis, and Coccidioides immitis by repetitive-sequence-based-PCR, J. Clin. Microbiol., 44, 2977, 2006. 96. White, T.J. et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In Innis, M.A. et al. (eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press, Inc., San Diego, CA, pp. 315– 322, 1990. 97. Porta, A.S. et al., A homologue of the human 100-kDa protein (p100) is differentially expressed by Histoplasma capsulatum during infection of murine macrophages, Biochem. Biophys. Res. Commun., 254, 605, 1999. 98. Tamura, M. et al., Phylogenetic characterization of Histoplasma capsulatum strains based on ITS region sequences, including two new strains from Thai and Chinese patients in Japan, Nippon Ishinkin Gakkai Zasshi, 43, 11, 2002. 99. Goldani L.Z. et al., Two speci�c strains of Histoplasma capsulatum causing mucocutaneous manifestations of histoplasmosis: Preliminary analysis of a frequent manifestation of histoplasmosis in Southern Brazil, Mycopathologia, 167, 181, 2009.
100. Muniz M.M., Caracterização fenotípica e genotípica de isolados de Histoplasma capsulatum em diferentes regiões brasileiras, Thesis (Doctor in Pesquisa Clinica em Doenças Infecciosas), Fundação Oswaldo Cruz, 2009. 101. Vassart G. et al., A sequence in M13 phage detects hypervariable minisatellites in human and animal DNA, Science, 167, 181, 2009. 102. Don, R.H. et al., ‘Touchdown’ PCR to circumvent spurious priming during gene ampli�cation, Nucleic Acids Res., 19, 4008, 1991. 34 Chapter 34 - Lacazia
1. Lobo, J.O. Nova especies de blastomycose. Brasil Med 44, 1227 (1930).
2. Elsayed, S. et al. Human case of lobomycosis. Emerg Infect Dis 10, 715–718 (2004).
3. Mendoza, L., Vilela, R., Rosa, P.S., and Fernandes Belone, A.F. Lacazia loboi and Rhinosporidium seeberi: A genomic perspective. Rev Iberoam Micol 22, 213–216 (2005).
4. Taborda, P.R., Taborda, V.A., and McGinnis, M.R. Lacazia loboi gen. nov., comb. nov., the etiologic agent of lobomycosis. J Clin Microbiol 37, 2031–2033 (1999).
5. Herr, R.A. et al. Phylogenetic analysis of Lacazia loboi places this previously uncharacterized pathogen within the dimorphic Onygenales. J Clin Microbiol 39, 309–314 (2001).
6. Mendoza, L., Ajello, L., and Taylor, J.W. The taxonomic status of Lacazia loboi and Rhinosporidium seeberi has been �nally resolved with the use of molecular tools. Rev Iberoam Micol 18, 95–98 (2001).
7. Vilela, R. et al. Molecular phylogeny of animal pathogen Lacazia loboi inferred from rDNA and DNA coding sequences. Mycol Res 113, 851–857 (2009).
8. Bhawan, J. et al. Lobomycosis. An electronmicroscopic, histochemical and immunologic study. J Cutan Pathol 3, 5–16 (1976).
9. Haubold, E.M., Cooper, C.R. Jr., Wen, J.W., McGinnis, M.R., and Cowan, D.F. Comparative morphology of Lacazia loboi (syn. Loboa loboi) in dolphins and humans. Med Mycol 38, 9–14 (2000).
10. Woodard, J.C. Electron microscopic study of lobomycosis (Loboa loboi). Lab Invest 27, 606–612 (1972).
11. Bossart, G.D. Suspected acquired immunode�ciency in an Atlantic bottlenosed dolphin with chronic-active hepatitis and lobomycosis. J Am Vet Med Assoc 185, 1413–1414 (1984). 12. Rodriguez-Toro, G. Lobomycosis. Int J Dermatol 32, 324– 332 (1993). 13. Jaramillo, D., Cortes, A., Restrepo, A., Builes, M., and Robledo, M. Lobomycosis. Report of the eighth Colombian case and review of the literature. J Cutan Pathol 3, 180–189 (1976). 14. Paniz-Mondol�, A.E., Reyes Jaimes, O., and Davila Jones, L. Lobomycosis in Venezuela. Int J Dermatol 46, 180–185 (2007). 15. Ramos, E.S.M., Aguiar-Santos-Vilela, F., Cardoso-de-Brito, A., and Coelho-Carneiro, S. Lobomycosis. Literature review and future perspectives. Actas Dermosi¡liogr 100(Suppl 1), 92–100 (2009). 16. Rodriguez-Toro, G. and Tellez, N. Lobomycosis in Colombian Amer Indian patients. Mycopathologia 120, 5–9 (1992). 17. Al-Daraji, W.I., Husain, E., and Robson, A. Lobomycosis in African patients. Br J Dermatol 159, 234–236 (2008). 18. Burns, R.A., Roy, J.S., Woods, C., Padhye, A.A., and Warnock, D.W. Report of the �rst human case of lobomycosis in the United States. J Clin Microbiol 38, 1283–1285 (2000). 19. Caldwell, D.K. et al. Lobomycosis as a disease of the Atlantic bottle-nosed dolphin (Tursiops truncatus Montagu, 1821). Am J Trop Med Hyg 24, 105–114 (1975). 20. Cowan, D.F. Lobo’s disease in a bottlenose dolphin (Tursiops truncatus) from Matagorda Bay, Texas. J Wildl Dis 29, 488– 489 (1993). 21. De Vries, G.A. and Larrman, J.J. A case of Lobo’s disease in the dolphin Sotalia guianensis. J Aquat Mammals 1, 26–33 (1973). 22. Reif, J.S. et al. Lobomycosis in Atlantic bottlenose dolphins from the Indian River Lagoon, Florida. J Am Vet Med Assoc 228, 104–108 (2006). 23. Rotstein, D.S. et al. Lobomycosis in offshore bottlenose dolphins (Tursiops truncatus), North Carolina. Emerg Infect Dis 15, 588–590 (2009). 24. Symmers, W.S. A possible case of Lobo’s disease acquired in Europe from a bottle-nosed dolphin (Tursiops truncatus). Bull Soc Pathol Exot Filiales 76, 777–784 (1983). 25. Norton, S.A. Dolphin-to-human transmission of lobomycosis? J Am Acad Dermatol 55, 723–724 (2006). 26. Belone, A.F., Madeira, S., Rosa, P.S., and Opromolla, D.V. Experimental reproduction of the Jorge Lobo’s disease in BAlb/c mice inoculated with Lacazia loboi obtained from a previously infected mouse. Mycopathologia 155, 191–194 (2002). 27. Madeira, S., Fernandes Belone Ade, F., Padovani, C.R., and Araujo Omoprolla, D.V. Comparative experimental infection of Lacazia loboi in BALB/c and B10.A mice. Rev Iberoam Micol 20, 55–59 (2003). 28. Bermudez, L., Van Bressem, M.F., Reyes-Jaimes, O., Sayegh, A.J., and Paniz-Mondol�, A.E. Lobomycosis in man and lobomycosis-like disease in bottlenose dolphin, Venezuela. Emerg Infect Dis 15, 1301–1303 (2009). 29. Rosa, P.S. et al. Accidental Jorge Lobo’s disease in a worker dealing with Lacazia loboi infected mice: A case report. J Med Case Reports 3, 67 (2009). 30. Vilani-Moreno, F.R., Belone, A.F., Soares, C.T., and Opromolla, D.V. Immunohistochemical characterization of the cellular in�ltrate in Jorge Lobo’s disease. Rev Iberoam Micol 22, 44–49 (2005). 31. Vilani-Moreno, F.R., Silva, L.M., and Opromolla, D.V. Evaluation of the phagocytic activity of peripheral blood monocytes of patients with Jorge Lobo’s disease. Rev Soc Bras Med Trop 37, 165–168 (2004).
32. Vilani-Moreno, F.R., Belone Ade, F., Rosa, P.S., Madeira, S., and Opromolla, D.V. Evaluation of the vital staining method for Lacazia loboi through the experimental inoculation of BALB/c mice. Med Mycol 41, 211–216 (2003).
33. Talhari, C., Chrusciak-Talhari, A., de Souza, J.V., Araujo, J.R., and Talhari, S. Exfoliative cytology as a rapid diagnostic tool for lobomycosis. Mycoses 52, 187–189 (2009).
34. Salgado, C.G. et al. Enzymatic isolation of Lacazia loboi cells from skin lesions of lobomycosis. Med Mycol 47, 119–123 (2009).
35. Camargo, Z.P., Baruzzi, R.G., Maeda, S.M., and Floriano, M.C. Antigenic relationship between Loboa loboi and Paracoccidioides brasiliensis as shown by serological methods. Med Mycol 36, 413–417 (1998).
36. Landman, G., Velludo, M.A., Lopes, J.A., and Mendes, E. Crossed-antigenicity between the etiologic agents of lobomycosis and paraccocidioidomycosis evidenced by an immunoenzymatic method (PAP). Allergol Immunopathol (Madr) 16, 215–218 (1988).
37. Taborda, C.P. and Camargo, Z.P. Diagnosis of paracoccidioidomycosis by passive haemagglutination assay of antibody using a puri�ed and speci�c antigen-gp43. J Med Vet Mycol 31, 155–160 (1993).
38. Taborda, C.P. and Camargo, Z.P. Diagnosis of paracoccidioidomycosis by dot immunobinding assay for antibody detection using the puri�ed and speci�c antigen gp43. J Clin Microbiol 32, 554–556 (1994).
39. Taborda, C.P., Juliano, M.A., Puccia, R., Franco, M., and Travassos, L.R. Mapping of the T-cell epitope in the major 43-kilodalton glycoprotein of Paracoccidioides brasiliensis which induces a Th-1 response protective against fungal infection in BALB/c mice. Infect Immun 66, 786–793 (1998). 40. Vidal, M.S., Palacios, S.A., de Melo, N.T., and Lacaz Cda, S. Reactivity of anti-gp43 antibodies from Paracoccidioides brasiliensis antiserum with extracts from cutaneous lesions of Lobo’s disease. Preliminary note. Rev Inst Med Trop Sao Paulo 39, 35–37 (1997). 41. Mendoza, L. et al. Use of sera from humans and dolphins with lacaziosis and sera from experimentally infected mice for Western Blot analyses of Lacazia loboi antigens. Clin Vaccine Immunol 15, 164–167 (2008). 42. Madeira, S., Opromolla, D.V., and Belone, A. Inoculation of BALB/c mice with Lacazia loboi. Rev Inst Med Trop Sao Paulo 42, 239–243 (2000). 43. Opromolla, D.V., Madeira, S., Belone, A.F., and Vilani-Moreno, F.R. Jorge Lobo’s disease: Experimental inoculation in Swiss mice. Rev Inst Med Trop Sao Paulo 41, 359–364 (1999). 44. Opromolla, D.V. and Nogueira, M.E. Inoculation of Lacazia loboi into the subcutaneous tissue of the hamster cheek pouch. Rev Inst Med Trop Sao Paulo 42, 119–123 (2000). 45. Vilela, R., Martins, J.E., Pereira, C.N., Melo, N., and Mendoza, L. Molecular study of archival fungal strains isolated from cases of lacaziosis (Jorge Lobo’s disease). Mycoses 50, 470–474 (2007). 46. Vilela, R. et al. Molecular model for studying the uncultivated fungal pathogen Lacazia loboi. J Clin Microbiol 43, 3657– 3661 (2005). 47. Puccia, R. and Travassos, L.R. 43-kilodalton glycoprotein from Paracoccidioides brasiliensis: Immunochemical reactions with sera from patients with paracoccidioidomycosis, histoplasmosis, or Jorge Lobo’s disease. J Clin Microbiol 29, 1610–1615 (1991). 48. Rosa, P.S., Belone, A.D., Lauris, J.R., and Soares, C.T. Fineneedle aspiration may replace skin biopsy for the collection of material for experimental infection of mice with Mycobacterium leprae and Lacazia loboi. Int J Infect Dis 14, e49–e53 (2010). 35 Chapter 35 - Lecythophora
1. The UniProt Consortium. Available at http://www.uniprot.org/, accessed on August 1, 2010.
2. Rippon JW, Medical Mycology, 3rd edn. W.B. Saunders Co., Philadelphia, PA, 1988.
3. Pierach CA et al., Phialophora mutabilis endocarditis. Ann Intern Med. 1973;79(6):900–901.
4. Ahmad S et al., Fungal peritonitis caused by Lecythophora mutabilis. J Clin Microbiol. 1985;22(2):182–186.
5. Marcus DM et al., Lecythophora mutabilis endophthalmitis after long-term corneal cyanoacrylate. Retina. 1999;19(4):351–353.
6. Sakaeyama S et al., Lecythophora hoffmannii isolated from a case of canine osteomyelitis in Japan. Med Mycol. 2007;45(3):267–272.
7. Rinaldi MG, McCoy EL, Winn DF. Gluteal abscess caused by Phialophora hoffmannii and review of the role of this organism in human mycoses. J Clin Microbiol. 1982;16:181–185.
8. Marriott DJ et al., Scytalidium dimidiatum and Lecythophora hoffmannii: Unusual causes of fungal infections in a patient with AIDS. J Clin Microbiol. 1997;35(11):2949–2952. 9. Chang CY et al., Novel use of a swimming pool biocide in the treatment of a rare fungal mastoiditis. Laryngoscope. 2005;115(6):1065–1069. 10. Slifkin M, Bowers HM Jr., Phialophora mutabilis endocarditis. Am J Clin Pathol. 1975;63(1):120–130. 11. Drees M et al., Lecythophora mutabilis prosthetic valve endocarditis in a diabetic patient. Med Mycol. 2007;45(5):463–467. 12. Scott IU et al., Delayed-onset, bleb-associated endophthalmitis caused by Lecythophora mutabilis. Am J Ophthalmol. 2004;137(3):583–585. 13. Taniguchi Y et al., Septic shock induced by Lecythophora mutabilis in a patient with mitochondrial encephalomyopathy. J Med Microbiol. 2009;58:1255–1258. 14. Espinel-Ingroff A et al., Evaluation of the API 20C yeast identi�cation system for the differentiation of some dematiaceous fungi. J Clin Microbiol. 1989;27(11):2565–2569. 15. Fell JW et al., Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/ D2 domain sequence analysis. Int J Syst Evol Microbiol. 2000;50:1351–1371. 16. Abliz P et al. Identi�cation of pathogenic dematiaceous fungi and related taxa based on large subunit ribosomal DNA D1/D2 domain sequence analysis. FEMS Immunol Med Microbiol. 2004;40(1):41–49. 17. Bagyalakshmi R et al., Newer emerging pathogens of ocular non-sporulating molds (NSM) identi�ed by polymerase chain reaction (PCR)-based DNA sequencing technique targeting internal transcribed spacer (ITS) region. Curr Eye Res. 2008;33(2):139–147. 18. Destino L et al., Severe osteomyelitis caused by Myceliophthora thermophila after a pitchfork injury. Ann Clin Microbiol Antimicrob. 2006;5:21. 19. Pounder JI, Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J Clin Microbiol. 2007;45(2):568–571. 36 Chapter 36 - Microsporum*
8. Dzawachiszwili, N. et al., The effect of sea water and sodium chloride on the growth of fungi pathogenic to man, J. Invest. Dermatol., 103, 1964.
9. Ajello, L., Natural history of the dermatophytes and related fungi, Mycopath. Mycol. Appl., 53, 93, 1974.
10. Kawasaki, M., Aoki, M., and Ishizaki H., Phylogenetic relationships of some Microsporum and Arthroderma species inferred from mitochondrial DNA analysis, Mycopathologia, 130, 11, 1995.
11. Gräser, Y. et al., Phylogeny and taxonomy of family Arthrodermataceae (dermatophytes) using sequence analysis of the ribosomal ITS region, Med. Mycol., 37, 105, 1999.
12. Magallon, S.A., Dating lineages molecular and paleontological approaches to the temporal framework of clades, Int. J. Plant. Sci., 165, S7, 2004.
13. Taylor, J.W. and Berbee, M.L., Dating divergences in the fungal tree of life: Review and new analysis, Mycologia, 98, 838, 2006.
14. Pagel, M. and Bodmer, W., A naked ape would have fewer parasites, Proc. R. Soc. Lond. B, 270, S117, 2003.
15. Schwartz, G.G. and Rosenblum, L.A., Allometry of primate hair density and the evolution of human hairlessness, Am. J. Phys. Anthropol., 55, 9, 1981.
16. Romano, C., Valenti, L., and Barbara, R., Dermatophytes isolated from asymptomatic stray cats, Mycoses, 40, 471, 1997.
17. Summerbell, R., Form and function in the evolution of dermatophytes, in Biology of Dermatophytes and Other Keratinophilic Fungi, Kushwaha, R.K.S. and Guarro, J., Eds., Rev. Iberoam. Micol., Bilbao, Spain, 2000, p. 30.
18. Rugmer, C., The fragility of gigantism. Research * eu, Special issue 22, September 2008.
19. Richardson, M. and Edward, M., Model systems for the study of dermatophyte and non-dermatophyte invasion of human keratin, in Biology of Dermatophytes and Other Keratinophilic Fungi, Kushwaha, R.K.S. and Guarro, J., Eds., Rev. Iberoam. Micol., Bilbao, Spain, 2000, p. 115.
20. Takashio, M., Sexual reproduction of some Arthroderma and Nannizzia on dilute Sabouraud agar with or without salts, Mykosen, 15, 11, 1972.
21. Wong, K., The human pedigree: A timeline of hominid evolution, Sci. Am. India, 4, 60, 2009.
22. Kaszubiak, A. et al., Population structure and evolutionary origins of Microsporum canis, M. ferrugineum and M. audouinii, Infect. Genet. Evol., 4, 179, 2004.
23. Dixon, D. et al., Cassell’s Atlas of Evolution, Cassell & Co. London, U.K., 2001, p. 312.
24. Bettis III, E.A., Way out of Africa: Early Pleistocene paleoenvironments inhabited by Homo erectus in Sangiran, Java, J. Hum. Evol., 56, 11, 2009.
25. Giraud, T. et al., Speciation in fungi, Fung. Genet. Biol., 45, 791, 2008.
26. Summerbell, R.C., Li, A., and Haugland, R., What constitute a functional species in the asexual dermatophytes? Microbiol. Cult. Coll., 13, 29, 1997.
27. Sharma, R. et al., A virulent genotype of Microsporum canis is responsible for the majority of human infections, J. Med. Microbiol., 56, 1377, 2007.
28. Dirscoll, C.A. et al., The near eastern origin of cat domestication, Science, 317, 519, 2007.
29. Dirscoll, C.A. et al., The taming of the cat, Sci. Am. India, 4, 54, 2009.
30. Brown, J.K.M. and Hovmoller, M.S., Epidemiology—Aerial dispersal of pathogens on the global and continental scales and its impact on plant disease, Science, 297, 537, 2002. 31. Burnet, J. (ed), The generation of variation-I Mutation and migration, in Fungal Population and Species, Burmett, J., Ed., Oxford University Press, New York, 2003, p. 121. 32. Webster, J. and Weber, R.W.S., Introduction to Fungi, 3rd edn., Cambridge University Press, Cambridge, U.K. 2007, p. 294. 33. Hubalek, Z. and Rush-Munro, F.M., A dermatophyte from birds: Microsporum ripariae sp.nov., Sabouraudia, 11, 287, 1973. 34. Ajello, L. and Padhye, A., Keratinophilic fungi of the Galapagos Islands, Mykosen, 17, 239, 1974. 35. Davidson, F.D.D., Mackenzie, D.W.R., and Owen, R.J., Deoxyribonucleic acid base composition of dermatophytes, J. Gen. Microbiol., 118, 465, 1980. 36. Gräser, Y., Scott, J., and Summerbell R.C., The new species concept in dermatophytes—A polyphasic approach, Mycopathologia, 166, 239, 2008. 37. Abdel-Rahman, S.M., Strain differentiation of dermatophytes, Mycopathologia, 166, 319, 2008. 38. Kanbe, T., Molecular approaches in the diagnosis of dermatophytes, Mycopathologia, 166, 307, 2008. 39. Sharma, R. et al., Molecular detection of Microsporum persicolor in soil suggesting widespread dispersal in central India, Med. Mycol., 46, 67, 2008. 40. Perkins, D.D., In praise of diversity, in More Gene Manipulations in Fungi, Bennet, J.W. and Lasure, L.L. Eds., Academic Press, New York, 1991, p. 3. 41. Garg, J. et al., Rapid detection of dermatophytes from skin and hair, BMC Res. Notes, 2, 60, 2009. 42. Arabatzis, M. et al., Diagnosis of common dermatophyte infections by a novel multiplex real time polymerase chain reaction detection/identi�cation scheme, Brit. J. Dermatol., 157, 681, 2007. 43. Vollmer, T. et al., Evaluation of novel broad-range real-time PCR assay for rapid detection of human pathogenic fungi in various clinical specimens, J. Clin. Microbiol., 46, 1919, 2008. 44. Li, H.C. et al., Identi�cation of dermatophytes by an oligonucleotide array, J. Clin. Microbiol., 45, 3160, 2007. 45. White, T.C. and Henn, M.R., Genomic determinants of infection competence in dermatophyte fungi. A white paper for the Fungal Genome Initiative, http://www.genome.gov/Pages/ Research/Sequencing/Seq/Proposals/Dermatophytes_WP_ Seq.pdf, pp12. 46. White, T. et al., Generating and testing molecular hypothesis, Eukar. Cell, 7, 1238, 2008. 47. Padhye, A.A. and Carmichael, J.W., The genus Arthroderma Berkeley, Can. J. Bot., 49, 1525, 1971. 48. Weitzman, I. et al., The genus Arthoderma and its later synonym Nannizia, Mycotaxon, 25, 505, 1986. 49. James, T.Y. et al., Reconstructing the early evolution of fungi using a six-gene phylogeny, Nature, 443, 818, 2006. 50. Hibbett, D.S. et al., A higher-level phylogenetic classi�cation of the fungi, Mycol. Res., 111, 509, 2007. 51. Cole, G.T. and Samson R.A., Patterns of Development in Conidial Fungi, Pitman Publishing Ltd., London, U.K., 1979. 52. Van Oorschot, C.A.N., A revision of Chrysosporium and allied genera, Stud. Mycol., 20, 1, 1980. 53. Kubo, H., Survey of keratinophilic fungi from soils of Hokkaido prefecture of Japan—Especially on the isolation of Nannizzia otae from the soils, Jpn. J. Med. Mycol., 27, 230, 1986. 54. Hironga, M., Nozaki, K., and Watanabe, S., Ascocarp production by Nannizzia otae on keratinous and non-keratinous agar media and mating behavior of N. otae and 123 Japanese isolates of Microsporum canis, Mycopathologia, 72, 135, 1980.
55. Degreef, H., Clinical forms of dermatophytosis (ringworm infection), Mycopathologia, 166, 257, 2008.
56. Havlickova, B., Czaika, V.A., and Friedrich, M., Epidemiological trends in skin mycoses worldwide, Mycoses, 51, 2, 2008.
57. Chermett, R., Ferreiro, L., and Guillot, J., Dermatophytoses in animals, Mycopathologia, 166, 385, 2008.
58. Carlotti D.N. and Bensignor, E., Dermatophytosis due to Microsporum persicolor (13 cases) or Microsporum gypseum (20 cases) in dogs, Vet. Dermatol., 10, 17, 1999.
59. Agrios, G.N., Introduction to Plant Pathology, Elsevier Academic Press, New Delhi, 2006.
60. Moss, S., Understanding Bird Behavior, New Holland Publishers Ltd., U.K., 2006, p. 70.
61. Sharma, R., Taxonomic studies on keratinolytic fungal diversity of central India, PhD thesis, Rani Durgavati University, Jabalpur, India, 2002.
62. Ghosh, L.N., An analysis of 50,000 skin cases as seen in the outpatient department of school of tropical medicine, Calcutta, during 5 years from 1942–1946, Ind. Med. Gaz., 83, 493, 1948.
63. Garg, A.P., Indian hair oils and protection of human hair against fungal infections, J. Ind. Bot. Soc., 71, 251, 1992.
64. Katoh, T., Dermatomycosis and environment, Jpn. J. Med. Mycol., 47, 63, 2006.
65. Ul�g, K., The occurrence of keratinolytic fungi in water and waste-contaminated habitats, in Biology of Dermatophytes and Other Keratinophilic Fungi, Kushwaha, R.K.S. and Guarro, J., Eds., Rev. Iberoam. Micol. Bilbao, Spain, 2000, p. 44.
66. Morishita, N. et al., Effects of temperature, humidity, minor injury and washing on penetration of dermatophytes into human stratum corneum, Jpn. J. Med. Mycol., 44, 269, 2003. 67. Morishita, N. et al., Experimental studies on the penetration of dermatophytes into the human stratum corneum and the effects of washing, Jpn. J. Med. Mycol., 45, 247, 2004.
68. May, R.M., Global problems and global science, Notes Rec. R. Soc. Lond., 59, 105, 2005.
69. Rosenthal, T., Aulus Cornelium Celsus, Arch. Derm., 84, 613, 1961.
70. Rippon, J.W., Clinical aspects of medically important conidial fungi, in Biology of Conidial Fungi, Vol. 2, Cole, G.T. and Kendrick, W., Ed., Academic Press Inc., New York, 1981, p. 13.
71. Kunert, J., Keratin decomposition by dermatophytes: Evidence of the sulphitolysis of protein, Experimentia, 28, 1025, 1972.
72. Kunert, J., Personal communication, 2001.
73. Kunert, J. and Trüper, H.G., Cystine catabolism in mycelia of Microsporum gypseum a dermatophyte fungus, Arch. Microbiol., 145, 181, 1986.
74. Sei, Y. and Takiuchi, I., Studies on the effect of keratinase on the keratinized structure, and localization of keratinase, Jpn. J. Med. Mycol., 23, 308, 1982.
75. Takiuchi, I. et al., Isolation of an extracellular proteinase (keratinase) from Microsporum canis, Sabouraudia, 20, 281, 1982.
76. Marchisio, V.P., Keratinophilic fungi: Their role in nature and degradation of keratinic substrates, in Biology of Dermatophytes and Other Keratinophilic Fungi, Kushwaha, R.K.S. and Guarro, J., Eds., Rev. Iberoam. Micol. Bilbao, Spain, 2000, p. 86.
77. Uchida, T. et al., Comparative study of direct polymerase chain reaction, microscopic examination and culture-based morphological methods for detection and identi�cation of dermatophytes in nail and skin samples, J. Dermatol., 36, 202, 2009. 78. Brasch, J. and Graeser, Y., Trichophyton eboreum sp.nov. isolated from human skin, J. Clin. Microbiol., 43, 5230, 2005. 79. Robert, R. and Pihet, M., Conventional methods for the diagnosis of dermatophytosis, Mycopathologia, 166, 295, 2008. 80. Kane et al., Laboratory Handbook of Dermatophytes, Star Publishing Company, Belmont, CA, 1997. 81. Robinson, B.E. and Padhye, A.A., Collection, transport and processing of clinical specimens, in Diagnostic Procedures for Mycotic and Parasitic Infections, Wentworth, B.B., Ed., American Public Health Association, Washington, DC, 1988, p. 11. 82. Mackenzie, D.W.R., “Hairbrush diagnosis” in detection and eradication of non-¼uorescent scalp ringworm, Br. Med. J., 2, 363, 1963. 83. Klokke, A.H.A., Purushotham, A.G., and Sundaraju, D., Mass treatment of non-¼uorescent tinea-capitis in an orphanage in India. Trial with a low griseofulvin dose using a modi�ed brush sampling technique, Trop. Georgr. Med., 18, 305, 1966. 84. Johnson, L., Dermatophytes-the skin eaters, Mycologist, 17, 147, 2003. 85. Ajello, L. and George, L.K., In vitro cultures for differentiating between atypical isolates of Trichophyton mentagrophytes and Trichophyton rubrum, Mycopath. Mycol. Appl., 8, 3, 1957. 86. Padhye, A.A., Young, C.N., and Ajello, L., Hair perforation as a diagnostic criterion in the identi�cation of Epidermophyton, Microsporum and Trichophyton species, Pan. Am. Health Org. Sci. Publ., 396, 115, 1980. 87. Liu, D. et al., A speci�c PCR assay for the dermatophyte fungus Microsporum canis, Med. Mycol., 39, 215, 2001. 88. Roque, H.D. et al., Speci�c primers for rapid detection of Microsporum audouinii by PCR in clinical samples, J. Clin. Microbiol., 44, 4336, 2006. 89. El Fari, M. et al., Development of an oligonucleotide probe speci�c for Trichophyton rubrum, Brit. J. Dermatol., 141, 240, 1999. 90. Savin, C. et al., Multicenter evaluation of a commercial PCR-enzyme-linked immunosorbent assay diagnostic kit (Onychodiag) for diagnosis of dermatophytic onychomycosis, J. Clin. Microbiol., 45, 1205, 2007. 91. Bergmans, A.M.C. et al., Validation of PCR-reverse line blot, a method for rapid detection and identi�cation of nine dermatophyte species in nail, skin and hair samples, Clin. Microbiol. Infect., 14, 778, 2008. 92. Gutzmer, R. et al., Rapid identi�cation and differentiation of fungal DNA in dermatological specimens by LightCycler PCR, J. Med. Microbiol., 53, 1207, 2004. 93. Bergmans, A.M.C. et al., Evaluation of a single-tube realtime PCR for detection and identi�cation of 11 dermatophyte species in clinical material, Clin. Microbiol. Infect., 16, 704, 2009. 94. Liu, D. et al., Rapid mini-preparation of fungal DNA for PCR. J. Clin. Microbiol., 38, 471, 2000. 95. Brillowska-Dobrowska, A., Saunte, D.M., and Arendrup, M.C., Five hour diagnosis of dermatophyte nail infection with speci�c detection of Trichophyton rubrum, J. Clin. Microbiol., 45, 1200, 2007. 96. White, T.J. et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics, in PCR Protocols: A Guide to Methods and Applications, Innis, M.A. et al. Eds., Academic Press, New York, 1990, p. 315. 97. Masclaux, F. et al., Phylogenetic relationships of human pathogenic Cladosporium (Xylohypha) species inferred from partial LS rRNA sequences, J. Med. Vet. Mycol., 33, 327, 1995.
98. de Hoog, G.S. and Gerrits van den Ende, A.H.G., Molecular diagnostics of clinical strains of �lamentous Basidiomycetes, Mycoses, 41, 183, 1998.
99. Dieffenbach, C.W. and Dveksler, G.S., PCR Primer—A Laboratory Manual, 2nd edn., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2003.
100. Zane, L., Bargelloni, L., and Patarnello, T., Strategies for microsatellite isolation: A review, Mol. Ecol., 11, 1, 2002.
101. Dutech, C. et al., Challenges of microsatellite isolation in fungi, Fung, Genet. Biol., 44, 933, 2007.
102. Badillet, G., Microsporum persicolor, an easily misinterpreted dermatophyte, Hautartz, 29, 10, 1987.
103. Kane, J., Sigler, L., and Summerbell, R.C., Improved procedure for differentiating Microsporum persicolor, an easily misinterpreted dermatophyte, J. Clin. Microbiol., 25, 2449, 1987.
104. Hansen, M., Hallden, C., and Sall T., Error rates and polymorphism frequencies for three RAPD protocols, Plant Mol. Biol. Reptr., 16, 139, 1998.
105. Kano, R. et al., Differentiation of Microsporum species by random ampli�cation of polymorphic DNA (RAPD) and southern hybridization analyses, Mycoses, 41, 229, 1998.
106. Graeser, Y. et al., Identi�cation of common dermatophytes (Trichophyton, Microsporum, Epidermophyton) using polymerase chain reactions, Br. J. Dermatol., 138, 576, 1998.
107. Male, O., The signi�cance of mycology in medicine, in Frontiers in Mycology, Hawksworth, D.L. Ed., CAB International, Wallingford, 1990, p. 131. 108. Champa, D. et al., DNA microarray based on arrayed-primer extension technique for identi�cation of pathogenic fungi responsible for invasive and super�cial mycoses, J. Clin. Microbiol., 46, 909, 2008. 109. Kardjeva, V. et al., Forty-eight-hour diagnosis of onychomycosis with subtyping of Trichophyton rubrum strains, J. Clin. Micrbiol., 44, 1419, 2006. 110. Burzykowski, T. et al., High prevalence of foot diseases in Europe: Results of the Achilles Project, Mycoses, 46, 496, 2003. 111. Marsella, R., Fungal skin diseases. In Current Therapy in Equine Medicine, Robinson, E.L. and Strayberry, K.A. Eds., Saunders, Elsevier, Philadelphia, PA, 2009, p. 687. 112. Pontecorvo, G., The parasexual cycle in fungi, Annu. Rev. Microbiol. 10, 393, 1956. 113. Heitman, J., Sexual reproduction and the evolution of microbial pathogens, Curr. Biol., 16, R711, 2006. 114. Graeser, Y. et al., Molecular and conventional taxonomy of Microsporum canis complex, Med. Mycol., 38, 143, 2000. 115. Sharma, R. et al., Internal transcribed spacer (ITS) of rDNA of appendaged and non-appendaged strains of Microsporum gypseum reveals Microsporum appendiculatum as its synonym, Antonie Leeuwenhoek, 20, 197, 2006. 116. Campbell, C.K. et al., Arthroderma olidum, sp.nov. a new addition to the Trichophyton terrestre complex, Med. Mycol., 44, 451, 2006. 117. de Hoog, G.S. et al., Atlas of Clinical Fungi, 2nd edn., Centraalbureau voor Schimmelculturales, Utrecht, the Netherlands, 2000. 37 Chapter 37 - Myriodontium
1. The UniProt Consortium. Available at http://www.uniprot. org/, accessed on August 1, 2010.
2. Samson RA, Polonelli L. Myriodontium keratinophilum. gen. et sp. nov. Persoonia. 1978;9:505–509.
3. Maran AG et al., Frontal sinusitis caused by Myriodontium keratinophilum. Br Med J. 1985;290:207.
4. Cano J et al., Studies on keratinophilic fungi. IX: Neoarachnotheca gen. nov. and a new species of Nannizziopsis. Anton Van Leeuwen. 1997;72(2):149–158. 5. Milosev B et al. Primary aspergilloma of the paranasal sinuses in the Sudan. Br J Surg. 1969;56:132–137. 6. Miller JW, Johnson A, Lamb D. Allergic aspergillosis of the maxillary sinuses. Thorax. 1981;36:710. 7. Pounder JI et al., Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J Clin Microbiol. 2007;45:568–571. 8. Bagyalakshmi R et al., Newer emerging pathogens of ocular non-sporulating molds (NSM) identi�ed by polymerase chain reaction (PCR)-based DNA sequencing technique targeting internal transcribed spacer (ITS) region. Curr Eye Res. 2008;33(2):139–147. 9. White, TJ et al., 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In M. A. Innis et al. (eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, pp. 315–322. 38 Chapter 38 - Onychocola
1. The UniProt Consortium. Available at http://www.uniprot.org/ taxonomy/, accessed on August 1, 2010.
2. Gibas CF et al. Arachnomyces kanei (anamorph Onychocola kanei) sp. nov., from human nails. Med Mycol. 2002;40(6):573–580.
3. Gibas CF et al. Mating patterns and ITS sequences distinguish the sclerotial species Arachnomyces glareosus sp. nov. and Onychocola sclerotica. Stud Mycol. 2004;50:525.
4. de Hoog GS et al. (eds.). Atlas of Clinical Fungi, 2nd edn., p. 325. Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands, 2004.
5. Gupta AK. Non-dermatophyte onychomycosis. Dermatol Clin. 2003;21(2):257–268.
6. Vélez H, Díaz F. Onychomycosis due to saprophytic fungi. Report of 25 cases. Mycopathologia. 1985;91(2):87–92.
7. Elewski BE. Onychomycosis: Pathogenesis, diagnosis, and management. Clin Microbiol Rev. 1998;11:415.
8. Gupta AK, Summerbell RC. Combined distal and lateral subungual and white super�cial onychomycosis in the toenails. J Am Acad Dermatol. 1999;41(6):938–944.
10. Gupta AK et al. Itraconazole and terbina�ne treatment of some nondermatophyte molds causing onychomycosis of the toes and a review of the literature. J Cutan Med Surg. 2001;5:206.
11. O’Donoghue NB, Moore MK, Creamer D. Onychomycosis due to Onychocola canadensis. Clin Exp Dermatol. 2003;28(3):283–284.
12. Piraccini BM, Tosti A. White super�cial onychomycosis: Epidemiological, clinical, and pathological study of 79 patients. Arch Dermatol. 2004;140(6):696–701.
13. Campbell CK, Johnson EM, Warnock DW. Nail infection caused by Onychocola canadensis: Report of the �rst four British cases. J Med Vet Mycol. 1997;35(6):423–425. 14. Llovo J et al. Onychomycosis due to Onychocola canadensis: Report of the �rst two Spanish cases. Med Mycol. 2002;40(2):209–212. 15. Fanti F et al. First Italian report of onychomycosis caused by Onychocola canadensis. Med Mycol. 2003;41(5):447–450. 16. Van Esbroeck M et al. Isolation of Onychocola canadensis from four cases of onychomycosis in Belgium. Acta Clin Belg. 2003;58(3):190–192. 17. Sigler L, Congly H. Toenail infection caused by Onychocola canadensis gen. et sp. nov. J Med Vet Mycol. 1990;28(5):405–417. 18. Sigler L, Abbott SP, Woodgyer AJ. New records of nail and skin infection due to Onychocola canadensis and description of its teleomorph Arachnomyces nodosetosus sp. nov. J Med Vet Mycol. 1994;32(4):275–285. 19. Gupta AK, Horgan-Bell CB, Summerbell RC. Onychomycosis associated with Onychocola canadensis: Ten case reports and a review of the literature. J Am Acad Dermatol. 1998;39 (3):410–417. 20. Erbagci Z et al. Cutaneous hyalohyphomycosis and onychomycosis caused by Onychocola canadensis: Report of the �rst case from Turkey. J Dermatol. 2002;29(8):522–528. 21. Walberg M et al. 18S rDNA polymerase chain reaction and sequencing in onychomycosis diagnostics. Acta Derm Venereol. 2006;86(3):223–226. 22. Garg J et al. Evaluation of pan-dermatophyte nested PCR in diagnosis of onychomycosis. J Clin Microbiol. 2007;45(10):3443–3445. 23. Pounder JI et al. Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J Clin Microbiol. 2007;45(2):568–571. 39 Chapter 39 - Paecilomyces
1. Madsen, A.M. et al., Human exposure to airborne fungi from genera used as biocontrol agents in plant production, Ann. Agric. Environ. Med., 14, 5, 2007.
2. Castro, L.G., Salebian, A., and Sotto, M.N., Hyalohyphomycosis by Paecilomyces lilacinus in a renal transplant patient and a review of human Paecilomyces species infections, J. Med. Vet. Mycol., 28, 15, 1990.
3. Gutierrez, F. et al., Pulmonary mycetoma caused by an atypical isolate of Paecilomyces species in an immunocompetent individual: Case report and literature review of Paecilomyces lung infections, Eur. J. Clin. Microbiol. Infect. Dis., 24, 607, 2005.
4. Gucalp, R. et al., Paecilomyces sinusitis in an immunocompromised adult patient: Case report and review, Clin. Infect. Dis., 23, 391, 1996.
5. Antachopoulos, C., Walsh, T.J., and Roilides, E., Fungal infections in primary immunode�ciencies, Eur. J. Pediatr., 166, 1099, 2007.
6. Tan, T.Q. et al., Paecilomyces lilacinus catheter-related fungemia in an immunocompromised pediatric patient, J. Clin. Microbiol., 30, 2479, 1992.
7. Chamilos, G. and Kontoyiannis, D.P., Voriconazole-resistant disseminated Paecilomyces variotii infection in a neutropenic patient with leukaemia on voriconazole prophylaxis. J. Infect., 51, e225, 2005.
8. Castelli, M.V. et al., Susceptibility testing and molecular classi�cation of Paecilomyces spp., Antimicrob. Agents Chemother., 52, 2926, 2008.
9. Cuenca-Estrella, M. et al., Activity pro�le in vitro of micafungin against Spanish clinical isolates of common and emerging species of yeasts and molds, Antimicrob. Agents Chemother., 53, 2192, 2009.
10. de Hoog, G.S., Guarro, J., Genè, J., and Figueras, M.J., Atlas of Clinical Fungi. 2nd edn., Centraalbureau voor Schimmelcultures/Universitat Rovira I Virgili, 2000.
11. Kwon-Chung, K.J. and Bennett, J.E., Medical Mycology, Lea & Febiger, Philadelphia, PA, 1992. 12. Pastor, F.J. and Guarro, J., Clinical manifestations, treatment and outcome of Paecilomyces lilacinus infections, Clin. Microbiol. Infect., 12, 948, 2006.
13. Akhunova, A.M., Infectious-allergic bronchopulmonary paecilomycosis, Ter. Arkh., 63, 19, 1991.
14. Allevato, P.A. et al., Paecilomyces javanicus endocarditis of native and prosthetic aortic valve, Am. J. Clin. Pathol., 82, 247, 1984.
15. Harris, L.F. et al., Paecilomyces cellulitis in a renal transplant patient: Successful treatment with intravenous miconazole, South. Med. J., 72, 897, 1979.
16. Pore, R.S. and Larsh, H.W., First occurrence of Thermoascus aurantiacus from animal and human sources, Mycologia, 59, 927, 1967.
17. Zeltzer, E. et al., Diminished chemokine and cytokine-induced adhesion of CD4+ T cells to extracellular matrix ligands in patients with end-stage renal failure, Isr. Med. Assoc. J., 2, 282, 2000.
18. Naldi, L. et al., Paecilomyces marquandii cellulitis in a kidney transplant patient, Br. J. Dermatol., 143, 647, 2000. 19. Quance-Fitch, F.J., Schachter, S., and Christopher, M.M., Pleural effusion in a dog with discospondylitis, Vet. Clin. Pathol., 31, 69, 2002. 20. Naggie, S. and Perfect, J.R., Molds: Hyalohyphomycosis, phaeohyphomycosis, and zygomycosis, Clin. Chest. Med., 30, 337, 2009. 21. Nucci, M. and Anaissie, E., Emerging fungi, Infect. Dis. Clin. North. Am., 20, 563, 2006. 22. Mosier, M.A. et al., Fungal endophthalmitis following intraocular lens implantation, Am. J. Ophthalmol., 83, 1, 1977. 23. Pettit, T.H. et al., Fungal endophthalmitis following intraocular lens implantation: A surgical epidemic, Arch. Ophthalmol., 98, 1025, 1980. 24. Diven, D.G. et al., Cutaneous hyalohyphomycosis caused by Paecilomyces lilacinus in a patient with lymphoma, J. Am. Acad. Dermatol., 35, 779, 1996. 25. Hall, V.C. et al., Cutaneous hyalohyphomycosis caused by Paecilomyces lilacinus: Report of three cases and review of the literature, Int. J. Dermatol., 43, 648, 2004. 26. Hilmarsdottir, I. et al., Cutaneous infection caused by Paecilomyces lilacinus in a renal transplant patient: Treatment with voriconazole, Scand. J. Infect. Dis., 32, 331, 2000. 27. Gottlieb, T. and Atkins, B.L., Case report: Successful treatment of cutaneous Paecilomyces lilacinus infection with oral itraconazole in an immune competent host, Mycoses, 44, 513, 2001. 28. Takayasu, S., Akagi, M., and Shimizu, Y., Cutaneous mycosis caused by Paecilomyces lilacinus, Arch. Dermatol., 113, 1687, 1977. 29. Gutierrez-Rodero, F. et al., Cutaneous hyalohyphomycosis caused by Paecilomyces lilacinus in an immunocompetent host successfully treated with itraconazole: Case report and review, Eur. J. Clin. Microbiol. Infect. Dis., 18, 814, 1999. 30. Saberhagen, C. et al., Infection due to Paecilomyces lilacinus: A challenging clinical identi�cation, Clin. Infect. Dis., 25, 1411, 1997. 31. Rockhill, R.C. and Klein, M.D., Paecilomyces lilacinus as the cause of chronic maxillary sinusitis, J. Clin. Microbiol., 11, 737, 1980. 32. Nayak, D.R. et al., Paecilomyces fungus infection of the paranasal sinuses, Int. J. Pediatr. Otorhinolaryngol., 52, 183, 2000. 33. Muller, H., Cikirikcioglu, M., and Lerch, R., Subaortic aneurysm caused by Paecilomyces lilacinus endocarditis, Arch. Cardiovasc. Dis., 101, 803, 2008. 34. Ono, N. et al., Lung abscess caused by Paecilomyces lilacinus, Respiration, 66, 85, 1999. 35. Fenech, F.F. and Mallia, C.P., Pleural effusion caused by Penicillium lilacinum, Br. J. Dis. Chest, 66, 284, 1972. 36. Carey, J. et al., Paecilomyces lilacinus vaginitis in an immunocompetent patient, Emerg. Infect. Dis., 9, 1155, 2003. 37. Haldane, E.V. et al., Prosthetic valvular endocarditis due to the fungus Paecilomyces, Can. Med. Assoc. J., 111, 963, 1974. 38. Silver, M.D., Tuffnell, P.G., and Bigelow, W.G., Endocarditis caused by Paecilomyces varioti affecting an aortic valve allograft, J. Thorac. Cardiovasc. Surg., 61, 278, 1971. 39. Chan, T.H., Koehler, A., and Li, P.K., Paecilomyces varioti peritonitis in patients on continuous ambulatory peritoneal dialysis, Am. J. Kidney Dis., 27, 138, 1996. 40. Crompton, C.H. et al., Peritonitis with Paecilomyces complicating peritoneal dialysis, Pediatr. Infect. Dis. J., 10, 869, 1991. 41. Kovac, D. et al., Treatment of severe Paecilomyces varioti peritonitis in a patient on continuous ambulatory peritoneal dialysis, Nephrol. Dial. Transplant., 13, 2943, 1998.
42. Marzec, A. et al., Paecilomyces variotii in peritoneal dialysate, J. Clin. Microbiol., 31, 2392, 1993.
43. Byrd, R.P. Jr. et al., Paecilomyces variotii pneumonia in a patient with diabetes mellitus, J. Diabetes Complications, 6, 150, 1992.
44. Dharmasena, F.M., Davies, G.S., and Catovsky, D., Paecilomyces variotii pneumonia complicating hairy cell leukaemia, Br. Med. J. (Clin. Res. Ed.), 290, 967, 1985. 45. Cohen-Abbo, A. and Edwards, K.M., Multifocal osteomyelitis caused by Paecilomyces variotii in a patient with chronic granulomatous disease, Infection, 23, 55, 1995.
46. Das, A. et al., Paecilomyces variotii in a pediatric patient with lung transplantation, Pediatr. Transplant., 4, 328, 2000.
47. Fagerburg, R. et al., Cerebrospinal ¼uid shunt colonization and obstruction by Paecilomyces variotii: Case report, J. Neurosurg., 54, 257, 1981.
48. Sherwood, J.A. and Dansky, A.S., Paecilomyces pyelonephritis complicating nephrolithiasis and review of Paecilomyces infections, J. Urol., 130, 526, 1983.
49. Pagano, L. et al., The role of neutrophils in the development and outcome of zygomycosis in haematological patients, Clin. Microbiol. Infect., 15(Suppl. 5), 33, 2009.
50. Ortoneda, M. et al., In vitro interactions of approved and novel drugs against Paecilomyces spp., Antimicrob. Agents Chemother., 48, 2727, 2004.
51. Atkins, S.D. et al., The use of real-time PCR and speciesspeci�c primers for the identi�cation and monitoring of Paecilomyces lilacinus, FEMS Microbiol. Ecol., 51, 257, 2005.
52. Beezhold, D.H. et al., Prevalence of allergic sensitization to indoor fungi in West Virginia, Allergy Asthma Proc., 29, 29, 2008.
53. Ujita, M. et al., Glucan-binding activity of silkworm 30-kDa apolipoprotein and its involvement in defense against fungal infection, Biosci. Biotechnol. Biochem., 69, 1178, 2005.
54. Schmechel, D., Simpson, J.P., and Lewis, D.M., The production and characterization of monoclonal antibodies to the fungus Aspergillus versicolor, Indoor Air, 15(Suppl. 9), 11, 2005. 55. Yang, S. et al., Biochemical characterization of a novel thermostable beta-1,3-1,4-glucanase (lichenase) from Paecilomyces thermophila, J. Agric. Food Chem., 56, 5345, 2008. 56. Obayashi, T. et al., Reappraisal of the serum (1–>3)-beta-dglucan assay for the diagnosis of invasive fungal infections— A study based on autopsy cases from 6 years, Clin. Infect. Dis., 46, 1864, 2008. 57. de Pauw, B. et al., Revised de�nitions of invasive fungal disease from the European Organization for Research and Treatment of Cancer/Invasive Fungal Infections Cooperative Group and the National Institute of Allergy and Infectious Diseases Mycoses Study Group (EORTC/MSG) Consensus Group, Clin. Infect. Dis., 46, 1813, 2008. 58. Koo, S. et al., Diagnostic performance of the (1–>3)-beta-dglucan assay for invasive fungal disease, Clin. Infect. Dis., 49, 1650, 2009. 59. Pfeiffer, C.D., Fine, J.P., and Safdar, N., Diagnosis of invasive aspergillosis using a galactomannan assay: A meta-analysis, Clin. Infect. Dis., 42, 1417, 2006. 60. Balajee, S.A. et al., Sequence-based identi�cation of Aspergillus, Fusarium, and mucorales species in the clinical mycology laboratory: Where are we and where should we go from here? J. Clin. Microbiol., 47, 877, 2009. 61. White, T.J. et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics, in: Innis, M. (Ed.), PCR Protocols: A guide to Methods and Applications, Academic Press, San Diego, CA, 1990, pp. 315–322. 62. Haugland, R.A. et al., Quantitative PCR analysis of selected Aspergillus, Penicillium and Paecilomyces species, Syst. Appl. Microbiol., 27, 198, 2004. 63. Maresca, B. and Kobayashi, G.S., Molecular Biology of Pathogenic Fungi: A Laboratory Manual, Telos Press, New York, 1994. 64. Cuenca-Estrella, M. et al., Incidence of zygomycosis in transplant recipients. Clin. Microbiol. Infect., 15, S37, 2009. 40 Chapter 40 - Paracoccidioides
4. Benard, G. et al., Severe acute paracoccidioidomycosis in children, Pediatr. Infect. Dis. J., 13, 510, 1994.
5. Marques, S.A., Paracoccidioidomycosis: Epidemiological, clinical and treatment up-date, An. Bras. Dermatol., 78, 135, 2003.
6. Pereira, R.M. et al., Fatal disseminated paracoccidioidomycosis in a two-year-old child, Rev. Inst. Med. Trop. Sao Paulo, 46, 37, 2004.
7. Plá, M.P. et al., Neuroparacoccidioidomycosis: Case report and review, Mycopathologia, 127, 139, 1994.
8. Paniago, A.M. et al., Neuroparacoccidioidomycosis: Analysis of 13 cases observed in an endemic area in Brazil, Trans. R. Soc. Trop. Med. Hyg., 101, 414, 2007.
9. Valle, A.C.F. et al., A case report of intraspinal paracoccidioidomycosis, Rev. Inst. Med. Trop. São Paulo, 40, 203, 1998.
10. Valera, E.T. et al., Fungal infection by Paracoccidioides brasiliensis mimicking bone tumor, Pediatr. Blood Cancer, 50, 1284, 2008.
11. Resende, L.S. et al., Bone marrow necrosis related to paracoccidioidomycosis: The �rst eight cases identi�ed at autopsy, Histopathology, 54, 486, 2009.
12. Severo, L.C. et al., Paracoccidioidomycosis of the male genital tract. Report of eleven cases and review of Brazilian literature, Rev. Inst. Med. Trop. São Paulo, 42, 38, 2000.
13. Lopes, D.L. et al., Prostatic paracoccidioidomycosis: Differential diagnosis of prostate cancer, Mem. Inst. Oswaldo Cruz, 104, 33, 2009.
14. Agudelo, C.A. et al., Identi�cation of Paracoccidioides brasiliensis in adrenal glands biopsies of two patients with paracoccidioidomycosis and adrenal insuf�ciency, Rev. Inst. Med. Trop. Sao Paulo, 51, 45, 2009.
15. Castro, L.G.M. et al., Hard palate perforation: An unusual �nding in paracoccidioidomycosis, Int. J. Dermatol., 40, 281, 2001. 16. Silva, C.O. et al., Gingival involvement in oral paracoccidioidomycosis, J. Periodontol., 78, 1229, 2007.
17. Marques, S.A. et al., Paracoccidioidomycosis: In�ltrated, sarcoid-like cutaneous lesions misinterpreted as tuberculoid leprosy, Rev. Inst. Med. Trop. Sao Paulo, 50, 47, 2008.
18. Ajello, L. and Polonelli, L., Imported paracoccidioidomycosis: A public health problem in non-endemic areas, Eur. J. Epidemiol., 1, 160, 1985.
19. Benoldi, D. et al., Paracoccidioidomycosis (South American blastomycosis): A report of an imported case previously diagnosed as tuberculosis, Eur. J. Epidemiol., 1, 150, 1985.
20. Horre, R. et al., A case of imported paracoccidioidomycosis in a German legionnaire, Med. Mycol., 40, 213, 2002.
21. Kamei, K. et al., The trend of imported mycoses in Japan, J. Infect. Chemother., 9, 16, 2003.
22. Ginarte, M., Pereiro, M. Jr., and Toribio, J., Imported paracoccidioicomycosis in Spain, Mycoses, 46, 407, 2003.
23. Mayr, A. et al., Chronic paracoccidioidomycosis in a female patient in Austria, Eur. J. Clin. Microbiol. Infect. Dis., 23, 916, 2004.
24. Van Damme, P.A. et al., A case of imported paracoccidioidomycosis: An awkward infection in the Netherlands, Med. Mycol., 44, 13, 2006.
25. Mayayo, E. et al., Report of an imported cutaneous disseminated case of paracoccidioidomycosis, Rev. Iberoam. Micol., 24, 44, 2007.
26. Bousquet, A. et al., Imported mycosis: A review of paracoccidioidomycosis, Med. Mal. Infect., 37, S210, 2007.
27. Bräuninger, W., Hastra, K., and Rubin, R., Paracoccidioidomycosis, an imported tropical disease, Hautarzt, 36, 408, 1985. 28. Lacaz, C.S., Historical evolution or the knowledge on paracoccidioidomycosis and its etiologic agent, Paracoccidioides brasiliensis, in Paracoccidioidomycosis, Franco, M. et al., Eds., Boca Raton, FL: CRC Press, 1994, 410pp. 29. Restrepo, A., The ecology of Paracoccidioides brasiliensis: A puzzle still unsolved, J. Med. Vet. Mycol., 23, 323, 1985. 30. Restrepo, A., Ecology of Paracoccidioides brasiliensis, in Paracoccidioidomycosis, Franco, M. et al. Eds. Boca Raton, FL: CRC Press, 1994. 31. Costa, E.O., Diniz, L.S.M., and Fava-Netto, C., The prevalence of positive intradermal reactions to paracoccidioidin in domestic and wild animals in São Paulo, Brazil, Vet. Res. Commun., 19, 127, 1995. 32. Costa, E.O. et al., Delayed hypersensitivity test with paracoccidioidin in captive Latin American wild mammals, J. Med. Vet. Mycol., 33, 39, 1995. 33. Richini-Pereira, V.B. et al., Molecular detection of Paracoccidioides brasiliensis in road-killed wild animals, Med. Mycol., 46, 35, 2008. 34. Richini-Pereira, V.B. et al., Molecular approaches for eco- epidemiological studies of Paracoccidioides brasiliensis, Mem. Inst. Oswaldo Cruz, 104, 636, 2009. 35. Bagagli, E. et al., Isolation of Paracoccidioides brasiliensis from armadillos (Dasypus novemcinctus) captured in an endemic area of paracoccidioidomycosis, Am. J. Trop. Med. Hyg., 58, 505, 1998. 36. Restrepo, A., Morphological aspects of Paracoccidioides brasiliensis in lymph nodes: Implications for the prolonged latency of paracoccidioidomycosis?, Med. Mycol., 38, 317, 2000. 37. Silva-Vergara, M.L., Martínez, R., and Camargo, Z.P., Isolation of Paracoccidioides brasiliensis from armadillo (Dasypus novemcinctus) in an area where the fungus was recently isolated from soil, Med. Mycol., 38, 185, 2000. 38. Bagagli, E. et al., High frequency of Paracoccidioides brasiliensis infection in armadillo (Dasypus novemcinctus): An ecological study, Med. Mycol., 41, 217, 2003. 39. Corredor, G.G. et al., The naked-tailed armadillo Cabassous centralis (Miller 1899): A new host to Paracoccidiodes brasiliensis. Molecular identi�cation of the isolate, Med. Mycol., 43, 275, 2005. 40. Ricci, G., Mota, F.T., and Wakamatsu, A., Canine paracoccidioidomycosis, Med. Mycol., 42, 379, 2004. 41. Farias, M.R. et al., Canine paracoccidioidomycosis: Case report of generalized lymphadenits [abstract], Rev. Inst. Med. Trop. Sao Paulo, Suppl 14, 64, 2005. 42. Untereiner, W.A. et al., The Ajellomycetaceae, a new family of vertebrate-associate Onygenales, Mycologia, 96, 812, 2004. 43. Wang, H. et al., A fungal phylogeny based on 82 complete genomes using the composition vector method, BMC Evol. Biol., 10, 195, 2009. 44. Herr, R.A. et al., Phylogenetic analysis of Lacazia loboi places this previously uncharacterized pathogen within the dimorphic Onygenales, J. Clin. Microbiol., 39, 309, 2001. 45. Vilela, R. et al., Molecular phylogeny of animal pathogen Lacazia loboi inferred from rDNA and DNA coding sequences, Mycol. Res., 113, 851, 2009. 46. Bagagli, E. et al., Phylogenetic and evolutionary aspects of Paracoccidioides brasiliensis reveal a long coexistence with animal hosts that explain several biological features of the pathogen, Infect. Genet. Evol., 6, 344, 2006. 47. Bagagli, E., Paracoccidioides brasiliensis: Phylogenetic and ecological aspects, Mycopathologia, 165, 197, 2008.
48. Franco, M. et al., Paracoccidioides brasiliensis antigen batches from the same isolate show immunological and biochemical differences, Mycopathologia, 135, 13, 1996.
49. Calgagno, A.M., Geographic discrimination of Paracoccidioides brasiliensis strains by randomly ampli�ed polymorphic DNA analysis, J. Clin. Microbiol., 36, 1733, 1998.
50. Sano, A. et al., Comparison between human and armadillo Paracoccidioides brasiliensis isolates by random ampli�ed polymorphic DNA analysis, Mycopathologia, 143, 165, 1999.
51. Hebeler-Barbosa, F., Montenegro, M.R., and Bagagli, E., Virulence pro�les of ten Paracoccidioides brasiliensis isolates obtained from armadillos (Dasypus novemcinctus), Med. Mycol., 41, 89, 2003.
52. Hebeler-Barbosa, F. et al., Sequence comparison of the internal transcribed spacer regions and gp 43 in Paracoccidioides brasiliensis for patients and armadillos Dasypus novemcinctus, J. Clin. Microbiol., 41, 5735, 2003.
53. Macoris, S.A.G. et al., Virulence attenuation and phenotypic variation of Paracoccidioides brasiliensis isolates obtained from armadillos and patients, Mem. Inst. Oswaldo Cruz, 101, 331, 2006.
54. Puccia, R., McEwen, J.G., and Cisalpino, P.S., Diversity in Paracoccidioides brasiliensis. The PbGP43 gene as a genetic marker, Mycopathologia, 165, 275, 2008.
55. Matute, D.R. et al., Cryptic speciation and recombination in the fungus Paracoccidioides brasiliensis as revealed by gene genealogies, Mol. Biol. Evol., 23, 65, 2006.
56. Carrero, L.L. et al., New Paracoccidioides brasiliensis isolate reveals unexpected genomic variability in this human pathogen, Fung. Genet. Biol., 45, 605, 2008.
57. Teixeira, M.M. et al., Phylogenetic analysis reveals a high level of speciation in the Paracoccidioides genus, Mol. Phylogenet. Evol., 52, 273, 2009.
58. Matute, D.R. et al., Microsatellite analysis of three phylogenetic species of Paracoccidioides brasiliensis, J. Clin. Microbiol., 44, 2153, 2006b.
59. Theodoro, R.C., Bagagli, E., and Oliveira, C., Phylogenetic analysis of PRP8 intein in Paracoccidioides brasiliensis species complex, Fung. Genet. Biol., 45, 1284, 2008.
60. Lutz, A., Uma micose pseudo-coccidica localizada na boca e observada no Brasil: Contribuição ao conhecimento das hiphoblastomicoses americanas, Brasil Med., 22, 121, 1908.
61. Batista Jr. J. et al., Is the geographical origin of a Paracoccidioides brasiliensis isolate important for antigen production for regional diagnosis of paracoccidioidomycosis? Mycoses, 53, 176, 2010.
62. Takayama, A. et al., An atypical Paracoccidioides brasiliensis clinical isolate based on multiple gene analysis, Med. Mycol., 19, 1, 2009.
63. Salina, M.A. et al., Detection of circulating Paracoccidioides brasiliensis antigen in urine of paracoccidioidomycosis patients before and during treatment, J. Clin. Microbiol., 36, 1723, 1998.
64. Sano, A. et al., Detection of gp43 and ITS1-5.8S-ITS2 ribosomal RNA genes of Paracoccidioides brasiliensis in paraf�nembedded tissue, Nippon Ishinkin Gakkai Zasshi, 42, 23, 2001.
65. Bialek, R. et al., Detection of Paracoccidioides brasiliensis in tissue samples by a Nested PCR assay, J. Clin. Microbiol., 38, 2940, 2000.
66. Albuquerque, C.F., Silva, S.H.M., and Camargo, Z.P., Improvement of the speci�city of an enzyme-linked immunosorbent assay for diagnosis of Paracoccidioidomycosis, J. Clin. Microbiol., 43, 1944, 2005. 67. Goldani, L.Z., Maia, A.L., and Sugar, A.M., Cloning and nucleotide sequence of a speci�c DNA fragment from Paracoccidioides brasiliensis, J. Clin. Microbiol., 33, 1652, 1995. 68. Goldani, L.Z. and Sugar, A.M., Short report: Use of the polymerase chain reaction to detect Paracoccidioides brasiliensis in murine paracoccidioidomycosis, Am. J. Trop. Med. Hyg., 58, 152, 1998. 69. Gomes, G.M. et al., PCR for diagnosis of paracoccidioidomycosis, J. Clin. Microbiol., 38, 3478, 2000. 70. Ricci, G. et al., Detection of Paracoccidioides brasiliensis by PCR in biopsies from patients with paracoccidioidomycosis: Correlation with the histopathological pattern, Pathologica, 99, 41, 2007. 71. Díez, S. et al., PCR with Paracoccidioides brasiliensis speci�c primers: Potential use in ecological studies, Rev. Inst. Med. Trop. Sao Paulo, 41, 351, 1999. 72. Corredor, G.G. et al., Isolation of Paracoccidioides brasiliensis from the nine-banded armadillo Dasypus novemcinctus, in an endemic area for paracoccidioidomycosis in Colombia, Rev. Iberoam. Micol., 16, 216, 1999. 73. San-Blas, G. et al., Primer for clinical detection of Paracoccidioides brasiliensis, J. Clin. Microbiol., 43, 4255, 2005. 74. Motoyama, A.B. et al., Molecular identi�cation of Paracoccidioides brasiliensis by PCR ampli�cation of ribosomal DNA, J. Clin. Microbiol., 38, 3106, 2000. 75. Imai, T., Sano, A., and Mikami, Y., A new PCR primer for the identi�cation of Paracoccidioides brasiliensis based on rRNA sequences coding the internal transcribed spacers (ITS) and 5.8 regions, Med. Mycol., 38, 323, 2000. 76. Theodoro, R.C. et al., Molecular detection of Paracoccidioides brasiliensis in soil, Med. Mycol., 43, 725, 2005. 77. Terçarioli, G.R. et al., Ecological study of Paracoccidioides brasiliensis in soil: Growth ability, conidia production and molecular detection, BMC Microbiol., 7, 1, 2007. 78. Buitrago, M.J. et al., Utility of real-time PCR for the detection of Paracoccidioides brasiliensis DNA in the diagnosis of imported paracoccidioidomycosis, Med. Mycol., 31, 1, 2009. 79. White, T.J. et al., Ampli�cation and direct sequencing of fungal ribossomal RNA genes for phylogenetics, in PCR Protocols-—A Guide to Methods and Applications, Innis, M.A. et al., Eds., San Diego, CA: Academic Press, Inc., 1990, pp. 315–322. 80. Cisalpino, P.S. et al., Cloning, characterization, and epitope expression of the major diagnostic antigen of Paracoccidioides brasiliensis, J. Biol. Chem., 271, 4553, 1996. 81. Ricci, G. et al., Genotyping of Paracoccidioides brasiliensis directly from paraf�n embedded tissue, Med. Mycol., 43, 31, 2008. 82. McEwen, J.G. et al., Molecular cloning, nucleotide sequencing, and characterization of a 27-kDa antigenic protein from Paracoccidioides brasiliensis, Fungal Genet. Biol., 20, 125, 1996. 83. Buckley, M., The Fungal Kingdom Diverse and Essential Roles in Earth’s Ecosystem, Washington, DC: American Academy of Microbiology, 2008, p. 44. 84. Iwen, P.C., Hinrichs, S.H., and Rupp, M.E., Utilization of the internal transcribed spacer regions as molecular targets to detect and identify human fungal pathogens, Med. Mycol., 40, 87, 2002.
41 Chapter 41 - Penicillium: Mycoses and Mycotoxinoses
1. Santos, C. et al., Filamentous fungal characterizations by matrix-assisted laser desorption/ionization time-of-¼ight mass spectrometry, J. Appl. Microbiol., 108, 375, 2010.
2. Paterson, R.R.M., Venâncio, A., and Lima, N., Solutions to Penicillium taxonomy crucial to mycotoxin research and health, Res. Microbiol., 155, 507, 2004.
3. Frisvad, J.C. and Samson, R.A., Polyphasic taxonomy of Penicillium subgenus Penicillium: A guide to identi�cation of food and air-borne terverticillate Penicillia and their mycotoxins, Stud. Mycol., 49, 1, 2004.
4. Pitt, J.I. and Hocking, A.D., Fungi and Food Spoilage, 2nd edn., Blackie Academic & Professional, London, U.K., 1997.
5. Richardson, M.D., Aspergillus and Penicillium species, in Medical Mycology, Ajello, L. and Hay, R.J., Eds., Arnold, London, U.K., 1998, p. 281.
6. Hocquette, A. et al., Les champignons des genres Acremonium, Beauveria, Chrysosporium, Fusarium, Onychocola, Paecilomyces, Penicillium, Scedosporium et Scopulariopsis responsables de hyalohyphomycoses, J. Mycol. Méd., 15, 136, 2005.
7. Vanittanakom, N. et al., Penicillium marneffei infection and recent advances in the epidemiology and molecular biology aspects, Clin. Microbiol. Rev., 19, 95, 2006.
8. Cappni, M., Sureau, P., and Segretain, G., Pénicillose de Rhizomys sinensis, Bull. Soc. Pathol. Exot., 49, 418, 1956.
* The trial is now published in: Rerks-Ngarm, P. et al., Vaccination with
ALVAC and AIDSVAX to prevent HIV-1 infection in Thailand. N. Engl.
J. Med., 361, 2209, 2009. 9. Supparatpinyo, K. et al., Disseminated Penicillium marneffei infection in Southeast Asia, Lancet, 344, 110, 1994. 10. Supparatpinyo, K. et al., A controlled trial of itraconazole to prevent relapse of Penicillium marneffei infection in patients infected with the human immunode�ciency virus, N. Engl. J. Med., 339, 1739, 1998. 11. Segretain, G., Description d’une nouvelle espèce de penicillium: Penicillium marneffei n. sp., Bull. Soc. Mycol. Fr., 75, 412, 1959. 12. Frisvad, R.A. and Filtenborg, O., Revision of Penicillium subgenus Furcatum based on secondary metabolites and conventional characters, in Modern Concepts in Penicillium and Aspergillus classi¡cation, Samson, R.A., Pitt, J.I., Eds., Plenum Press, New York, 1990, p. 159. 13. LoBuglio, K.F. and Taylor, J., Phylogeny and PCR identi�cation of the human pathogenic fungus Penicillium marneffei, J. Clin. Microbiol., 33, 85, 1995. 14. Cai, J.J., Understanding the pathogenic fungus Penicillium marneffei: A computational genomics perspective, PhD thesis, The University of Hong Kong, 2006. 15. Piehl, M.R., Kaplan, R.L., and Haber, M.H., Disseminated penicilliosis in a patient with acquired immunode�ciency syndrome, Arch. Pathol. Lab. Med., 112, 1262, 1988. 16. Sathapatayavongs, B. et al., Disseminated penicilliosis associated with HIV infection, J. Infect., 19, 84, 1989. 17. Pócsi, Z. et al., Yeast-like cell formation and glutathione metabolism in autolysing cultures of Penicillium chrysogenum, Acta Biol. Hungar., 58, 431, 2007. 18. Devlieghere, F., Debevere, J., and Van Impe, J., Concentration of carbon dioxide in the water-phase as a parameter to model the effect of a modi�ed atmosphere on microorganisms, Int. J. Food Microbiol., 43, 105, 1998. 19. Cao, C. et al., The effects of temperature, pH, and salinity on the growth and dimorphism of Penicillium marneffei, Med. Mycol., 45, 401, 2007. 20. Viviani, M.A. and Tortorano, A.M., Penicillium marneffei, in Topley & Wilson’s Microbiology and Microbial Infections, Ajello, L. and Hay, R.J., Eds., 9th edn., Medical Mycology, Arnold, London, U.K., 1989, p. 409. 21. Mapari, S.A.S. et al., Identi�cation of potentially safe promising fungal cell factories for the production of polyketide natural food colorants using chemotaxonomic rationale, Microb. Cell Fact., 8, 24, 2009. 22. Ehrlich, K.C. et al., Secalonic acid D: Natural contaminant of corn dust, Appl. Environ. Microbiol., 44, 1007, 1982. 23. Bhardwaj, S. et al., Putative structure and characteristics of a red water-soluble pigment secreted by Penicillium marneffei, Med. Mycol., 45, 419, 2007. 24. Youngchim, S., Vanittanakom, N., and Hamilton, A.J., Analysis of the enzymatic activity of mycelial and yeast phases of Penicillium marneffei, Med. Mycol., 37, 445, 1999. 25. Wong, S.S. et al., Biotyping of Penicillium marneffei reveals concentration-dependent growth inhibition by galactose, J. Clin. Microbiol., 39, 1416, 2001. 26. Gugnani, H.C. et al., Cannomys badius as a natural animal host of Penicillium marneffei in India, J. Clin. Microbiol., 42, 5070, 2004. 27. Vanittanakom, N. and Sirisanthana, T., Penicillium marneffei infection in patients infected with human immunode�ciency virus, Curr. Top. Med. Mycol., 8, 35, 1997. 28. Pongpom, P., Cooper, Jr. C.R., and Vanittanakom, N., Isolation and characterization of a catalase-peroxidase gene from the pathogenic fungus, Penicillium marneffei, Med. Mycol., 43, 403, 2005.
29. Chariyalertsak, S. et al., Rhizomys sumatrensis and Cannomys badius, new natural animal hosts of Penicillium marneffei, J. Med. Vet. Mycol., 34, 105, 1996.
30. Chariyalertsak, S. et al., Case-control study of risk factors for Penicillium marneffei infection in human immunode�ciency virus-infected patients in northern Thailand, Clin. Infect. Dis., 24, 1080, 1997.
31. Frisvad, J.C. et al., The homogeneous species and series in subgenus Penicillium are related to mammal nutrition and excretion, in Integration of Modern Taxonomic Methods for Penicillium and Aspergillus Classi¡cation, Samson, R.A. and Pitt, J.I., Eds., Harwood Academic, the Netherlands, 2000, p. 265.
32. Vanittanakom, N. et al., Ef�ciency of ¼otation method in the isolation of Penicillium marneffei from seeded soil, J. Med. Vet. Mycol., 33, 271, 1995.
33. Drouhet, E., Penicilliosis due to Penicillium marneffei: A new emerging systemic mycosis in AIDS patients travelling or living in Southeast Asia. Review of 44 cases reported in HIV infected patients during the last 5 years compared to 44 cases of non AIDS patients reported over 20 years, J. Mycol. Med. (Paris), 4, 195, 1993.
34. Hamilton, A.J. et al., Recognition of �bronectin by Penicillium marneffei conidia via a sialic acid dependent process and its relationship to the interaction between conidia and laminin, Infect. Immun., 67, 5200, 1999.
35. Hamilton, A.J. et al., Sialic-acid dependent recognition of laminin by Penicillium marneffei conidia, Infect. Immun., 66, 6024, 1998.
36. Supparatpinyo, K. et al., Penicillium marneffei infection in patients infected with human immunode�ciency virus, Clin. Infect. Dis., 14, 871, 1992.
37. Sisto, F. et al., Differential cytokine pattern in the spleens and livers of BALB/c mice infected with Penicillium marneffei: Protective role of gamma interferon, Infect. Immun., 71, 465, 2003.
38. Koguchi, Y. et al., Penicillium marneffei causes osteopontinmediated production of interleukin-12 by peripheral blood mononuclear cells, Infect. Immun., 70, 1042, 2002.
39. Estrada, J.A. et al., Immunohistochemical identi�cation of Penicillium marneffei by monoclonal antibody, Int. J. Dermatol., 31, 410, 1992.
40. Notermans, S. et al., (1–5) linked beta-d-galctofuranosides are immunodominant in extracellular polysaccharides of Penicillium and Aspergillus species, Mol. Immunol., 25, 975, 1988.
41. Vanittanakom, N. et al., Penicillium marneffei, past, present and future identi�cation methods, in The 15th Congress of the International Society for Human and Animal Mycology, McGinnis, M.R., Rinaldi, M.G., and Graybill, J.R., Eds., San Antonio, TX, 2003, p. 273.
42. Kaufman, L. et al., Development of speci�c ¼uorescentantibody test for tissue form of Penicillium marneffei, J. Clin. Microbiol., 33, 2136, 1995.
43. Trewatcharegon, S. et al., Production and characterization of monoclonal antibodies reactive with the mycelial and yeast phases of Penicillium marneffei, Med. Mycol., 38, 91, 2000.
44. Chaiwun, B. et al., Lymhadenopathy due to Penicillium marneffei infection: Diagnosis by �ne needle aspiration cytology, Mod. Pathol., 15, 939, 2002.
45. Ma, K.F., Tsui, M.S., and Tsang, D.N., Fine needle aspiration diagnosis of Penicillium marneffei infection, Acta Cytol., 35, 557, 1991. 46. Sekhon, A.S., Li, J.S.K., and Garg, A.K., Penicilliosis marneffei: Serological and exoantigen studies, Mycopathologia, 77, 51, 1982. 47. Sekhon, A.S., Garg, A.K., and Padhye, A.A., Antigenic relationship of Penicillium marneffei to P. primulinum, J. Med. Vet. Mycol., 27, 105, 1989. 48. Viviani, M.A. et al., Treatment and serological studies of an Italian case of penicilliosis marneffei contracted in Thailand by a drug addict infected with the human immunode�ciency virus, Eur. J. Epidemiol., 9, 79, 1993. 49. Kaufman, L. et al., Diagnostic antigenemia tests for penicilliosis marneffei, J. Clin. Microbiol., 34, 2503, 1996. 50. Yuen, K.Y. et al., Serodiagnosis of Penicillium marneffei infection, Lancet, 344, 444, 1994. 51. Vanittanakom, N. et al., Western immunoblot analysis of protein antigens of Penicillium marneffei, J. Med. Vet. Mycol., 35, 123, 1997. 52. Chongtrakool, P. et al., Immunoreactivity of a 38-kilodalton Penicillium marneffei antigen with human immunode�ciency virus-positive sera, J. Clin. Microbiol., 35, 2220, 1997. 53. Jeavons, L. et al., Identi�cation and puri�cation of speci�c Penicillium marneffei antigens and their recognition by human immune sera, J. Clin. Microbiol., 36, 949, 1998. 54. Cao, L. et al., Detection of speci�c antibodies to an antigenic mannoprotein for diagnosis of Penicillium marneffei penicilliosis, J. Clin. Microbiol., 36, 3028, 1998. 55. Van Cutsem, J., Fungal models in immunocompromised animals, in Mycoses in AIDS Patients, Van Den Bossche, H. et al., Eds., Plenum Press, New York, 1990, p. 207. 56. Desakorn, V. et al., Diagnosis of Penicillium marneffei infection by quantitation of urinary antigen by using an enzyme immunoassay, J. Clin. Microbiol., 37, 117, 1999. 57. Desakorn, V. et al., Development and evaluation of rapid urinary antigen detection tests for diagnosis of penicilliosis marneffei, J. Clin. Microbiol., 40, 3179, 2002. 58. Panichakul, T. et al., Development of a monoclonal antibodybased enzyme-linked immunosorbent assay for the diagnosis of Penicillium marneffei infection, Am. J. Trop. Med. Hyg., 67, 443, 2002. 59. Pitt, J.I., Toxigenic fungi and mycotoxins, Br. Med. Bull., 20, 184, 2000. 60. Paterson, R.R.M. and Lima, N., Toxicology of mycotoxins, in Molecular, Clinical and Environmental Toxicology. Volume 2: Clinical Toxicology, Luch, A., Ed., Birkhäuser Verlag, Switzerland, 2009, p. 31. 61. Paterson, R.R.M., Fungi and fungal toxins as weapons, Mycol. Res., 110, 1003, 2006. 62. CAST, Mycotoxins: Risks in Plant, Animal, and Human Systems, Council for Agricultural Science and Technology, Ames, IA, 2003. 63. Marasas, W.F.O. and Nelson, P.E., Mycotoxicology, Pennsylvania State University Press, PA, 1987. 64. Riley, R.T. and Showker, J.L., The mechanism of patulin’s cytotoxicity and the antioxidant activity of indole tetramic acids, Toxicol. Appl. Pharmacol., 109, 108, 1991. 65. Paterson, R.R.M. et al., Mutagenic and inhibitory compounds produced by fungi affect detrimentally their PCR-based diagnosis and phylogenetic analyses. Curr. Bioact. Comp., 4, 245, 2008. 66. Palma, N. et al., Ochratoxin A-induced mutagenesis in mammalian cells is consistent with the production of oxidative stress, Chem. Res. Toxicol., 20, 1031, 2007. 67. Schumacher, D.M. et al., DNA–DNA cross-links contribute to the mutagenic potential of the mycotoxin patulin, Toxicol. Lett., 166, 268, 2006.
68. Knaus, H.-G. et al., Tremorgenic indole alkaloids potently inhibit smooth muscle high-conductance calcium-activated potassium channels, Biochemistry, 33, 5819, 1994.
69. Pitt, J.I., The genus Penicillium and Its Teleomorphic States Eupenicillium and Talaromyces, Academic Press, London, U.K., 1979.
70. Peterson, S.W., Phylogenetic analysis of Penicillium species based in ITS and LSU-rDNA nucleotide sequences, in Integration of Modern Taxonomic Methods for Penicillium and Aspergillus Classi¡cation, Samson, R.A. and Pitt, J.I., Eds., Harwood Academic, Amsterdam, the Netherlands, 2000, p. 163.
71. Bridge, P.D. et al., A reappraisal of the terverticillate penicillia using biochemical, physiological, and morphological features. I. Numerical taxonomy, J. Gen. Microbiol., 135, 2941, 1989.
72. Seifert, K.A. and Lous-Seize, G., Phylogeny and species concepts in the Penicillium aurantiogriseum complex as inferred from partial β-tubulin gene DNA sequences, in Integration of Modern Taxonomic Methods for Penicillium and Aspergillus Classi¡cation, Samson, R.A. and Pitt, J.I., Eds., Harwood Academic, Amsterdam, the Netherlands, 2000, p. 189.
73. Samson, R.A. et al., Phylogenetic analysis of Penicillium subgenus Penicillium using β-tubulin sequences, Stud. Mycol., 49, 175, 2004.
74. Paterson, R.R.M. Book review, Mycotaxon, 91, 519–521, 2005.
75. Paterson, R.R.M. et al., A reappraisal of the terverticillate penicillia using biochemical, physiological, and morphological features. III. An evaluation of pectinases and amylase isozymes for species characterization, J. Gen. Microbiol., 135, 2979, 1989.
76. Paterson, R.R.M., Venâncio, A., and Lima, N., A novel identi�cation system based on 318 penicillia strains using the isoepoxydon dehydrogenase gene and patulin production, Rev. Ibero. Micol., 23, 155, 2006.
77. Dupont, J., Penicillium, in Molecular Detection of Foodborne Pathogens, Liu, D., Ed., CRC Press, Boca Raton, FL, 2009, pp. 585–594.
78. White, T.J. et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics, in PCR Protocols: A Guide to Methods and Applications, Innis, M.A. et al., Eds., Academic Press Inc., New York, 1990, p. 315.
79. Tsunemi, Y., Takahashi, T., and Tamaki, T., Penicillium marneffei infection diagnosed by polymerase chain reaction from the skin specimen, J. Am. Acad. Dermatol., 49, 344, 2003.
80. Lindsley, M.D. et al., Rapid identi�cation of dimorphic and yeast-like fungal pathogens using speci�c DNA probes, J. Clin. Microbiol., 39, 3505, 2001.
81. Vanittanakom, N. et al., Speci�c identi�cation of Penicillium marneffei by a polymerase chain reaction/hybridization technique, Med. Mycol., 36, 169, 1998.
82. Vanittanakom, N., Vanittanakom, P., and Hay, R.J., Rapid identi�cation of Penicillium marneffei by PCR-based detection of speci�c sequences on the rRNA gene, J. Clin. Microbiol., 40, 1739, 2002.
83. Prariyachatigul, C. et al., Development and evaluation of a one-tube seminested PCR assay for the detection and identi�cation of Penicillium marneffei, Mycoses, 46, 447, 2003.
84. Vanittanakom, N. et al., Restriction endonuclease analysis of Penicillium marneffei, J. Clin. Microbiol., 34, 1834, 1996. 85. Hsueh, P.R. et al., Molecular evidence for strain dissemination of Penicillium marneffei: An emerging pathogen in Taiwan, J. Infect. Dis., 181, 1712, 2000. 86. Imwidthaya, P. et al., Penicillium marneffei: Types and drug susceptibility, Mycopathologia, 149, 109, 2001. 87. Trewatcharegon, S. et al., Molecular typing of Penicillium marneffei isolates from Thailand by NotI macrorestriction and pulsed-�eld gel electrophoresis, J. Clin. Microbiol., 39, 4544, 2001. 88. Yuen, K.Y. et al., Exploring the Penicillium marneffei genome, Arch. Microbiol., 179, 339, 2003. 89. Fisher, M.C., de Hoog, S., and Vanittanakom, N., A highly discriminatory multilocus microsatellite typing (MLMT) system for Penicillium marneffei, Mol. Ecol. Notes, 4, 515, 2004. 90. Lasker, B.A. and Ran, Y., Analysis of polymorphic microsatellite markers for typing Penicillium marneffei isolates, J. Clin. Microbiol., 42, 1483, 2004. 91. Fisher, M.C. et al., Multilocus microsatellite typing system for Penicillium marneffei reveals spatially structured populations, J. Clin. Microbiol., 42, 5065, 2004. 92. Ranjana, K.H. et al., Disseminated Penicillium marneffei infection among HIV-infected patients in Manipur state, India, J. Infect., 45, 268, 2002. 93. Pedersen, L.H. et al., Detection of Penicillium species in complex food samples using the polymerase chain reaction, Int. J. Food Microbiol., 35, 169, 1997. 94. Marek, P., Annamalai, T., and Venkitanarayanan, K., Detection of Penicillium expansum by polymerase chain reaction, Int. J. Food. Microbiol., 89, 139, 2003. 95. Calderon, C. et al., Detection of airborne fungal spores sampled by rotating arm and Hirst-type spore traps using polymerase chain reaction assays, J. Aerosol. Sci., 33, 283, 2002. 96. Colombo, F. et al., Identi�cation of Penicillium aurantiogriseum species with a method of polymerase chain reactionrestriction fragment length polymorphism, Food Contr., 14, 137, 2003. 97. Sholberg, P.L. et al., Benzimidazole and diphenylamine sensitivity and identity of Penicillium spp. that cause postharvest blue mold of apples using β-tubulin gene sequences, Postharvest Biol. Technol., 36, 41, 2005. 98. Dupont, J. et al., Molecular tools for identi�cation of Penicillium starter cultures used in the food industry, Int. J. Food Microbiol., 49, 109, 1999. 99. Dao, H.P., Mathieu, F., and Lebrihi, A., Two primer pairs to detect OTA producers by PCR method, Int. J. Food Microbiol., 104, 61, 2005. 100. Paterson, R.R.M., Identi�cation and quanti�cation of mycotoxigenic fungi by PCR, Process. Biochem., 41, 1467, 2006. 101. Geisen, R. et al., Development of a real time PCR system for detection of Penicillium nordicum and for monitoring ochratoxin A production in foods by targeting the ochratoxin polyketide synthase gene system, Appl. Microbiol., 27, 501, 2004. 102. Bogs, C., Battilani, P., and Geisen, R., Development of a molecular detection and differentiation system for ochratoxin A producing Penicillium species and its application to analyse the occurrence of Penicillium nordicum in cured meats, Int. J. Food Microbiol., 107, 39–47, 2006. 103. Paterson, R.R.M., The isoepoxydon dehydrogenase gene of patulin biosynthesis in cultures and secondary metabolites as candidate PCR inhibitors, Mycol. Res., 108, 1431, 2004.
104. Paterson, R.R.M., Primers from the isoepoxydon dehydrogenase gene of the patulin biosynthetic pathway to indicate critical control points for patulin contamination of apples, Food Control, 7, 741, 2006. 105. Dombrink-Kurtzman, M.A., The isoepoxydon dehydrogenase gene of the patulin metabolic pathway differs for Penicillium griseofulvum and Penicillium expansum, Ant. Leeuwen., 89, 1, 2005.
106. Dombrink-Kurtzman, M.A., The sequence of the isoepoxydon dehydrogenase gene of the patulin biosynthetic pathway in Penicillium species, Ant. Leeuwen., 91, 179, 2007.
107. Seifert, K.A. et al., Prospects for fungus identi�cation using CO1 DNA barcodes, with Penicillium as a test case. Proc. Natl. Acad. Sci. U.S.A., 104, 3901, 2007. 108. Boysen, M. et al., Reclassi�cation of the Penicillium roqueforti group into three species on the basis of molecular genetic and biochemical pro�les, Microbiology, 142, 541, 1996. 109. LoBuglio, K.F., Pitt, J.I., and Taylor, J.W., Phylogenetic analysis of two ribosomal DNA regions indicates multiple independent losses of a sexual Talaromyces state among asexual Penicillium species in subgenus Biverticillium, Mycologia, 85, 592, 1993. 110. Lyratzopoulos, G. et al., Invasive infection due to Penicillium species other than P. marneffei, J. Infect., 45, 184, 2002. 111. Paterson, R.R.M., Fungus or bacterium and vice versa? Microbiology, 151, 641, 2005. 112. Paterson, R.R.M. and Lima, N., How will climate change affect mycotoxins? Food Int. Res., 43, 1902, 2010. 42 Chapter 42 - Phialophora
23. Yamagishi Y, Kawasaki K, Ishizaki H. Mitochondrial DNA analysis of Phialophora verrucosa. Mycoses 1997;40:329–334.
24. Abliz P et al., Identi�cation of pathogenic dematiaceous fungi and related taxa based on large subunit ribosomal DNA D1/D2 domain sequence analysis. FEMS Immunol Med Microbiol. 2004;40(1):41–49.
25. Pounder JI, Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J Clin Microbiol. 2007;45(2):568–571. 26. Zeng JS et al., Spectrum of clinically relevant Exophiala species in the United States. J Clin Microbiol. 2007; 45:3713–3720. 27. Desnos-Ollivier M et al., Molecular identi�cation of black-grain mycetoma agents. J Clin Microbiol. 2006; 44(10):3517–3523. 28. White TJ et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., Gelfand, J.J., Sninsky, J.J., and White, J.T., Eds., 1990. PCR Protocols: A Guide to Methods and Applications, Academic Press, Inc., San Diego, CA, pp. 315–322. 43 Chapter 43 - Rhinocladiella
18. Alkhunaizi AM, Amir AA, Al-Taw�q JA. Invasive fungal infections in living unrelated renal transplantation. Transplant Proc. 2005;37(7):3034–3037.
19. Podnos YD et al. Cerebral phaeohyphomycosis caused by Ramichloridium obovoideum (Ramichloridium mackenziei): Case report. Neurosurgery 1999;45:372–375.
20. Kanj SS, Amr SS, Roberts GD. Ramichloridium mackenziei brain abscess: Report of two cases and review of the literature. Med Mycol. 2001;39:97–102.
21. Arango M et al. Auricular chromoblastomycosis caused by Rhinocladiella aquaspersa. Med Mycol. 1998;36(1):43–45.
22. Marques SG et al. Chromoblastomycosis caused by Rhinocladiella aquaspersa. Med Mycol. 2004, 42(3):261–265.
23. Badali H et al. Rhinocladiella aquaspersa, proven agent of verrucous skin infection and a novel type of chromoblastomycosis. Med Mycol. 2010;48:696–703.
24. Dixon DM, Shadomy HJ, Shadomy S. Dematiaceous fungal pathogens isolated from nature. Mycopathologia 1980;70(3):153–161.
25. Dixon DM, Polak-Wyss A. The medically important dematiaceous fungi and their identi�cation. Mycoses 1991;34(1–2):1–18.
26. McGinnis MR. Chromoblastomycosis and phaeohyphomycosis: New concepts, diagnosis, and mycology. J Am Acad Dermatol. 1983;8(1):1–16.
27. Rinaldi MG. Phaeohyphomycosis. Dermatol Clin. 1996;14:147–153.
28. Matsumoto T et al. Developments in hyalohyphomycosis and phaeohyphomycosis. J Med Vet Mycol. 1994;32(Suppl 1): 329–349. 29. Horre R, de Hoog GS. Primary cerebral infections by melanized fungi: A review. Stud Mycol. 1999;43:176–193. 30. Polak A. Melanin as a virulence factor in pathogenic fungi. Mycoses 1990;33(5):215–224. 31. Hayakawa M et al. Phagocytosis, production of nitric oxide and pro-in¼ammatory cytokines by macrophages in the presence of dematiaceous fungi that cause chromoblastomycosis. Scand J Immunol. 2006;64(4):382–387. 32. Taylor JW et al. Phylogenetic species recognition and species concepts in fungi. Fungal Genet Biol. 2000;31:21–32. 33. Caligiorne RB et al. Internal transcribed spacer rRNA genebased phylogenetic reconstruction using algorithms with local and global sequence alignment for black yeasts and their relatives. J Clin Microbiol. 2005;43(6):2816–2823. 34. Crous PW et al. Unravelling Mycosphaerella: Do you believe in genera? Persoonia 2009;23:99–118. 35. Spatafora JW, Mitchell TG, Vilgalys R. Analysis of genes coding for small-subunit rRNA sequences in studying phylogenetics of dematiaceous fungal pathogens. J Clin Microbiol. 1995;33(5):1322–1326. 36. Zeng JS, de Hoog GS. Exophiala spinifera and its allies: Diagnostics from morphology to DNA barcoding. Med Mycol. 2008;46(3):193–208. 37. Cheewangkoon R et al. Species of Mycosphaerella and related anamorphs on Eucalyptus leaves from Thailand. Persoonia 2008;21:77–91. 38. Amr SS, Al-Taw�q JA. Aspiration cytology of brain abscess from a fatal case of cerebral phaeohyphomycosis due to Ramichloridium mackenziei. Diagn Cytopathol. 2007;35(11):695–699. 44 Chapter 44 - Trichophyton
22. Woodgyer, A. The curious adventures of Trichophyton equinum in the realm of molecular biology: A modern fairy tale. Med. Mycol., 42, 397, 2004.
23. Kawasaki, M. et al. Different genes can result in different phylogenetic relationships in Trichophyton species. Jpn. J. Med. Mycol., 49, 311, 2008.
24. Leclerc, M.C., Philippe, H., and Gueho, E. Phylogeny of dermatophytes and dimorphic fungi based on large subunit ribosomal RNA sequence comparisons. J. Med. Vet. Mycol., 32, 331, 1994.
25. Ninet, B. et al. Identi�cation of dermatophyte species by 28S ribosomal DNA sequencing with a commercial kit. J. Clin. Microbiol., 41, 826, 2003.
26. Jackson, C., Barton, R.C., and Evans, E.G. Species identi�cation and strain differentiation of dermatophytes fungi by analysis of ribosomal DNA intergenic spacer regions. J. Clin. Microbiol., 37, 931, 1999.
27. Kano, R. et al. Differences among chintin synthase I gene sequences in Trichophyton rubrum and T. violaceum. Med. Mycol., 38, 47, 2000.
28. Kanbe, T. et al. PCR-based identi�cation of common dermatophyte species using primer sets speci�c for the DNA topoisomerase II genes. J. Dermatol. Sci., 32, 151, 2003.
29. Kanbe, T. et al. Species-identi�cation of dermatophytes Trichophyton, Microsporum and Epidermophyton by PCR and PCR-RFP targeting of the DNA topoisomerase II genes. J. Dermatol. Sci., 33, 41, 2003.
30. Wu, Y. et al. Recent dermatophyte divergence revealed by comparative phylogenetic analysis of mitochondrial genomes. BMC Genomics, 10, 238, 2009.
31. Gräser, Y., de Hoog, S., and Summerbell, R.C. Dermatophytes: Recognizing species of clonal fungi. Med. Mycol., 44, 199, 2006.
32. Probst, S., de Hoog, G.S., and Gräser, Y. Development of DNA markers to explore host shifts in dermatophytes. Stud. Mycol., 47, 57, 2003.
33. Lui, D. et al. Application of PCR to the identi�cation of dermatophyte fungi. J. Med. Microbiol., 49, 493, 2000.
34. Gräser, Y., Fröhlich, J., and Presber, W. Molecular markers reveal geographic population differentiation in Trichophyton rubrum. J. Med. Microbiol., 56, 1058, 2007.
35. Jackson, C.J. et al. Strain identi�cation of Trichophyton rubrum by speci�c ampli�cation of subrepeat elements in the ribosomal DNA nontranscribed spacer. J. Clin. Microbiol., 38, 4527, 2000.
36. Gupta, A.K., Kohli, Y., and Summerbell, R.C. Exploratory study of single-copy genes and ribosomal intergenic spacers for distinction of dermatophytes. Stud. Mycol., 47, 87, 2002.
37. Brasch, J. and Gräser, Y. Trichophyton eboreum sp. nov. isolated from human skin. J. Clin. Microbiol., 43, 5237, 2005.
38. Campbell, C.K. et al. Arthroderma olidum. sp. nov. A new addition to the Trichophyton terrestre complex. Med. Mycol., 44, 451, 2006.
39. Borman, A.M. et al. Analysis of the dermatophyte species isolated in the British Isles between 1980 and 2005 and review of worldwide dermatophyte trends over the last three decades. Med. Mycol., 45, 131, 2007.
40. Fuller, L.C. Changing face of tinea capitis in Europe. Curr. Opin. Infect. Dis., 22, 115, 2009.
41. Deng, S. et al. changes in frequency of agents of tinea capitis in school children from Western China suggest slow migration rates in dermatophytes. Med. Mycol., 46, 421, 2008. 42. Cetner, A. et al. Tinea capitis die to Trichophyton soudanense in Chicago, Illinois: Report of a case. Pediatr. Dermatol., 26, 226, 2009. 43. Lewis, S. and Lewis, B. Nosocomial transmission of Trichophyton tonsurans tinea corporis in a rehabilitation hospital. Infect. Control. Hosp. Epidemiol., 18, 322, 1997. 44. Arnow, P., Houchins, B.A., and Pugliese, G. An outbreak of tinea corporis in hospital personnel caused by a patient with Trichophyton tonsurans infection. Pediatr. Infect. Dis., 10, 355, 1991. 45. Wood, B. and Rademaker, M. Nosocomial Trichophyton tonsurans in a long-stay ward. N. Z. Med. J., 110, 277, 1997. 46. Drusin, L. et al. Nosocomial ringworm in a neonatal intensive care unit: A nurse and her cat. Infect. Control. Hosp. Epidemiol., 21, 60, 2002. 47. Vermout, S. et al. Pathogenesis of dermatophyteosis. Mycopathologica, 166, 267, 2008. 48. Esquenazi, D. et al. The in¼uence of surface carbohydrates during in vitro infection of mammalian cells by the dermatophyte Trichophyton rubrum. Res. Microbiol., 155, 144, 2004. 49. Monod, M. et al. Aminopeptidases and dipeptidyl-peptidases secreted by the dermatophyte Trichophyton rubrum. Microbiology, 15, 145, 2005. 50. Kaufman, G. et al. Infection stages of the dermatophyte pathogen Trichophyton: Microscopic characterisation and proteolytic enzymes. Med. Mycol., 45, 149, 2007. 51. Ferreira-Nozawa, M.S. et al. The pH signalling transcription factor PACC mediates the growth of Trichophyton rubrum on human nail in vitro. Med. Mycol., 44, 641, 2006. 52. Bolognia, J.L. et al. Dermatology, Mosby, New York, 2003, pp. 1176–1178. 53. Bonifaz, A., Archer-Dubon, C., and Saul, A. Tinea imbricata or Tokelau. Int. J. Dermatol., 43, 506, 2004. 54. Smith, K.J. et al. Majocchi’s granuloma. J. Cutan. Pathol., 18, 28, 1991. 55. Lestringent, G. et al. Deep dermatophytosis to Trichophyton rubrum and T. verrucosum in an immunosuppressed patient. Int. J. Dermatol., 27, 707, 1988. 56. Nir-Paz, R. et al. Deep infection by Trichophyton rubrum in an immunocompromised patient. J. Clin. Microbiol., 41, 5298, 2003. 57. Chastain, M.A., Reed, R.J., and Pankey, G.A. Deep dermatophytosis: Report of 2 cases and review of the literature. Cutis, 67, 457, 2001. 58. Robert, R. and Pihet, M. Conventional methods for the diagnosis of dermatophytes. Mycopathologia, 166, 295, 2008. 59. Miranda, M.F. and Silva, A.J. New uses of vinyl tape for reliable collection and diagnosis of common super�cial mycoses. Skinmed, 2, 156, 2003. 60. Qureshi, H.S., Ornsby, H.A., and Kapadia, N. Effects of modi�ed sample collection technique on fungal culture yield: Nail clipping/scraping versus microdrill. J. Pak. Med. Assoc., 54, 301, 2004. 61. Sugita, T., Shiraki, Y., and Hiruma, M. Real time PCR TaqMan assay for detecting Trichophyton tonsuans, a causative agent of tinea capitis, from hairbrushes. Med. Mycol., 44, 579, 2006. 62. Lau, A. et al. Development and clinical application of a panfungal PCR assay to detect and identify fungal DNA in tissue specimens. J. Clin. Microbiol., 45, 380, 2007. 63. Ellis, D. et al. Descriptions of Medical Fungi, 2nd edn., Mycology Unit, Women’s and Children’s Hospital, North Adelaide, Australia. ISBN 9780959851267, 2007.
64. Suhonen, R.E., Dawber, R.P.R., and Ellis, D.H. Fungal Infections of the Skin, Hair and Nails, Martin Dunitz, London, U.K., 1999, p. 132.
65. Garg, J. et al. Evaluation of pan-dermatophyte nested PCR in diagnosis of onychomycosis. J. Clin. Microbiol., 45, 3443, 2007.
66. Bhathena, A., Gaedigk, R., and Abdel-Rahman, S.M. Characterisation of the ALP1 gene locus of Trichophyton tonsurans. Mycopathologia, 160, 265, 2005.
67. Kanbe, T. Molecular approaches in the diagnosis of dermatophytosis. Mycopathologica, 166, 307, 2008.
68. Loef¼er, J. et al. Contaminations occurring in fungal PCR assays. J. Clin. Microbiol., 37, 1200, 1999.
69. Loef¼er, J. et al. Automated extraction of genomic DNA from medically important yeast species and �lamentous fungi by using the MagNA Pure LC system. J. Clin. Microbiol., 40, 2240, 2002.
70. Gupta, A.K., Zaman, M., and Singh, J. Fast and sensitive detection of Trichophyton rubrum DNA from the nail samples of patients with onychomycosis by a double-round polymerase chain reaction-based assay. Br. J. Dermatol., 157, 698, 2007.
71. Bergmans, A.M.C. et al. Validation of PCR-reverse line blot method for rapid detection and identi�cation of nine dermatophytes species in nail, skin and hair samples. Clin. Microbiol. Infect., 14, 778, 2008.
72. Kardjeva, V. et al. Forty-eight hour diagnosis of onychomycosis with subtyping of Trichophyton rubrum strains. J. Clin. Microbiol., 44,1419, 2006.
73. Monod, M. et al. Fast and reliable PCR/sequencing/RFLP assay for identi�cation of fungi in onychomycoses. J. Med. Microbiol., 55, 1211, 2006.
74. Brillowska-Dabrowska, A. et al. Five-hour diagnosis of dermatophyte nail infections with speci�c detection of Trichophyton rubrum. J. Clin. Microbiol., 45, 1200, 2007.
75. Savin, C. et al. Multicentre evaluation of a commercial PCR-enzyme linked immunosorbent assay diagnostic kit (Onychodiag) for diagnosis of dermatophyte onychomycosis. J. Clin. Microbiol., 45, 1205, 2007.
76. Mochizuki, T. et al. Rapid identi�cation of Trichophyton tonsurans by PCR-RFLP analysis of ribosomal DNA regions. J. Dermatol. Sci., 32, 25, 2003. 77. Gutzmer, R. et al. Rapid identi�cation and differentiation of fungal DNA in dermatological specimens by LightCycler PCR. J. Med. Microbiol., 53, 1207, 2004.
78. Kong, F. et al. Rapid identi�cation and differentiation of Trichophyton species based on sequence polymorphisms of the ribosomal internal transcribed spacer regions by rolling circle ampli�cation. J. Clin. Microbiol., 46, 1192, 2008.
79. Li, H.C. et al. Identi�cation of dermatophytes by an oligonucleotide array. J. Clin. Microbiol., 45, 3160, 2007.
80. Baek, S.-C. et al. Detection and differentiation of causative fungi of onychomycosis using PCR ampli�cation and restriction enzyme analysis. Int. J. Dermatol., 37, 682, 1998.
81. Kano, R. et al. Direct detection of dermatophytes in skin samples based on sequences of the chitin synthase 1 (CHS1) gene. J. Vet. Med. Sci., 65, 267, 2003.
82. Yoshida, E. et al. Rapid identi�cation of Trichophyton tonsurans by speci�c PCR based on DNA sequences of nuclear ribosomal internal transcribed spacer (ITS) 1 region. J. Dermatol. Sci., 42, 225, 2006.
83. Bock, M. et al. Diagnostik von dermatomykosen mit der polymerase-ketten-reaktion. Hautarzt, 48, 175, 1997. 84. Arabatzis, M. et al. Diagnosis of common dermatophyte infections by a novel multiplex real-time polymerase chain reaction detection/identi�cation scheme. Br. J. Dermatol., 157, 681, 2007. 85. Wallberg, M. et al. 18S rDNA polymerase chain reaction and sequencing in onychomycosis diagnostics. Acta Derm. Venearol., 86, 223, 2006. 86. Kac, G. Molecular approaches to the study of dermatophytes. Med. Mycol., 38, 329, 2000. 87. Vilgalys, R. and Hesters, M. Rapid genetic identi�cation and mapping of enzymatically ampli�ed ribosomal DNA from several Cryptococcus species. J. Bacteriol., 172, 4238, 1990. 88. Nilsson, R.H. et al. Taxonomic reliability of DNA sequences in public sequence databases: A fungal perspective. PLoS One, 1, e59, 2006. 89. Zhong, Z. et al. Typing of common dermatophytes by random-ampli�cation of polymorphic DNA. Jpn. J. Med. Mycol., 38, 239, 1997. 90. Hajdúch, M. et al. Diversity among wild-type and vaccination strains of Trichophyton verrucosum investigated using random ampli�ed polymorphic DNA analysis. Folia Biol., 45, 151, 1999. 91. Baeza, L., Mendes, C., and Giannini, M.J.S. Strain differentiation of Trichophyton rubrum by random ampli�cation pf polymorphic DNA (RAPD). Rev. Inst. Med. Trop. S. Paulo, 46, 339, 2004. 92. Liu, D. et al. Use of arbitrarily primed polymerase chain reaction to differentiate Trichophyton dermatophytes. FEMS Microbiol. Lett., 136, 147, 1996. 93. Gräser, Y. et al. Identi�cation of common dermatophytes (Trichophyton, Microsporum, Epidermophyton) using polymerase chain reaction. Br. J. Dermatol., 138, 576, 1998. 94. Arabatzis, M. et al. First report on autochthonous urease-positive Trichophyton rubrum (T. raubitschekii) from South-east Europe. Br. J. Dermatol., 153, 178, 2005. 95. Shehata, A.S. et al. Single-step PCR using (GACA) 4 primer: Utility for Rapid identi�cation of dermatophyte species and strains. J. Clin. Microbiol., 46, 2641, 2008. 96. Jackson, C.J., Mochizuki, T., and Barton, R.C. PCR �ngerprinting of Trichophyton mentagrophytes var. interdigitale using polymorphic subrepeat loci in the rDNA non-transcribed spacer. J. Med. Microbiol., 55, 1349, 2006. 97. Mochizuki, T. et al. Restriction fragment length polymorphism analysis of ribosomal DNA intergenic regions is useful for differentiating strains of Trichophyton mentagrophytes. J. Clin. Microbiol., 41, 4583, 2003. 98. Abdel-Rahman, S.M. et al. Tracking Trichophyton tonsurans through a large urban child care centre: De�ning infection prevalence and transmission patterns by molecular strain typing. Paediatrics, 118, 2365, 2006. 99. Yang, G. et al. Genotyping of Trichophyton rubrum by analysis of ribosomal-DNA intergenic spacer regions. Mycopathologia, 164, 19, 2007. 100. de Assis Santos, D. et al. Molecular typing and antifungal susceptibility of Trichophyton rubrum isolates from patients with onychomycosis pre- and post-treatment. Int. J. Antimicrob. Agents, 29, 536, 2007. 101. Abdel-Rahman, S.M. et al. Divergence among an international population of Trichophyton tonsurans isolates. Mycopathologia, 169, 1–13, doi 10.1007/s11046-009-92237, 2009.
102. Baeza, L.C. et al. Strain differentiation of Trichophyton rubrum by random ampli�ed polymorphic DNA and analysis of rDNA non-transcribed spacer. J. Med. Microbiol., 55, 429, 2006.
103. Kac, G. et al. Genetic diversity among Trichophyton mentagrophytes isolates using random ampli�cation of polymorphic DNA method. Br. J. Dermatol., 140, 839, 1999.
104. Yang, X. et al. Differentiation of Trichophyton rubrum clinical isolates from Japanese and Chinese patients by random ampli�ed polymorphic DNA and DNA sequence analysis of the non-transcribed spacer region of the rRNA gene. J. Dermatol. Sci., 54, 38, 2009. 105. Mochizuki, T. et al. Epidemiology of sporadic (non-epidemic) cases of Trichophyton tonsurans infections in Japan based on PCR-RFLP analysis of non-transcribed spacer region of the ribosomal RNA gene. Jpn. J. Infect. Dis., 61, 219, 2008. 45 Chapter 45 - Veronaea
5. Chakrabarti A. Epidemiology of central nervous system mycoses. Neurol India 2007;55:191–197.
6. Brandt ME, Warnock DW. Epidemiology, clinical manifestations, and therapy of infections caused by dematiaceous fungi. J Chemother. 2003;15(Suppl. 2):36–47.
7. Kondo Y et al. Cutaneous phaeohyphomycosis caused by Veronaea botryosa observed as sclerotic cells in tissue. Int J Dermatol. 2007;46(6):625–627.
8. Zhang HE, Wang DL, Li RY. Report of the case of phaeohyphomycosis caused by Veronaea botryosa. Chin J Dermatol. 1990;23:96–98.
9. Wang DL et al. Studies on Veronaea botryosa agent of the �rst human case. Acta Mycol Sin. 1991;10:159–165.
10. Ayadi A, Huerre MR, de Bievre C. Phaeohyphomycosis caused by Veronaea botryosa. Lancet 1995;346:1703.
11. Foulet F et al. Cutaneous phaeohphomycosis caused by Veronaea bothryosa in a liver transplant recipient successfully treated with Itraconazole. Clin Infect Dis. 1999;29:689–690. 12. Chen YT et al. Cutaneous phaeohyphomycosis caused by an Itraconazole and Amphoterecin B resistant strain of Veronaeae botryosa. Int J Dermatol. 2006;45(4):429–432. 13. Matsushita A et al. Subcutaneous phaeohyphomycosis caused by Veronaea botryosa in the People’s Republic of China. J Clin Microbiol. 2003;41:2219–2222. Erratum in: J Clin Microbiol. 2003;41(7):3462. 14. Sutton DA, Rinaldi MG, Kielhofner M. First U.S. report of subcutaneous phaeohyphomycosis caused by Veronaea botryosa in a heart transplant recipient and review of the literature. J Clin Microbiol. 2004;42(6):2843–2846. 15. Da Cunha Filho, RR et al. Subcutaneous phaeohyphomycosis caused by Veronaea bothryosa: Report of 2 cases. An Bras Dermatol. 2005;80:1. 16. Kumar KK, Hallikeri K. Phaeohyphomycosis. Indian J Pathol Microbiol. 2008;51:556–558.
Pezizomycotina: Sordariomycetes 46 Chapter 46 - Acremonium
8. Roilides E et al. Acremonium fungemia in two immunocompromised children. Pediatr Infect Dis J. 1995;14:548–550.
9. Cameron JA et al., Chronic endophthalmitis caused by Acremonium falciforme. Can J Ophthalmol. 1996;31:367–368.
10. Koç AN, Erdem F, Patiroglu, T. Case report: Acremonium falciforme fungemia in a patient with acute leukaemia. Mycoses 2002;45:202–203.
11. Mattei D et al. Successful treatment of Acremonium fungemia with voriconazole. Mycoses 2003;46:511–514.
12. Alfonso JF et al. Acremonium fungal infection in 4 patients after laser in situ keratomileusis. J Cataract Refract Surg. 2004;30(1):262–267.
13. Miyakis S et al. Invasive Acremonium strictum infection in a bone marrow transplant recipient. Pediatr Infect Dis J. 2006;25:273–275.
14. Jeffrey WR et al. Disseminated infection due to Acremonium species in a patient with Addison’s disease. Clin Infect Dis. 1993;16:170.
15. Yalaz M et al. Fatal disseminated Acremonium strictum infection in a preterm newborn: A very rare cause of neonatal septicaemia. J Med Microbiol. 2003;52:835–837.
16. Mulwafu WK et al. Allergic fungal sinusitis secondary to Acremonium species causing unilateral visual loss. East Central Afr J Surg. 2006;11:62–64.
17. Brabender W et al. Acremonium kiliense osteomyelitis of the calvarium. Neurosurgery 1985;16:554–556.
18. Fridkin SK et al. Acremonium kiliense endophthalmitis that occurred after cataract extraction in an ambulatory surgical care and was traced to an environmental reservoir. Clin Infect Dis. 1996b;22:222–227.
19. Pastorino AC et al. Acremonium kiliense infection in a child with chronic granulomatous disease. Braz J Infect Dis. 2005;9(6):529–534.
20. Schell WA, Perfect JR. Fatal, disseminated Acremonium strictum infection in a neutropenic host. J Clin Microbiol. 1996;34:1333–1336.
21. Koç AN et al. Peritonitis due to Acremonium strictum in a patient on continuous ambulatory peritoneal dialysis. Nephron 1998;79:357–358.
22. Koç AN et al. Pleuritis caused by Acremonium strictum in a patient with colon adenocarcinoma. Mycoses 2008;51(6):554–556.
23. Koç AN, Mutlu Sarigüzel F, Artiş T. Isolation of Acremonium strictum from pleural ¼uid of a patient with colon adenocarcinoma. Mycoses 2009;52(2):190–192.
24. Anadolu R et al. Indolent Acremonium strictum infection in an immunocompetent patient. Int J Dermatol. 2001;40:451–453.
25. Scott IU, Flynn HW Jr., Miller D. Delayed-onset endophthalmitis following cataract surgery caused by Acremonium strictum. Ophthalmic Surg Lasers Imaging. 2005;36:506–507.
26. Guarro J et al. A case of colonization of a prosthetic mitral valve by Acremonium strictum. Rev Iberoam Micol. 2009;26(2):146–148. 27. Novicki TJ et al. Genetic diversity among clinical isolates of Acremonium strictum determined during an investigation of a fatal mycosis. J Clin Microbiol. 2003;41(6):2623–2628. 28. Van Etta LL, Peterson LR, Gerding DN. Acremonium falciforme (Cephalosporium falciforme) mycetoma in a renal transplant patient. Arch Dermatol. 1983;119:707–708. 29. Fincher RME et al. Infection due to the fungus Acremonium (Cephalosporium). Medicine 1991;70:398–409. 30. Kan SF et al. Cutaneous hyalohyphomycosis caused by Acremonium in an immunocompetent patient. Br J Dermatol. 2004;150(4):789–790. 31. Yamazaki R et al. Systemic infection due to Acremonium after allogeneic peripheral blood stem cell transplantation. Intern Med. 2006;45(16):989–990. 32. Chang HY et al. Acremonium pyomyositis in a pediatric patient with acute leukemia. Pediatr Blood Cancer 2005;44:521–524. 33. Joe SG et al. Case report of Acremonium intraocular infection after cataract extraction. Korean J Ophthalmol. 2010 April;24(2):119–122. 34. Guarro J et al. Acremonium species: New emerging fungal opportunistis—In vitro antifungal susceptibilities and review. Clin Infect Dis. 1997;25:1222–1229. 35. Weissgold DJ, Maguire AM, Brucker AJ. Management of postoperative Acremonium endophthalmitis. Ophthalmology 1996;103:749–756. 36. Weil J, Miramonti J, Ladisch MR. Cephalosporin-C—Mode of action and biosynthetic-pathway. Enzyme Microb Technol. 1995;17:85–87. 37. Barber MS, Giesecke U, Reichert A, Minas W. Industrial enzymatic production of cephalosporin-based beta-lactams. Adv Biochem Eng Biotechnol. 2004;88:179–215. 38. Chen YC et al. Identi�cation of medically important yeasts using PCR-based detection of DNA sequence polymorphisms in the internal transcribed spacer 2 region of the rRNA genes. J Clin Microbiol. 2000;38:2302–2310. 39. Chen YC et al. Polymorphic internal transcribed spacer region 1 DNA sequences identify medically important yeasts. J Clin Microbiol. 2001;39:4042–4051. 40. Borazjani RN, Lott TJ, Ahearn DG. Comparison of 5.8S and ITS2 rDNA RFLP patterns among isolates of Acremonium obclavatum, A. kiliense, and A. strictum from diverse sources. Curr Microbiol. 1998;36(2):70–74. 41. Landlinger C et al. Species-speci�c identi�cation of a wide range of clinically relevant fungal pathogens by use of Luminex xMAP technology. J Clin Microbiol. 2009;47(4):1063–1073. 42. White TJ et al. Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In MA Innis, DH Gelfand, JJ Sninsky, and TJ White (eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, pp. 315–322, 1990. 43. Keynan Y, Sprecher H, Weber G. Acremonium vertebral osteomyelitis: Molecular diagnosis and response to voriconazole. Clin Infect Dis. 2007;45(1):e5–e6. 47 Chapter 47 - Beauveria
1. The UniProt Consortium. Available at http://www.uniprot. org/, accessed on August 1, 2010.
2. Li, Z. et al. 2001. Discovery and demonstration of the teleomorph of Beauveria bassiana (Bals.) Vuill., an important entomogenous fungus. Chin. Sc. Bull., 46:751–753.
3. Wagner, B.L. and L.C. Lewis. 2000. Colonization of corn, Zea mays, by the entomopathogenic fungus Beauveria bassiana. Appl. Environ. Microbiol., 66:3468–3473.
4. Shimazu, M., H. Sato, and N. Maehara. 2002. Density of the entomopathogenic fungus, Beauveria bassiana Vuillemin (Deuteromycotina: Hyphomycetes) in forest air and soil. Appl. Entomol. Zool., 37:19–26.
5. Strasser, H., T.M. Butt, and A. Vey. 2000. Are there any risks in using entomopathogenic fungi for pest control, with particular reference to the bioactive metabolites of Metarhizium, Tolypocladium and Beauveria species? Biocontrol Sci. Technol., 10:717–735.
6. De Hoog, G.S. et al. 2000. Atlas of Clinical Fungi. Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands.
7. Sachs, S.W., J. Baum, and C. Mies. 1985. Beauvaria bassiana keratitis. Br. J. Ophthalmol., 69:548–550.
8. Low, C.D., P.R. Badenoch, and D.J. Coster. 1997. Beauveria bassiana keratitis cured by deep lamellar dissection. Cornea, 16:698–699.
9. Gürcan, S. et al. 2006. First case report of empyema caused by Beauveria bassiana. Mycoses, 49(3):246–248.
10. Tu, E.Y. and A.J. Park. 2007. Recalcitrant Beauveria bassiana keratitis: Confocal microscopy �ndings and treatment with posaconazole (Noxa�l). Cornea, 26(8):1008–1010.
11. Oh, J.Y. et al. 2009. A case of necrotizing sclerokeratitis and endophthalmitis caused by Beauveria bassiana. Jpn. J. Ophthalmol., 53(5):551–553.
12. Tucker, D.L. et al. 2004. Disseminated Beauveria bassiana infection in a patient with acute lymphoblastic leukemia. J. Clin. Microbiol., 42(11):5412–5414.
13. Kisla, T.A. et al. 2000. Medical management of Beauveria bassiana keratitis. Cornea, 19:405–406.
14. Sonoyama, H. et al. 2008. The characteristics of keratomycosis by Beauveria bassiana and its successful treatment with antimycotic agents. Clin. Ophthalmol., 2(3):675–678.
15. Pariseau, B. et al. 2010. Beauveria keratitis and biopesticides: Case histories and a random ampli�cation of polymorphic DNA comparison. Cornea, 29(2):152–158. 16. Henke, M.O. et al. 2002. Human deep tissue infection with an entomopathogenic Beauveria species. J. Clin. Microbiol., 40:2698–2702. 17. McDonnell, P.J. et al. 1984–1985. Mycotic keratitis due to Beauveria alba. Cornea, 3(3):213–216. 18. Safavi, S.A. et al. 2007. Effect of nutrition on growth and virulence of the entomopathogenic fungus Beauveria bassiana. FEMS Microbiol. Lett., 270:116–123. 19. Kosir, J.M. and J.M. MacPherson, and G.G. Khachatourians. 1991. Genomic analysis of virulent and less virulent strain of the entomopathogenic fungus Beauveria bassiana using RFLP. Can. J. Microbiol., 37:534–541. 20. Hegedus, D.D. and G.G. Khachatourians. 1993a. Construction of cloned DNA probes for the speci�c detection of the entomopathogenic fungus Beauveria bassiana in grasshoppers. J. Invertebr. Pathol., 62:233–240. 21. Hegedus, D.D. and G.G. Khachatourians. 1993b. Identi�cation of molecular variants in mitochondrial DNAs of members of the genera Beauveria, Verticillium, Paecilomyces, Tolypocladium, and Metarhizium. Appl. Env. Microbiol., 59:4283–4288. 22. Hegedus, D.D. and G.G. Khachatourians. 1996. Detection of the entomopathogenic fungus Beauveria bassiana within infected migratory grasshoppers (Melanoplus sanguinipes) using polymerase chain reaction and DNA probe. J. Invertebr. Pathol., 67:21–27. 23. Shih, H.L. et al. 1995. Complete nucleotide sequence of Beauveria bassiana 5.8s rRNA coding gene and ¼anking internal transcribed spacers. DNA Seq., 5:381–383. 24. De Muro, M.A., S. Mehta, and D. Moore. 2003. The use of ampli�ed fragment length polymorphism for molecular analysis of Beauveria bassiana isolates from Kenya and other countries and their correlation with host and geographic origin. FEMS Microbiol. Lett. 229:249–257. 25. Wang, C. et al. 2003. Molecular investigation on strain genetic relatedness and population structure of Beauveria bassiana. Environ. Microbiol., 5:908–915. 26. Wang, C. et al. 2004. Molecular monitoring and evaluation of the application of the insect-pathogenic fungus Beauveria bassiana in southeast China. J. Appl. Microbiol., 96:861–870. 27. Rehner, S.A. and Buckley, E. 2005. A Beauveria phylogeny inferred from nuclear ITS and EF1-α sequences: Evidence for cryptic diversi�cation and links to Cordyceps teleomorphs. Mycologia, 97:84–98. 28. Neuvéglise, C., Y. Brygoo, and G. Riba. 1997. 28s rDNA group-I introns: A powerful tool for identifying strains of Beauveria brongniartii. Mol. Ecol., 6:373–381. 29. Castrillo, L.A., J.D. Vandenberg, and S.P. Wraight. 2003. Strain-speci�c detection of introduced Beauveria bassiana in agricultural �elds by use of sequence-characterized ampli�ed region markers. J. Invertebr. Pathol., 82:75–83. 30. Castrillo, L.A., M.H. Griggs and J.D. Vandenberg. 2008. Quantitative detection of Beauveria bassiana GHA (Ascomycota: Hypocreales), a potential microbial control agent of the emerald ash borer, by use of real-time PCR. Biol. Control, 45:163–169. 31. Pounder, J.I. et al. 2007. Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J. Clin. Microbiol., 45(2):568–571. 48 Chapter 48 - Chaetomium
1. The UniProt Consortium. Available at http://www.uniprot. org/, accessed on August 1, 2010.
2. von Arx, J. A., J. Guarro, and M. J. Figueras. 1986. The ascomycete genus Chaetomium. Beih. Nova Hedwigia 84:1–162.
3. Abbott, S. P. et al. 1995. Fatal cerebral mycoses caused by the ascomycete Chaetomium strumarium. J. Clin. Microbiol. 33:2692–2698.
4. Barron, M. A. et al. 2003. Invasive mycotic infections caused by Chaetomium perlucidum, a new agent of cerebral phaeohyphomycosis. J. Clin. Microbiol. 41(11):5302–5307.
5. Hoppin, E. C., E. L. McCoy, and M. G. Rinaldi. 1983. Opportunistic mycotic infection caused by Chaetomium in a patient with acute leukemia. Cancer 52:555–556.
6. Anandi, V. et al. 1989. Cerebral phaeohyphomycosis caused by Chaetomium globosum in a renal transplant recipient. J. Clin. Microbiol. 27:2226–2229.
7. Yeghen, T. et al. 1996. Chaetomium pneumonia in a patient with acute myeloid leukaemia. J. Clin. Pathol. 49:184–186.
8. Aru, A., L. Munk-Nielsen, and B. H. Federspiel. 1997. The soil fungus Chaetomium in the human paranasal sinuses. Eur. Arch. Otorhinolaryngol. 254:350–352.
9. Thomas, C. et al. 1999. Fatal Chaetomium cerebritis in a bone marrow transplant patient. Hum. Pathol. 30:874–879.
10. Guarro, J., L. Soler, and M. G. Rinaldi. 1995. Pathogenicity and antifungal susceptibility of Chaetomium species. Eur. J. Clin. Microbiol. Infect. Dis. 14:613–618.
11. Segal, R. and S. Kusne. 1999. Cerebral fungal infections in the immunocompromised host: A literature review and a new pathogen-Chaetomium atrobrunneum: Case report. Neurosurgery, 45:200.
12. Guppy, K. H. et al. 1998. Cerebral fungal infections in the immunocompromised host: A literature review and a new pathogen—Chaetomium atrobrunneum: Case report. Neurosurgery 43:1463–1469. 13. Rock, J. P. 1998. Cerebral fungal infections in the immunocompromised host: A literature review and a new pathogen—Chaetomium atrobrunneum: Case report—Comment. Neurosurgery 43:1469.
14. Stiller, M. J. et al. 1992. Onychomycosis of the toenails caused by Chaetomium globosum. J. Am. Acad. Dermatol. 26:775–776.
15. Lesire, V. et al. 1999. Possible role of Chaetomium globosum in infection after autologous bone marrow transplantation. Intensive Care Med. 25:124–125.
16. Teixeira, A. B. et al. 2003. Phaeohyphomycosis caused by Chaetomium globosum in an allogeneic bone marrow transplant recipient. Mycopathologia 156(4):309–312.
17. Youngchim, S. et al. 2004. Production of melanin by Aspergillus fumigatus. J. Med. Microbiol. 53:175–181.
18. Arzanlou, M. et al. 2007. Phylogenetic and morphotaxonomic revision of Ramichloridium and allied genera. Stud Mycol. 58:57–93. 49 Chapter 49 - Colletotrichum
Subcutaneous infections
1 O’Quinn et al. 33 Case 1 C. gloeosporioides 34/M Acute lymphocytic leukemia on chemotherapy and relapse. Injury (fallen on cactus). A tender erythamatous nodule measuring 1.2 × 1.2 cm with minimal super�cial scaling on right forearm. Case 2 C. coccodes 47/M Stage III non-hodgkins lymphoma of 8 years duration. Undergone autologous peripheral stem cell transplantation. Enlarged, tender, and erythematous nodule on left arm measuring 1 × 1.5 cm with a central pustule and super�cial crusting. Case 3 C. coccodes 58/M Stage I non-hodgkins lymphoma, allogenic bone marrow transplantation. A tender erythematous papule measuring 0.5 × 0.5 cm with a central pustule.
2 Guarro et al., 1998 32 C. gloeosporioides 56/M Diabetes mellitus. Injury by rotten wood. Erythematous, violaceous, and tuberose nodular lesions on his left forearm and elbow measuring 1 × 3 cm in diameter.
3 Castro et al. 21 C. crassipes 34/M Renal transplant recipient. Nodular and purulent cysts with thick walls on the right leg.
Eye infections
1 Fernandez et al. 12 Case 1 C. gloeosporioides 68/M IDDM NA Case 2 Colletotrichum spp. 34/M IDDM, Trauma Case 3 Colletotrichum spp. 78/F Corneal erosion Case 4 C. gloeosporioides 74/M IDDM Case 5 Colletotrichum spp. 69/M Trauma by tree branch, topical steroids Case 6 C. dematium 40/M Sand in eye Case 7 Colletotrichum spp. 35/M Trauma by dust and prednisolone use Case 8 C. dematium 28/M Injury by plant liquid Case 9 C. dematium 28/M Injury by plant liquid Case 10 C. gloeosporioides 78/M Facial injury and exposure keratopathy
2 Kaliamurthy et al. Case 1 C. dematium 47/M Topical chloramphenicol ointment Corneal ulcer irregular edges, stromal in�ltration, ¼are and cells in anterior chamber. Case 2 C. dematium 19/M Injury by stick Paracentral ulcer with dendritic pattern, stromal in�ltrate. Case 3 C. dematium 30/F Fall of insect, removed by �nger Central corneal ulcer with stromal in�ltrate. Case 4 C. dematium 41/M Acyclovir ointment Paracentral corneal ulcer, serrated marginstromal in�ltration, and hypopyon. Case 5 C. dematium 50/F NA Central corneal ulcer, ¼are. Case 6 Colletotrichum spp. 80/F NA Central ulcer, hypopyon, and stromal in�ltratation. Case 7 Not done 70/M Mud particles in eye Central ulcer, hypopyon, and stromal in�ltratation.
3 Yamamoto et al. 19 C. gloeosporioides 82/M Myelodysplastic syndrome, cataract surgery NA
4 Ritterband et al. 20 C. graminicola 24/M Cataract surgery NA
5 Upadhyay et al. 22 C. capsici NA NA NA
6 Matsuzaki et al. 50 C. gloeosporioides NA Injury, topical steroid NA C. gloeosporioides NA Injury by leaf of orange tree NA
7 Liao et al. 14 C. dematium Injury NA
8 Shukla et al. 18 G. lomerella cingulata Injury NA
9 Liesegang and Forster 17 C. coccodes neutropenic patient possibly caused by an unidenti�ed spe cies of Colletotrichum.
Colletotrichum keratitis may present with the symptoms similar to other fungal keratitis like ocular pain, redness, decreased vision, photophobia, and discharge. Corneal ulcer caused by this agent may be central or paracentral with irregular or serrated edges with varying amounts of stro mal in�ltration and edema. Hypopyon may also be present.
Sometimes the ulcer on presentation may exhibit dendritic pattern resembling viral keratitis. Like other melanized fungi, Colletotrichum keratitis progresses slowly and less aggressively, in contrast to Aspergillus or Fusarium kerati tis. Macroscopic brown pigmentation of the corneal in�ltrate may also be noticed when keratitis is caused by this mela nized fungus. 34
Disease caused by Collectotrichum belongs to the group of infections called “phaeohyphomycosis,” the name proposed by Ajello et al. 35 in 1974, as the fungus produces melanin.
A case of subcutaneous infection due to C. gloeosporioides has been reported as hyalohyphomycosis by Guarro et al., 32 as the hyphae were hyaline on direct microscopic examina tion of the tissue. In such a situation, Fontana-Masson stain may correctly identify the presence or absence of melanin.
The subcutaneous infection is due to the traumatic implanta tion of the fungus, though the history of the trauma may not be elicited in all patients, especially in prolonged course of the progression of the disease. The presence of the fungus in the wood and soil and frequent occurrence of lesions on the exposed part of the body supports traumatic acquisition of infection. The subcutaneous infection due to Colletotrichum spp. is usually seen in the warm climates and particu larly in immunocompromised individuals. 36 Subcutaneous
Colletotrichum infections may present as painless or tender nodule on the extremities with or without obvious history of trauma at the site of origin. The size of the nodule may vary. The overlying skin may be normal without any signs of in¼ammation or may be accompanied with erythematous lesion. The nodule may be solitary or multiple satellite nodules around primary lesion. In addition to one possible case of systemic infection reported by Midha et al., 24 one out of three cases of phaeohyphomycosis reported by O’Quinn et al. 33 died due to fulminating infection in the lungs suggesting possible dissemination due to C. coccodes. In general, most cases of keratitis caused by Colletotrichum species appear to respond well to the topical natamycin alone or in combination with amphotericin B. Different combinations of drugs like topical natamycin and oral itraconazole, intravitreal amphotericin B and ¼uconazole, and amphotericin B and topical miconazole were used successfully for the management of keratitis. 12,15,18–20,29,33 Kaliamurthy et al. reported successful resolution of corneal lesion in �ve cases using topical natamycin and cipro¼oxacin for a mean duration of 47 ± 14 days. 29 Topical antifungal alone may not be suf�cient for the resolution of the lesion and may require surgical procedure like therapeutic keratoplasty (TPK). 29 Treatment data with the use of newer triazoles are not available but one case of keratitis caused by C dematium was treated with topical voriconazole (1%). The lesion did not respond to the therapy though the strain was susceptible by in vitro antifungal susceptibility testing (1 μg/mL). 30 Subcutaneous phaeohyphomycosis due to C. gloeosporioides and C. coccodes was successfully treated with the combination of amphotericin B and itraconazole. 33 Reports of antifungal susceptibility testing are few. Guarro et al. tested 16 isolates of Colletotrichum (C. gloeosporioides—7, C. coccodes—5, C. dematium—4) against azoles (¼uconazole, itraconazole, ketoconazole, and miconazole), amphotericin B, and ¼ucytosine and showed low minimum inhibitory concentration (MIC) for all antifungal agents tested except ¼ucytosine, though high MICs were expected due to the extensive use of sublethal concentration of azoles in the agricultural practice. 32 Experimental demonstration indicated possible additive effect while combinations of azoles and caspofungin were used. 37
TABLE 49.2 (continued)
List of Reported Human Infections due to Colletotrichum
S.
1 Joseph et al. 51 C. dematium 25/F Trauma with stones Central ulcer, corneal oedema, and stromal in�ltratation.
2 Mendiratta et al. 15 C. dematium 27/M Injury with soybean branch Paracentral ulcer irregular margin and leathery slough at base and stromal in�latrate.
3 Giaconi et al. 13 C. dematium 59/M Injury after work at grinding wheel, topical antiviral and steroids NA
4 Mitani et al. 52 C. gloeosporioides 80/F Traumatic injury while working in �eld Corneal ulcer with grayish stromal in�ltrate, indistinct margins, and Hypopyon.
5 Singh et al. 31 C. dematium 38/M Acute nodular scerelitis, subconjunctival injection of triamcinolone acetonide Fungal endophthalmitis.
49.1.3 DIAGNOSIS
49.1.3.1 Conventional Techniques
49.1.3.1.1 Keratitis
The diagnosis of keratitis due to Colletotrichum species includes clinical history, clinical examination, and accu rate identi�cation of causative agent. Isolation of the caus ative agent is important for authoritative identi�cation and appropriate antifungal therapy. The corneal scrapings should preferably be collected by the ophthalmologists and directly inoculated at the bedside or transported to the laboratory between two sterile glass slides (one for microscopy and the other for culture). Swabs or samples collected by labo ratory loop are not good specimens and should be avoided.
The direct examination of potassium hydroxide wet mount of the corneal scrapings helps in early diagnosis. The use of calco¼uor white stain and examination under ¼uorescent microscope would increase the sensitivity and rapidity in detection of fungal elements. Isolation of the fungus can be attempted by inoculating the corneal scrapings on the blood agar/Sabourauds dextrose agar by using “C” streak. Only colonies appearing on the “C” streak should be considered as corneal pathogen.
49.1.3.1.2 Subcutaneous Phaeohyphomycosis
Excised tissue or biopsy or the aspirated ¼uid from the lesion are the ideal samples for the laboratory con�rmation of the infection. Direct microscopic examination of the potassium hydroxide (KOH) or calco¼uor wet mount, histopathology, and isolation of the fungus should be attempted from the sample. The presence of pigmented or dark-colored hyphae in the KOH wet mounts or on histopathology slides helps in the diagnosis of phaeohyphomycosis cases. However, occa sionally pigment may not be noticed. Fontana-Masson stain may con�rm the diagnosis in such situations. This stain spe ci�cally stains the melanin present in the fungal cell wall and appears black to brown. Various other special fungal stains like periodic acid schiff stain (PAS) and Gomori’s methana mine silver stain (GMS) may be performed on histopathology sections. Materials from suspected cases should be cultured to isolate the fungus. The fungus grows within 4–6 days.
49.1.3.1.3 Identification of Fungus
Identi�cation of Colletotrichum to the species level may be important for epidemiological considerations. Appearances of conidia, appressoria, and acervulus on the routine media may take longer time and this may lead to dif�culty in mor phological identi�cation. Cultures are usually plated onto potato dextrose agar (PDA) and incubated at 25°C. Five 4 mm plugs may be cut from the actively sporulating areas near the growing edge of a 5-day-old culture using a sterile cork borer. Each plug may be placed on PDA plates and grown by alternating 12 h under ultraviolet light or 12 h in dark at
25°C to induce characteristic morphological characters. 6
Identi�cation of medically important Colletotrichum species is usually performed on the basis of morphological features as shown in Table 49.1. It is noteworthy to mention here that some Colletotrichum spp. may be misidenti�ed as Fusarium due to the close resemblance of the falcate conidia in both these fungi. However, the conidia of Colletotrichum species are nonseptate. Further, the presence of appressoria and in the later stage acervulus with setae may help in identi�cation. 49.1.3.2 Molecular Techniques Due to the inadequacies and plasticity of morphological characters, nucleic acid sequence analysis has been regarded as more reliable method for the identi�cation and classi�cation of Colletotrichum species. 4,7,23,26,28 Even the application of the molecular techniques directly on the clinical samples may help in rapid diagnosis. 49.1.3.2.1 Molecular Diagnosis The utility of polymerase chain reaction (PCR) has been established for the detection of many dif�cult organisms like Mycobacteria, Microsporidia, and Acanthamoeba causing eye infections. But the same for the diagnosis of Colletotrichum is not well established. Kumar and Shukla developed a PCR targeting internal transcribed spacer (ITS) regions and single-stranded conformation polymorphism of rRNA genes for rapid diagnosis of mycotic keratitis. 38 One of the three fungi identi�ed by this method is Colletotrichum state of Glomerella cingulata. In another study by Vengayil et al., PCR was proved not only as an effective rapid method, but also as a sensitive method for the diagnosis of fungal keratitis compared to KOH wet mount and Gram’s smear. 39 However, the sample collection and DNA extraction procedure may interfere with the PCR test sensitivity. To overcome this problem, Menassa et al. recently developed a DNAstabilizing Whatman (FTA) �lter paper method for specimen collection. It can be used as a single-step, non-nested PCR for fungal keratitis without the need of DNA extraction. 40 Thus PCR is a promising tool for rapid diagnosis of fungal keratitis caused by Colletotrichum spp. 49.1.3.2.2 Molecular Identification Due to certain limitations of the morphological identi�cation of Colletotrichum species, molecular techniques seem to be an important tool for species determination. The rRNA-ITS sequencing holds the potential to identify most of the clinically important species of Colletotrichum. Cano et al. demonstrated the utility of ITS and D1–D2 region of rRNA gene to identify the most relevant clinical species of Colletotrichum causing human infections. 41 Though the ITS region is widely sequenced region, there are some concerns to use ITS sequence data for species identi�cation. Crouch and Beirn reported a high error rate (86%) while comparing ITS sequence data within the C. graminicola species complex. 4 Entry of sequence data under an incorrect speci�c name in public domain has created more confusion. According to one analysis of 343 ITS sequences named C. gloeosporioides (accessed on September 6, 2009) more than 86% had considerable evolutionary divergence from the type species of C. gloeosporioides, and most likely the strains are other than Colletotrichum species. 28 However, as the spectrum of species of Colletotrichum causing human infection is expanding, it might not be possible to identify all the clini cally relevant species of Colletotrichum just by rRNA-ITS sequence. Thus multigene phylogenetics is employed to sys tematically characterize Colletotrichum species. 4,23,26,42–44
Prihastuti et al. used six genes, the nuclear rDNA ITS region, partial Actin (ACT), β-tubulin (TUB2), Calmodulin (CAL),
Glutamine synthetase (GS), and Glyceraldehyde 3-phos phate dehydrogenase (GPDH) to study a few closely related Colletotrichum species (C. gloeosporioides sensu lato) and established that species relationships could well be resolved by the same procedure. 26 Multigene phylogenetics is an accu rate and reliable method for the diagnosis of Colletotrichum species, but it is neither very ef�cient nor economical. It is currently impractical to apply multiple gene phylogenetics to identify each clinical isolate. It is paramount that sequence data be generated from type species and used in species com parisons and phylogenetic analysis. However, the ITS region is still useful in some cases for reconstruction of interspe ci�c relationships, although it is not ideal for inferring intra speci�c relationships. Currently, ITS is the only gene region that is available from all the ex-type or ex-epitype cultures of
Colletotrichum species.
49.1.3.2.3 Epitypification in Colletotrichum
According to article 9.7 of the International Code of
Botanical Nomenclature (Vienna Code)
An epitype is a specimen or illustration selected to serve as an interpretative type when the holotype, lectotype, or previ ously designated neotype, or all original material associated with a validly published name, is demonstrably ambiguous and cannot be critically identi�ed for purposes of the precise application of the name of a taxon. 45–47 When an epitype is designated, the holotype, lectotype, or neotype that the epi type supports must be explicitly cited.
It has become relatively common to epitypify fungi. 27,42,46,48
One of the major reasons to epitypify is that the type mate rial is lost or is in poor condition. Even if the type material is in relatively good condition, epitypi�cation is needed for gene research. Another reason is that mycologists may have seen good type material and their understanding of a taxon/ genus/family may be based on literature or drawings of the type or representative (possibly misidenti�ed) collections.
The individual understanding may therefore be questionable.
So epitypi�cation can solve many taxonomic problems and stabilize the understanding of species, genera, families, or orders in general and particularly in Colletotrichum.
49.2 METHODS
49.2.1 SAMPLE PREPARATION
Whole cell DNA from the mycelia can be extracted fol lowing a slightly modi�ed protocol of small-scale fun gal DNA extraction method by Lee and Taylor. 49 Brie¼y, Colletotrichum species is allowed to grow on PDA at 37°C on a rotary shaker at 120 rpm for 3–5 days. The mycelial mat is recovered by �ltration and washed with sterile normal saline. About 0.2–0.3 g of the mycelial mat is grinded in the presence of liquid nitrogen, and the resultant powder is transferred to a 1.5 mL microcentrifuge tube containing 600 μL of lysis buffer (100 mM Tris–HCl pH8.0, 50 mM EDTA, 3% sodium dodecycl sulphate (SDS)). After vortexing the tube brie¼y proteinase K is added to a �nal concentration of 20 μg/mL. The tube is incubated at 56°C for 1 h. Finally, DNA can be extracted using phenol:chloroform extraction procedure. The DNA precipitation is done with equal volume of isopropanol in the presence of 3M sodium acetate. The pellet is washed with 70% alcohol and dissolved in 100 μL of TE (10 mM Tris–HCl pH 7.5, 1 mM EDTA), and stored at −20°C for further use. Alternatively the commercial DNA isolation kit may be used for the extraction of the DNA from the culture. 49.2.2 DETECTION PROCEDURES 49.2.2.1 PCR-ITS Region The rRNA gene-ITS can be ampli�ed by PCR in the presence of 2 mM MgCl 2 , 200 μM of dNTP, 0.25 μM of primer (ITS1—GCATATCAATAAGCGGAGGAAAAG and ITS4—GGTCCGTGTTTCAAGACGG), 0.25 U of Taq polymerase, and 5–10 ng of fungal genomic DNA in a total volume of 10 μL. The ampli�cation reaction is performed in a thermalcycler. The PCR cycling conditions consist of an initial denaturation step for 5 min at 94°C, followed by 35 cycles of denaturation at 94°C for 1 min, annealing at 55°C for 30 s and 72°C for 1 min, and a �nal extension step at 72°C for 5 min. 49.2.2.2 Sequencing of rRNA-ITS Region To extract the gene fragment, agarose gel can be excised with a clean, sharp scalpel. To the weighed gel slice, three times the volume of buffer, Qiagen (QG) is added and incubated at 50°C for 10 min or until the gel slice is dissolved completely. To accelerate dissolution, the gel is vortexed every 2–3 min during incubation. One gel volume of isopropanol is added to the sample and mixed. The Q/A quick spin column (Qiagen, QIA quick) is placed in 2 mL collection tube. To bind DNA, the sample is applied to the Q/A quick column and centrifuged for 1 min. The ¼ow-through is discarded and the Q/A quick column is placed back into the same tube. To wash 0.75 mL of buffer, Qiagen (PE) is added to Q/A quick column and centrifuged for 1 min. The ¼ow-through is discarded. The column is centrifuged in a 2 mL collection tube for 1 min at 13,000 rpm. To elute DNA, 30–50 μL of elution buffer (10 mM Tris–HCl pH 8.5) is added to the center of the Q/A quick membrane and centrifuged for 1 min. The elute is used as the puri�ed gene product. Sequencing reactions can be performed in any sequencing platform, but are more commonly performed with Big Dye Terminator Cycle Sequencing Kit, Version 3.1/1.1 (Applied Biosystems). The sequencing reactions may be analyzed on ABI Genetic Analyzer (Applied Biosystems) or other software depending upon the sequencing kit used. The identity of the isolate can be found by compar ing the sequence with the deposited sequence in the public databases like GenBank.
49.3 CONCLUSION AND FUTURE PERSPECTIVES
Colletotrichum species, basically the plant pathogen, is recently emerging as an opportunistic agent causing eye infec tions and subcutaneous infections in humans. Though very few human cases are reported in the literature, exact number may be much higher due to lack of awareness and dif�culty in identi�cation of these agents in the routine clinical mycol ogy laboratory. Among many species of Colletotrichum,
C. dematium, C. coccodes, C. gloeosporioides, C. gramini cola, C. crassipes, and C. truncatum are known to cause human infections. As this fungus takes longer time to pro duce conidia, appressoria, and acervulus on the routine cul ture media, morphological identi�cation becomes dif�cult or delayed. Molecular techniques, especially the sequencing of
ITS and D1–D2 region of rDNA, may help in rapid identi� cation of the fungi. However, many sequences deposited in
GenBank are wrongly labeled due to multiple names of the same species or misidenti�cation of the fungus on the basis of morphological characters. So epitypi�cation of all the
Colletotrichum species may resolve many taxonomic prob lems and may help in accurate identi�cation.
1. Bauley, J.A. et al., Infection strategies of Colletotrichum species. In Bailey, J.A. and Jeger, M.J. Eds., Colletotrichum: Biology, Pathology and Control, CAB International, Wallingford, CT, 1992.
2. Hyde., K.D. et al., Colletotrichum: A catalogue of confusion. Fungal Divers., 39, 1–17, 2009.
3. Sutton, D.A., Coelomycetous fungi in human disease. A review: Clinical entities, pathogenesis, identi�cation and therapy. Rev. Iberoam. Micol., 16, 171, 1999.
4. Crouch, J.A. and Beirn, L.A., Anthracnose of cereals and grasses. Fungal Divers., 39, 19, 2009.
5. Hyde, K.D. et al., Colletotrichum—Names in current use. Fungal Divers., 39, 147, 2009.
6. Sutton, B.C., Fungi imperfecti with pycnidia, acervuli and stromata. In Coelomycetes, Commonwealth Mycological Institute, Kew, U.K., 1980.
7. Sutton, B.C., Genus Glomerella and its anamorph Colletotrichum. In Bailey, J.A. and Jeger, M.J., Eds., Colletotrichum: Biology, Pathology and Control, CAB International, Wallingford, CT, 1992.
8. Kirk, P.M. et al., The Dictionary of the Fungi, 10th edn., CABI Bioscience, U.K., 2008.
9. Cai, L. et al., A Polyphasic approach for studying colletatrichum. Fungal Divers., 39, 183, 2009.
10. Chakrabarti, A. et al., Fungal endophthalmitis: Fourteen years’ experience from a center in India. Retina, 28, 1400, 2008.
11. Kaliamurthy, J. and Thomas, P.A., Keratitis due to Colletotrichum dematium. Indian. J. Med. Microbiol., 23, 206, 2005. 12. Fernandez, V. et al., Colletotrichum keratitis. Am. J. Ophthalmol., 134, 435, 2002. 13. Giaconi, J.A. et al., Voriconazole and fungal keratitis: A report of two treatment failures. J. Ocul. Pharmacol. Ther., 22, 437, 2006. 14. Liao, W.Q., Shao, J.Z., and Li, S. Q., Colletotrichum dematium caused keratitis. Chinese Med. J., 96, 391, 1983. 15. Mendiratta, D.K. et al., Keratitis due to Colletotrichum dematium—A case report. Indian J. Med. Microbiol., 23, 56, 2005. 16. Rosa, R.H. Jr., Miller, D., and Alfonso, E.C., The changing spectrum of fungal keratitis in south Florida. Ophthalmology, 101, 1005, 1994. 17. Liesegang, T.J. and Forster, R.K., Spectrum of microbial keratitis in South Florida. Am. J. Ophthalmol., 90, 38, 1980. 18. Shukla, P.K. et al., Clinical and experimental keratitis caused by the Colletotrichum state of Glomerella cingulata and Acrophialophora fusispora. Sabouraudia, 21, 137, 1983. 19. Yamamoto, N., Matsumoto, T., and Ishibashi, Y., Fungal keratitis caused by Colletotrichum gloeosporioides. Cornea, 20, 902, 2001. 20. Ritterband, D.C., Shah, M., and Seedor, J.A., Colletotrichum graminicola: A new corneal pathogen. Cornea, 16, 362, 1997. 21. Castro, L.G. et al., Phaeohyphomycotic cyst caused by Colletotrichum crassipes. J. Clin. Microbiol., 39, 2321, 2001. 22. Upadhyay, M.P. et al., Epidemiologic characteristics, predisposing factors, and etiologic diagnosis of corneal ulceration in Nepal. Am. J. Ophthalmol., 111, 92–99, 1991. 23. Damm, U. et al., Colletotrichum species with curved conidia from herbaceous hosts. Fungal Divers., 39, 45, 2009. 24. Midha, N.K., Mirzanejad, Y., and Soni, M., Colletotrichum Sp.: Plant or human pathogen? Antimicrob. Infect. Dis. Newsl., 15, 26, 1996. 25. de Hoog, G. S. et al., Atlas of Clinical Fungi, a pilot CD-ROM version of the 3rd edn., Centraalbureau voor Schimmelcultures, Baarn, the Netherlands, 2009. 26. Prihastuti, H. et al., Characterization of Colletotrichum species associated with coffee berries in northern Thailand. Fungal Divers., 39, 89, 2009. 27. Shenoy, B.D. et al., Morpho-molecular characterization and epitypi�cation of Colletotrichum capsici (Glomerellaceae, Sordariomycetes), the causative agent of antharacnose in chilli. Fungal Divers., 27, 197, 2007. 28. Cannon, P.F., Buddie, A.G., and Bridge, P.D., The typi�cation of Colletotrichum gloeosporioides. Mycotaxon, 104, 189, 2008. 29. Kaliamurthy, J. et al., Keratitis due to a coelomycetous fungus: Case reports and review of the literature. Cornea, 23, 3, 2004. 30. Marangon, F.B. et al., In vitro investigation of voriconazole susceptibility for keratitis and endophthalmitis fungal pathogens. Am. J. Ophthalmol., 137, 820, 2004. 31. Singh, R. et al., Fungal endophthalmitis complicating subconjunctival injection of triamcinolone acetonide in anterior seleritis. Ann. Ophthalmol., 38, 253, 2006. 32. Guarro, J. et al., Subcutaneous hyalohyphomycosis caused by Colletotrichum gloeosporioides. J. Clin. Microbiol., 36, 3060, 1998. 33. O’Quinn, R.P., Hoffmann, J.L., and Boyd, A.S., Colletotrichum species as emerging opportunistic fungal pathogens: A report of 3 cases of phaeohyphomycosis and review. J. Am. Acad. Dermatol., 45, 56, 2001. 34. Berger, S.T. et al., Macroscopic pigmentation in a dematiaceous fungal keratitis. Cornea, 10, 272, 1991.
35. Ajello, L. et al., A case of phaeohyphomycosis caused by a new species of Phialophora. Mycologia, 66, 490, 1974.
36. Sanche, S.E., Sutton, D.A., and Rinaldi, M.G., Dematiaceous fungi. In Anaissie, E.J., McGinnis, M.R., and Pfaller, M.A., Eds., Clinical Mycology 1st edn., Churchill Livingstone, Philadelphia, PA, 2003, p. 325.
37. Ser¼ing, A., Wohlrab, J., and Deising, H.B., Treatment of a clinically relevant plant-pathogenic fungus with an agricultural azole causes cross-resistance to medical azoles and potentiates caspofungin ef�cacy. Antimicrob. Agents Chemother., 51, 3672, 2007.
38. Kumar, M. and Shukla, P.K., Use of PCR targeting of internal transcribed spacer regions and single-stranded conformation polymorphism analysis of sequence variation in different regions of rRNA genes in fungi for rapid diagnosis of mycotic keratitis. J. Clin. Microbiol., 43, 662, 2005.
39. Vengayil, S. et al., Polymerase chain reaction-guided diagnosis of mycotic keratitis: A prospective evaluation of its ef�cacy and limitations. Invest. Ophthalmol. Vis. Sci., 50, 152, 2009.
40. Menassa, N. et al., Rapid detection of fungal keratitis using DNA-stabilizing FTA(R) �lter paper. Invest. Ophthalmol. Vis. Sci., 51, 1905, 2010.
41. Cano, J., Guarro, J., and Gene, J., Molecular and morphological identi�cation of Colletotrichum species of clinical interest. J. Clin. Microbiol., 42, 2450, 2004.
42. Crouch, J.A. et al., Systematic analysis of the falcate-spored graminicolous Colletotrichum and a description of six new species from warm-season grasses. Mycologia, 101, 717, 2009. 43. Farr, D.F. et al., Species of Colletotrichum on agavaceae. Mycol. Res., 110, 1395, 2006. 44. Crouch, J.A., Clarke, B.B., and Hillman, B.I., Unraveling evolutionary relationships among the divergent lineages of Colletotrichum causing anthracnose disease in turfgrass and corn. Phytopathology, 96, 46, 2006. 45. MCNeil, J. et al., International Code of Botanical Nomenclature (VIENNA CODE), 2006, adapted by the seventeeth International Botanical Congress, Vienna, Austria, July 2005. Published Ruggel, Gantner, 2006. Available at http://ibot.sav.sk/icbn/main.htm 46. Hyde, K.D. and Zhang, Y., Epitypi�cation: Should we epitypify? J. Zhejiang. Univ. Sci., 9, 842, 2008. 47. Alves, A. et al., Morphological and molecular data reveal cryptic speciation in Lasiodiplodia theobromae. Fungal Divers., 28, 1, 2008. 48. Than, P.P. et al., Epitypi�cation and phylogeny of Colletotrichum acutatum. Fungal Divers., 28, 97, 2008. 49. Lee, S.B. and Taylor, J.W., Isolation of DNA from fungal mycelia and single spores. In Innis, M.A., Gelfand, D.H., and Sninsky, J.J. et al., Eds., PCR Protocols: A Guide to Methods and Applications., Academic Press, San Diego, CA, 1990. 50. Matsuzaki, O., Yasuda, M., and Ichinohe, M., Keratomycosis due to Glomerella cingulata. Rev. Iber. Micol., 5, S30, 1988. 51. Joseph, J., Fernandes, M., and Sharma, S., Colletotrichum dematium keratitis. J. Postgrad. Med., 50, 309, 2004. 52. Mitani, A. et al., In vivo and in vitro investigations of fungal keratitis caused by Colletotrichum gloeosporioides. J. Ocular. Pharm. Therap., 25, 563, 2009. 50 Chapter 50 - Cylindrocarpon
1. Booth C. The genus Cylindrocarpon. Mycological Papers, no. 104. Kew, Surrey, England: Commonwealth Mycological Institute, 1996.
2. Watanabe T. Cylindrocladium tenue comb. nov. and two other Cylindrocladium species isolated from diseased seedlings of Phellodendron amurense in Japan. Mycologia 1994;86:151–156.
3. Booth C, Clayton CY, Usherwood M. Cylindrocarpon species associated with mycotic keratitis. Proc Indian Acad Sci Plant Sci. 1984;94:422–436.
4. Matsumoto T, Masaki J, Okabe T. Cylindrocarpon tonkinense: As a cause of keratomycosis. Trans Br Mycol Soc. 1979;72:503–504.
5. De Vries GA, de Hoog GS, de Bruyn HP. Phialophora cyanescens sp. nov. with Phaeosclera-like synanamorph, causing white-grain mycetoma in man. Anton Van Leeuwen. 1984;50:149–153.
6. Summerbell RC, Schroers HJ. Analysis of phylogenetic relationship of Cylindrocarpon lichenicola and Acremonium falciforme to the Fusarium solani species complex and a review of similarities in the spectrum of opportunistic infections caused by these fungi. J Clin Microbiol. 2002;40(8):2866–2875.
7. Iwen PC et al. Cutaneous infection caused by Cylindrocarpon lichenicola in a patient with acute myelogenous leukemia. J Clin Microbiol. 2000;38:3375–3378.
8. de Hoog GS et al. Atlas of Clinical Fungi. 2nd edn. Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands, 2000.
9. Samuels GJ, Brayford D. Phragmosporous Nectria species with Cylindrocarpon anamorphs. Sydowia 1993;45:55–80.
10. O’Donnell K. Molecular phylogeny of the Nectria haematococca-Fusarium solani species complex. Mycologia 2000; 92:919–938.
11. Laney B, Blanc C, Lapalu J. Cylindrocarpon: A new athlete’s foot agent. Bull Soc Fr Mycol Med. 1985;14:73–76. 12. James EA et al. Disseminated infection due to Cylindrocarpon lichenicola in a patient with acute myeloid leukaemia. J Infect. 1997;34:65–67. 13. Sharma R et al. Peritonitis in continuous ambulatory peritoneal dialysis due to Cylindrocarpon lichenicola infection. Nephrol Dial Transplant. 1998;13:2662–2664. 14. Mangiaterra M et al. Keratomycosis caused by Cylindrocarpon lichenicola. Med Mycol. 2001;39:143–145. 15. Rodríguez-Villalobos H et al. Disseminated infection due to Cylindrocarpon (Fusarium) lichenicola in a neutropenic patient with acute leukaemia: Report of a case and review of the literature. Eur J Clin Microbiol Infect Dis. 2003;22(1):62–65. 16. Chazan B et al. Mycetoma of the foot caused by Cylindrocarpon lichenicola in an immunocompetent traveler. J Travel Med. 2004;11(5):331–332. 17. Kaliamurthy J et al. Keratitis due to Cylindrocarpon lichenicola. J Postgrad Med. 2006;52(2):155–157. 18. Zoutman DE, Sigler L. Mycetoma of the foot caused by Cylindrocarpon destructans. J Clin Microbiol. 1991;29: 1855–1859. 19. Hemashettar BM et al. White grain mycetoma caused by a Cylindrocarpon sp. in India. J Clin Microbiol. 2000;38(11): 4288–4291. 20. Mitra A et al. The use of voriconazole in the treatment of cylindrocarpon keratomycosis. Cornea 2009;28(2):217–218. 21. Nelson PJ, Dignani, MC, Anaissie, EJ. Taxonomy, biology and clinical aspects of Fusarium species. Clin Microbiol Rev. 1994l;7:479–504. 22. O’Donnell K, Cigelnik, E. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Mol Phylogenet Evol. 1997;7:103–116. 23. de Hoog GS, Gerrits van den Ende, AHG. Molecular diagnostics of clinical strains of �lamentous basidiomycetes. Mycoses 1998;41:183–189. 24. Hennequin C et al. Identi�cation of Fusarium species involved in human infections by 28S rRNA gene sequencing. J Clin Microbiol. 1999;37:3586–3589. 25. Hue F-X et al. Speci�c identi�cation of Fusarium species in blood and tissue by a PCR technique. J Clin Microbiol. 1999;37:2434–2438. 26. Mantiri FR et al. Phylogenetic relationships in Neonectria species having Cylindrocarpon anamorphs inferred from mitochondrial ribosomal DNA sequences. Can J Bot. 2001; 79:334–340. 27. White TJ et al., 1990. Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In MA Innis, DH Gelfand, JJ Sninsky, and TJ White (eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press, Inc., San Diego, CA, pp. 315–322. 28. Henry T, Iwen PC, Hinrichs SH. Identi�cation of Aspergillus species using internal transcribed spacer regions 1 and 2. J Clin Microbiol. 2000;38:1510–1515. 51 Chapter 51 - Fusarium
1. Guy St-Germain, B.S. and Summerbell, R., Identifying Filamentous Fungi, Star Publishing Co., Belmont, CA, 1996.
2. Nelson, P.E., Dignani, M.C., and Anaissie, E.J., Taxonomy, biology, and clinical aspects of Fusarium species, Clin. Microbiol. Rev., 7, 479, 1994.
3. Link, H.F., Observationes in ordines plantarum naturales, Dissertatio I, Mag. Ges. Naturf. Freunde, Berlin, 3, 3, 1809.
4. Verweij, P.E. and Brandt M.E., Aspergillus, Fusarium and other opportunistic moniliaceous fungi, In Murray, P.R. et al. (Eds.), Manual of Clinical Microbiology, 8th edn., ASM Press Washington, DC, p. 1802, 2007.
5. Boonpasart, S. et al., Infectious keratitis at King Chulalongkorn Memorial Hospital: A 12 year retrospective study of 391 cases, J. Med. Ass. Thailand, 85, 217, 2002.
6. Goldschmied, R.A. et al., Fusarium spp. isolated from nonocular sites: A 10 year experience at an Israeli general hospital, J. Mycol. Med., 3, 99, 1993.
7. Krcmery, V. et al., Fungaemia due to Fusarium spp. in cancer patients, J. Hosp. Infect., 36, 223, 1997.
8. Burgess, L.W., General ecology, In Nelson, P.E., Toussoun, T.A., and Cook, R.J. (Eds.), Fusarium: Diseases, Biology and Taxonomy, Pennsylvania State University Press, University Park, PA, pp. 225–235, 1981.
9. Moretti, A.N., Taxonomy of Fusarium genus, a continuous �ght between lumpers and splitters, Proc. Nat. Sci. Matica Srpska Novi Sad, 117, 7, 2009.
10. Ploetz, R.C. and Pegg, K.G., Fusarium wilt. In Jones, D.R. (Ed.), Diseases of Banana, Abaca and Enset, CABI Publishing, Wallingford, U.K., pp. 143–159, 1999. 11. Windels, C.E., Economic and social impacts of Fusarium head blight: Changing farms and rural communities in the Northern Great Plains, 91st Annual Meeting of The American Phytopathological Society August 8, 1999, Montreal, Quebec, Canada, Phytopathology, 90, 17, 2000. 12. Eljaschewitsch, J. et al., Port-a-cath-related Fusarium oxysporum infection in an HIV-infected patient: Treatment with liposomal amphotericin B, Mycoses, 39, 115, 1996. 13. Guarro, J. et al., Fungemia due to Fusarium sacchari in an immunosuppressed patient, J. Clin. Microbiol., 38, 419, 2000. 14. Mselle, J., Fungal keratitis as an indicator of HIV infection in Africa, Trop. Doctor, 29, 133, 1999. 15. Nir-Paz, R. et al., Clinical and epidemiological aspects of infections caused by Fusarium species: A collaborative study from Israel, J. Clin. Microbiol., 42, 3456, 2004. 16. Chang, D.C. et al., Multistate outbreak of Fusarium keratitis associated with use of a contact lens solution, JAMA, 296, 953, 2006. 17. Khor, W.B. et al., An outbreak of Fusarium keratitis associated with contact lens wear in Singapore, JAMA, 295, 2867, 2006. 18. Godoy, P. et al., Genotyping of 44 isolates of Fusarium solani, the main agent of fungal keratitis in Brazil, J. Clin. Microbiol., 42, 4494, 2004. 19. Hidy, P.H. et al., Zearalenone and some derivatives: Production and biological activity, Adv. Appl. Microbiol., 22, 59, 1977. 20. Shukla, R. et al., Bioprocess strategies and recovery process in gibberellic acid fermentation, Biotech. Bioproc. Eng., 8, 269, 2003. 21. Tomasini, A. et al., Gibberellic acid production using different solid-state fermentation systems, World J. Microbiol. Biotech., 13, 203, 1997. 22. Heyndrickx, A. et al., Detection of trichothecene mycotoxins yellow rain in blood, urine and feces of Iranian soldiers treated as victims of a gas attack, Riv. Tossicol. Speriment. Clin., 19, 7, 1989. 23. Whiteside T., Annals of the cold war: The yellow rain complex, New Yorker, 66, 52, 1991. 24. Naseema, A. et al., Fusarium pallidoroseum for management of water hyacinth, Curr. Sci., 86, 770, 2004. 25. Leslie, J.F. and Summerell B.A., The Fusarium Laboratory Manual, Blackwell Publishing, Ames, IA, 2006. 26. O’Donnell, K. et al., Phylogenetic diversity and microsphere array-based genotyping of human pathogenic Fusaria, including isolates from the multistate contact lens-associated U.S. keratitis outbreaks of 2005 and 2006, J. Clin. Microbiol., 45, 2235, 48, 2007. 27. O’Donnell, K. et al., Molecular systematics and phylogeography of the Gibberella fujikuroi species complex, Mycologia, 90, 465, 1998. 28. Arikan, S. et al., In vitro susceptibility testing methods for caspofungin against Aspergillus and Fusarium isolates, Antimicrob. Agents Chemother., 45, 327, 2001. 29. Arikan, S. et al., Microdilution susceptibility testing of amphotericin B, itraconazole, and voriconazole against clinical isolates of Aspergillus and Fusarium species, J. Clin. Microbiol., 37, 3946, 1999. 30. Wollenweber, H.W. and Reinking, O.A., Die Fusarien, ihre Beschreibung, Schadwirkung und Bekämpfung, Paul Parey, Berlin, 1935. 31. Boutati, E.I. and Anassie, E.J., Fusarium, a signi�cant emerging pathogen in patients with haemorrhagic malignancy: Ten years experience at a cancer centre and implications for management, Blood, 90, 999, 1997.
32. Walsh, T.J. and Groll, A.H., Emerging fungal pathogens: Evolving challenges to immunocompromised patients for the twenty-�rst century, Transpl. Infect. Dis., 1, 247, 1999.
33. Marr, K.A. et al., Epidemiology and outcome of mould infections in hematopoietic stem cell transplant recipients, Clin. Infect. Dis., 34, 909, 2002.
34. Cho, C.T. et al., Fusarium solani infection during treatment for acute leukemia, J. Pediatr., 83, 1028, 1973.
35. Girmenia, C. et al., Onychomycosis as a possible origin of disseminated Fusarium solani infection in a patient with severe aplastic anemia, Clin. Infect. Dis., 14, 1167, 1992.
36. Austen, B. et al., Fatal disseminated Fusarium infection in acute lymphoblastic leukaemia in complete remission, J. Clin. Pathol., 54, 488, 2001.
37. Nucci, M. and Anaissie, E., Cutaneous infection by Fusarium species in healthy and immunocompromised hosts: Implications for diagnosis and management, Clin. Infect. Dis., 35, 909, 2002.
38. Anandi, V. et al., Fusarium solani breast abscess, Indian J. Med. Microbiol., 23, 198, 2005.
39. Guarro, J. and Gene J., Opportunistic fusarial infections in humans, Eur. J. Microbiol. Infect. Dis., 14, 741, 1995.
40. Madhavan, M., Ratnakar, C., Veliath, A.J., Kanungo, R., Smile, S.R., and Bhat, S., Primary disseminated fusarial infection, Postgrad. Med. J., 68, 143, 1992.
41. Rekha, A. et al., Fusarium solani in the post-transplant patient: An unusual fungus, Int. J. Low. Extrem. Wounds, 7, 38, 2008.
42. Bharathi, M.J. et al., Microbial keratitis in South India: In¼uence of risk factors, climate, and geographical variation, Ophthalmic. Epidemiol., 14, 2007.
43. Manikandan, P. et al., Corneal ulcer due to Neocosmospora vasinfecta in an immunocompetent patient, Med. Mycol., 46, 279, 2008.
44. Bhartiya, P. et al., Fungal keratitis in Melbourne, Clin. Exp. Ophthalmol., 35, 124, 2007.
45. Michael, R.J., Thew, M.B.B.S., and Todd, B., Fungal keratitis in far north Queensland, Australia, Clin. Exp. Ophthalmol., 36, 721, 2008.
46. Green, M., Apel, A., and Stapleton, F., Risk factors and causative organisms in microbial keratitis, Cornea, 27, 22, 2008.
47. Dunlop, A.A. et al., Suppurative corneal ulceration in Bangladesh. A study of 142 cases examining the microbiological diagnosis, clinical and epidemiological features of bacterial and fungal keratitis, Austral. N.Z. J. Ophthalmol., 22, 105, 1994.
48. Williams, G. et al., Microbiological diagnosis of suppurative keratitis in Bangladesh, Br. J. Ophthalmol., 71, 315, 1987.
49. Williams, G., McClellan, K., and Billson, F., Suppurative keratitis in rural Bangladesh: The value of gram stain in planning management, Int. Ophthalmol., 15, 131, 1991.
50. Rahman, M.R. et al., Randomised trial of 0.2% chlorhexidine gluconate and 2.5% natamycin for fungal keratitis in Bangladesh, Br. J. Ophthalmol., 82, 919, 1998.
51. Hö¼ing-Lima, A.L. et al., Laboratory study of the mycotic infectious eye diseases and factors associated with keratitis [in Portuguese], Arq. Bras. Oftalmol., 68, 21, 2005.
52. Alvarez-de-Carvalho, A.C. et al., Fungal keratitis in the State of Parana-Brazil: Clinical, epidemiological and diagnostic �ndings [in Portuguese], Rev. Iberoam. Micol., 18, 76, 2001.
53. Salera, C.M. et al., Spectrum of fungal keratitis at the Săo Geraldo Hospital–Belo Horizonte–MG [in Portuguese], Arq. Bras. Oftalmol., 65, 9, 2002. 54. Ibrahim, M.M. et al., Epidemiologic aspects and clinical outcome of fungal keratitis in southeastern Brazil, Eur. J. Ophthalmol., 19, 355, 2009. 55. Leck, A.K. et al., Aetiology of suppurative corneal ulcers in Ghana and south India, and epidemiology of fungal keratitis, Br. J. Ophthalmol., 86, 1211, 2002. 56. Upadhyay, M.P. et al., Epidemiologic characteristics, predisposing factors, and etiologic diagnosis of corneal ulceration in Nepal, Am. J. Ophthalmol., 111, 92, 1991. 57. Khanal, B. et al., Laboratory diagnosis in ulcerative keratitis, Ophthalmic Res., 37, 123, 2005. 58. Gugnani, H.C., Gupta, S., and Talwar, R.S., Role of opportunistic fungi in ocular infections in Nigeria, Mycopathologia, 65, 155, 1978. 59. Zhang, W. et al., The variance of pathogenic organisms of purulent ulcerative keratitis [in Chinese], Zhonghua Yan Ke Za Zhi, 38, 8, 2002. 60. Wang, L. et al., Spectrum of mycotic keratitis in China [in Chinese], Zhonghua Yan Ke Za Zhi, 36, 138, 2000. 61. Wang, L. et al., Spectrum of fungal keratitis in central China, Clin. Exp. Ophthalmol., 37, 763, 2009. 62. Xie, L., Dong, X., and Shi, W., Treatment of fungal keratitis by penetrating keratoplasty, Br. J. Ophthalmol., 85, 1070, 2001. 63. Xie, L. et al., Spectrum of fungal keratitis in North China, Ophthalmology, 113, 1943, 2006. 64. Xie, L. et al., Antifungal susceptibility for common pathogens of fungal keratitis in Shandong province, China. Am. J. Ophthalmol., 146, 260, 2008. 65. Sun, X.G. et al., Etiological analysis on ocular fungal infection in the period of 1989–2000, Chin. Med. J., 117, 598, 2004. 66. Sun, X. et al., Ocular fungal isolates and antifungal susceptibility in Northern China, Am. J. Ophthalmol., 143, 131, 2007. 67. Qiu, W.-Z. et al., Fungal spectrum identi�ed by a new slide culture and in vitro drug susceptibility using Etest in fungal keratitis, Curr. Eye Res., 30, 1113, 2005. 68. Rondeau, N. et al., Fungal keratitis at the Centre Hospitalier National d’Ophtalmologie des Quinze-Vingts: Retrospective study of 19 cases [in French], J. Fr. Ophtalmol., 25, 890, 2002. 69. Shokohi, T., Nowroozpoor-Dailami, K., and MoaddelHaghighi, T., Fungal keratitis in patients with corneal ulcer in Sari, Northern Iran, Arch. Iran. Med., 9, 222, 2006. 70. Mirshahi, A. et al., Fungal keratitis in patients at Farabi Hospital, Tehran (1998–1999) [in Persian], Bina, 5, 135, 1999. 71. Berenji, F. et al., Fungal keratitis in patients at Imam Reza Hospital, Mashhad (1982–2001) [in Persian], Med. J. Mashhad Univ. Med. Sci., 45, 49, 2003. 72. Norina, T.J. et al., Microbial keratitis: Aetiological diagnosis and clinical features in patients admitted to Hospital Universiti Sains Malaysia, Singapore Med. J., 49, 67, 2008. 73. Mino de Kaspar, H. et al., Mycotic keratitis in Paraguay, Mycoses, 34, 251, 1991. 74. Laspina, F. et al., Epidemiological characteristics of microbiological results on patients with infectious corneal ulcers: A 13-year survey in Paraguay, Graefes Arch. Clin. Exp. Ophthalmol., 242, 204, 2004. 75. Maidana, E. et al., Infectious keratitis in children: An epidemiological and microbiological study in a universitary hospital in Asunción–Paraguay [in Portuguese], Arq. Bras. Oftalmol., 68, 828, 2005.
76. Wong, T.Y., Fong, K.S., and Tan, D.T., Clinical and microbial spectrum of fungal keratitis in Singapore: A 5-year retrospective study, Int. Ophthalmol., 21, 127, 1997.
77. Sirikul, T. et al., Predisposing factors and etiologic diagnosis of ulcerative keratitis, Cornea, 27, 283, 2008.
78. Tanure, M.A. et al., Spectrum of fungal keratitis at Wills Eye Hospital, Philadelphia, Pennsylvania, Cornea, 19, 307, 2000.
79. Rosa, R.H., Miller, D., and Alfonso, E.C., The changing spectrum of fungal keratitis in South Florida, Ophthalmology, 101, 1005, 1994.
80. Liesegang, T.J. and Forster, R.K., Spectrum of microbial keratitis in South Florida, Am. J. Ophthalmol., 90, 38, 1980.
81. Alfonso, E.C. et al., Fungal keratitis associated with nontherapeutic soft contact lenses, Am. J. Ophthalmol., 142, 154, 2006.
82. Iyer, S.A., Tuli, S.S., and Wagoner, R.C., Fungal keratitis: Emerging trends and treatment outcomes, Eye Contact Lens, 32, 267, 2006.
83. Doughman, D.J. et al., Fungal keratitis at the University of Minnesota: 1971–1981, Trans. Am. Ophthalmol. Soc., 80, 235, 1982.
84. Jurkunas, U., Behlau, I., and Colby, K., Fungal keratitis: Changing pathogens and risk factors, Cornea, 28, 638, 2009.
85. Singh, G. et al., Multivariate analysis of childhood microbial keratitis in South India, Ann. Acad. Med. Singapore, 35, 185, 2006.
86. Srinivasan, M. et al., Epidemiology and aetiological diagnosis of corneal ulceration in Madurai, south India, Br. J. Ophthalmol., 81, 965, 1997.
87. Thomas, P.A. et al., Oral itraconazole therapy for mycotic keratitis, Mycoses, 31, 271, 1988.
88. Sundaram, B.M., Badrinath, S., and Subramanian, S., Studies on mycotic keratitis, Mycoses, 32, 568, 1989.
89. Panhalkar, S. et al., Bacterial and mycotic agents of corneal ulcers in Vellore, Indian J. Ophthalmol., 33, 289, 1985.
90. Vasudevan R. et al., Prevalence of bacterial and fungal keratitis in and around Chidambaram, J. Tamil Nadu Ophthalmol. Assoc., 44, 25, 2006.
91. Bharathi, M.J. et al., Aetiological diagnosis of microbial keratitis in South India—A study of 1618 cases, Indian J. Med. Microbiol., 20, 19, 2002.
92. Bharathi, M.J. et al., Epidemiological characteristics and laboratory diagnosis of fungal keratitis. A three-year study, Indian J. Ophthalmol., 51, 315, 2003.
93. Bharathi, M.J. et al., Microbiological diagnosis of infective keratitis: Comparative evaluation of direct microscopy and culture results, Br. J. Ophthalmol., 90, 1271, 2006.
94. Panda, A. et al., Mycotic keratitis in children: Epidemiologic and microbiologic evaluation, Cornea, 16, 295, 1997.
95. Saha, R. and Das, S., Mycological pro�le of infectious keratitis from Delhi, Indian J. Med. Res., 123, 159, 2006.
96. Chowdhary, A. and Singh, K., Spectrum of fungal keratitis in North India, Cornea, 24, 8, 2005.
97. Vajpayee, R.B. et al., Ocular atopy and mycotic keratitis, Ann. Ophthalmol., 22, 369, 1990.
98. Chander, J. and Sharma, A., Prevalence of fungal corneal ulcers in northern India, Infection, 22, 207, 1994.
99. Chander, J. et al., Keratomycosis in and around Chandigarh: A �ve-year study from a north Indian tertiary care hospital, Indian J. Pathol. Microbiol., 51, 304, 2008.
100. Gopinathan, U. et al., The epidemiological features and laboratory results of fungal keratitis: A 10-year review at a referral eye care center in South India, Cornea, 21, 555, 2002. 101. Garg, P. et al., Keratomycosis: Clinical and microbiologic experience with dematiaceous fungi, Ophthalmology, 107, 574, 2000. 102. Kunimoto, D.Y. et al., Corneal ulceration in the elderly in Hyderabad, south India, Br. J. Ophthalmol., 84, 54, 2000. 103. Kumari, N., Xess, A., and Shahi, S.K., A study of keratomycosis: Our experience, Indian J. Pathol. Microbiol., 45, 299, 2002. 104. Deshpande, S.D. and Koppikar, G.V., A study of mycotic keratitis in Mumbai, Indian J. Pathol. Microbiol., 42, 81, 1999. 105. Verenkar, M.P. et al., Study of mycotic keratitis in Goa, Indian J. Med. Microbiol., 16, 58, 1998. 106. Basak, S.K. et al., Epidemiological and microbiological diagnosis of suppurative keratitis in Gangetic West Bengal, eastern India, Indian J. Ophthalmol., 53, 17, 2005. 107. Pichare, A. et al., Bacteriological and mycological study of corneal ulcers in and around Aurangabad, Indian J. Pathol. Microbiol., 47, 284, 2004. 108. Dóczi, I. et al., Involvement of Fusarium spp. in fungal keratitis, Clin. Microbiol. Infect., 10, 773, 2004. 109. Gupta, V. et al., Polymicrobial keratitis after laser in situ keratomileusis, J. Refract. Surg., 17, 147, 2001. 110. Weissman, B. and Mondino, B., Risk factors for contact lens associated microbial keratitis, Contact Lens Anterior Eye, 25, 3, 2002. 111. Ma, S.K. et al., A multi-country outbreak of fungal keratitis associated with a brand of contact lens solution: The Hong Kong experience, Int. J. Infect. Dis., 13, 443, 2008. 112. Saw, S.M. et al., Risk factors for contact lens-related Fusarium keratitis: A case-control study in Singapore, Arch. Ophthalmol., 125, 611, 2007. 113. Dyavaiah, M. et al., Molecular characterization, bio�lm analysis and experimental biofouling study of Fusarium isolates from recent cases of fungal keratitis in New York State, BMC Ophthalmol., 7, 1, 2007. 114. Bausch & Lomb, Fusarium keratitis and Bausch & Lomb’s response: An issue summary in New York State, Rochester, NY, May 19, 2006. 115. http://www.bausch.com/en_US/corporate/corpcomm/ news/2006_5_19_issue_summary.aspx (accessed August 23, 2006). 116. Epstein, A.B., In the aftermath of the Fusarium keratitis outbreak: What have we learned? Clin. Ophthalmol., 1, 355, 2007. 117. Bullock, J.D. et al., Temperature instability of ReNu with MoistureLoc: A new theory to explain the worldwide Fusarium keratitis epidemic of 2004–2006, Trans. Am. Ophthalmol. Soc., 106, 117, 2008. 118. Kombila, M. et al., Fungal otitis in Libreville, study of 83 cases, Bull. Soc. Pathol. Exot. Filial., 82, 201, 1989. 119. Wadhwani, K. and Srivastava, A.K., Fungi from otitis media of agricultural �eld workers, Mycopathologia, 88, 155, 1984. 120. Nuovo, M. et al., Fusarium solani osteomyelitis with probable nosocomial spread, Am. J. Clin. Pathol., 90, 738, 1988. 121. Yu, W.K., Fusarium infection, Hong Kong Dermatol. Venereol. Bull., 9, 71, 2000. 122. Anaissie, E.J. et al., Emerging fungal pathogens, Eur. J. Clin. Microbiol. Infect. Dis., 8, 323, 1989. 123. Kontoyiannis, D.P., Mycetoma. In Goldman, L. and Bennett, J.C. (Eds.), Cecil Textbook of Medicine, 22nd edn., W. B. Saunders Company, Philadelphia, PA, 2003. 124. Wheeler, M.S. et al., Fusarium infection in burned patients, Am. J. Clin. Pathol., 75, 304, 1981.
125. Gordon, W.L., The taxonomy and habitats of Fusarium species from tropical and temperate regions, Can. J. Bot., 38, 643, 1960.
126. Young, C.N. and Meyers, A.M., Opportunistic fungal infection by Fusarium oxysporum in a renal transplant patient, Sabouraudia, 17, 219, 1979.
127. Luque, A. et al., Aumento de la incidencia de micosis super�ciales producidas por hongos del género Fusarium, Rev. Iberoam. Micol., 12, 65, 1995.
128. Merz, W.G. et al., Diagnosis and successful treatment of fusariosis in the compromised host, J. Infect. Dis., 158, 1046, 1988.
129. Robertson, M.J. et al., Successful treatment of disseminated Fusarium infection after autologous bone marrow transplantation for acute myeloid leukemia, Bone Marrow Transpl., 8, 143, 1991.
130. Squier, C. et al., Waterborne nosocomial infections, Curr. Infect. Dis. Rep., 2, 490, 2000.
131. Anaissie, E.J. et al., Fusariosis associated with pathogenic Fusarium species colonization of a hospital water system: A new paradigm for the epidemiology of opportunistic mold infections, Clin. Infect. Dis., 33, 1871, 2001.
132. Raad, I. et al., Epidemiology, molecular mycology, and environmental sources of Fusarium infection in patients with cancer, Infect. Control Hosp. Epidemiol., 23, 532, 2002.
133. Summerbell, R.C. et al., Fusarium proliferatum as an agent of disseminated infection in an immunosuppressed patient, J. Clin. Microbiol., 26, 82, 1988.
134. Anaissie, E. et al., The emerging role of Fusarium infections in patients with cancer, Medicine, 67, 77, 1988.
135. Nucci, M. et al., Outcome predictors of 84 patients with hematologic malignancies and Fusarium infection, Cancer, 98, 315, 2003.
136. Fridkin, S.K. and Jarvis, W.R., Epidemiology of nosocomial fungal infections, Clin. Microbiol. Rev., 9, 499, 1996.
137. Anaissie, E.J. and Rinaldi, M.G., Fusarium and the immunocompromised host, N. Y. State J. Med., 90, 586, 1990.
138. Anaissie, E. et al., Fusarium, a newly recognized fungal pathogen in immunosuppressed patients, Cancer, 57, 141, 1986.
139. Stainbrook, T.R., Shaeffer, J., and Kusne, S., A retrospective review of Fusarium infections in a tertiary care hospital. Presented at the 38th Annual Meeting of the Infectious Diseases Society of America, September 7–10, 2000; New Orleans, LA, Abstract 283.
140. Ando, N. and Takatori, K., Fungal ¼ora of the conjunctival sac, Am. J. Ophthalmol., 94, 67, 1982.
141. Lionakis, M.S. et al., Pentamidine is active in vitro against Fusarium species, Antimicrob. Agents Chemother., 47, 3252, 2003.
142. Zhao, X.J. and Richard, A., Calderone antifungals currently used in the treatment of invasive fungal diseases. In Calderone, R.A. and Cihlar, R.L. (Eds.), Fungal Pathogenesis, Principles and Clinical Applications, Marcel Dekker, Inc., New York, p. 559, 2002.
143. Martino, P. et al., Clinical patterns of Fusarium infections in immunocompromised patients, J. Infect., 1, 7, 1994.
144. Rabodonirina, M. et al., Fusarium infections in immunocompromised patients: Case reports and literature review, Eur. J. Clin. Microbiol. Infect. Dis., 13, 152, 1994.
145. Freidank, H., Hyalohyphomycoses due to Fusarium spp.— Two case reports and review of the literature, Mycoses, 38, 69, 1995. 146. Fang, C.T. et al., Fusarium solani fungemia in a bone marrow transplant recipient, J. Formos. Med. Assoc., 96, 129, 1997. 147. Pontón, J. et al., Emerging pathogens, Med. Mycol., 38, 225, 2000. 148. Musa, M.O. et al., The spectrum of Fusarium infection in immunocompromised patients with haematological malignancies and in non-immunocompromised patients: A single institution experience over 10 years, Br. J. Haematol., 108, 544, 2000. 149. Viscoli, C. et al., Infection with Fusarium species in two children with neuroblastoma, Eur. J. Clin. Microbiol. Infect. Dis., 9, 773, 1990. 150. Jakle, C. et al., Septic arthritis due to Fusarium solani, J. Rheumatol., 10, 151, 1983. 151. Young, J.B. et al., Opportunistic peritonitis in continuous ambulatory peritoneal dialysis, Clin. Nephrol., 22, 268, 1984. 152. Minor, R. et al., Disseminated Fusarium infections in patients following bone marrow transplantation, Bone Marrow Transpl., 4, 653, 1989. 153. Agamanolis, D.P. et al., Fusarium meningoencephalitis in a child with acute leukemia, Neuropediatrics, 22, 110, 1991. 154. Mohammedi, I. et al., Overwhelming myocarditis due to Fusarium oxysporum following bone marrow transplantation, Scand. J. Infect. Dis., 27, 643, 1995. 155. Girardi, M., Glusac, E.J., and Imaeda, S., Subcutaneous Fusarium foot abscess in a renal transplant patient, Cutis, 63, 267, 1999. 156. Rolston, K.V.I., The spectrum of pulmonary infections in cancer patients, Curr. Opin. Oncol., 13, 218, 2001. 157. Perfect, J.R. and Schell, W.A., The new fungal opportunists are coming, Clin. Infect. Dis., 22, S112, 1996. 158. Warnock, D.W., Fungal infections in neutropenia: Current problems and chemotherapeutic control, J. Antimicrob. Chemother., 41, 95, 1998. 159. Bodey, G.P. et al., Skin lesions associated with Fusarium infection, J. Am. Acad. Dermatol., 47, 659, 2002. 160. Mayayo, E. et al., Experimental pathogenicity of four opportunist Fusarium species in a murine model, J. Med. Microbiol., 48, 363, 1999. 161. Peraica, M. et al., Toxic effects of mycotoxins in humans, Bull. WHO, 77, 754, 1999. 162. Smith, S.N., An overview of ecological and habitat aspects in the genus Fusarium with special emphasis on the soil-borne pathogenic forms, Plant Pathol. Bull., 16, 97, 2007. 163. Etzel, R.A., Mycotoxins, JAMA, 287, 425, 2002. 164. Marasas, W.F.O. et al., Fusarium andiyazi sp. nov., a new species from sorghum, Mycologia, 93, 1203, 2001. 165. Gajdusek, D.C., Acute infectious hemorrhagic fevers and mycotoxicoses in the Union of Soviet Socialist Republics. Medical Science Publication No. 2, Walter Reed Army Medical Center, Washington, DC, 1953. 166. Pestka, J.J. et al., Suppression of immune response in the B6C3FI mouse after dietary exposure to the Fusarium mycotoxins deoxynivalenol and zearalenone, Food Chem. Toxicol., 25, 297, 1987. 167. Yarom, R. et al., T-2 toxin-induced pathology in the hearts of rats, Br. J. Exp. Pathol., 64, 570, 1983. 168. Pitt, J.I., Toxigenic fungi and mycotoxins, Br. Med. Bull., 56, 184, 2000. 169. Bhat, R.V., A foodborne disease outbreak due to the consumption of moldy sorghum and maize containing fumonisin mycotoxins, J. Toxicol. Clin. Toxicol., 35, 249, 1997.
170. Visconti, A. et al., Determination of ochratoxin A in domestic and imported beers in Italy by immunoaf�nity clean-up and liquid chromatography, J. Chromatogr. A, 888, 321, 2000.
171. Hu, Z.Q. et al., Antibody-mediated prevention of Fusarium mycotoxins in the �eld, Int. J. Mol. Sci., 9, 1915, 2008.
172. Visconti, A. et al., Determination of ochratoxin A in wine and beer by immunoaf�nity column cleanup and liquid chromatographic analysis with ¼uorometric detection: Collaborative study, J. AOAC Int., 84, 1818, 2001.
173. Thomas, P.A., Current perspectives on ophthalmic mycoses, Clin. Microbiol. Rev., 16, 730, 2003.
174. Anaissie, E.J. et al., Lack of activity of amphotericin B in systemic murine fusarial infection, J. Infect. Dis., 165, 1155, 1992.
175. Guarro, J. et al., In vitro and in vivo experimental activities of antifungal agents against Fusarium solani, Antimicrob. Agents Chemother., 43, 1256, 1999.
176. Richardson, S.E. et al., Disseminated fusarial infection in the immunocompromised host, Rev. Infect. Dis., 10, 1171, 1988.
177. Speeleveld, E. et al., Susceptibility of clinical isolates of Fusarium to antifungal drugs, Mycoses, 39, 37, 1996.
178. Marco, F. et al., In vitro activity of a new triazole antifungal agent, SCH 56592, against clinical isolates of �lamentous fungi, Mycopathologia, 141, 73, 1998.
179. Johnson, E.M., In vitro activity of Syn-2869, a novel triazole agent, against emerging and less common mold pathogens, Antimicrob. Agents Chemother., 43, 1260, 1999.
180. Li, R.K. and Rinaldi, M.G., In vitro antifungal activity of nikkomycin Z in combination with ¼uconazole or itraconazole, Antimicrob. Agents Chemother., 43, 1401, 1999.
181. Capilla, J. et al., In vitro antifungal activities of the new triazole UR-9825 against clinically important �lamentous fungi, Antimicrob. Agents Chemother., 45, 2635, 2001.
182. Pujol, I. et al., In-vitro antifungal susceptibility of clinical and environmental Fusarium spp. strains, J. Antimicrob. Chemother., 39, 163, 1997.
183. Johnson, E.M. et al., In-vitro activity of voriconazole, itraconazole and amphotericin B against �lamentous fungi, J. Antimicrob. Chemother., 42, 741, 1998.
184. Espinel-Ingroff, A., Comparison of in vitro activities of the new triazole SCH56592 and the echinocandins MK-0991 (L-743,872) and LY303366 against opportunistic �lamentous and dimorphic fungi and yeasts, J. Clin. Microbiol., 36, 2950, 1998.
185. Espinel-Ingroff, et al., In vitro antifungal activities of voriconazole and reference agents as determined by NCCLS methods: Review of the literature, Mycopathologia, 150, 101, 2001.
186. Lozano-Chiu, M. et al., Treatment of murine fusariosis with SCH 56592, Antimicrob. Agents Chemother., 43, 589, 1999.
187. Pfaller, M.A. et al., Antifungal activities of posaconazole, ravuconazole, and voriconazole compared to those of itraconazole and amphotericin B tested against 239 clinical isolates of Aspergillus spp. and other �lamentous fungi: Report from the SENTRY antimicrobial surveillance program, 2000, Antimicrob. Agents Chemother., 46, 1032, 2002.
188. Leslie, J.F., Genetic status of the Gibberella fujikuroi species complex, Plant. Pathol. J., 15, 259, 1999.
189. Summerell, B.A., Salleh, B., and Leslie, J.F., A utilitarian approach to Fusarium identi�cation, Plant Dis., 87, 117, 2003.
190. Burgess, L.W., Liddell, C.M., and Summerell, B.A., Laboratory Manual for Fusarium Research, 2nd edn., University of Sydney, Sydney, Australia, 1988. 191. Nelson, P.E., Toussoun, T.A., and Marasas, W.F.O., Fusarium species: An Illustrated Manual for Identi¡cation, Pennsylvania State University Press, University Park, PA, 1983. 192. Thrane, U., Developments in the taxonomy of Fusarium species based on secondary metabolites, In Summerell, B.A., Leslie, J.F., Backhouse, D., Bryden, W.L. and Burgess, L.W. (Eds.), Fusarium: Paul E. Nelson Memorial Symposium, American Phytopathological Society, St. Paul, MN, pp. 29–49, 2001. 193. Klittich, C.J.R. and Leslie, J.F., Nitrate reduction mutants of Fusarium moniliforme (Gibberella fujikuroi), Genetics, 118, 417, 1988. 194. Petti, C.A., Detection and identi�cation of microorganisms by gene ampli�cation and sequencing, Clin. Infect. Dis., 44, 1108, 2007. 195. O’Donnell, K., Cigelnik, E., and Casper, H.H., Molecular phylogenetic, morphological, and mycotoxin data support reidenti�cation of the quorn mycoprotein fungus as Fusarium venenatum, Fungal Genet. Biol., 23, 57, 1998. 196. Geiser, D.M. et al., FUSARIUM-ID v. 1.0: A DNA sequence database for identifying Fusarium, Eur. J. Plant Pathol., 110, 473, 2004. 197. Hue, F.-X. et al., Speci�c detection of Fusarium species in blood and tissues by a PCR technique, J. Clin. Microbiol., 37, 2434, 1999. 198. Ghignone, S. and Migheli, Q., The database of PCR primers for phytopathogenic fungi, Eur. J. Plant Pathol., 113, 107, 2005. 199. Nicolaisen, M. et al., Real-time PCR for quanti�cation of eleven individual Fusarium species in cereals, J. Microbiol. Meth., 76, 234, 2009. 200. Bluhm, B.H., Cousin, M.A., and Woloshuk, C.P., Multiplex real-time PCR detection of fumonisin-producing and trichothecene-producing groups of Fusarium species, J. Food Prot., 67, 536, 2004. 201. Strausbaugh, C.A., Overturf, K., and Koehn, A.C., Pathogenicity and real-time PCR detection of Fusarium spp. in wheat and barley roots, Can. J. Plant Pathol., 27, 430, 2005. 202. Abd-Elsalam, K.A. et al., Molecular detection of Fusarium oxysporum f. sp. vasinfectum in cotton roots by PCR and realtime PCR assay, J. Plant Dis. Protect., 113, 14, 2006. 203. Hogg, A.C., Johnston, R.H., and Dyer, A.T., Applying realtime quantitative PCR to Fusarium crown rot of wheat, Plant Dis., 91, 1021, 2007. 204. Yli-Mattila, T. et al., Real-time PCR detection and quanti�cation of Fusarium poae, F. graminearum, F. sporotrichioides and F. langsethiae in cereal grains in Finland and Russia, Arch. Phytopathol. Plant Protect., 41, 1477, 2008. 205. Kristensen, R. et al., DNA microarray to detect and identify trichothecene- and moniliformin-producing Fusarium species, J. Appl. Microbiol., 102, 1060, 2007. 206. Yli-Mattila, T. et al., Phylogenetic relationship of Fusarium langsethiae to Fusarium poae and Fusarium sporotrichioides as inferred by IGS, ITS, β-tubulin sequences and UP-PCR hybridization analysis, Int. J. Food Microbiol., 95, 267, 2004. 207. Lee, S.B. and Taylor, J.W., Isolation of DNA from fungal mycelia and single spores. In Innis, M.A., Gelfand, D.H., Sninsky, J., and White, T.J. (Eds.), PCR Protocols: A Guide to Methods and Applications, Academic Press, New York, pp. 282–287, 1990. 208. Fisher, N.L. et al., Carnation leaves as a substrate and for preserving cultures of Fusarium species, Phytopathology, 72, 151, 1982.
209. Nirenberg, H.I., Untersuchungen über die morphologische und biologische Differenzierung in der Fusarium Sektion Liseola, Mitt. Biol. Bund. Land–Forst. (Berlin-Dahlem), 169, 1–117, 1976.
210. Nirenberg, H.I. and O’Donnell, K., New Fusarium species and combinations within the Gibberella fujikuroi species complex, Mycologia, 90, 434, 1998.
211. Ryan, F.J., Beadle, G.W., and Tatum, E.L., The tube method of measuring the growth rate of Neurospora, Am. J. Bot., 30, 784, 1943.
212. Burgess, L.W. et al., Laboratory Manual for Fusarium Research, 3rd edn., University of Sydney/Royal Botanic Gardens, Sydney, Australia, 1994.
213. Gerlach, W. and Nirenberg, H.I., The genus Fusarium—A pictorial atlas, Mitt. Biol. Bund. Land-Forst. (Berlin-Dahlem), 209, 1–406, 1982.
214. Hennequin, C. et al., Identi�cation of Fusarium species involved in human infections by 28S rRNA gene sequencing, J. Clin. Microbiol., 37, 3586, 1999.
215. O’Donnell, K. and Cigelnik, E., Two different intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous, Mol. Phylogenet. Evol., 7, 103, 1997. 216. Chung, W.-H. et al., Genetic analysis and PCR-based identi�cation of major Fusarium species causing head blight on wheat in Japan, J. Gen. Plant Pathol., 74, 364, 2008. 217. Rahjoo, V. et al., Morphological and molecular identi�cation of Fusarium isolated from maize ears in Iran, J. Plant Pathol., 90, 463, 2008. 218. Steenkamp, E.T. et al., Differentiation of Fusarium subglutinans f. sp. pini by histone gene sequence data, Appl. Environ. Microbiol., 65, 3401, 1999. 219. Glass, N.L. and Donaldson G.C., Development of primer sets designed for use with PCR to amplify conserved genes from �lamentous ascomycetes, Appl. Environ. Microbiol., 61, 1323, 1995. 220. Oechsler, R.A. et al., Utility of molecular sequence analysis of the ITS rRNA region for identi�cation of Fusarium spp. from ocular sources, Invest. Ophthalmol. Vis. Sci., 50, 2230, 2009. 221. Demeke, T. et al., Species-speci�c PCR-based assays for the detection of Fusarium species and a comparison with the whole seed agar plate method and trichothecene analysis, Int. J. Food Microbiol., 103, 271, 2005. 52 Chapter 52 - Microascus, Including Scopulariopsis
1. Tang, A.M.C., Jeewon, R., and Hyde, K.D., Phylogenetic utility of protein (RPB2, beta-tubulin) and ribosomal (LSU, SSU) gene sequences in the systematics of Sordariomycetes (Ascomycota, Fungi). Anton. Leeuwen., 91, 327, 2007.
2. Issakainen, J., Microascaceae (Ascomycota, Fungi) as a medical mycological problem. Molecular relationships and occurrence in Finnish patients (PhD thesis). Ann. Univ. Turkuensis, Ser. A II, Tom., 236, 1–156, 2009.
3. Issakainen, J. et al., Relationships of Scopulariopsis based on LSU rDNA sequences. Med. Mycol., 41, 31, 2003.
4. von Arx, J.A., Figueras, M.J., and Guarro, J., Sordariaceous Ascomycetes without ascospore ejaculation. Beih. Nova Hedwigia, 94, 1, 1988.
5. Dykstra, M.J., Salkin, I.F., and McGinnis, M.R., An ultrastructural comparison of conidiogenesis in Scedosporium apiospermum, Scedosporium in°atum and Scopulariopsis brumptii. Mycologia, 81, 896, 1989.
6. Issakainen, J. et al., Deep, respiratory tract and ear infections caused by Pseudallescheria (Scedosporium) and Microascus (Scopulariopsis) in Finland. A 10-year retrospective multicenter study. Med. Mycol., 48, 458, 2010.
7. Morton, F.J. and Smith, G., The genera Scopulariopsis Bainier, Microascus Zukal, and Doratomyces Corda. Mycol. Pap., 86, 1, 1963. 8. Abbott, S.P., Sigler, L., and Currah, R.S., Microascus brevicaulis sp. nov., the teleomorph of Scopulariopsis brevicaulis, supports placement of Scopulariopsis with the Microascaceae. Mycologia, 90, 297, 1998. 9. Abbott, S.P. and Sigler, L., Heterothallism in the Microascaceae demonstrated by three species in the Scopulariopsis brevicaulis series. Mycologia, 93, 1211, 2001. 10. Abbott, S.P., Lumley, T.C., and Sigler, L., Use of holomorph characters to delimit Microascus nidicola and M. soppii sp. nov., with notes on the genus Pithoascus. Mycologia, 94, 362, 2002. 11. Malloch, D. and Cain, R.F., The genus Kernia. Can. J. Bot., 49, 855, 1971. 12. Malloch, D. and Hubart, J.-M., An undescribed species of Microascus from the Cave of Ramioul. Can. J. Bot., 65, 2384, 1986. 13. de Hoog, G.S. et al., Atlas of Clinical Fungi, 2nd edn., vol. 1. Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands, 2000. 14. de Hoog, G.S. et al., Atlas of Clinical Fungi Cd-Rom (CD-ROM), 2nd edn., ASM Press, Washington, DC, 2007. 15. Mycology Online at http://www.mycology.adelaide.edu.au/, accessed on August 1, 2010. 16. Issakainen, J. et al., Occurrence of Scopulariopsis and Scedosporium in nails and keratinous skin. A 5-year retrospective multi-center study. Med. Mycol., 45, 201, 2007. 17. André, J. and Achten, G., Onychomycosis. Int. J. Dermatol., 26, 481, 1987. 18. Tosti, A. et al., Treatment of nondermatophyte mold and Candida onychomycosis. Dermatol. Clin., 21, 491, 2003. 19. Romano, C., Gianni, C., and Difonzo, E.M., Retrospective study of onychomycosis in Italy: 1985–2000. Mycoses, 48, 42, 2005. 20. Summerbell, R.C. et al., Onychomycosis: A critical study of techniques and criteria for con�rming the etiologic signi�cance of nondermatophytes. Med. Mycol., 43, 39, 2005. 21. López-Jodra, O. and Torres-Rodríguez, J.M., Unusual fungal species causing onychomycosis. Rev. Iberoam. Micol., 16, S15, 1999. 22. Svejgaard, E.L. and Nilsson, J., Onychomycosis in Denmark: Prevalence of fungal nail infection in general practice. Mycoses, 47, 131, 2004. 23. García-Martos, P. et al., Onychomycoses caused by nondermatophytic �lamentous fungi in Cádiz. Enferm. Infecc. Microbiol. Clin., 18, 319, 2000. 24. Escobar, M.L. and Carmona-Fonseca, J., Onychomycosis by common non-dermatophyte moulds, Rev. Iberoam. Micol., 20, 6, 2003. 25. Järv, H. et al., Toenail onychomycosis in Estonia. Mycoses, 47, 57, 2004. 26. Lateur, N., Mortaki, A., and André, J., Two hundred ninety-six cases of onychomycosis in children and teenagers: A 10-year laboratory survey. Pediatr. Dermatol., 20, 385, 2003. 27. Gupta, A.K. and Gregurek-Novak, T., Ef�cacy of itrakonazole, terbina�ne, ¼uconazole, griseofulvin and ketoconazole in the treatment of Scopulariopsis brevicaulis causing onychomycosis of the toes. Dermatology, 202, 235, 2001. 28. Besbes, M. et al., Otomycose à Scopulariopis brevicaulis. Rev. Laryngol. Otol. Rhinol., 123, 77, 2002. 29. Neglia, J.P., Invasive Scopulariopsis in the immunocompromised host. Am. J. Med., 83, 1163, 1987. 30. Ellison, M.D. et al., Report of the �rst case of invasive fungal sinusitis caused by Scopulariopsis acremonium: Review of Scopulariopsis infections. Arch. Otolaryngol. Head Neck Surg., 124, 1014, 1998.
31. Jabor, M.A., Greer, D.L., and Amedee, R.G., Scopulariopsis: An invasive nasal infection. Am. J. Rhinol., 12, 367, 1998.
32. Endo, S. et al., Scopulariopsis fungus ball. Ann. Thorac. Surg., 74, 926, 2002.
33. Migrino, R.Q., Hall, G.S., and Longworth, D.L., Deep tissue infections caused by Scopulariopsis brevicaulis: Report of a case of prosthetic valve endocarditis and review. Clin. Infect. Dis., 21, 672, 1994.
34. Mohammedi, I. et al., Fatal Microascus trigonosporus (anamorph Scopulariopsis) pneumonia in a bone marrow transplant recipient. Eur. J. Clin. Microbiol. Infect. Dis., 23, 215, 2004.
35. Steinbach, W.J. et al., Fatal Scopulariopsis brevicaulis infection in a paediatric stem-cell transplant patient treated with voriconazole and caspofungin and a review of Scopulariopsis infections in immunocompromized patients. J. Infect., 48, 112, 2004.
36. Nwabuisi, C. et al., Scopulariopsis associated meningitis in adult Nigerian AIDS patient—A case report. West Afr. J. Med., 22, 364, 2003.
37. Hart, A.P. et al., Cerebral phaeohyphomycosis caused by dematiaceous Scopulariopsis species. Clin. Neuropathol., 20, 224, 2001.
38. Chen-Scarabelli, C. and Scarabelli, T.M. Fungal endocarditis due to Scopulariopsis. Ann. Intern. Med., 139, W77, 2003.
39. Ng, K.P. et al., Scopulariopsis brevicaulis infection in a patient with acute myeloid leukemia. Med. J. Malaysia, 58, 608, 2003.
40. Ellis, D.H. et al., Non-dermatophytes in onychomycosis of toenails. Br. J. Dermatol., 136, 490, 1997.
41. Filipello Marchisio, V., Fusconi, A., and Querio, F.L., Scopulariopsis brevicaulis: A keratinophilic or a keratinolytic fungus? Mycoses, 43, 281, 2000.
42. Bruynzeel, I. and Starink, T.M., Granulomatous skin infection caused by Scopulariopsis brevicaulis. J. Am. Acad. Dermatol., 39, 365, 1998.
43. Sellier, P. et al., Recurrent subcutaneous infection due to Scopulariopsis brevicaulis in a liver transplant recipient. Clin. Infect. Dis., 30, 820, 2000.
44. Krisher, K.K. et al., Disseminated Microascus cirrosus infection in pediatric bone marrow transplant recipient. J. Clin. Microbiol., 33, 735, 1995.
45. Haneke, E., Fungal infections of the nail. Semin. Dermatol., 10, 41, 1991.
46. Larone, D.H. (ed.), Medically Important Fungi—A Guide to Identi¡cation, 4th edn., ASM Press, Washington, DC, 2002.
47. Carillo-Munõz, A.J. et al., In vitro activity of voriconazole against dermatophytes, Scopulariopsis brevicaulis and other opportunistic fungi as agents of onychomycosis. Int. J. Antimicrob. Agents, 30, 157, 2007.
48. Summerbell, R.C., The benomyl test as a fundamental diagnostic method for medical mycology. J. Clin. Microbiol., 31, 572, 1993.
49. de Hoog, G.S. et al., Ecology and physiology of the emerging opportunistic fungi Pseudallescheria boydii and Scedosporium proli¡cans. Mycoses, 37, 71, 1994. [Erratum in: Mycoses, 37, 223, 1994.]
50. Sage, L. et al., Description and physiological properties of two new varieties and one species of Microascus from Israel. Mycotaxon, 55, 189, 1995.
51. Kaufman, L. et al., Immunohistologic identi�cation of Aspergillus spp. and other hyaline fungi by using polyclonal ¼uorescent antibodies. J. Clin. Microbiol., 35, 2206, 1997. 52. Choi, J.K., Mauger, J., and McGowan, K.L., Immunohistochemical detection of Aspergillus species in pediatric tissue samples. Am. J. Clin. Pathol., 121, 18, 2004. 53. Vollmer, T. et al., Evaluation of a novel broad-range real-time PCR assay for the rapid detection of human pathogenic fungi in various clinical specimens. J. Clin. Microbiol., 46, 1919, 2008. 54. Wedde, M. et al., PCR-based identi�cation of clinically relevant Pseudallescheria/Scedosporium strains. Med. Mycol., 36, 61, 1998. 55. Alastruey-Izquierdo, A. et al., Prevalence and susceptibility testing of new species of pseudallescheria and scedosporium in a collection of clinical mold isolates. Antimicrob. Agents Chemother., 51, 748, 2007. 56. Zeng, J.S. et al., Intraspeci�c diversity of species of the Pseudallescheria boydii complex. Med. Mycol., 45, 547, 2007. 57. Hull, P.R., Gupta, A.K., and Summerbell, R.C., Onychomycosis: An evaluation of three sampling methods. J. Am. Acad. Dermatol., 39, 1015, 1998. 58. Weiland, J.J., Rapid procedure for the extraction of DNA from fungal spores and mycelia. Fungal Genet. Newsl., 44, 60, 1997. 59. LaMontagne, M.G. et al., Evaluation of extraction and puri�cation methods for obtaining PCR-ampli�able DNA from compost for microbial community analysis. J. Microbiol. Methods, 49, 255, 2002. 60. Rantakokko-Jalava, K. and Jalava, J., Optimal DNA isolation method for detection of bacteria in clinical specimens by broad-range PCR. J. Clin. Microbiol., 40, 4211, 2002. 61. Faggi, E., Pini, G., and Campisi, E., Use of magnetic beads to extract fungal DNA. Mycoses, 48, 3, 2005. 62. Fredricks, D.N., Smith, C., and Meier, A., Comparison of six DNA extraction methods for recovery of fungal DNA as assessed by quantitative PCR. J. Clin. Microbiol., 43, 5122, 2005. 63. Cankar, K. et al., Critical points of DNA quanti�cation by real-time PCR—Effects of DNA extraction method and sample matrix on quanti�cation of genetically modi�ed organisms. BMC Biotechnol., 6, 37, 2006. 64. Lugert, R., Schettler, C., and Gross, U., Comparison of different protocols for DNA preparation and PCR for the detection of fungal pathogens in vitro. Mycoses, 49, 298, 2006. 65. Scupham, A.J., Jones, J.A., and Wesley, I.V., Comparison of DNA extraction methods for analysis of turkey cecal microbiota. J. Appl. Microbiol., 102, 401, 2007. 66. Kardjeva, V. et al., Forty-eight-hour diagnosis of onychomycosis with subtyping of Trichophyton rubrum strains. J. Clin. Microbiol., 44, 1419, 2006. 67. Baron, G.L., Gain, R.F., and Gilman, J.C., The genus Microascus. Can. J. Bot., 39, 1609, 1961. 68. Issakainen, J. et al., Relatedness of Pseudallescheria, Scedosporium and Graphium pro parte based on SSU rDNA sequences. J. Med. Vet. Mycol., 35, 389, 1997. 69. Issakainen, J. et al., Relationship of S. proli¡cans with Petriella (Microascales, Ascomycetes) con�rmed by partial LSU rDNA sequences. Mycol. Res., 103, 1179, 1999. 70. Monod, M. et al., Direct mycological examination in dermatology: A comparison of different methods. Dermatologica, 179, 183, 1989. 71. Monod, M. et al., Fast and reliable PCR/sequencing/RFLP assay for identi�cation of fungi in onychomycoses. J. Med. Microbiol., 55, 1211, 2006.
72. Baran, R. et al., A new classi�cation of onychomycosis. Br. J. Dermatol., 139, 567, 1998.
73. Agarwal, G.P. and Singh, S.M., Microascus cinereus infection of human nail. Indian J. Med. Sci., 34, 263, 1980.
74. Aznar, C., de Bievre, C., and Guiguen, C., Maxillary sinusitis from Microascus cinereus and Aspergillus repens. Mycopathologia, 105, 93, 1989. 75. Aguilar, C., Pujol, I., and Guarro, J., In vitro antifungal susceptibilities of Scopulariopsis isolates. Antimicrob. Agents Chemother. 43, 1520, 1999.
76. Celard, M. et al., Early Microascus cinereus endocarditis of a prosthetic valve implanted after Staphylococcus aureus endocarditis of the native valve. Clin. Infect. Dis., 29, 691, 1999.
77. Baddley, J.W. et al., Microascus cinereus (anamorph Scopulariopsis) brain abscess in a bone marrow transplant recipient. J. Clin. Microbiol., 38, 395, 2000.
78. López-Jodra, O. and Torres-Rodríguez, J.M., Unusual fungal species causing onychomycosis. Rev. Iberoam. Micol., 16(S), S11, 1999.
79. Heikkilä, H. and Stubb, S., The prevalence of onychomycosis in Finland. Br. J. Dermatol., 133, 699, 1995. 80. Marques, A.R. et al., Suppurative cutaneous granulomata caused by Microascus cinereus in a patient with chronic granulomatous disease. Clin. Infect. Dis., 20, 110, 1995. 81. Skou, J.P. Microascus exsertus sp. nov. associated with a leaf-cutting bee, with considerations on relationships of species in the genus Microascus Zukal. Anton. Leeuwen., 39, 529, 1973. 82. Wuyts, W. et al., Fatal Scopulariopsis infection in a lung transplant recipient: A case report. J. Heart Lung Transpl., 24, 2301, 2005. 83. Berbee, M.L. and Taylor, J.W., 18S ribosomal sequence data and dating, classifying, and ranking the fungi. In Hawksworth, D.L. (ed.), Ascomycete Systematics: Problems and Perspectives in the Nineties, Plenum Press, New York, 1994, pp. 213–223. 84. Tehler, A., Little, D.P., and Farris, J.S., The full-length phylogenetic tree from 1551 ribosomal sequences of chitinous fungi. Mycol. Res., 107, 901, 2003. 85. Sutton, D.A., Fothergill, A.W., and Rinaldi, M.G. (ed.), Guide to Clinically Signi¡cant Fungi, 1st edn., Williams & Wilkins, Baltimore, MD, 1998. 53 Chapter 53 - Myceliophthora and Thielavia
1. The UniProt Consortium. Available at http://www.uniprot.org/, accessed on August 1, 2010.
2. Moustafa AW, Abdel-Azeem AM. Thielavia gigaspora, a new thermotolerant ascomycete from Egypt. Microbiol. Res. 2008;163(4):441–444.
3. Bourbeau P et al. Fatal disseminated infection caused by Myceliophthora thermophila, a new agent of mycosis: Case history and laboratory characteristics. J. Clin. Microbiol. 1992;30(11):3019–3023.
4. Theoulakis P et al. Keratitis resulting from Thielavia subthermophila Mouchacca. Cornea 2009;28:1067–1069.
5. Abdel-Hafez AI, el-Sharouny HM. Keratinophilic and saprophytic fungi isolated from students’ nails in Egypt. J. Basic Microbiol. 1990;30(1):3–11.
6. Revankar SG et al. Disseminated phaeohyphomycosis: Review of an emerging mycosis. Clin. Infect. Dis. 2002;34:467–476.
7. Destino L et al. Severe osteomyelitis caused by Myceliophthora thermophila after a pitchfork injury. Ann. Clin. Microbiol. Antimicrob. 2006;5:21.
8. Tekkok IH, Higgins MJ, Ventureyra EC. Posttraumatic gas-containing brain abscess caused by Clostridium perfringens with unique simultaneous fungal suppuration by Myceliophthora thermophila: Case report. Neurosurgery 1996;39:1247–1251.
9. Farina C et al. Fatal aortic Myceliophthora thermophila infection in a patient affected by cystic medial necrosis. Med. Mycol. 1998;36:113–118.
10. Weitzel N et al. Left ventricular assist device out¼ow cannula obstruction by the rare environmental fungus Myceliophthora thermophila. Anesth. Analg. 2009;108:73–75.
11. Bagyalakshmi R et al. Newer emerging pathogens of ocular non-sporulating molds (NSM) identi�ed by polymerase chain reaction (PCR)-based DNA sequencing technique targeting internal transcribed spacer (ITS) region. Curr. Eye Res. 2008;33:139–147. 12. Pounder JI. Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J. Clin. Microbiol. 2007; 45(2):568–571.
13. Zeng JS et al. Spectrum of clinically relevant Exophiala species in the United States. J. Clin. Microbiol. 2007;45:3713–3720.
14. Leaw SN et al. Identi�cation of medically important yeast species by sequence analysis of the internal transcribed spacer regions. J. Clin. Microbiol. 2006;44:693–699. 54 Chapter 54 - Neocosmosporas
1. Smith, E.F., Wilt disease of cotton, watermelon and cowpea, USDA Bull., 17, 1, 1899.
2. von Jaczewski, V.A., Über das Vorkommen von Neocosmospora vasinfecta E. Smith auf Sesamum orientale, Ann. Mycol., 1, 31, 1903.
3. von Arx, J.A., Ein neuer Ascomycet aus Afrika, Ant. Leeuw., 21, 161, 1955.
4. Doguet, G., Morphologie et organogenie du Neocosmospora vasinfecta E. F. Smith et du Neocosmospora africana von Arx, Ann. Sci. Nat. Ser. Bot. 11, 17, 353, 1956.
5. van Warmelo, K.T., Scanning electron microscopy of Neocosmospora vasinfecta ascospores, Mycologia, 68, 1181, 1976.
6. van Warmelo, K.T., Asexual nuclear division in Neocosmospora, Bothalia, 12, 247, 1977.
7. van Warmelo, K.T., Sexual nuclear division in Neocosmospora, Bothalia, 13, 415, 1981.
8. Udagawa, S., Neocosmospora in Japan, Trans. Mycol. Soc. Jpn., 4, 121, 1963.
9. Barbosa, M.A., A new species of Neocosmospora found in stored peanut, Garcia de Orto, 13, 17, 1965.
10. Rama Rao, P., Studies on soil fungi. 1. Ascomycetes from soils of Hyderabad (India), Mycopathol. Mycol. Appl., 21, 217, 1963.
11. Kamyschko, O.P., Ascomycetes novi e terris Asiae mediae, Novitat. Syst. Plant. Vascul., 1965, 115, 1965.
12. Udagawa, S. and Horie, Y., Notes on some Japanese ascomycetes XIV, Trans. Mycol. Soc. Jpn., 16, 337, 1975.
13. Mahoney, D.P., A new Neocosmospora from Galapagos Islan soil, Mycologia, 68, 1111, 1976.
14. Ueda, S. and Udagawa, S., A new Japanese species of Neocosmospora from marine sludges, Mycotaxon, 16, 387, 1983.
15. Cannon, P.F. and Hawksworth, D.L., A revision of the genus Neocosmospora (Hypocreales), Trans. Br. Mycol. Soc., 82, 673, 1984.
16. Wadhwani, Neocosmospora indica Wadhwani, Indian Bot. Rep. (1983), 2, 158, 1984.
17. Udagawa, S.-I., Horie, Y., and Cannon, P.F., Two new species of Neocosmospora from Japan, with a key to the currently accepted species, Sydowia, 41, 349, 1989.
18. Polishook, J.D., Bills, G.F., and Rossman, A.Y., A new species of Neocosmospora with a Penicillifera anamorph, Mycologia, 83, 797, 1991.
19. Rossman, A.Y., Samuels, G.J., and Lowen R., Leuconectria clusiae gen. nov. and its anamorph Gliocephalotrichium bulbilium with notes on Pseudonectria, Mycologia, 85, 685, 1993.
20. Pfenning, L., Neocosmospora spinulosa, Sydowia, 47, 66, 1995.
21. Rehner, S.A. and Samuels, G.J., Molecular systematics of the Hypocreales: A teleomorph gene phylogeny and the status of their anamorph, Can. J. Bot., 73(S1), S816, 1995.
22. Spatafora, J.W. and Blackwell, M., Molecular systematics of unitunicate perithecial ascomycetes. I. The Clavicipitales— Hypocreales connection, Mycologia, 85, 912, 1993.
23. O’Donnell, K., Progress towards a phylogenetic classi�cation of Fusarium, Sydowia, 48, 57, 1996. 24. Rossman, A.Y. et al., Genera of Bionectriaceae, Hypocreaceae and Nectriaceae (Hypocreales, Ascomycetes), Stud. Mycol., 42, 1, 1999. 25. O’Donnell, K., Molecular phylogeny of the Nectria haematococca–Fusarium solani species complex, Mycologia, 92, 919, 2000. 26. Zhang, N. et al., Members of the Fusarium solani species complex that cause infections in both humans and plants are common in the environment, J. Clin. Microbiol., 44, 2186, 2006. 27. O’Donnell, K. et al., Molecular phylogenetic diversity, multilocus haplotype nomenclature, and in vitro antifungal resistance within the Fusarium solani species complex, J. Clin. Microbiol., 46, 2477, 2008. 28. Mehl, H.L. and Epstein, L., Fusarium solani species complex isolates conspeci�c with Fusarium solani f. sp. cucurbitae race 2 from naturally infected human and plant tissue and environmental sources are equally virulent on plants, grow at 37°C and are interfertile, Environ. Microbiol., 9, 2189, 2007. 29. Godeas, A.M., Mico¼ora del suelo de la argentina. I algunas formas ascosporicas de la region chaqueña, Mycopathol. Mycol. Appl., 46, 189, 1972. 30. Okafor, J.I. and Gugnani, H.C., Dermatophytes and other keratinophilic fungi associated with hairs of rodents in Nigeria, Mykosen, 24, 616, 1981. 31. Rodriguez-Kabana, R. and Morgan-Jones, G., Potential for nematode control by myco¼oras endemic in the tropics, J. Nematol., 20, 191, 1988. 32. Carris, L.M. and Glawe, D.A., Fungi colonizing cysts of Heterodera glycines, Bulletin 786, United States Department of Agriculture, University of Illinois at Urbana-Champaign, College of Agriculture, Agricultural Experiment Station, 1989. 33. Meyer, S.L.F., Huettel, R.N., and Sayre, R.M., Isolation of fungi from Heterodera glycines and in vitro bioassay for their antagonism to eggs, J. Nematol., 22, 532, 1990. 34. Chen, S.Y. et al., Fungi associated with females and cysts of Heterodera glycines in a Florida soybean �eld, J. Nematol., 26, 296, 1994. 35. Godoy, G., Rodriguez-Kabana, R., and Morgan-Jones, G., Parasitism of eggs of Heterodera glycines and Meloidogyne arenaria by fungi isolated from cysts of H. glycines, Nematropica, 12, 111, 1982. 36. Chen, S.Y., Dickson, D.W., and Mitchell, D.J., Pathogenicity of fungi to Heterodera glycines, J. Nematol., 28, 145, 1996. 37. Chen, S.Y. and Dickson, D.W., Fungal penetration of the cyst wall of Heterodera glycines, Phytopathology, 86, 319, 1996. 38. Chen, S.Y., Dickson, D.W., and Mitchell, D.J., Viability of Heterodera glycines exposed to fungal �ltrates, J. Nematol., 32, 190, 2000. 39. Kern, H., Naef-Roth, S., and Défago, G., Zur Toxinbildung von Neocosmospora vasinfecta und Neocosmospora africana, Phytopathol. Zeitschr., 72, 327, 1971. 40. Thakur, R.N. and Sastry, K.S.M., Studies on wilt disease of Crotalaria mucronata, Indian J. Mycol. Plant Pathol., 1, 84, 1971. 41. Domsh, K.H., Gams, W., and Anderson, T.-H., Compendium of Soil Fungi, Vols. 1 and 2, Academic Press, London, U.K., 1980. 42. Vishwa, D. et al., Occurrence of pigeon pea wilt caused by Neocosmospora vasinfecta, Indian J. Pulses Res., 9, 254, 2005. 43. Sato, T., Matsuhashi, M., and Iida, O., Fungi isolated from diseased medicinal plants, Bull. Nat. Inst. Hyg. Sci., 110, 60–66, 1992.
44. Phillips, D.V., A disease of soybean caused by Neocosmospora vasinfecta, Phytopathology, 62, 612, 1972.
45. Gray, F.A., Rodriguez-Kaban, R., and Adams, J., Neocosmospora stem rot of soybeans in Alabama, Plant Dis., 64, 321, 1980.
46. Smit, W.A. and Knox-Davies, P.S., Elimination of Diaporthe phaseolorum and Neocosmospora vasinfecta from rooibos tea seeds by hot-water treatment and acid scari�cation, Phytophylactica, 21, 297, 1989.
47. Temporini, E.D. and VanEtten, H.D., An analysis of the phylogenetic distribution of the pea pathogenicity genes of Nectria haematococca MPVI supports the hypothesis of their origin by horizontal transfer and uncovers a potentially new pathogen of garden pea: Neocosmospora boniensis, Curr. Genet., 46, 29, 2004.
48. Watanabe, M. et al., A novel saponin hydrolase from Neocosmospora vasinfecta var. vasinfecta, Appl. Environ. Microbiol., 70, 865, 2004.
49. Morrissey, J.P. and Osbourn, A.E., Fungal resistance to plant antibiotics as a mechanism of pathogenesis, Microbiol. Mol. Biol. Rev., 63, 708, 1999.
50. de Souza-Motta, C.M. et al., Identi�cation and characterization of �lamentous fungi isolated from the sun¼ower (Helianthus annus L.) rhizosphere according to their capacity to hydrolyse inulin, Braz. J. Microbiol., 34, 273, 2003.
51. Kern, H., Les naphtarizines des Fusarium, Ann. Phytopathol., 10, 327, 1978.
52. Roos, A., Zur Physiologie und Pathologie von Neocosmospora vasinfecta E. F. Smith, Phytopathol. Zeitschr., 88, 238, 1977.
53. Nakajima, H. et al., Structure of neovasinone, a new α-pyrine plant growth regulator produced by the fungus, Neocosmospora vasinfecta E.F. Smith, Agric. Biol. Chem., 51, 1221, 1987.
54. Nakajima, H. et al., Structure of neovasinin, a new metabolite produced by the fungus, Neocosmospora vasinfecta E.F. Smith, and its biological activity to lettuce seedlings, Agric. Biol. Chem., 51, 2831, 1987.
55. Nakajima, H. et al., Absolute stereochemistry of neovasinin, a phytotoxin produced by the fungus, Neocosmospora vasinfecta, Biosci. Biotechnol. Biochem., 56, 1148, 1992.
56. Furumoto, T. et al., Neovasipyrones and neovasifuranones: four new metabolites related to neovasinin, a phytotoxin of the fungus Neocosmospora vasinfecta, Phytochemistry, 40, 745, 1995.
57. Nakajima, H. et al., Neovasipyridones A, B and C: metabolites related to neovasinin, a phytotoxin of the fungus, Neocosmospora vasinfecta, Phytochemistry, 40, 1643, 1995.
58. Nakajima, H. et al., Neovasipyridones related to neovasinin, a phytotoxin of the fungus, Neocosmospora vasinfecta, Phytochemistry, 43, 1015, 1996.
59. Furumoto, T., Hamasaki, T. and Nakajima, H., Vasinfectins A and B: new phytotoxins from Neocosmospora vasinfecta, Tetrahedron Lett., 38, 5523, 1997.
60. Cutler, H.G. et al., Monorden from a novel source, Neocosmospora tenuicristata: Stereochemistry and plant growth regulatory properties, Agric. Biol. Chem., 51, 3331, 1987.
61. Oikawa, T. et al., Radicicol, a microbial cell differentiation modulator, inhibits in vivo angiogenesis, Eur. J. Pharmacol., 241, 221, 1993.
62. Nakajima, H. et al., Isolation of 2-acetylamino-3-hydroxy4-methyloct-6-enoic acid, a derivative of the “C9-amino acid” residue of cyclosporins, produced by the fungus Neocosmospora vasinfecta E. F. Smith, Agric. Biol. Chem., 52, 1621, 1988. 63. Nakajima, H. et al., Production of cyclosporin by fungi belonging to the genus Neocosmospora, Agric. Biol. Chem., 53, 2291, 1989. 64. Daboussi, M.-J. et al., Evolution of the Fot1 transposons in the genus Fusarium: discontinuous distribution and epigenetic inactivation, Mol. Biol. Evol., 19, 510, 2002. 65. Budd, K. and Harley, J.L., The uptake and assimilation of ammonia by Neocosmospora vasinfecta, New Phytol., 61, 138, 1962. 66. Budd, K. and Harley, J.L., The uptake and assimilation of ammonia by Neocosmospora vasinfecta II: Increases in the ammonia level in the mycelium during the uptake of ammonia, New Phytol., 61, 244, 1962. 67. Budd, K., The assimilation of bicarbonate by Neocosmospora vasinfecta, Can. J. Microbiol., 15, 389, 1969. 68. Budd, K., Potassium transport in non-growing mycelium of Neocosmospora vasinfecta, J. Gen. Microbiol., 59, 229, 1969. 69. Budd, K., Potassium ¼uxes in Neocosmospora vasinfecta, J. Gen. Microbiol., 90, 311, 1975. 70. Miller, A.G. and Budd, K., Chloride uptake by mycelium of Neocosmospora vasinfecta and its inhibition by glucose, J. Gen. Microbiol., 66, 243, 1971. 71. Miller, A.G. and Budd, K., Halide uptake by the �lamentous ascomycete Neocosmospora vasinfecta, J. Bacteriol., 121, 91, 1975. 72. Miller, A.G. and Budd, K., The development of an increased rate of Cl-uptake in the ascomycete Neocosmospora vasinfecta, Can. J. Microbiol., 21, 1211, 1975. 73. Miller, A.G. and Budd, K., Evidence for a negative membrane potential and for movement of C1-against its electrochemical gradient in the ascomycete Neocosmospora vasinfecta, J. Bacteriol., 128, 741, 1976. 74. Miller, A.G. and Budd, K., In¼uence of exogenous sugars and polyols on C1-in¼ux and ef¼ux by the ascomycete Neocosmospora vasinfecta, J. Bacteriol., 126, 690, 1976. 75. Paton, W.H.N. and Budd, K., Zinc uptake in Neocosmospora vasinfecta, J. Gen. Microbiol., 72, 173, 1972. 76. Budd, K., A high-af�nity system for the transport of zinc in Neocosmospora vasinfecta, Exp. Mycol., 12, 195, 1988. 77. Budd, K., Role of membrane potential in the transport of zinc by Neocosmospora vasinfecta, Exp. Mycol., 13, 356, 1989. 78. Budd, K., Magnesium uptake in Neocosmospora vasinfecta, Can. J. Bot., 57, 491, 1979. 79. Budd, K., A cadmium-tolerant strain of Neocosmospora vasinfecta shows reduced cadmium in¼ux, Can. J. Bot., 69, 1296, 1991. 80. Oluyedun, O.A. and VanLoon, G.W., Factors affecting uptake of aluminum by the fungus Neocosmospora vasinfecta, 15th World Congress of Soil Science, Vol. 4A, 1994, p. 45. 81. Budd, K., Lefebvre, D.D., and Kelly, D.J.A., The biotransformation of mercury in pH-stat cultures of microfungi, Can. J. Bot., 84, 254, 2006. 82. Budd, K., The utilization of acetate by Neocosmospora vasinfecta, New Phytol., 65, 32, 1966. 83. Budd, K., Uptake and metabolism of D-glucose by Neocosmospora vasinfecta E. F. Smith., Plant Physiol., 58, 193, 1976. 84. Kelly, D.J.A. and Budd, K., Polyol metabolism and osmotic adjustment in the mycelial ascomycete Neocosmospora vasinfecta (E. F. Smith), Exp. Mycol., 13, 356, 1989. 85. Kelly, D.J.A. and Budd, K., Osmotic adjustment in the mycelia ascomycete Neocosmospora vasinfecta (E.F. Smith), Exp. Mycol., 14, 136, 1990.
86. Ben Hamida, F. et al., Leg granuloma due to Neocosmospora vasinfecta in a renal graft recipient, Transpl. Proc., 25, 2292, 1993.
87. Chandenier, J. et al., Leg tumefaction with Neocosmospora vasinfecta in a renal transplant patient. First human case report, J. Mycol. Med., 3, 165, 1993.
88. Kac, G. et al., Osteo-arthritis due to Neocosmospora africana successfully treated by radical surgery, Abstracts of the 4th Congress of the European Confederation of Medical Mycology, 1998, p. 31.
89. Kac, G. et al., Osteoarthritis caused by Neocosmospora vasinfecta, Med. Mycol., 37, 213, 1999.
90. Cornely, O.A. et al., Disseminated Neocosmospora vasinfecta infection in a patient with acute nonlymphocytic leukemia, Emerg. Infect. Dis., 7, 149, 2001.
91. O’Donnell, K., Neocosmospora vasinfecta infection in a pediatric burn patient: The registry of the �rst case in the American continent, a case report. Direct NCBI submission, Accession numbers AY381138_AY381155. Available from http://www. ncbi.nlm.nih.gov, 2003.
92. Elfar, M.S., Heggers, J.P., Sutton, D.A., Rinaldi, M.G., O’Donnell, K., and Herndon, D.N., Neocosmospora vasinfecta infection in a pediatric burn patient: registry of the �rst case in North America, a case report; 2004 March, American Burn Association 36th Annual Meeting, Vancouver, BC, 2004. 93. Manikandan, P. et al., Corneal ulcer due to Neocosmospora vasinfecta in an immunocompetent patient, Med. Mycol., 46, 279, 2008. 94. Hue, F.-X. et al., Speci�c detection of Fusarium species in blood and tissues by a PCR technique, J. Clin. Microbiol., 37, 2434, 1999. 95. Yanai, Y., Fungal N 2 O production in an arable peat soil in Central Kalimantan, Indonesia, Soil Sci. Plant Nutr., 53, 806, 2007. 96. Wedde, M. et al., PCR-based identi�cation of clinically relevant Pseudallescheria/Scedosporium strains, Med. Mycol., 36, 61, 1998. 97. White, T.J. et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics, In Innes, M.H. et al. (eds.), PCR Protocols, Academic Press, San Diego, CA, 1990, pp. 315–322. 98. Altschul, S.F. et al., Basic local alignment search tool, J. Mol. Biol., 215, 403, 1990. 55 Chapter 55 - Ochroconis
1. de Hoog, G.S., Ochroconis gallopava, in Atlas of Clinical Fungi, 2nd edn., de Hoog, G.S, Guarro, J., and Gen, J., Eds., Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands, 2000, p. 782.
2. Ohori, A. et al., Rapid identi�cation of Ochroconis gallopava by a loop-mediated isothermal ampli�cation (LAMP) method, Vet. Microbiol., 114, 359, 2006.
3. Yarita, K. et al., Ochroconis calidi°uminalis, a sibling of the neurotropic pathogen O. gallopava, isolated from hot spring, Mycopathologia, 170, 21, 2010.
4. Yarita, K. et al., Pathogenicity of Ochroconis gallopava isolated from hot springs in Japan and a review of published reports, Mycopathologia, 164, 135, 2007.
5. Dixon, D.M. and Salkin, I., Morphologic and physiologic studies of three dematiaceous pathogens, J. Clin. Microbiol., 24, 12, 1986.
6. Tansey, M.R. and Brock, T.D., Dactylaria gallopava, a cause of avian encephalitis, in hot spring ef¼uents, thermal soils and self-heated coal waste piles, Nature, 242, 202, 1973.
7. Fukushiro, R. et al., Subcutaneous abscesses caused by Ochroconis gallopavum, J. Med. Vet. Mycol., 24, 175, 1986.
8. Evans, H.C., Thermophilous fungi of coal spoil tips. I. Taxonomy, Trans. Br. Mycol. Soc., 57, 241, 1971.
9. Evans, H. C., Thermophilous fungi of coal spoil tips. II. Occurrence, distribution and temperature, Trans. Br. Mycol. Soc., 57, 255, 1971.
10. Weitzman, I., Rosenthal, S.A., and Shupack, J.L., A comparison between Dactylaria gallopava and Scolecobasidium humicola: First report of an infection in a tortoise caused by S. humicola, Med. Vet. Mycol., 23, 287, 1985.
11. Redman, R.S. et al., Fungi from geothermal soils in Yellowstone National Park, Appl. Environ. Microbiol., 65, 5193, 1999.
12. Tansey, M.R., Fliermans, C.B., and Kern, C.D., Aerosol dissemination of veterinary pathogenic and human opportunistic thermophilic and thermotolerant fungi from thermal ef¼uents of nuclear production reactors, Mycopathologia, 69, 91, 1979.
13. Rippon, J.W., Gerholdm, R., and Heath, M., Thermophilic and thermotolerant fungi isolated from the thermal ef¼uent of nuclear power generating reactors: Dispersal of human opportunistic and veterinary pathogenic fungi, Mycopathologia, 70, 169, 1980.
14. Waldrip, D.W. et al., Isolation of Dactylaria gallopava from broiler-house litter, Avian Dis., 18, 445, 1974.
15. Randall, C.J. and Owen, D.M., Encephalytis in broiler chickens caused by a hyphomycete resembling Dactylaria gallopava, Avian Pathol., 10, 31, 1981.
16. Terreni, A.A. et al. Disseminated Dactylaria gallopava infection in a diabetic patient with chronic lymphocytic leukemia of the T-cell type, Am. J. Clin. Pathol., 94, 104, 1990.
17. Sides, E.H. 3rd, Benson, J.D., and Padhye, A.A., Phaeohyphomycotic brain abscess due to Ochroconis gallopavum in a patient with malignant lymphoma of a large cell type, J. Med. Vet. Mycol., 29, 317, 1991.
18. Mancini, M.C. and McGinnis, M.R., Dactylaria infection of a human being: Pulmonary disease in a heart transplant recipient, J. Heart Lung Transpl., 11, 827, 1992.
19. Prevost-Smith, E. et al., Fatal phaeohyphomycotic infection due to Dactylaria gallopava and Scedosporium proli¡cans in a cardiac transplant, in Proceedings and Abstracts of the 93rd Annual Meeting of the American Society for Microbiology, Atlanta, GA: ASM Press, F-35, 1993. 20. Vukmir, R.B. et al., Successful therapy for cerebral phaeohyphomycosis due to Dactylaria gallopava in a liver transplant recipient, Clin. Infect. Dis., 19, 714, 1994. 21. Kralovic, S.M. and Rhodes, J.C., Phaeohyphomycosis caused by Dactylaria (human dactylariosis): Report of a case with review of the literature, J. Infect., 31, 107, 1995. 22. Rossmann, S.N., Cernoch, P.L., and Davis, J.R., Dematiaceous fungi are an increasing cause of human disease, Clin. Infect. Dis., 22, 73, 1996. 23. Bonham, A. et al., Central nerves system lesions in liver transplant recipients: Prospective assessment of indications for biopsy and implications for management, in 15th Annual Scienti¡c Meeting of the American Society of Transplantation Physicians, Dallas, TX, 66, 1596, 1998. 24. Jenney, A. et al., Pulmonary infection due to Ochroconis gallopavum treated successfully after orthotopic heart transplantation, Clin. Infect. Dis., 26, 236, 1988. 25. Horré, R. and de Hoog, G.S., Primary cerebral infections by melanized fungi: A review, Stud. Mycol., 43, 176, 1999. 26. Horré, R. et al., rDNA diversity and physiology of Ochroconis and Scolecobasidium species reported from humans and other vertebrates, Stud. Mycol., 43, 194, 1999. 27. Burns, K.E., Ohori, N.P., and Iacono, A.T., Dactylaria gallopava infection presenting as a pulmonary nodule in a singlelung transplant recipient, J. Heart. Lung Transpl., 19, 900, 2000. 28. Odell, J.A. et al., Multiple lung abscesses due to Ochroconis gallopavum, a dematiaceous fungus, in a nonimmunocompromised wood pulp worker, Chest, 118, 1503, 2000. 29. Bowyer, J.D. et al., Ochroconis gallopava endophthalmitis in ¼udarabine treated chronic lymphocytic leukemia, Br. J. Ophthalmol., 84, 117, 2000. 30. Mazur, J.E. and Judson, M.A., A case report of a dactylaria fungal infection in a lung transplant patient, Chest, 119, 651, 2001. 31. Malani, P.N. et al., Disseminated Dactylaria constricta infection in a renal transplant recipient, Transpl. Infect. Dis., 3, 40, 2001. 32. Zhao, J. et al., Pemphigus patient with pulmonary fungal infection caused by Ochroconis gallopava: The �rst case report in China, Zhonghua Yi Xue Za Zhi, 82, 1310, 2002. 33. Wang, T.K. et al., Disseminated Ochroconis gallopavum infection in a renal transplant recipient: The �rst reported case and a review of the literature, Clin. Nephrol., 60, 415, 2003. 34. Fukushima, N. et al., Disseminated Ochroconis gallopavum infection in a chronic lymphocytic leukemia: A case report and review of the literature on hematological malignancies, Intern. Med., 44, 879, 2005. 35. Boggild, A.K. et al., Disseminated phaeohyphomycosis due to Ochroconis gallopavum in the setting of advanced HIV infection, Med. Mycol., 44, 777, 2006. 36. Hollingsworth, J.W., Shofer, S., and Zaas, A., Successful treatment of Ochroconis gallopavum infection in an immunocompetent host. Infection, 35, 367, 2007. 37. Shoham, S. et al., Transplant-associated Ochroconis gallopava infections, Transpl. Infect. Dis., 10, 442, 2008. 38. Mayer, N. and Bastani, B., Dactylaria constricta var. gallopava in a renal transplant patient, Nephrology, 14, 262, 2009. 39. Georg, L.K., Bierer, B.W., and Cooke, W.B., Encephalytis in turkey poults due to a new fungus species, Sabouraudia, 3, 239, 1964. 40. Connole, M.D., Some aspects of animal mycoses in Australia, in Fourth Meeting of the International Society for Human and Animal Mycology, New Orleans, LA, 1967.
41. Blalock, H.G., Georg, L.K., and Derieux, W.T., Encephalitis in turkey poults due to Dactylaria (Diplorhinotrichum) gallopava case report and its experimental reproduction, Avian Dis., 17, 197, 1973.
42. Ranck, F.M. Jr., Georg, L.K., and Wallace, D.H., Dactylariosis: A newly recognized fungus disease of chickens, Avian Dis., 18, 4, 1973.
43. Shane, S.M. et al., Encephalitis attributed to dactylariosis in Japanese quail chicks (Coturnix coturnix japonica), Avian Dis., 29, 822, 1985.
44. Karesh, W.B., Russell, R., and Gribble, D., Dactylaria gallopava encephalitis in two gray-winged trumpeters (Psophia crepitans), Avian Dis., 31, 685, 1987.
45. Salkin, I.F. et al., Fatal encephalitis caused by Dactylaria constricta var. gallopava in a snowy owl chick (Nyctea sandiaca), J. Clin. Microbiol., 28, 2845, 1990.
46. Padhye, A.A. et al., Fatal encephalitis caused by Ochroconis gallopavum in a domestic cat (Felis domesticus), J. Med. Vet. Mycol., 32, 141, 1994.
47. Singh, K. et al., Fatal systemic phaeohyphomycosis caused by Ochroconis gallopavum in a dog (Canis familaris), Vet. Pathol., 43, 988, 2006.
48. Dixon, D.M. et al., Dactylaria constricta: Another dematiaceous fungus with neurotropic potential in mammals, J. Med. Vet. Mycol., 25, 55, 1987
49. Walsh, T.J. et al., Comparative histopathology of Dactylaria constricta, Fonsecaea pedrosoi, Wangiella dermatitidis, and Xylohypha bantiana in experimental phaeohyphomycosis of the central nervous system, Mykosen, 30, 215, 1987.
50. Sano, A. et al., The effects of storage at –135°C with a programmed freezing method on the virulence and morphology of Paracoccidioides brasiliensis yeast form cells, Nippon Ishinkin Gakkai Zassi, 35, 161, 1994. 51. McGinnis, M.R. and Pasarell, L., In vitro testing of susceptibilities of �lamentous ascomycetes to voriconazole, itraconazole, and amphotericin B, with consideration of phylogenetic implications, J. Clin. Microbiol., 36, 2353, 1998. 52. Meletiadis, J. et al., Short communication: In vitro antifungal activity of six drugs against 13 clinical isolates of Ochroconis gallopava, Stud. Mycol., 43, 206, 1999. 53. Espinel-Ingroff, A., In vitro fungicidal activities of voriconazole, itraconazole, and amphotericin B against opportunistic moniliaceous and dematiaceous fungi, J. Clin. Microbiol., 39, 954, 2001. 54. Method for broth dilution antifungal susceptibility testing of �lamentous fungi—Second edition: Approved standard M38-A2, clinical and laboratory standards institute, Wayne, Pennsylvania, USA, 2008. 55. Sano, A. and Itano, E.N., Applications of loop-mediated isothermal ampli�cation methods (LAMP) for identi�cation and diagnosis of mycotic diseases: Paracoccidioidomycosis and Ochroconis gallopava infection, in Molecular Identi¡cation of Fungi, Gherbawy, Y. and Voigt, K., Eds., Springer Verlag, Berlin, Heidelberg, 2010, pp. 417–437. 56. Endo, S. et al., Detection of gp43 of Paracoccidioides brasiliensis by the loop-mediated isothermal ampli�cation (LAMP) method, FEMS Microbiol. Lett., 234, 93, 2004. 57. Teixeira, M.M. et al., Phylogenetic analysis reveals a high level of speciation in the Paracoccidioides genus, Mol. Phylogenet. Evol., 52, 273, 2009. 58. Takayama, A. et al., An atypical Paracoccidioides brasiliensis clinical isolate based on multiple gene analysis, Med. Mycol., 48, 64, 2010. 56 Chapter 56 - Phaeoacremonium
1. Mostert, L. et al., Taxonomy and pathology of Togninia (Diaporthales) and its Phaeoacremonium anamorphs. Stud. Mycol., 54, 1, 2006.
2. Mostert, L. et al., Species of Phaeoacremonium associated with infections in humans and environmental reservoirs in infected woody plants. J. Clin. Microbiol., 43, 1752, 2005.
3. Aroca, A., Raposo, R., and Lunello, P., A biomarker for the identi�cation of four Phaeoacremonium species using the β-tubulin gene as the target sequence. Appl. Microbiol. Biotechnol., 80, 1131, 2008.
4. Gramaje, D. et al., Novel Phaeoacremonium species associated with Petri disease and esca of grapevine in Iran and Spain. Mycologia, 101, 920, 2009.
5. Crous, P.W et al., Phaeoacremonium gen. nov. associated with wilt and declining diseases of woody host and human infections. Mycologia, 88, 786, 1996.
6. Crous, P.W. and Gams, W., Phaeomoniella chlamydospora gen. et. comb. nov., a causal organism of Petri grapevine decline and esca. Phytopathol. Mediterr., 39, 112, 2000.
7. Groenewald, M., Kang, J.C., and Crous, P.W., ITS and β-tubulin phylogeny of Phaeoacremonium and Phaeomoniella species. Mycol. Res., 105, 651, 2001.
8. Dupont, J. et al., Phaeoacremonium viticola, a new species associated with Esca disease of grapevine in France. Mycologia, 92, 499, 2000.
9. Damm, U. et al., Novel Phaeoacremonium species associated with necrotic wood of Prunus trees. Persoonia, 20, 87, 2008.
10. Essakhi, S. et al., Molecular and phenotypic characterisation of novel Phaeoacremonium species isolated from esca diseased grapevines. Persoonia, 21, 119, 2008.
11. Kubátová, A., Kolarˇík, M., and Pažoutová, S., Phaeoacremonium rubrigenum—Hyphomycete associated with bark beetles found in Czechia. Folia Microbiol., 49, 99, 2004.
12. Baddley, J.W. et al., Phaeoacremonium parasiticum infections con�rmed by β-Tubulin sequence analysis of case isolates. J. Clin. Microbiol., 44, 2207, 2006. 13. Heath, C.H. et al., Phaeoacremonium parasiticum infective endocarditis following liver transplantation. Clin. Infect. Dis., 25, 1251, 1997. 14. Hemashettar, B.M. et al., Phaeoacremonium krajdenii, a cause of white grain eumycetoma. J. Clin. Microbiol., 44, 4619, 2006. 15. Sun, P.-L. and Ju, Y.-M., Onychomycosis caused by Phaeoacremonium parasiticum: First case report. Mycoses, doi:10.1111/j.1439-0507.2009.01789.x., 2009. 16. Huynh, T.K., Lee, L.R., and Ellis, D., Late-onset post- traumatic Phaeoacremonium parasiticum endophthalmitis. Clin. Experiment. Ophthalmol., 35:366, 2007. 17. Llinas, L. et al., Osteomyelitis resulting from chronic �lamentous fungus olecranon bursitis. J. Clin. Rheumatol., 11, 280, 2005. 18. Kaell, A.T. and Weitzman, I., Acute monoarticular arthritis due to Phialophora parasitica. Am. J. Med., 74, 519, 1983. 19. Rowland, M.D. and Ferrar, W.E., Case report: Thorn-induced Phialophora parasitica arthritis treated successfully with synovectomy and ketaconazole. Am. J. Med. Sci., 293, 393, 1987. 20. Padhye, A.A. et al., Phaeohyphomycosis caused by Phaeoacremonium in°atipes J. Clin. Microbiol., 36, 2763, 1998. 21. Guarro, J. et al., Two cases of subcutaneous infection due to Phaeoacremonium spp. J. Clin. Microbiol., 41, 1332, 2003. 22. Matsui, T. et al., Subcutaneous phaeohyphomycosis caused by Phaeoacremonium rubrigenum in an immunosuppressed patient. Jpn. J. Med. Mycol., 40, 99, 1999. 23. Meyers, W.M., Dooley, J.R., and Kwon-Chung, K.J., Mycotic granuloma caused by Phialophora repens. Am. J. Clin. Pathol., 64, 549, 1975. 24. Hironaga, M. et al., Phialophora repens, an emerging agent of subcutaneous Phaeohyphomycosis in humans J. Clin. Microbiol., 27, 394, 1989. 25. Jha, V. et al., Subcutaneous phaeohyphomycosis in a renal transplant recipient: A case report and review of the literature. Am. J. Kidney Dis., 28, 137, 1996. 26. Ajello, L. et al., A case of phaeohyphomycosis caused by a new species of Phialophora. Mycologia, 66, 490, 1974. 27. Fincher, R.M. et al., Subcutaneous phaeohyphomycotic abscess caused by Phialophora parasitica in a renal allograft recipient. J. Med. Vet. Mycol., 26, 311, 1988. 28. Kitamura, K. et al., Phaeomycotic cyst caused by Phaeoacremonium parasiticum. Jpn. J. Med. Mycol., 41, 89, 2000. 29. Marques, S.A. et al., Subcutaneous phaeohyphomycosis caused by Phaeoacremonium parasiticum in a renal transplant patient. Med. Mycol., 44, 671, 2006. 30. Farina, C. et al., Phaeoacremonium parasiticum subcutaneous infection in a kidney-transplanted patient successfully treated by surgery. Transpl. Infect. Dis., 9, 253, 2007. 31. Baradkar, V.P., Mathur, M., and Kumar, S., Phaeohyphomycosis of subcutaneous tissue caused by Phaeoacremonium parasiticum. Ind. J. Med. Microbiol., 27, 66, 2009. 32. Lavarde, V. et al., Un cas de phaeomycose a` Phialophora parasitica chez un transplanté. Deuxie`me observation mondiale. Bull. Soc. Fr. Mycol. Med., 11, 273, 1982. 33. Ziza, J.M. et al., Ostéoarthrites a` champignons noirs (dématiés). A propos de 3 observations. Ann. Med. Interne, 136, 393, 1985. 34. Dupont, B. and Drouhet, E. Early experience with itraconazole in vitro and in patients: Pharmacokinetic studies and clinical results. Rev. Infect. Dis., 9, S71, 1987.
35. Wong, P.K. et al., Disseminated Phialophora parasitica infection in humans: Case report and review. Rev. Infect. Dis., 11, 770, 1989.
36. Ferraro, F.A. and Morgan, M.A., A case of disseminated Phialophora parasitica infection. Arch. Pathol. Lab. Med., 113, 1379, 1989.
37. Revankar, S.G. et al., Disseminated phaeohyphomycosis: Review of an emerging mycosis. Clin. Infect. Dis., 34, 467, 2002.
38. Hood, S.V. et al., Atypical eumycetoma caused by Phialophora parasitica successfully treated with itraconazole and ¼ucytosine. Br. J. Dermatol., 136, 953, 1997.
39. Segal, B.H. et al., Posaconazole as salvage therapy in patients with chronic granulomatous disease and invasive �lamentous fungal infection. Clin. Infect. Dis., 40, 1684, 2005.
40. Weitzman, I. et al., Phialophora parasitica, an emerging pathogen. Sabouraudia, 22, 331, 1984.
41. Espinel-Ingroff, A., Boyle, K., and Sheehan, D.J., In vitro antifungal activities of voriconazole and reference agents as determined by NCCLS methods: Review of the literature. Mycopathologia, 150, 101, 2001.
42. McGinnis, M.R. and Pasarell, L., In vitro testing of susceptibilities of �lamentous ascomycetes to voriconazole, itraconazole, and amphotericin B, with consideration of phylogenetic implications. J. Clin. Microbiol., 36, 2353, 1998.
43. De Albornoz, M.B., Cephalosporium serrae, agente etiológico de micetomas. Mycopathol. Mycol. Appl., 54, 485, 1974.
44. Guarro, J. et al., Limitations of DNA sequencing for diagnosis of a mixed infection by two fungi, Phaeoacremonium venezuelense and a Plectophomella sp., in a transplant recipient. J. Clin. Microbiol., 44, 4279, 2006.
45. Wang, S-H. et al., Fatal fungemia due to Phaeoacremonium in°atipes in a child with severe aplastic anemia. Clin. Infect. Dis., 40, 1067, 2005.
46. Petti, C.A., Detection and identi�cation of microorganisms by gene ampli�cation and sequencing. Clin. Infect. Dis., 44, 1108, 2007.
47. Tegli, S. et al., Genetic variation within Phaeoacremonium aleophilum and P. chlamydosporum in Italy. Phytopathol. Mediterr., 39, 125, 2000.
48. Dupont, J. et al., ITS and β-tubulin markers help delineate Phaeoacremonium species, and the occurrence of P. parasiticum in grapevine disease in Argentina. Mycol. Res., 106, 1143, 2002. 49. Mostert, L. et al., Togninia (Calosphaeriales) is con�rmed as teleomorph of Phaeoacremonium by means of morphology, sexual compatibility, and DNA phylogeny. Mycologia, 95, 646, 2003. 50. Aroca, A. and Raposo, R., PCR-based strategy to detect and identify species of Phaeoacremonium causing grapevine diseases. Appl. Environ. Microbiol., 73, 2911, 2007. 51. Overton, B.E., Stewartm, E.L., and Wenner, N.G., Molecular phylogenetics of grapevine decline fungi from Pennsylvania and New York. Paper presented at Proceedings of the 4th International Workshop on Grapevine Trunk Diseases, Stellenbosch, South Africa, p. 27, 2005. 52. Lee, S.B. and Taylor, J.W., Isolation of DNA from fungal mycelia and single spores, in PCR Protocols: A Guide to Methods and Applications, Innis, M.A., Gelfand, D. H., Sninsky, J. and White, T. J., Eds., pp. 282–287, Academic Press, New York, 1990. 53. Gardes, M. and Bruns, T.D., ITS primers with enhanced speci�city for basidiomycetes—Application to the identi�cation of mycorrhizae and rusts. Mol. Ecol., 2, 113, 1993. 54. White, T. et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics, in PCR Protocols. A Guide to Methods and Applications, Innis, M.A., Gelfand, D. H., Sninsky, J. and White, T. J., Eds., pp. 315–322, Academic Press, San Diego, CA, 1990. 55. O’Donnell, K. and Cigelnik, E., Two different intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Mol. Phylogenet. Evol., 7, 103, 1997. 56. Carbone, I. and Kohn, L.M., A method for designing primer sets for speciation studies in �lamentous ascomycetes. Mycologia, 91, 553, 1999. 57. Glass, N.L. and Donaldson, G.C., Development of primer sets designed for use with the PCR to amplify conserved genes from �lamentous ascomycetes. Appl. Environ. Microbiol., 61, 1323, 1995. 58. Gilgado, F. et al., Molecular phylogeny of the Pseudallescheria boydii species complex: Proposal of two new species. J. Clin. Microbiol., 43, 4930, 2005. 59. Wengenack, N.L. and Binnicker, M.J., Fungal molecular diagnostics. Clin. Chest. Med., 30, 391, 2009. 57 Chapter 57 - Phialemonium
1. The UniProt Consortium. Available at http://www.uniprot. org/, accessed on August 1, 2010.
2. Gams W, McGinnis MR. Phialemonium, a new anamorph genus intermediate between Phialophora and Acremonium. Mycologia 1983;75:977–987.
3. de Hoog GS et al. (eds.), Atlas of Clinical Fungi, 2nd edn. Utrecht, the Netherlands: Centraalbureau voor Schimmelcultures, 2000.
4. Ajello L. Hyalohyphomycosis and phaeohyphomycosis: Two global disease entities of public health importance. Eur J Epidemiol. 1986;2:243–251.
5. King D et al. A phaeohyphomycotic cyst and peritonitis caused by Phialemonium species and a reevaluation of its taxonomy. J Clin Microbiol. 1993;31:1804–1810. 6. Guarro J et al. Phialemonium fungemia: Two documented nosocomial cases. J Clin Microbiol. 1999;37:2493–2497. 7. Huang J et al. Flow impeding fungal thrombus in the ascending aorta. Ann Thorac Surg. 2008;86(4):1373–1375. 8. Rivero M et al., Infections due to Phialemonium species: Case report and review. Med Mycol. 2009;47(7):766–774. 9. Strahilevitz J et al. An outbreak of Phialemonium infective endocarditis linked to intracavernous penile injections for the treatment of impotence. Clin Infect Dis. 2005;40:781–786. 10. Schonheyder HC et al. Late bioprosthetic valve endocarditis caused by Phialemonium aff. curvatum and Streptococcus sanguis: A case report. J Med Vet Mycol. 1996;34:209–214. 11. Proia LA et al. Phialemonium: An emerging mold pathogen that caused 4 cases of hemodialysis—Associated endovascular infection. Clin Infect Dis. 2004;39:373–379. 12. Zayit-Soudry S et al. Endogenous Phialemonium curvatum endophthalmitis. Am J Ophthalmol. 2005;140(4):755–757. 13. Dan M et al. Phialemonium curvatum arthritis of the knee following intra-articular injection of a corticosteroid. Med Mycol. 2006;44(6):571–574. 14. Weinberger M et al. Isolated endogenous endophthalmitis due to a sporodochial-forming Phialemonium curvatum acquired through intracavernous autoinjections. Med Mycol. 2006 May;44(3):253–259. 15. Rao CY et al. Contaminated product water as the source of Phialemonium curvatum bloodstream infection among patients undergoing hemodialysis. Infect Control Hosp Epidemiol. 2009;30(9):840–847. 16. Heins-Vaccari EM et al. Phialemonium curvatum infection after bone marrow transplantation. Rev Inst Med Trop Sao Paulo. 2001;43(3):163–166. 17. McGinnis MR, Gams W, Goodwin MN. Phialemonium obovatum in a burned child. J Med Vet Mycol. 1986;24:51–55. 18. Magnon KC, Jalbert M, Padhye AA. Osteolytic phaeohyphomycosis caused by Phialemonium obovatum. Arch Pathol Lab Med. 1993;117:841–843. 19. Osherov A et al. Phialemonium curvatum prosthetic valve endocarditis with an unusual echocardiographic presentation. Echocardiography. 2006;23:6, 503–505. 20. Gavin PJ et al. Fatal endocarditis caused by the dematiaceous fungus Phialemonium obovatum: Case report and review of the literature. J Clin Microbiol. 2002;40:2207–2212. 21. Scott RS, Sutton DA, Jagirdar J. Lung infection due to opportunistic fungus, Phialemonium obovatum, in a bone marrow transplant recipient: An emerging infection with fungemia and Crohn disease-like involvement of the gastrointestinal tract. Ann Diagn Pathol. 2005;9(4):227–230. 22. Clark T et al. Outbreak of bloodstream infection with the mold Phialemonium among patients receiving dialysis at a hemodialysis unit. Infect Control Hosp Epidemiol. 2006;27:1164–1170. 23. Zeng JS et al. Spectrum of clinically relevant Exophiala species in the United States. J Clin Microbiol. 2007;45(11):3713–3720. 24. White TJ et al. Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics, in PCR Protocols: A guide to methods and Applications, Innis, M.A., Gelfand, D.H., Sninsky, J. and White, T.J., Eds., Academic Press Inc., San Diego, CA, 1990;315–322. 58 Chapter 58 - Pseudallescheria and Scedosporium
12. de Hoog G et al. Hyphomycetes. In: G.S. de Hoog, J. Guarro (eds.), Atlas of Clinical Fungi. Reus, España/Utrecht, The Netherlands: Universitat Rovira i Virgili and Centraalbureau voor Schimmelcultures, 1995, pp. 380–1007.
13. Kwon-Chung KJ, Bennett JE. Pseudallescheriasis and Scedosporium Infection. In: C. Cann, S. Hunsberger (eds.), Medical Mycology. Philadelphia, PA: Lea and Febiger, 1992, pp. 678–694.
14. Fisher JF et al. Near-drowning complicated by brain abscess due to Petriellidium boydii. Arch Neurol. 39(8), 511, 1982.
15. Berenguer J et al. Central nervous system infection caused by Pseudallescheria boydii: Case report and review. Rev Infect Dis. 11(6), 890, 1989.
16. Creitz J, Harris HW. Isolation of Allescheria boydii from sputum. Am Rev Tuberc. 71(1), 126, 1955.
17. Cimon B et al. Clinical signi�cance of Scedosporium apiospermum in patients with cystic �brosis. Eur J Clin Microbiol Infect Dis. 19(1), 53, 2000.
18. Rippon JW. Pseudallescheriasis. In: Medical Mycology: The Pathogenic Fungi and the Pathogenic Actinomycetes. Philadelphia, PA: W. B. Saunders, 1988, pp. 651–680.
19. Berenguer J et al. Deep infections caused by Scedosporium proli¡cans. A report on 16 cases in Spain and a review of the literature. Scedosporium Proli¡cans Spanish Study Group. Medicine (Baltimore). 76(4), 256, 1997.
20. deBatlle J. et al. Disseminated infection caused by Scedosporium proli¡cans in a patient with acute multilineal leukemia. J Clin Microbiol. 38(4), 1694–1695, 2000.
21. Cooley L et al. Infection with Scedosporium apiospermum and S. proli¡cans, Australia. Emerg Infect Dis. 13(8), 1170, 2007.
22. Cortez KJ et al. Infections caused by Scedosporium spp. Clin Microbiol Rev. 21(1), 157, 2008. 23. Rodriguez-Tudela JL et al. Epidemiology and outcome of Scedosporium proli¡cans infection, a review of 162 cases. Med Mycol. 47(4), 359, 2009.
24. Thornton CR. Tracking the emerging human pathogen Pseudallescheria boydii by using highly speci�c monoclonal antibodies. Clin Vac. Immunol. 16(5), 756, 2009.
25. Maertens J et al. Disseminated infection by Scedosporium proli¡cans: An emerging fatality among haematology patients. Case report and review. Ann Hematol. 79(6), 340, 2000.
26. Ponton J et al. Emerging pathogens. Med Mycol. 38(Suppl 1), 225, 2000.
27. Cuenca-Estrella M et al. Head-to-head comparison of the activities of currently available antifungal agents against 3,378 Spanish clinical isolates of yeasts and �lamentous fungi. Antimicrob Agents Chemother. 50(3), 917, 2006.
28. Cuenca-Estrella M et al. Comparative in-vitro activity of voriconazole (UK-109,496) and six other antifungal agents against clinical isolates of Scedosporium proli¡cans and Scedosporium apiospermum. J Antimicrob Chemother. 43(1), 149, 1999.
29. Castelli MV et al. Development and validation of a quantitative PCR assay for diagnosis of scedosporiosis. J Clin Microbiol. 46(10), 3412, 2008.
30. Guarro J, Gene J. Acrophialophora fusispora misidenti�ed as Scedosporium proli¡cans. J Clin Microbiol. 40(9), 3544, 2002. 31. Kaufman L et al. Immunohistologic identi�cation of Aspergillus spp. and other hyaline fungi by using polyclonal ¼uorescent antibodies. J Clin Microbiol. 35(9), 2206, 1997. 32. Hagari Y et al. Cutaneous infection showing sporotrichoid spread caused by Pseudallescheria boydii (Scedosporium apiospermum): Successful detection of fungal DNA in formalin-�xed, paraf�n-embedded sections by seminested PCR. Arch Dermatol. 138(2), 271, 2002. 33. Hayden RT et al. In situ hybridization for the differentiation of Aspergillus, Fusarium, and Pseudallescheria species in tissue section. Diagn Mol Pathol. 12(1),21, 2003. 34. Dixon DM, Polak-Wyss A. The medically important dematiaceous fungi and their identi�cation. Mycoses. 34(1–2), 1, 1991. 35. Alastruey-Izquierdo A et al. Prevalence and susceptibility testing of new species of Pseudallescheria and Scedosporium in a collection of clinical mold isolates. Antimicrob Agents Chemother. 51(2), 748, 2007. 36. Tang CM, Cohen J, Holden DW. An Aspergillus fumigatus alkaline protease mutant constructed by gene disruption is de�cient in extracellular elastase activity. Mol Microbiol. 6(12), 1663, 1992. 37. Pinto MR et al. A peptidorhamnomannan from the mycelium of Pseudallescheria boydii is a potential diagnostic antigen of this emerging human pathogen. Microbiology. 147(Pt 6), 1499, 2001. 38. Jabado N et al. Invasive pulmonary infection due to Scedosporium apiospermum in two children with chronic granulomatous disease. Clin Infect Dis. 27(6), 1437, 1998. 39. Bagyalakshmi R et al. Newer emerging pathogens of ocular non-sporulating molds (NSM) identi�ed by polymerase chain reaction (PCR)-based DNA sequencing technique targeting internal transcribed spacer (ITS) region. Curr Eye Res. 33(2), 139, 2008. 40. Wedde M et al. PCR-based identi�cation of clinically relevant Pseudallescheria/Scedosporium strains. Med Mycol. 36(2), 61, 1998. 41. Espy MJ et al. Real-time PCR in clinical microbiology: Applications for routine laboratory testing. Clin Microbiol Rev. 19(1), 165, 2006. 42. Spiess B et al. DNA microarray-based detection and identi�cation of fungal pathogens in clinical samples from neutropenic patients. J Clin Microbiol. 45(11), 3743, 2007. 43. Holden DW. DNA mini prep method for Aspergillus fumigatus (and other �lamentous fungi). In: B. Maresca, G.S. Kobayashi (eds.), Molecular Biology of Pathogenic Fungi, a Laboratory Manual. New York: Telos Press, 1994, pp. 3–4. 44. White TJ. Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: M. Innis (ed.), PCR Protocols: A Guide to Methods and Applications. San Diego, CA: Academic Press, 1990, pp. 315–322. 45. Cruse M et al. Cryptic species in Stachybotrys chartarum. Mycologia. 94(5), 814, 2002. 46. Sambrook KJ, Fritsch EF, Maniatis T. Molecular cloning second edition. New York: Cold spring harbour laboratory Press, 1989. 59 Chapter 59 - Sarcopodium
1. Sutton, B. C. 1981. Sarcopodium and its synonyms. Trans Br Mycol Soc. 76:97–102.
2. Watanabe, T. 1993. Sarcopodium araliae sp. nov. on root of Aralia elata from Japan. Mycologia. 85:520–526.
3. Guarro, J. et al., Corneal ulcer caused by the new fungal species Sarcopodium oculorum. J Clin Microbiol. 2002;40(8):3071–3075.
4. Leaw, S. N. et al., Identi�cation of medically important yeast species by sequence analysis of the internal transcribed spacer regions. J Clin Microbiol. 2006;44(3):693–699.
5. Pounder, J. I. et al. Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J Clin Microbiol. 2007;45(2):568–571.
6. Bagyalakshmi, R. et al. Newer emerging pathogens of ocular non-sporulating molds (NSM) identi�ed by polymerase chain reaction (PCR)-based DNA sequencing technique targeting internal transcribed spacer (ITS) region. Curr Eye Res. 2008;33(2):139–147.
7. White, T. J. et al. 1990. Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In M. A. Innis, D. H. Gelfand, J. J. Snisky, and T. J. White (eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, pp. 315–322. 60 Chapter 60 - Sporothrix and Sporotrichosis
1. Six, D.L., Bark beetle-fungus symbioses, in Insect Symbiosis, p. 97, Bourtzis, K. and Miller, T.A., Eds., CRC Press, New York, 2003.
2. Kirisits, T., Fungal associates of European Bark beetles with special emphasis on the ophiostomatoid fungi, in Bark and Wood Boring Insects in Living Trees in Europe, a Synthesis, p. 181, Lieutier, F. et al., Eds., Kluwer Academic Press, Dordrecht, the Netherlands, 2004.
3. Seifert, K.A., Sapstain of commercial lumber by species of Ophiostoma and Ceratocystis, in Ceratocystis and Ophiostoma: Taxonomy, Ecology and Pathogenicity, p. 141, Wing�eld, M. J., Seifert, K. A., and Webber, J. F., Eds., APS Press, Mendota Heights MN, 1993.
4. Berbee, M.L. and Taylor, J.W., 18S Ribosomal RNA gene sequence characters place the human pathogen Sporothrix schenckii in the genus Ophiostoma, Exp. Mycol., 16, 87, 1992.
5. Summerbell, R.C. et al., Medically important Sporothrix species and related Ophiostomatoid fungi, in Ceratocystis and Ophiostoma: Taxonomy, Ecology and Pathogenicity, p. 185, Wing�eld, M.J., Seifert, K.A., and Webber, J.F., Eds., APS Press, Mendota Heights, MN, 1993.
6. de Beer, Z.W., Phylogeny of the Ophiostoma stenocerasSporothrix schenckii complex, Mycologia, 95, 434, 2003.
7. Spencer, J.F.T. and Gorin, P.A.J., Systematics of the genera Certocystis and Graphium. Proton magnetic resonance spectra of the mannose-containing polysaccharides as an aid in classi�cation, Mycologia, 63, 387, 1971. 8. Toriello, C. and Mariat, F., Etude comparée des polyosides des champignons Ceratocystis stenoceras et Sporothrix schenckii. Composition chimique et analyse immunologique, Ann. Microbiol., 125A, 287, 1974. 9. Travassos, L.R. and Lloyd, K.O., Sporothrix schenckii and related species of Ceratocystis, Microbiol. Rev., 44, 683, 1980. 10. Mariat, F., Adaptation de Ceratocystis a la vie parasitaire chez l’animal. Etude de l’aquisition d’un pouvoir pathogéne comparable a celui de Sporothrix schenckii, Sabouraudia, 9, 191, 1971. 11. Suzuki, K., Kawasaki, M., and Ishizaki, H., Analysis of restriction pro�les of mitochondrial DNA from Sporothrix schenckii and related fungi, Mycopathologia, 103, 147, 1988. 12. O’Reilly, L.C. and Altman, S.A., Macrorestriction analysis of clinical and environmental isolates of Sporothrix schenckii, J. Clin. Microbiol., 44, 7, 2006. 13. James, J.T. et al., Reconstructing the early evolution of fungi using a six-gene phylogeny, Nature, 44, 19, 2006. 14. Hibbett, S.D., A higher-level phylogenetic classi�cation of the Fungi, Mycol. Res., 111, 509, 2007. 15. Zhang, N. et al., An overview of the systematics of the Sordariomycetes based on a four-gene phylogeny, Mycologia, 98, 1076, 2006. 16. Hektoen, L. and Perkins, C.F., Refractory subcutaneous abscesses caused by Sporothrix schenckii, J. Exp. Med., 5, 77, 1900. 17. CABI Bioscience, CBS, 2009, Index Fungorum. Available: http://www.indexfungorum.org, accessed October 12, 2009. 18. Marimon, R. et al., Molecular phylogeny of Sporothrix schenckii, J. Clin. Microbiol., 44, 3251, 2006. 19. Watanabe, S. et al., RFLP analysis of the internal transcribed spacer regions of Sporothrix schenckii, Jpn. J. Med. Mycol., 45, 165, 2004. 20. Marimon, R. et al., Sporothrix brasiliensis, S. globosa, and S. mexicana. Three new Sporothrix species of clinical interest, J. Clin. Microbiol., 45, 3198, 2007. 21. Marimon, R. et al., Sporothrix luriei: A rare fungus from clinical origin, Med. Mycol., 46, 621, 2008. 22. Rippon, J.W., Sporotrichosis, in Medical Mycology, 3rd edn., The W.B. Saunders Co, Philadelphia, PA, 1990, Chap. 11. 23. Kwon-Chung, K.J. and Bennett, J.E., Medical Mycology, Lea & Febiger, Philadelphia, PA, 1992, Chap. 26. 24. Emmons, C.W. et al., Medical Mycology, 3rd edn., Lea & Febiger, Philadelphia, PA, 1977, Chap. 25. 25. Mariat, F., The epidemiology of sporotrichosis, in Systemic Mycoses, p. 144, Wolstenholme, G. E. W., Ed., A. Churchill, London, U.K., 1968. 26. Barros, M.B.L. et al., Cat-transmitted sporotrichosis epidemic in Rio de Janeiro, Brazil: Description of a series of cases, Clin. Infect. Dis., 38, 529, 2004. 27. Durden, F.M. and Elewski, B., Fungal infections in HIV patients, Semin. Cutan. Med. Surg., 16, 200, 1997. 28. Dixon, D.M. et al., Isolation and characterization of Sporothrix schenckii from clinical and environmental sources associated with the largest U.S. epidemic of sporotrichosis, J. Clin. Microbiol., 29, 1106, 1991. 29. Gonzalez-Ochoa, A., Contribuciones recientes al conocimiento de la esporotricosis, Gac. Med. Mex., 95, 463, 1965. 30. Bonifaz, A., Micología Médica Básica, p. 179, 3rd edn., McGraw-Hill, México, 2010. 31. Arenas, R., Micología Médica Ilustrada, p. 149, 3rd edn., McGraw-Hill, México, 2008.
32. Barros, M.B. et al., Sporotrichosis: An emergent zoonosis in Rio de Janeiro, Mem. Inst. Oswaldo Cruz, 96, 777, 2001.
33. Schubach, T.M.P. et al., Evaluation of an epidemic of sporotrichosis in cats: 347 cases (1998–2001), J. Am. Vet. Med. Assoc., 224, 1623, 2004.
34. Schubach, T.M. et al., Canine sporotrichosis in Rio de Janeiro, Brazil, clinical presentation, laboratory diagnosis and therapeutic response in 44 cases (1998–2003), Med. Mycol, 44, 87, 2006.
35. Schubach, A., Barros, M.B.D.L., and Wanke, B., Epidemic sporotrichosis, Curr. Opin. Infect. Dis, 21, 129, 2008.
36. Kauffman, C.A., Sporotrichosis, Clin. Infect. Dis., 29, 231, 1999.
37. Nicot, J. and Mariat, F., Caracteres morphologiques et position systématique de Sporothrix schenckii agent de la sporotrichose humaine, Mycopathol. Mycol. Appl., 49, 53, 1973.
38. Rodríguez del Valle, N., Rosario, M., and Torres-Blasini, G., Effects of pH, temperature, aeration and carbon source on the development of the mycelia or yeast forms of Sporothrix schenckii from conidia, Mycopathologia, 82, 83, 1983.
39. Splendore, A., Sobre a cultura de uma nova especie de cogumello patogénica do home: Sporotrichum splendore ou “Sporotrichum asteroide” n. sp, Rev. Soc. Sc. Sao Paulo, 3, 62, 1908.
40. Drouhet, E. and Mariat, F., Etude des facteurs déterminant la dévelopment de la phase levure de Sporotrichum schenckii, Ann. Inst. Pasteur Paris, 83, 506, 1952.
41. Ghosh, A. et al., Physiological characters of Sporothrix schenckii isolates, Mycoses, 45, 449, 2002.
42. Lloyd, K.O. and Bitoon, M.A., Isolation and puri�cation of a peptido-rhamnomannan from the yeast form of Sporothrix schenckii. Structural and immunochemical studies, J. Immunol., 107, 663, 1971.
43. Mendonca, L. et al., Polymorphism of Sporothrix schenckii surface polysaccharides as a function of morphological differentiation, Biochemistry, 15, 2423, 1976.
44. Lopes-Bezerra, L.M., Schubach, A., and Costa, O.R., Sporothrix schenckii and Sporotrichosis, Ann. Acad. Bras. Cienc., 78, 293, 2006.
45. Gonzalez-Ochoa, A. and Figueroa, E.S., Polisacáridos del Sporotrichum schenckii, Datos immunológicos. Intradermoreacción en el diagnóstico de la esporotricosis, Rev. Inst. Salubr. Enferm. Trop. Mexico City, 8, 143, 1947.
46. Arenas, G. and Toriello, C., Actividad inmunológica de antígenos miceliales-levaduriformes de diferentes fases de crecimiento de Sporothrix schenckii, Rev. Mex. Micol., 2, l3l, 1986.
47. Romero-Martínez, R. et al., Biosynthesis and function of melanin in Sporothrix schenckii, Infect. Immun., 68, 3696, 2000.
48. Morris-Jones, R. et al., Synthesis of melanin-like pigments by Sporothrix schenckii in vitro and during mammalian infection, Infect. Immun., 71, 4026, 2003.
49. Almeida-Paes, R. et al., Growth conditions in¼uence melanization of Brazilian clinical Sporothrix schenckii isolates, Microbes Infect., 11, 554, 2009.
50. Cooper, C.R., Dixon, D.M., and Salkin, I.F., Laboratoryacquired sporotrichosis, J. Med. Vet. Mycol., 30, 169, 1992.
51. Casadevall, A. and Pirofski, L.A., Host-pathogen interactions: Rede�ning the basic concepts of virulence and pathogenicity, Infect. Immun., 67, 3703, 1999.
52. Meléndez Ruíz, C.A. et al., Per�l inmunológico del paciente con esporotricosis linfocutánea, Mycopathologia, 83, 169, 1983. 53. Mackinnon, J.E., Ecology and epidemiology of sporotrichosis, in Proceedings of the International Symposium on Mycoses, p. 169, Pan American Health Organization, Washington, DC, 1970. 54. Mariat, F. et al., Premieres observations sur les macrospores pigmentées de Sporothrix schenckii, C. R. Acad. Sci. Paris, 286, 1429, 1978. 55. Ramos-Zepeda, R. and Gonzalez-Mendoza, A., Metabolic activity of phagocytes in experimental sporotrichosis, Mycopathologia, 93, 109, 1986. 56. Wang, X.L. et al., Differential mRNA expression of Sporothrix schenckii catalase gene in two growth phases and other factors, Chin. Med. J., 121, 2100, 2008. 57. Muller, H.E., Uber das Vorkommen von Neuraminidase bei Sporothrix schenckii and Ceratocystis stenoceras und ihre Bedeutung fur die Okologie und den Pathomechanismus dieser Pilze, Zentralbl Bakteriol, Parasitenkd Infektionskr, Hyg. Abt., 232, 365, 1975. 58. Ruiz-Baca, E. et al., Isolation and some properties of a glycoprotein of 70 kDa (Gp70) from the cell wall of Sporothrix schenckii involved in fungal adherence to dermal extracellular matrix, Med. Mycol., 27, 185, 2009. 59. Lima, O.C. et al., Adhesion of the human pathogen Sporothrix schenckii to several extracellular matrix proteins, Braz. J. Med. Biol. Res., 32, 651, 1999. 60. Lima, O.C. et al., Immuno¼uorescence and ¼ow cytometry analysis of �bronectin and laminin binding to Sporothrix schenckii yeast cells and conidia, Microb. Pathog., 37, 131, 2004. 61. Figueiredo, C. et al., The in vitro interaction of Sporothrix schenckii with human endothelial cells is modulated by cytokines and involves endothelial surface molecules, Microb. Pathog., 36, 177, 2004. 62. Nascimento, R.C. et al., Passive immunization with monoclonal antibody against a 70 kDa putative adhesin of Sporothrix schenckii induces protection in murine sporotrichosis, Eur. J. Immunol., 38, 3080, 2008. 63. Teixeira, C.P.A. et al., Cell surface expression of adhesions for �bronectin correlates with virulence in Sporothrix schenckii, Microbiology, 155, 3730, 2009. 64. Hiruma, M., Kawada, A., and Ishibashi, A., Ultrastructure of asteroid bodies in sporotrichosis, Mycoses, 34, 103, 1991. 65. Lurie, H.I. and Still, W.J.S., The “capsule” of Sporotrichum schenckii and the evolution of the asteroid body. A light and electron microscopic study, Sabouraudia, 7, 64, 1969. 66. Smith, A.G. et al., Chronic pulmonary sporotrichosis: Report of a case, including morphologic and mycologic studies, Am. J. Clin. Pathol., 54, 401, 1970. 67. Lurie, H.I. and Still, W.J.S., Histopathology of sporotrichosis, Arch. Pathol., 75, 421, 1963. 68. Zaharopoulos, P., Fine-needle aspiration cytologic diagnosis of lymphocutaneous sporotrichosis: A case report, Diagn. Cytopathol., 20, 74, 1999. 69. Gerhard, R. et al., Fine-needle aspiration biopsy of disseminated sporotrichosis: A case report, Diagn. Cytopathol., 36, 174, 2008. 70. Okudaira, M., Tsubura, E., and Schwartz, J., A histopathological study of experimental murine sporotrichosis, Mycopathologia, 14, 284, 1961. 71. Maberry, J.D., Mullins, J.F., and Stone, O.J., Sporotrichosis with demonstration of hyphae in human tissue, Arch. Dermatol., 93, 1, 65, 1966. 72. Lii, S.L. and Shigemi, F., Demonstration of hyphae in human tissue of sporotrichosis, with statistics of cases reported from Tokushima, Tokushima, J. Exp. Med., 20, 69, 1973.
73. Fujimura, T. et al., Local expression of migration inhibitory factor and Th1 type cytokine mRNA in sporotrichosis lesions, Acta Dermatol. Venereol. (Stockh), 76, 321, 1996.
74. Tachibana, T., Matsuyama, T., and Mitsuyama, M., Involvement of CD4+ T cells and macrophages in acquired protection against infection with Sporothrix schenckii in mice, Med. Mycol., 37, 397, 1999.
75. Koga, T., Duan, H., and Furue, M., Immunohistochemical detection of interferon-gamma-producing cells in granuloma formation of sporotrichosis, Med. Mycol., 40, 111, 2002.
76. Koga, T. et al., Immunohistochemical localization of activated and mature CD83+ dendritic cells in granulomas of sporotrichosis, Eur. J. Dermatol., 11, 527, 2001.
77. Buentke, E. and Scheynius, A., Dendritic cells and fungi, Acta Pathol. Microbiol. Immunol. Scand., 111, 789, 2003.
78. Netea, M.G. et al., Recognition of fungal pathogens by Toll-like receptors, Eur. J. Clin. Microbiol. Infect. Dis., 23, 672, 2004.
79. Uenotsuchi, T. et al., Differential induction of Th1-prone immunity by human dendritic cells activated with Sporothrix schenckii of cutaneous and visceral origins to determine their different virulence, Int. Immunol., 18, 1637, 2006.
80. Howard, D.H. and Orr, G.F., Comparison of strains of Sporotrichum schenckii isolated from nature, J. Bacteriol., 85, 816, 1963.
81. Vélez, H. et al., Polimor�smo fenotípico de cepas autóctonas de Sporothrix schenckii, IATREIA, 9, 71, 1996.
82. Pérez, A. et al., Diferencias en la virulencia de aislamientos de Sporothrix schenckii, in Memorias VI Congreso Nacional de Micología, IX Jornadas Cientí¡cas, Sociedad Mexicana de Micología, El Colegio de la Frontera Sur, Tapachula, Chiapas, México, 1997, p. 176.
83. Takeda, Y., Kawasakii, M., and Ishizaki, H., Phylogeny and molecular epidemiology of Sporothrix schenckii in Japan, Mycopathologia, 116, 9, 1991. 84. Hajjeh, R. et al., Outbreak of sporotrichosis among tree nursery workers, J. Infect. Dis., 176, 499, 1997.
85. Ishizaki, H. et al., Mitochondrial DNA analysis of Sporothrix schenckii in Costa Rica, J. Med. Vet. Mycol., 34, 71, 1996.
86. Ishizaki, H. et al., Mitochondrial DNA analysis of Sporothrix schenckii in North and South America, Mycopathologia, 142, 115, 1998.
87. Ishizaki, H. and Kawasaki, M., Molecular epidemiology of Sporothrix schenckii, Jpn. J. Med. Mycol., 41, 245, 2000.
88. Ishizaki, H. et al., Mitochondrial DNA analysis of Sporothrix schenckii in India, Thailand, Brazil, Colombia, Guatemala and Mexico, Jpn. J. Med. Mycol., 50, 19, 2009.
89. Lin, J. et al, Mitochondrial DNA analysis of Sporothrix schenckii clinical isolates from China, Mycopathology, 148, 69, 1999.
90. Mora-Cabrera, M. et al., Analysis of restriction pro�les of mitochondrial DNA from Sporothrix schenckii, Med. Mycol., 39, 439, 2001.
91. Arenas, R., Miller, D., and Campos-Macias, P., Epidemiological data and molecular characterization (mtDNA) of Sporothrix schenckii in 13 cases from Mexico, Int. J. Dermatol., 46, 177, 2007.
92. Zhang, Z. et al., Genotyping of Sporothrix schenckii by analysis of ribosomal DNA regions, Mycoses, 49, 305, 2006.
93. Mesa-Arango, A.C. et al., Phenotyping and genotyping of Sporothrix schenckii isolates according to geographic origin and clinical forms of sporotrichosis, J. Clin. Microbiol., 40, 3004, 2002.
94. Gutiérrez Galhardo, M.C. et al., Molecular epidemiology and antifungal susceptibility patterns of Sporothrix schenckii isolates from a cat-transmitted epidemic of sporotrichosis in Rio de Janeiro, Brazil, Med. Mycol., 46, 141, 2008. 95. Neyra, E.P. et al., Epidemiology of human sporotrichosis investigated by ampli�ed fragment length polymorphism, J. Clin. Microbiol., 43, 1348, 2005. 96. Tateishi, T. et al., Karyotyping by PFGE of clinical isolates of Sporothrix schenckii, FEMS Immunol. Med. Microbiol., 13, 147, 1996. 97. Madrid, H. et al., Sporothrix globosa, a pathogenic fungus with widespread geographical distribution, Rev. Iberoam. Micol., 26, 218, 2009. 98. Kawasaki, M. et al., Molecular epidemiology of Sporothrix schenckii in Mexico, Brazil and Spain, in Proceedings of the Fourth Congress of the International Society for Human and Animal Mycology, p. 120, Buenos Aires, Argentina, 2000. 99. Sugita, Y., Molecular analysis of DNA polymorphism of Sporothrix schenckii, Jpn. J. Med. Mycol., 41, 11, 2000. 100. Reis, R.S. et al., Molecular typing of Sporothrix schenckii strains isolated from clinical specimens in Rio de Jainero, Brazil, in Proceedings of the Fourth Congress of the International Society for Human and Animal Mycology, p. 132, Buenos Aires, Argentina, 2000. 101. Lee, J.B., Lee, S.C., and Won, H.Y., Analysis of random ampli�ed polymorphic DNA (RAPD) for Sporothrix schenckii and related fungi, Korean J. Med. Mycol., 5, 113, 2000. 102. Marimon, R. et al., In vitro antifungal susceptibilities of �ve species of Sporothrix, Antimicrob. Agents Chemother. 52, 732, 2008. 103. Kajiwara, H. et al., Impaired host defense against Sporothrix schenckii in mice with chronic granulomatous disease, Infect. Immun., 72, 5073, 2004. 104. Sharma, S. et al., Cutaneous tuberculosis mimicking sporotrichosis, Indian J. Pediatr., 72, 86, 2005. 105. Tobin, E.H. and Jih, W.W., Sporotrichoid lymphocutaneous infections: Etiology, diagnosis, and therapy, Am. Fam. Physician, 63, 326, 2001. 106. Al-Taw�q, J.A. and Wools, K.K., Disseminated sporotrichosis and Sporothrix schenckii fungemia as the initial presentation of immunode�ciency virus infection, Clin. Infect. Dis., 26, 1403, 1983. 107. Gezuele, E. and Da Rosa, D., Relevancia del cuerpo asteroide esporotricósico en el diagnóstico rápido de la esporotricosis, Rev. Iberoam. Micol., 22, 147, 2005. 108. Padilla Desgarennes, M.C., Siodia Zambrano, S.P., and Novales Santa Coloma J., Esporotricosis con involución espontánea, Dermatol. Rev. Mex., 51, 14, 2007. 109. Suchitha, A. et al., Sporotrichosis in Mysore: A case report to emphasize the role of histopathology, Indian J. Pathol. Microbiol., 51, 45, 2008. 110. Lima, O.C. and Bezerra, L.M., Identi�cation of a concanavalin A-binding antigen of the cell surface of Sporothrix schenckii, J. Med. Vet. Mycol., 35, 167, 1997. 111. Mendoza, M. et al., Production of culture �ltrates of Sporothrix schenckii in diverse culture media, Med. Mycol., 40, 447, 2002. 112. Albornoz, M.B., Villanueva, E., and Torres, E.D., Application of immunoprecipitation techniques to the diagnosis of cutaneous and extracutaneous forms of sporotrichosis, Mycopathologia, 85, 177, 1984. 113. Bernardes-Engermann, A.R. et al., Improved-enzyme-linked immunosorbent assay using the Ss-CBF antigen for the serodiagnosis of several clinical forms of sporotrichosis, Med. Mycol., 43, 487, 2005.
114. Almeida-Paes, R. et al., Use of Mycelial-Phase Sporothrix schenckii exoantigens in an enzyme-linked immunosorbent assay for diagnosis of sporotrichosis by antibody detection, Clin. Vaccine Immunol., 14, 244, 2007.
115. Almeida-Paes, R. et al., Immunoglobulins G, M, and A against Sporothrix schenckii exoantigens in patients with sporotrichosis before and during treatment with itraconazole, Clin. Vaccine Immunol., 14, 1149, 2007.
116. Hu, S. et al., Detection of Sporothrix schenckii in clinical samples by a nested PCR assay, J. Clin. Microbiol., 41, 1414, 2003. 117. Sandhu, G.S. et al., Molecular probes for diagnosis of fungal infections, J. Clin. Microbiol., 33, 2913, 2005. 118. Kano, R. et al., Identi�cation of Sporothrix schenckii based on sequences of the chitin synthase 1 gene, Mycoses, 44, 261, 2001. 119. Xu, T.H. et al., Identi�cation of Sporothix schenckii of various mtDNA types by Nested PCR assay, Med. Mycol., 48, 161, 2010. 61 Chapter 61 - Stachybotrys
22. Solomon, G. M. et al., 2006. Airborne mold and endotoxin concentrations in New Orleans, Louisiana, after ¼ooding, October through November 2005. Environ Health Perspect. 114:1381–1386.
23. Meggs, W. J., 2009. Epidemics of mold poisoning past and present. Toxicol Ind Health. 25:571–576.
24. Straus, D. C., 2009. Molds, mycotoxins, and sick building syndrome. Toxicol Ind Health. 25:617–635.
25. Al-Ahmad, M. et al., 2010. Symptoms after mould exposure including Stachybotrys chartarum, and comparison with darkroom disease. Allergy. 65(2):245–255.
26. Nikulin, M. et al., 1996. Experimental lung mycotoxicosis in mice induced by Stachybotrys atra. Int J Exp Pathol. 77:213–218.
27. Wilkins, C. K. et al., 1998. Respiratory effects in mice exposed to airborne emissions from Stachybotrys chartarum and implications for risk assessment. Pharm Toxicol. 83:112–119.
28. Rand, T. G. et al., 2002. Histological, immunohistochemical and morphometric changes in lung tissue in juvenile mice experimentally exposed to Stachybotrys chartarum spores. Mycopathologica. 156:119–131.
29. Edmondson, D.A. et al., 2009. Immune response among patients exposed to molds. Int J Mol Sci. 10:5471–5484.
30. Piecková, E. et al., 2006. Pulmonary cytotoxicity of secondary metabolites of Stachybotrys chartarum (Ehrenb.) Hughes. Ann Agric Environ Med. 13(2):259–262.
31. Piecková, E. et al., 2009. In¼ammatory and haematotoxic potential of indoor Stachybotrys chartarum (Ehrenb.) Hughes metabolites. Arh Hig Rada Toksikol. 60(4):401–409.
32. Kankkunen, P. et al., 2009. Trichothecene mycotoxins activate in¼ammatory response in human macrophages. J Immunol. 182(10):6418–6425.
33. Mason, C. D. et al., 2001. Effects of Stachybotrys chartarum on surfactant convertase activity in juvenile mice. Toxicol Appl Pharm. 172:21–28.
34. Yike, I., T. Rand, and D. C. Dearborn, 2007. The role of fungal proteinases in pathophysiology of Stachybotrys chartarum. Mycopathologia. 164(4):171–181.
35. Rakkestad, K. E. et al., 2010. DNA damage and DNA damage responses in THP-1 monocytes after exposure to spores of either Stachybotrys chartarum or Aspergillus versicolor or to T-2 toxin. Toxicol Sci. 115(1):140–155.
36. Hinkley, S. F. and B. B. Jarvis, 2001. Chromatographic method for Stachybotrys toxins. Methods Mol Biol. 157:173–194. 37. Chung, Y.-J. et al., 2003. Immunochemical assay for satratoxin G and other macrocyclic trichothecenes associated with indoor air contamination by Stachybotrys chartarum. Toxicol Mech Methods. 13:247–252. 38. Brasel, T. L. et al., 2004. Detection of airborne Stachybotrys chartarum macrocyclic trichothecene mycotoxins on particulates smaller than conidia. Appl Environ Microbiol. 71:114–122. 39. Brasel, T.L. et al., 2005. Detection of airborne Stachybotrys chartarum macrocyclic trichothecene mycotoxins in the indoor environment. Appl Environ Microbiol. 71(11):7376–7388. 40. Gregory, L. et al., 2004. Localization of satratoxin-G in Stachybotrys chartarum spores and spore-impacted mouse lung using immunocytochemistry. Toxicol Pathol. 32:26–34. 41. Bloom, E. et al., 2007. Mass spectrometry-based strategy for direct detection and quanti�cation of some mycotoxins produced by Stachybotrys and Aspergillus spp. in indoor environments. Appl Environ Microbiol. 73:4211–4217. 42. Vesper, S. J. et al., 1999. Hemolysis, toxicity, and randomly ampli�ed polymorphic DNA analysis of Stachybotrys chartarum strains. Appl Environ Microbiol. 65:3175–3181. 43. Vesper, S. J. et al., 2000. Quanti�cation of siderophore and hemolysin from Stachybotrys chartarum strains, including a strain isolated from the lung of a child with pulmonary hemorrhage and hemosiderosis. Appl Environ Microbiol. 66:2678–2681. 44. Pietarinen, V. M. et al., 2008. Quantitative PCR analysis of fungi and bacteria in building materials and comparison to culture-based analysis. J Environ Monit. 10:655–663. 45. Pounder, J. I. et al., 2007. Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J Clin Microbiol. 45(2):568–571. 46. Pasanen, A.-L. et al., 1993. Laboratory experiments on membrane �lter sampling of airborne mycotoxins produced by Stachybotrys atra corda. Atmos Environ. 27A:9–13. 47. Leaw, S. N. et al., 2006. Identi�cation of medically important yeast species by sequence analysis of the internal transcribed spacer regions. J Clin Microbiol. 44:693–699. 48. Pestka, J. J. et al., 2008. Stachybotrys chartarum, trichothecene mycotoxins, and damp building-related illness: New insights into a public health enigma. Toxicol Sci. 104(1):4–26. 49. Vesper, S. J. et al., 2001. Initial characterization of the hemolysin stachylysin from Stachybotrys chartarum. Infect Immun. 69:912–916. 62 Chapter 62 - Trichoderma
1. Druzhinina, I.S. and Kubicek, C.P., Species concepts and biodiversity in Trichoderma and Hypocrea: From aggregate species to species clusters? J. Zhejiang Univ. Sci., 6B, 100, 2005.
2. Druzhinina, I.S. et al., The �rst 100 Trichoderma species characterized by molecular data, Mycoscience, 47, 55, 2006. 3. Persoon, C.H., Disposito methodica fungorum in classes, ordines, familias et genera. In: Römer, J.J. (ed.), Neues Magazin für Botanik, pp. 63–128. Ziegler und Söhne, Zürich, 1794. 4. Bisby, G.R., Trichoderma viride Pers. ex Fries, and notes on Hypocrea., Trans. Br. Mycol. Soc., 23, 149, 1939. 5. Rifai, M.A., A revision of the genus Trichoderma, Mycol. Pap., 116, 1, 1969. 6. Bissett, J., A revision of the genus Trichoderma. I. Sect. Longibrachiatum sect. Nov, Can. J. Bot., 62, 924, 1984. 7. Bissett, J., A revision of the genus Trichoderma. II. Infrageneric classi�cation, Can. J. Bot., 69, 2357, 1991. 8. Bissett, J., A revision of the genus Trichoderma. III. Sect. Pachybasium, Can. J. Bot., 69, 2373, 1991. 9. Bissett, J., A revision of the genus Trichoderma. IV. Additional notes on section Longibrachiatum, Can. J. Bot., 69, 2418, 1991. 10. Kindermann, J. et al., Phylogeny of the genus Trichoderma based on sequence analysis of the internal transcribed spacer region 1 of the rDNA clade, Fungal Genet. Biol., 24, 298, 1998. 11. Kullnig-Gradinger, C.M. et al., Phylogeny and evolution of the fungal genus Trichoderma: A multigene approach, Mycol. Res., 106, 757, 2002. 12. Taylor, J.W. et al., Phylogenetic species recognition and species concepts in fungi, Fungal Genet. Biol., 31, 21, 2000. 13. Druzhinina, I. et al., An oligonucleotide barcode for species identi�cation in Trichoderma and Hypocrea, Fungal Genet. Biol., 42, 813, 2005. 14. Druzhinina, I.S. and Kopchinskiy, A.G., TrichOKEY v. 2—A DNA oligonucleotide BarCode program for the identi�cation of multiple sequences of Hypocrea and Trichoderma. In: Meyer, W. and Pearce, C. (eds.), Proceedings of the 8th International Mycological Congress, Cairns, Australia, pp. 53–59. Medimond-Monduzzi, Bologna, Italy, 2006. 15. Kopchinskiy, A. et al., TrichoBLAST: A multiloci database of phylogenetic markers for Trichoderma and Hypocrea powered by sequence diagnosis and similarity search tools, Mycol. Res., 109, 658, 2005. 16. Kubicek, C.P. and Penttilä, M.E., Regulation of production of plant polysaccharide degrading enzymes by Trichoderma. In: Harman, G.E. and Kubicek, C.P. (eds.), Trichoderma and Gliocladium, Volume 2: Enzymes, Biological Control and Commercial Applications, pp. 49–71. Taylor & Francis Ltd., London, U.K., 1998. 17. Papavizas, G.C., Trichoderma and Gliocladium: Biology, ecology, and potential for biocontrol, Annu. Rev. Phytopathol., 23, 23, 1985. 18. Herrera-Estrella, A. and Chet, I., Biocontrol of bacteria and phytopathogenic fungi. In: Altman, A. (ed.), Agricultural Biotechnology, pp. 263–282. Marcel Dekker Inc. New York, 1998. 19. Howell, C.R., Mechanisms employed by Trichoderma species in the biological control of plant diseases: The history and evolution of current concepts, Plant Dis., 87, 4, 2003. 20. Benítez, T. et al., Biocontrol mechanisms of Trichoderma strains. Int. Microbiol., 7, 249, 2004. 21. Szekeres, A. et al., Peptaibols and related peptaibiotics of Trichoderma. A review, Acta Microbiol. Immunol. Hung., 52, 137, 2005. 22. Samuels, G.J. et al., Trichoderma species associated with the green mold epidemic of commercially grown Agaricus bisporus, Mycologia, 94, 146, 2002. 23. Hatvani, L. et al., Green mould diseases of Agaricus and Pleurotus are caused by related but phylogenetically different Trichoderma species, Phytopathology, 97, 532, 2007.
24. Komon´-Zelazowska, M. et al., Genetically closely related but phenotypically divergent Trichoderma species cause worldwide green mould disease in oyster mushroom farms, Appl. Environ. Microbiol., 73, 7415, 2007.
25. Foreyt, W.J. and Leathers, C.W., Trichoderma sp. infection in the alligator (Alligator mississippiensis), J. Herpetol., 19, 530, 1985.
26. Jacobson, E.R., Necrotizing mycotic dermatitis in snakes: Clinical and pathologic features, J. Am. Vet. Med. Assoc., 177, 838, 1980.
27. Kredics, L. et al., Clinical importance of the genus Trichoderma, Acta Microbiol. Immunol. Hung., 50, 105, 2003.
28. Nagy, E. et al., Molecular diagnosis, epidemiology and taxonomy of emerging medically important �lamentous fungi, Rev. Med. Microbiol., 15, 153, 2004.
29. Loeppky, C.B. et al., Trichoderma viride peritonitis, South Med. J., 76, 798, 1983.
30. Ragnaud, J.M. et al., Infection peritoneale a Trichoderma koningii sur dialyse peritoneale continue ambulatoire, Med. Maladies Infect., 7, 402, 1984.
31. Warnock, D.W. and Johnson, E.M., Clinical manifestation and management of hyalohyphomycosis, phaehyphomycosis and other uncommon forms of fungal infection in the compromised patient. In: Warnock, D.W. and Richardson, M.D. (eds.), Fungal Infection in the Compromised Patient, pp. 248– 310. John Wiley & Sons Ltd., Chichester, U.K. 1991.
32. Guiserix, J. et al., Trichoderma harzianum peritonitis in peritoneal dialysis, Nephron, 74, 473, 1996.
33. Tanis, B.C. et al., Fatal fungal peritonitis by Trichoderma longibrachiatum complicating peritoneal dialysis, Nephrol. Dial. Transplant., 10, 114, 1995.
34. Campos-Herrero, M.I. et al., Trichoderma koningii peritonitis in a patient undergoing peritoneal dialysis, Clin. Microbiol. Newslett., 18, 150, 1996.
35. Bren, A., Fungal peritonitis in patients on continuous ambulatory peritoneal dialysis, Eur. J. Clin. Microbiol. Infect. Dis., 17, 839, 1998.
36. Rota, S. et al., Trichoderma pseudokoningii peritonitis in automated peritoneal dialysis patient successfully treated by early catheter removal, Perit. Dial. Int., 20, 91, 2000.
37. Esel, D. et al., Fatal peritonitis due to Trichoderma sp. in a patient undergoing continuous ambulatory peritoneal dialysis, Mycoses, 46, 71, 2003.
38. Aroca, T.S. et al., Case report: Trichoderma longibrachiatum infections in a pediatric patient with peritoneal dialysis, Bol. Micol., 19, 13, 2004.
39. Lee, H.J. et al., Peritonitis and intra-abdominal abscess by Trichoderma longibrachiatum in a patient undergoing continuous ambulatory peritoneal dialysis (CAPD), Korean J. Nephrol., 26, 254, 2007.
40. Ranque, S. et al., Isolation of Trichoderma atroviride from a liver transplant, J. Mycol. Med., 18, 234, 2008.
41. Jacobs, F. et al., Trichoderma viride infection in a liver transplant recipient, Mycoses, 35, 301, 1992.
42. Gautheret, A. et al., Trichoderma pseudokoningii as a cause of fatal infection in a bone marrow transplant recipient, Clin. Infect. Dis., 20, 1063, 1995.
43. Furukawa, H. et al., Acute invasive sinusitis due to Trichoderma longibrachiatum in a liver and small bowel transplant recipient, Clin. Infect. Dis., 26, 487, 1998.
44. Guarro, J. et al., Fatal case of Trichoderma harzianum infection in a renal transplant recipient, J. Clin. Microbiol., 37, 3751, 1999. 45. Richter, S. et al., Fatal disseminated Trichoderma longibrachiatum infection in an adult bone marrow transplant patient: Species identi�cation and review of the literature, J. Clin. Microbiol., 37, 1154, 1999. 46. Chouaki, T. et al., Invasive infections due to Trichoderma species: Report of 2 cases, �ndings of in vitro susceptibility testing and review of the literature, Clin. Infect. Dis., 35, 1360, 2002. 47. Stelzmueller, I. et al., Zygomycosis and other rare �lamentous fungal infections in solid organ transplant recipients, Transpl. Int., 21, 534, 2008. 48. Seguin, P. et al., Successful treatment of a brain abscess due to Trichoderma longibrachiatum after surgical resection, Eur. J. Clin. Microbiol. Infect. Dis., 14, 445, 1995. 49. Munoz, F.M. et al., Trichoderma longibrachiatum infection in a pediatric patient with aplastic anemia, J. Clin. Microbiol., 35, 499, 1997. 50. Myoken, Y. et al., Fatal necrotizing stomatitis due to Trichoderma longibrachiatum in a neutropenic patient with malignant lymphoma: A case report, Int. J. Oral. Maxillofac. Surg., 31, 688, 2002. 51. De Miguel, D. et al., Nonfatal pulmonary Trichoderma viride infection in an adult patient with acute myeloid leukemia. Report of one case and review of the literature, Diagn. Microbiol. Infect. Dis., 53, 33, 2005. 52. Kviliute, R. et al., Nonfatal Trichoderma citrinoviride pneumonia in an acute myeloid leukemia patient, Ann. Hematol., 87, 501, 2008. 53. Alanio, A. et al., Invasive pulmonary infection due to Trichoderma longibrachiatum mimicking invasive Aspergillosis in a neutropenic patient successfully treated with voriconazole combined with caspofungin, Clin. Infect. Dis., 46, e116, 2008. 54. Kantarciog˘lu, A.S. et al., Fatal Trichoderma harzianum infection in a leukemic pediatric patient, Med. Mycol., 47, 207, 2009. 55. Escudero, C.M.R., Pino Corral, E., and Munoz, R., Micoma pulmonar causado por Trichoderma viride, Actas Dermosi¡liogr., 67, 673, 1976. 56. Druzhinina, I.S. et al., An unknown Hypocreaceae species isolated from human lung tissue of a patient with non-fatal pulmonary �brosis, Clin. Microbiol. Newslett., 29, 180, 2007. 57. Tang, P. et al., Allergic fungal sinusitis associated with Trichoderma longibrachiatum, J. Clin. Microbiol., 41, 5333, 2003. 58. Robertson, M.H., Fungi in ¼uids—A hazard of intravenous therapy, J. Med. Microbiol., 3, 99, 1970. 59. Lagrange-Xélot, M. et al., Trichoderma fungaemia in a neutropenic patient with pulmonary cancer and human immunode�ciency virus infection, Clin. Microbiol. Infect., 14, 1190, 2008. 60. Hennequin, C. et al., Otitis externa due to Trichoderma longibrachiatum, Eur. J. Clin. Microbiol. Infect. Dis., 19, 641, 2000. 61. Piens, M.A. et al., Trichoderma infection of cerebrospinal ¼uid shunt device in a non immunocompromised patient, J. Mycol. Med., 14, 49, 2004. 62. Bustamante-Labarta, M.H. et al., Unsuspected embolic fungal endocarditis of an aortic conduit diagnosed by transesophageal echocardiography, J. Am. Soc. Echocardiogr., 13, 953, 2000. 63. Kuhls, K. et al., Molecular reidenti�cation of human pathogenic Trichoderma isolates as Trichoderma longibrachiatum and Trichoderma citrinoviride, Med. Mycol., 37, 25, 1999.
64. Garcia-Effron, G. et al., In vitro activity of terbina�ne against medically important non-dermatophyte species of �lamentous fungi, J. Antimicrob. Chemother., 53, 1086, 2004.
65. Braun, H. et al., Incidence and detection of fungi and eosinophilic granulocytes in chronic rhinosinusitis, Laryngo-RhinoOtol., 82, 330, 2003.
66. Buzina, W. et al., Biodiversity of fungi in nasal mucus. In: IUMS—The World of Microbes, Xth International Congress of Mycology, Abstracts, p 79. EDK Medical and Scienti�c International Publisher, Paris, U.K., 2002.
67. Kredics, L. et al., Emergence of the �lamentous fungal opportunist Trichoderma longibrachiatum in Hungary, Acta Microbiol. Immunol. Hung., 53, 305, 2006.
68. Hilmiog˘lu-Polat, S. et al., Non-dermatophytic molds as agents of onychomycosis in Izmir, Turkey—A prospective study, Mycopathologia, 160, 125, 2005.
69. Amato, J.G. et al., An AIDS patient with Trichoderma, Rev. Soc. Brasil. Med. Tropic., 35, 269, 2002.
70. Venugopal, P.L. et al., Mycotic keratitis in Madras, Indian J. Pathol. Microbiol., 32, 190, 1989.
71. Colakoglu, G., Airborne fungal spores at the Belgrad forest near the city of Istanbul (Turkey) in the year 2001 and their relation to allergic diseases, J. Bas. Microbiol., 43, 376, 2003.
72. Madsen, A.M. et al., Human exposure to airborne fungi from genera used as biocontrol agents in plant production, Ann. Agric. Environ. Med., 14, 5, 2007.
73. Mobin, M. and Amparo Salmito, M., Fungus microbiota in air conditioners in intensive care units in Teresina, Piauí, Rev. Soc. Bras. Med. Trop., 39, 556, 2006.
74. Hageskal, G. et al., Diversity and signi�cance of mold species in Norwegian drinking water, Appl. Environ. Microbiol., 72, 7586, 2006.
75. Warris, A. et al., Water as a source of �lamentous fungi in a childhood bone marrow transplantation unit. In: Program and Abstracts of the 39th Interscience Conference on Antimicrobial Agents and Chemotherapy (San Francisco), p. 578. American Society for Microbiology, Washington, DC, 1999.
76. Varo, S.D. et al., Isolation of �lamentous fungi from water used in a hemodialysis unit, Rev. Soc. Bras. Med. Trop., 40, 326, 2007.
77. Enríquez-Matas, A. et al., Hypersensitivity pneumonitis caused by Trichoderma viride, Arch. Bronconeumol., 45, 304, 2009.
78. Gravesen, S., Identi�cation and quantitation of indoor airborne microfungi during 12 months from 44 danish homes, Acta Allergol., 27, 337, 1972.
79. Lübeck, M. et al., Identi�cation of Trichoderma strains from building materials by ITS1 ribotyping, UP-PCR �ngerprinting and UP-PCR cross hybridization, FEMS Microbiol. Lett., 185, 129, 2000.
80. Thrane, U. et al., Identi�cation of Trichoderma strains by image analysis of HPLC chromatograms, FEMS Microbiol. Lett., 203, 249, 2001.
81. Ebbehøj, N.E. et al., Building-related symptoms and molds: A two-step intervention study, Indoor Air, 12, 273, 2002.
82. Kildesø, J. et al., Determination of fungal spore release from wet building materials, Indoor Air, 13, 148, 2003.
83. Bullerman, L.B., Biology and healths aspects of molds in foods and the environment, J. Korean Soc. Food Nutr., 22, 359, 1993
84. Bouakline, A. et al., Fungal contamination of food in hematology units, J. Clin. Microbiol., 38, 4272, 2000. 85. Antal, Z. et al., Comparative study of potential virulence factors in human pathogenic and saprophytic Trichoderma longibrachiatum strains, Acta Microbiol. Immunol. Hung., 52, 341, 2005. 86. Hogan, L.H. et al., Virulence factors of medically important fungi, Clin. Microbiol. Rev., 9, 469, 1996. 87. Kredics, L. et al., Production of extracellular proteases by human pathogenic Trichoderma longibrachiatum strains, Acta Microbiol. Immunol. Hung., 51, 283, 2004. 88. Schmoll, M. et al., Gene regulation in the emerging fungal pathogen Trichoderma longibrachiatum during its growth in the presence of bronchial epithelial cells. In: Druzhinina, I.S., Kopchinskiy, A.G., and Kubicek, C.P. (eds.), Proceedings of the 8th European Conference on Fungal Genetics, Book of Abstracts, p. 394. Vienna University of Technology, Vienna, Austria, 2006. 89. Burge, H.A., Fungus allergens, Clin. Rev. Allergy, 3, 319, 1985. 90. Vesper, S.J. et al., Speci�c molds associated with asthma in water-damaged homes, J. Occup. Environ. Med., 48, 852, 2006. 91. Imokawa, S. et al., Two cases of acute eosinophilic pneumonia with precipitating antibody against Trichosporon cutaneum and Trichoderma viride, Nihon Kyobu Shikkan Gakkai Zasshi, 31, 352, 1993. 92. Mouri, M. et al., Case report and review of literature on seasonal distribution and pathogenesis of acute eosinophilic pneumonia in Japan, Nihon Kyobu Shikkan Gakkai Zasshi, 31, 1568, 1993. 93. Larsen, F.O. et al., The indoor microfungus Trichoderma viride potentiates histamine release from human bronchoalveolar cells, APMIS, 104, 673, 1996. 94. Danesh, P. et al., Mycobiota in Portuguese normal and green cork throughout the manufacturing process of stoppers, J. Appl. Microbiol., 82, 689, 1997. 95. Winck, J.C. et al., Cork workers’ occupational asthma: Lack of association with allergic sensitisation to fungi of the work environment, Int. Arch. Occup. Environ. Health, 77, 296, 2004. 96. Jaakkola, M.S. et al., Immunoglobulin G antibodies against indoor dampness-related microbes and adult-onset asthma: A population-based incident case–control study, Clin. Exp. Immunol., 129, 107, 2002. 97. Hyvärinen, A. et al., Comparison of the indoor air quality in mould damaged and reference buildings in a subarctic climate, Cent. Eur. J. Publ. Health, 9, 133, 2001. 98. Allermann, L. et al., In¼ammatory potency of dust from the indoor environment and correlation to content of NAGase and fungi, Toxicol. In Vitro, 20, 1522, 2006. 99. Meyer, H.W. et al., Double blind placebo controlled exposure to molds: Exposure system and clinical results, Indoor Air, 15(S10), 73, 2005. 100. Samuels, G.J. et al., The Hypocrea schweinitzii complex and Trichoderma sect. Longibrachiatum, Stud. Mycol., 41, 1, 1998. 101. Rinaldi, M.G. and Howell, A.W., Antifungal antimicrobics: Laboratory evaluation. In: Wentworth, B. (ed.), Diagnostic Procedures for Mycotic and Parasitic Infections, 7th edn., pp. 325–356. American Public Health Association, Washington, DC, 1988. 102. Etest technical guide 10: Antifungal susceptibility testing of moulds. AB Biodisk, Solna, Sweden, 1999. 103. National Committee for Clinical Laboratory Standards, Reference method for broth dilution antifungal susceptibility testing of conidium forming �lamentous fungi: Proposed standard M38-P. National Committee for Clinical Laboratory Standards, Wayne, PA, 1998.
104. National Committee for Clinical Laboratory Standards, Reference method for broth dilution antifungal susceptibility testing of conidium forming �lamentous fungi: Approved standard M38-A. National Committee for Clinical Laboratory Standards, Wayne, PA, 2002.
105. National Committee for Clinical Laboratory Standards, Reference method for broth dilution antifungal susceptibility testing of yeast: Approved standard M27-A. National Committee for Clinical Laboratory Standards, Wayne, PA, 1997.
106. Pujol, I. et al., Comparison study of broth macrodilution and microdilution antifungal susceptibility tests for the �lamentous fungi, Antimicrob. Agents Chemother., 40, 2106, 1996.
107. Cuenca-Estrella, M. et al., Multicentre determination of quality control strains and quality control ranges for antifungal susceptibility testing of yeasts and �lamentous fungi using the methods of the Antifungal Susceptibility Testing Subcommittee of the European Committee on Antimicrobial Susceptibility Testing (AFST-EUCAST), Clin. Microbiol. Infect., 13, 1018, 2007.
108. Shadomy, S. and Pfaller, M., Laboratory studies with antifungal agents: Susceptibility tests and quantitation in body ¼uids. In: Balows, A. et al. (eds.), Manual of Clinical Microbiology, 5th edn., pp. 1173–1183. American Society for Microbiology, Washington, DC, 1991.
109. Drouhet, E. et al., Disc agar diffusion and microplate automatized technics for in vitro evaluation of antifungal agents on yeasts and sporulated pathogenic fungi. In: Iwata, K. and Vanden Bossche, H. (eds.), In Vitro and In Vivo Evaluation of Antifungal Agents, pp. 31–49. Elsevier Science Press, Paris, France, 1986.
110. Espinel-Ingroff, A., Comparison of the Etest with the NCCLS M38-P method for antifungal susceptibility testing of common and emerging pathogenic �lamentous fungi, J. Clin. Microbiol., 39, 1360, 2001.
111. Antal, Z. et al., The physiological features of opportunistic Trichoderma strains, Acta Microbiol. Immunol. Hung., 49, 393, 2002.
112. Marco, F. et al., Antifungal activity of a new triazole, voriconazole (UK-109,496), compared with three other antifungal agents tested against clinical isolates of �lamentous fungi, Med. Mycol., 36, 433, 1998.
113. Kratzer, C. et al., In vitro activity and synergism of amphotericin B, azoles and cationic antimicrobials against the emerging pathogen Trichoderma spp., J. Antimicrob. Chemother., 58, 1058, 2006.
114. Espinel-Ingroff, A., In vitro fungicidal activities of voriconazole, itraconazole, and amphotericin B against opportunistic moniliaceous and dematiaceous fungi, J. Clin. Microbiol., 39, 954, 2001.
115. Espinel-Ingroff, A. et al., Optimal testing conditions for determining MICs and minimum fungicidal concentrations of new and established antifungal agents for uncommon molds: NCCLS collaborative study, J. Clin. Microbiol., 40, 3776, 2002.
116. Marco, F. et al., In vitro activity of a new triazole antifungal agent, Sch 56592, against clinical isolates of �lamentous fungi, Mycopathologia, 141, 73, 1998.
117. Pfaller, M. et al., In vitro activity of two echinocandin derivatives, LY303366 and MK-0991 (L-743,792), against clinical isolates of Aspergillus, Fusarium, Rhizopus, and other �lamentous fungi, Diagn. Microbiol. Infect. Dis., 30, 251, 1998. 118. Kahn, J.N. et al., Caspofungin susceptibility in Aspergillus and non-Aspergillus molds: Inhibition of glucan synthase and reduction of β-d-1,3 glucan levels in culture, Antimicrob. Agents Chemother., 50, 2214, 2006. 119. Dóczi, I. et al., Etest for assessing the susceptibility of �lamentous fungi, Acta Microbiol. Immunol. Hung., 51, 271, 2004. 120. Lionakis, M.S. et al., The signi�cance of blood cultures positive for emerging saprophytic moulds in cancer patients, Clin. Microbiol. Infect., 10, 922, 2004. 121. Ascioglu, S. et al., De�ning opportunistic invasive fungal infections in immunocompromised patients with cancer and hematopoietic stem cell transplants: An international consensus, Clin. Infect. Dis., 34, 7, 2002. 122. Summerbell, R.C., Ascomycetes: Aspergillus, Fusarium, Sporothrix, Piedra, and relatives. In: Howard, D.H. (ed.), Pathogenic Fungi in Humans and Animals, pp. 437–449. Marcel Dekker Inc., New York, 2003. 123. Gams, W. and Bissett, J., Morphology and identi�cation of Trichoderma. In: Kubicek, C.P. and Harman, G.E. (eds.), Trichoderma and Gliocladium. Volume 1. Basic Biology, Taxonomy and Genetics, pp. 3–34. Taylor & Francis, London, U.K., 1998. 124. Kredics, L. et al., Genetic variability and antifungal susceptibilities of clinical Trichoderma isolates. In: Trends in Medical Mycology, pp. 133–136. Monduzzi Editore, Bologna, Italy, 2003. 125. Szekeres, A. et al., Rapid identi�cation of clinical Trichoderma longibrachiatum isolates by cellulose-acetate electrophoresis mediated isoenzyme analysis, Clin. Microbiol. Infect., 12, 369, 2006. 126. Turner, D. et al., Biogeography and phenotype variation in Trichoderma sect. Longibrachiatum and associated Hypocrea species, Mycol. Res., 101, 449, 1997. 127. Kuhls, K. et al., Revision of Trichoderma section Longibrachiatum including related teleomorphs based on analysis of ribosomal DNA internal transcribed spacer sequences, Mycologia, 89, 442, 1995. 128. Lieckfeldt, E. et al., Neotypi�cation of Trichoderma koningii and its Hypocrea koningii teleomorph, Can. J. Bot., 76, 1519, 1998. 129. Lieckfeldt, E. et al., A morphological and molecular perspective of Trichoderma viride: Is it one or two species? Appl. Environ. Microbiol., 65, 2418, 1999. 130. Hebert, P.D.N. and Beaton, M.J., Methodologies for Allozyme Analysis Using Cellulose Acetate Electrophoresis. A Practical Handbook. Helena Laboratories, Beaumont, TX, 1993. 131. Antal, Z. et al., Intraspeci�c mitochondrial DNA polymorphism within the emerging �lamentous fungal pathogen Trichoderma longibrachiatum, J. Med. Microbiol., 55, 31, 2006. 132. Druzhinina, I.S. et al., Alternative reproductive strategies of Hypocrea orientalis and genetically close but clonal Trichoderma longibrachiatum, both capable to cause invasive mycoses of humans, Microbiol-SGM, 154, 3447, 2008. 133. Gruber, F. et al., The development of a heterologous transformation system for the cellulolytic fungus Trichoderma reesei based on a pyrG-negative mutant strain, Curr. Genet., 18, 71, 1990. 134. Leach, J. et al., Rapid miniprep of DNA from �lamentous fungi, Fungal Genet. Newslett., 33, 32, 1986. 135. Varga, J. et al., Restriction fragment length polymorphisms in the mitochondrial DNAs of the Aspergillus niger aggregate, Mycol. Res., 97, 1207, 1993. 136. Kuhls, K. et al., PCR-�ngerprinting used for comparison of ex type strains of Trichoderma species deposited in different culture collections, Microbiol. Res., 150, 363, 1995.
137. White, T.J. et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.S. and Gelfand, D.H. (eds.), PCR Protocols: A Guide to Methods and Applications. pp. 315–322. Academic Press, New York, 1990.
138. Hermosa, M.R. et al., Molecular characterization and identi�cation of biocontrol isolates of Trichoderma spp., Appl. Environ. Microbiol., 66, 1890, 2000.
139. Tamura, M. et al., Molecular characterization of new clinical isolates of Candida albicans and C. dubliniensis in Japan: Analysis reveals a new genotype of C. albicans with Group I intron, J. Clin. Microbiol., 39, 4309, 2001. 140. Carbone, I. and Kohn, L.M., A method for designing primer sets for speciation studies in �lamentous ascomycetes, Mycologia, 91, 553, 1999. 141. Jaklitsch, W.M. et al., Hypocrea voglmayrii sp. nov. from the Austrian Alps represents a new phylogenetic clade in Hypocrea/Trichoderma, Mycologia, 97, 1391, 2005. 142. Samuels, G.J. et al., Trichoderma theobromicola and T. paucisporum: Two new species isolated from cacao in South America, Mycol. Res., 110, 381, 2006. 143. Altschul, S.F. et al., Basic local alignment search tool, J. Mol. Biol., 215, 403, 1990. 63 Chapter 63 - Verticillium
1. Gams, W. and Zare, R., A revision of Verticillium sect. Prostrata. III. Generic classi�cation, Nova Hedwigia, 72, 329, 2001.
2. Zare, R., Gams, W., and Culham, A., A revision of Verticillium sect. Prostrata. I. Phylogenetic studies using ITS sequences, Nova Hedwigia, 71, 465, 2000. 3. Zare, R. and Gams, W., A revision of Verticillium section Prostrata. IV. The genera Lecanicillium and Simplicillium gen. nov., Nova Hedwigia, 73, 1, 2001. 4. Zare, R. and Gams, W., A revision of Verticillium section Prostrata. VI. The genus Haptocillium, Nova Hedwigia, 73, 271, 2001. 5. Zare, R., Gams, W., and Evans, H.C., A revision of Verticillium section Prostrata. V. The genus Pochonia, with notes on Rotiferophthora, Nova Hedwigia, 73, 51, 2001. 6. Sung, G. H. et al., A revision of Verticillium sect. Prostrata. II. Phylogenetic analyses of SSU and LSU nuclear rDNA sequences from anamorphs and teleomorphs of the Clavicipitaceae, Nova Hedwigia, 72, 311, 2001. 7. Zare, R. and Gams, W., A monograph of Verticillium section Prostrata, Rostaniha, 3(Suppl.), 1, 2004. 8. Fahleson, J., Hu, Q., and Dixelius, C., Phylogenetic analysis of Verticillium species based on nuclear and mitochondrial sequences, Arch. Microbiol., 181, 435, 2004. 9. Pantou, M.P. et al., Molecular and immunochemical phylogeny of Verticillium species, Mycol. Res., 109, 889, 2005. 10. Zare, R., Gams, W., and Schroers, H.J., The type species of Verticillium is not congeneric with the plant-pathogenic species placed in Verticillium and it is not the anamorph of ‘Nectria’ inventa, Mycol. Res., 108, 576, 2004. 11. Zare, R. et al., Gibellulopsis, a suitable genus for Verticillium nigrescens, and Musicillium, a new genus for V. theobromae, Nova Hedwigia, 85, 463, 2007. 12. Yokoyama, E., Yamagishi, K., and Hara, A., Development of a PCR-based mating-type assay for Clavicipitaceae, FEMS Microbiol. Lett., 237, 205, 2004. 13. Zare, R. and Gams, W., A revision of the Verticillium fungicola species complex and its af�nity with the genus Lecanicillium, Mycol. Res., 112, 811, 2008. 14. Perry, J.W. and Evert, R.F., Structure of microsclerotia of Verticillium dahliae in roots of ‘Russett Burbank’ potatoes, Can. J. Bot., 62, 396, 1982. 15. Karapapa, V.K., Bainbridge, B.W., and Heale, J.B., Morphological and molecular characterization of Verticillium longisporum comb. nov., pathogenic to oilseed rape, Mycol. Res., 101, 1281, 1997. 16. Collins, A. et al., Isolates of Verticillium dahliae pathogenic to crucifers are of at least three distinct molecular types, Phytopathology, 93, 364, 2003. 17. Goud, J.-K.C., Termorshuizen, A.J., and Gams, W., Morphology of Verticillium dahliae and V. tricorpus on semi-selective media used for the detection of V. dahliae in soil, Mycol. Res., 107, 822, 2003. 18. Bell, A.A. and Wheeler, M.H., Biosynthesis and function of fungal melanins, Annu. Rev. Phytopathol., 24, 411, 1986. 19. Jiménez-Díaz, R.M. and Millar, R.L., Sporulation on infected tissues and presence of airborne Verticillium alboatrum in alfalfa �elds in New York, Plant Pathol., 37, 64, 1988. 20. Clarkson, J.M. and Charnley, A.K., New insights into the mechanisms of fungal pathogenesis in insects, Trends Microbiol., 4, 197, 1996. 21. Lisansky, S., Robinson, A., and Coombs, J., Green Growers’ Guide, CPL Scienti�c Press, Newbury, U.K., 1991. 22. Kerry, B.R. et al., Growth and survival of Verticillium chlamydosporium goddard, a parasite of nematodes, in soil, Biocontrol. Sci. Technol., 3, 355, 1993. 23. Davies, R.R. and Isaak, I., Dissemination of Verticillium alboatrum through the atmosphere, Nature (London), 181, 649, 1958.
24. Kwaasi, A.A.A. et al., Aeroallergens and viable microbes in sandstorm dust. Potential triggers of allergic and nonallergic respiratory ailments, Allergy, 53, 255, 1998.
25. Lindemann, J., Arny, D.C., and Delwiche, P.A., Detection of Verticillium albo-atrum in the air over infected alfalfa �elds in Wisconsin, Phytopathology, 72, 1382, 1982.
26. Hryhorczuk, D. et al., Bioaerosol emissions from a suburban yard waste composting facility, Ann. Agric. Environ. Med., 8, 177, 2001.
27. Solomon, W.R., A volumetric study of winter fungus prevalence in the air of midwestern homes, J. Allergy Clin. Immun., 57, 46, 1976.
28. Lacey, J., Exposure of farm workers to fungi and Actinomycetes while harvesting cereal crops and handling stored grain, Eur. J. Respir. Dis., 154, 37, 1987.
29. Douwes, J. et al., Bioaerosols health effects and exposure assessment: Progress and prospects, Ann. Occup. Hyg., 47, 187, 2003.
30. Hastie, A.C., The parasexual cycle in Verticillium albo-atrum, Genet. Res., 5, 305, 1964.
31. Hastie, A.C., Mitotic recombination in conidiophores of Verticillium albo-atrum, Nature, 214, 249, 1967.
32. Typas, M.A. and Heale, J.B., Heterozygous diploid analyses via the parasexual cycle and a cytoplasmic pattern of inheritance in Verticillium species, Genet. Res., 31, 131, 1978.
33. Typas, M.A., Heterokaryon incompatibility and interspeci�c hybridization between Verticillium albo-atrum and Verticillium dahliae following protoplast fusion and microinjection, J. Gen. Microbiol., 129, 3043, 1983.
34. Koike, S.T. et al., Verticillium wilts of cauli¼ower in California, Plant Dis., 78, 116, 1994.
35. Butt, T.M., Jackson, C.W., and Magan, N., Introduction-fungal biological control agents: Progress, problems and potential, in Fungi as Biocontrol Agents, pp. 1–8, Butt, T.M., Jackson, C.W. and Magan, N. (Eds.), CABI Publishing, Walingford, CT, 2001.
36. Pantou, M.P. and Typas, M.A., Electrophoretic karyotype and gene mapping of the vascular wilt fungus Verticillium dahliae, FEMS Microbiol. Lett., 254, 213, 2005.
37. Kouvelis, V.N., Ghikas, D.V., and Typas, M.A., The analysis of the complete mitochondrial genome of the entomopathogenic fungus Lecanicillium muscarium (syn. Verticillium lecanii) suggests a minimum common gene organization in mtDNAs of Sordariomycetes: Phylogenetic implications, Fungal Genet. Biol., 41, 930, 2004.
38. Pantou, M.P., Kouvelis, V.N., and Typas, M.A., The complete mitochondrial genome of the vascular wilt fungus Verticillium dahliae: A novel gene order for Verticillium and a diagnostic tool for species identi�cation, Curr. Genet., 50, 125, 2006.
39. Zolan, M.E., Chromosome-length polymorphism in fungi, Microbiol. Rev., 59, 686, 1995.
40. Hatta, R. et al., A conditionally dispensable chromosome controls host-speci�c pathogenicity in the fungal plant pathogen Alternaria alternata, Genetics, 161, 59, 2002.
41. Wildfeuer, A. et al., In vitro evaluation of voriconazole against clinical isolates of yeasts, moulds and dermatophytes in comparison with itraconazole, ketoconazole, amphotericin B and griseofulvin, Mycoses, 41, 309, 1998.
42. Das, D.K. et al., Fine needle aspiration cytology diagnosis of a fungal lesion of the Verticillium species. A case report, Acta Cytol., 41, 577, 1997.
43. Amici, G. et al., Verticillium peritonitis in a patient on peritoneal dialysis, Am. J. Nephrol., 14, 216, 1994. 44. Shin, J.Y., Kim, H.M., and Hong, J.W., Keratitis caused by Verticillium species, Cornea, 21, 240, 2002. 45. Bashir, G. et al., Fungemia caused by Verticillium species in an immunocompromised child, Indian J. Med. Microbiol., 24, 65, 2006. 46. Wu, C.-J. et al., Verticillium infection—A rare cause of hepatosplenic abscesses, Diagn. Microbial. Infect. Dis., 62, 427, 2008. 47. Nehemy, M.B. et al., Chronic endophthalmitis due to Verticillium species after cataract surgery treated (or managed) with pars plana vitrectomy and oral and intravitreal voriconazole, Retina, 26, 225, 2006. 48. Vasconcelos-Santos, D.V. and Nehemy, M.B., Use of voriconazole in the surgical management of chronic postoperative fungal endophthalmitis, Ophthalmic Surg. Laser Imaging, 40, 425, 2009. 49. Monod, M. et al., Fast and reliable PCR/sequencing/RFLP assay for identi�cation of fungi in onychomycoses, J. Med. Microbiol., 55, 1211, 2006. 50. Anttila, V.J. et al., Hepatosplenic candidiasis in patients with acute leukemia: Incidence and prognostic implications, Clin. Infect. Dis., 24, 375, 1997. 51. Carder, J.H. and Barbara, D.J., Molecular variation and restriction length polymorphisms (RFLPs) within and between six species of Verticillium, Mycol. Res., 95, 935, 1991. 52. Okoli, C.A.N., Carder, J.H., and Barbara, D.J., Restriction fragment length polymorphisms (RFLPs) and the relationships of some host-adapted isolates of Verticillium dahliae, Plant Pathol., 43, 33, 1994. 53. Li, K.-N., Rouse, D.I., and German, T.L., PCR primers that allow intergeneric differentiation of Ascomycetes and their application to Verticillium spp., Appl. Environ. Microbiol., 60, 4324, 1994. 54. Mitina, G.V., Mikhailova, L.A., and Yli-Mattila, T., RAPD-PCR, UP-PCR and rDNA sequence analyses of the entomopathogenic fungus Verticillium lecanii and its pathogenicity towards insects and phytopathogenic fungi, Arch. Phytopathol. P°., 41, 113, 2008. 55. Zeise, K. and von Tiedemann, A., Application of RAPD-PCR for virulence type analysis within Verticillium dahliae and V. longisporum, J. Phytopathol., 150, 557, 2002. 56. Fahleson, J. et al., Estimation of genetic variation among Verticillium isolates using AFLP analysis, Eur. J. Plant Pathol., 109, 361, 2003. 57. Collado-Romero, M. et al., Phylogenetic analysis of Verticillium dahliae vegetative compatibility groups, Phytopathology, 98, 1019, 2008. 58. Lievens, B. et al., Design and development of a DNA array for rapid detection and identi�cation of multiple tomato vascular wilt pathogens, FEMS Microbiol. Lett., 223, 113, 2003. 59. Pramateftaki, P.V., Antoniou, P.P., and Typas, M.A., The complete DNA sequence of the nuclear ribosomal RNA gene complex of Verticillium dahliae: Intraspeci�c heterogeneity within the intergenic spacer region, Fungal Genet. Biol., 29, 19, 2000. 60. Karapapa, V.K. and Typas, M.A., Molecular characterization of the host-adapted pathogen Verticillium longisporum on the basis of a group-I intron found in the nuclear SSU-rRNA gene, Curr. Microbiol., 42, 217, 2001. 61. Qin, Q.-M. et al., Phylogenetic analyses of phytopathogenic isolates of Verticillium spp., Phytopathology, 96, 582, 2006. 62. Nilsson, R.H. et al., Intraspeci�c ITS variability in the kingdom of fungi as expressed in the international sequence databases and its implications for molecular species identi�cation, Evol. Bioinform., 4, 193, 2008.
63. Seifert, K.A., Progress towards DNA barcoding of fungi, Mol. Ecol. Resour., 9, 83, 2009.
64. Carder, J.H. and Barbara, D.J., Taxonomic status of putative Verticillium albo-atrum isolates, FEMS Microbiol. Lett., 170, 211, 1999.
65. Seifert, K.A. et al., Prospects for fungus identi�cation using CO1 DNA barcodes, with Penicillium as a test case, Proc. Natl. Acad. Sci. U.S.A., 104, 3901, 2007.
66. Gayoso, C. et al., Assessment of real-time PCR as a method for determining the presence of Verticillium dahliae in different Solanaceae cultivars, Eur. J. Plant Pathol., 118, 199, 2007. 67. Larsen, R.C. et al., Development of a real-time polymerase chain reaction assay for quantifying Verticillium albo-atrum DNA in resistant and susceptible alfalfa, Phytopathology, 97, 1519, 2007. 68. Fredricks, D.N., Smith, C., and Meier, A., Comparison of six DNA extraction methods for recovery of fungal DNA as assessed by quantitative PCR, J. Clin. Microbiol., 43, 5122, 2005. 69. Kouvelis, V.N., Sialakouma, A., and Typas, M.A., Mitochondrial gene sequences alone or combined with ITS region sequences provide �rm molecular criteria for the classi�cation of Lecanicillium species, Mycol. Res., 112, 829, 2008.
Saccharomycotina and Taphrinomycotina 64 Chapter 64 - Candida
20. Rustchenko, E.P., Curran, T.M., and Sherman, F., Variations in the number of ribosomal DNA units in morphological mutants and normal strains of C. albicans and S. Cerevisiae. J. Bacteriol., 175, 7189, 1993.
21. Jackson, A.P. et al., Comparative genomics of the fungal pathogens Candida dubliniensis and C. albicans. Genome Res., 19, 2231, Epub ahead of print, 2009.
22. Hajjeh, R.A. et al., Incidence of bloodstream infections due to Candida species and in vitro susceptibilities of isolates c ollected from 1998 to 2000 in a population-based active surveillance program. J. Clin Microbiol., 42, 1519, 2004.
23. Kao, A.S. et al., The epidemiology of candidemia in two United States cities: Results of a population-based active surveillance. Clin. Infect. Dis., 29, 1164, 1999.
24. Lass-Florl, C., The changing face of epidemiology of invasive fungal disease in Europe. Mycoses, 52, 197, 2009.
25. Horn, D.L. et al., Epidemiology and outcomes of candidaemia in 2019 patients: Data from the Prospective Antifungal Therapy Alliance Registry. Clin. Infect. Dis., 48, 1695, 2009.
26. Hachem, R. et al., The Changing epidemiology of invasive candidiasis. Candida glabrata and Candida krusei as the leading causes of candidaemia in Hematologic Malignancy. Cancer, 112, 2493, 2008.
27. Hope, W., Morton, A., and Eisen, D.P., Increase in prevalence of nosocimial non-Candida albicans candidaemia and the association of Candida krusei with ¼uconazole use. J. Hosp. Infect., 50, 56, 2002.
28. Magill, S.S. et al., The epidemiology of Candida colonisation in a surgical intensive care unit where ¼uconazole prophylaxis is utilised. Ann. Surg., 249, 657, 2009.
29. Tortorano, A.M. et al., Candidaemia in Europe: Epidemiology and resistance. Int. J. Antimicrob. Agents, 27, 359, 2006.
30. Richardson, M.D. and Warnock, D.W., Fungal Infections: Diagnosis and Management, 3rd edn., Blackwell Science Ltd. Oxford, London, U.K., 2003.
31. Odds, F.C., Gow, N.A.R., and Brown, A.J.P., Toward a molecular understanding of Candida albicans virulence, in Molecular Principles of Fungal Pathogenesis, Chap. 2, Heitman, J., Filler, S.G., Edwards, J.E., and Mitchell, A.P. (Eds.), ASM Press, Washington, DC, 2006.
32. Butler, G. et al., Evolution of pathogenicity and sexual reproduction in eight Candida genomes. Nature, 459, 657, 2009.
33. Lima Neto, R.G. et al., Adherence of Candila albicans Candida parapsilosis to epithelial cells correlates with fungal cell surface carbohydrates. Mycoses, 54, 23, 2011.
34. Castano, I., Des Las Penas, A., and Cormack, B.P., Molecular basis of fungal adherence to endothelial and epithelial cells, in Molecular Principles of Fungal Pathogenesis, Chap. 13, Heitman, J., Filler, S.G., Edwards, J.E., and Mitchell, A.P. (Eds.), ASM Press, Washington, DC, 2006.
35. Hong Nguyen, M., Cheng, S., and Clancy, C.J., Assessment of Candida albicans genes expressed during infection as a tool to understand pathogenesis. Med. Mycol., 42, 293, 2004.
36. Lerman, U. and Morshhauser, J., Secreted aspartic proteases are not required for invasion of reconstituted human epithelia by Candida albicans. Microbiology, 154, 3281, 2008.
37. Schindler, B. and Segal, E., Candida albicans metabolite affects the cytoskeleton and phagocytic activity of murine macrophages. Med. Mycol., 46, 251, 2008.
38. Sundstrom, P., Candida albicans hyphal formation and virulence, in Molecular Principles of Fungal Pathogenesis, Chap. 4, Heitman, J., Filler, S.G., Edwards, J.E., and Mitchell, A.P. (Eds.), ASM Press, Washington, DC, 2006. 39. Netea, M.G. et al., Immune sensing of Candida albicans requires cooperative recognition of mannans and glucans by lectin and toll-like receptors. J. Clin. Invest., 116, 1642, 2006. 40. Romani, L. and Puccetti, P., Controlling pathogenic in¼ammation to fungi. Expert Rev. Anti-Infect. Ther., 5, 1007, 2007. 41. Denning, D.W., Kibbler, C.C., and Barnes, R.A., British Society for Medical Mycology proposed standards of care for patients with invasive fungal infections. Lancet Infect. Dis., 3, 230, 2003. 42. Campbell, C.K. et al., Comparison of the API Candida system with the AUXACOLOR system for identi�cation of common yeast pathogens. J. Clin. Microbiol., 37, 821, 1999. 43. Cooke, V.M. et al., New chromogenic agar medium for the identi�cation of Candida spp. Appl. Environ. Microbiol., 68, 3622, 2002. 44. Barnes, R.A. and Vale, L., Spiking as a rapid method for differentiation of Candida albicans from other yeasts species. J. Hosp. Infect., 60, 78, 2005. 45. Rimek, D., Fehse, B., and Gopel, P., Evaluation of Mueller Hinton Agar as a simple medium for the germ tube production of Candida albicans and Candida dubliniensis. Mycoses, 51, 205, 2007. 46. Sendid, B. et al., New Immunoassays for sensitive detection of circulating Candida albicans mannan and antimannan antibodies: Useful combined test for diagnosis of systemic candidiasis. J. Clin. Microbiol., 37, 1510, 1999. 47. White, P.L., Archer, A.E., and Barnes, R.A., Comparison of non-culture based methods for detection of systemic fungal infections, with an emphasis on invasive Candida infections. J. Clin. Microbiol., 43, 2181, 2005. 48. Sendid, B. et al., Combined detection of mannanaemia and anti-mannan antibodies as a strategy for the diagnosis of systemic infection caused by pathogenic Candida species. J. Med. Microbiol., 51, 433, 2002. 49. Alam, F.F., Mustafa, A.S., and Khan, Z.U., Comparative evaluation of (1,3)-β-d-glucan, mannan and anti-mannan antibodies and Candida species speci�c snPCR in patients with candidemia. BMC Infect. Dis., 7, 103, 2007. 50. Kedzierska, A. et al., Current status of fungal cell wall components in the immunodiagnostics of invasive fungal infections in humans: Galactomannan, mannan and (1–3)-β-d-Glucan. Eur. J. Clin. Microbiol. Infect. Dis., 26, 755, 2007. 51. De Pauw, B. et al., Revised de�nitions of invasive fungal disease from the European Organization for Research and Treatment of Cancer/Invasive Fungal Infections Cooperative Group and the National Institute of Allergy and Infectious Diseases Mycoses Study Group (EORTC/MSG) Consensus Group. Clin. Infect. Dis., 46, 1813, 2008. 52. Voss, A. et al., Investigation of the sequence of colonization and candidemia in nonneutropenic patients. J. Clin. Microbiol., 32, 975, 1994. 53. Pittet, D. et al., Candida colonization and subsequent infections in critically ill surgical patients. Ann. Surg., 220, 751, 1994. 54. Leon, C. et al., A bedside scoring system (“Candida score”) for early antifungal treatment in nonneutropenic critically ill patients with Candida colonization. Crit. Care Med., 34, 730, 2006. 55. Faiz, S. et al., Risk-based ¼uconazole prophylaxis of Candida bloodstream infection in a medical intensive care unit. Eur. J. Clin. Microbiol. Infect. Dis., 28, 689, 2009. 56. Maarou�, Y. et al., Rapid detection of Candida albicans in clinical blood samples by using a TaqMan-based PCR assay. J. Clin. Microbiol., 41, 3293, 2003.
57. McMullan, R. et al., A prospective clinical trial of a real-time polymerase chain reaction assay for the diagnosis of candidemia in nonneutropenic, critically ill adults. Clin. Infect. Dis., 46, 890, 2008.
58. Lau, A. et al., Multiplex tandem PCR: A novel platform for rapid detection and identi�cation of fungal pathogens from blood culture specimens. J. Clin. Microbiol., 46, 3021, 2008.
59. Wellinghausen, N. et al., Rapid diagnosis of candidaemia by real-time PCR detection of Candida DNA in blood samples. J. Med. Microbiol., 58, 1106, 2009.
60. Schabereiter-Gurtner, C. et al., Development of novel realtime PCR assays for detection and differentiation of eleven medically important Aspergillus and Candida species in clinical specimens. J. Clin. Microbiol., 45, 906, 2007.
61. Vollmer, T. et al., Evaluation of novel broad-range real-time PCR assay for rapid detection of human pathogenic fungi in various clinical specimens. J. Clin. Microbiol., 46, 1919, 2008.
62. Hendolin, P.H. et al., Panfungal PCR and multiplex liquid hybridization for detection of fungi in tissue specimens. J. Clin. Microbiol., 38, 4186, 2000.
63. Lau, A. et al., Development and clinical application of a panfungal PCR assay to detect and identify fungal DNA in tissue specimens. J. Clin. Microbiol., 45, 380, 2007.
64. Bagyalakshmi, R., Madhavan, H.N., and Therese, K.L., Development and application of multiplex polymerase chain reaction for the etiological diagnosis of infectious endophthalmitis. J. Postgrad. Med., 52, 179, 2006.
65. Arancia, S. et al., Construction and use of PCR primers from a 70 kDa heat shock protein gene for identi�cation of Candida albicans. Mol. Cell Probes, 11, 329, 1997.
66. Ebihara, M. et al., Molecular detection of dermatophytes and nondermatophytes in onychomycosis by nested polymerase chain reaction based on 28S ribosomal RNA gene sequences. Br. J. Dermatol., 161, 1038, 2009. 67. Borman, A.M. et al., Pyrosequencing analysis of 20 nucleotides of internal transcribed spacer 2 discriminates Candida parapsilosis, Candida metapsilosis, and Candida orthopsilosis. J. Clin. Microbiol., 47, 2307, 2009.
68. Carvalho, A. et al., Multiplex PCR identi�cation of eight clinically relevant Candida species. Med. Mycol., 45, 619, 2007.
69. Sakai, T. et al., Rapid, sensitive and simple detection of Candida deep mycosis by ampli�cation of 18S ribosomal RNA gene; comparison with assay of serum beta-d-glucan level in clinical samples. Tohoku J. Exp. Med., 190, 119, 2000.
70. Ahmad, S. et al., Seminested PCR for diagnosis of candidemia: Comparison with culture, antigen detection, and biochemical methods for species identi�cation. J. Clin. Microbiol., 40, 2483, 2002.
71. Einsele, H. et al., Detection and identi�cation of fungal pathogens in blood by using molecular probes. J. Clin. Microbiol., 35, 1353, 1997.
72. Van Burik, J. et al., Panfungal PCR assay for detection of fungal infection in human blood specimens. J. Clin. Microbiol., 36, 1169, 1998.
73. Löf¼er, J. et al., Detection of PCR-ampli�ed fungal DNA by using a PCR-ELISA system. Med. Mycol., 36, 275, 1998.
74. Badiee, P. et al., Early detection of systemic candidiasis in the whole blood of patients with hematologic malignancies. Jpn. J. Infect. Dis., 62, 1, 2009.
75. Skovbjerg, S. et al., Optimization of the detection of microbes in blood from immunocompromised patients with haematological malignancies. Clin. Microbiol. Infect., 15, 680, 2009. 76. Chen, Y.C. et al., Identi�cation of medically important yeasts using PCR-based detection of DNA sequence polymorphisms in the internal transcribed spacer 2 region of the rRNA genes. J. Clin. Microbiol., 38, 2302, 2000. 77. Spiess, B. et al., DNA microarray-based detection and identi�cation of fungal pathogens in clinical samples from neutropenic patients. J. Clin. Microbiol., 45, 3743, 2007. 78. Palka-Santini, M. et al., Large scale multiplex PCR improves pathogen detection by DNA microarrays. BMC Microbiol., 3, 1, 2009. 79. Landlinger, C. et al., Species-speci�c identi�cation of a wide range of clinically relevant fungal pathogens by use of Luminex xMAP technology. J. Clin. Microbiol., 47, 1063, 2009. 80. Leake, J.L. et al., Identi�cation of yeast in chronic wounds using new pathogen-detection technologies. J. Wound Care, 18, 103, 2009. 81. Bleve, G. et al., Development of reverse transcription (RT)PCR and real-time RT-PCR assays for rapid detection and quanti�cation of viable yeasts and molds contaminating yogurts and pasteurized food products. Appl. Environ. Microbiol., 69, 4116, 2003. 82. Widjojoatmodjo, M.N. et al., Nucleic acid sequence-based ampli�cation (NASBA) detection of medically important Candida species. J. Microbiol. Methods, 38, 81, 1999. 83. Hierro, N. et al., Real-time quantitative PCR (QPCR) and reverse transcription-QPCR for detection and enumeration of total yeasts in wine. Appl. Environ. Microbiol., 72, 7148, 2006. 84. Löf¼er, J. et al., Comparison of different methods for extraction of DNA of fungal pathogens from cultures and blood. J. Clin. Microbiol., 35, 3311, 1997. 85. Morrissey, C.O. et al., Use of PCR on the combination of serum and whole blood specimens for the earlier diagnosis of invasive aspergillosis in haematology patients. Abstract M1721. ICAAC Washington, DC, 2008. 86. White, P.L., Shetty, A., and Barnes, R.A., Detection of seven Candida species using the Light-Cycler system. J. Med. Microbiol., 52, 229, 2003. 87. White, P.L. et al., Detection of Candida in concentrated oral rinse cultures by real-time PCR. J. Clin. Microbiol., 42, 2101, 2004. 88. Loef¼er, J. et al., Quanti�cation of fungal DNA by using ¼uorescence resonance energy transfer and the light cycler system. J. Clin. Microbiol., 38, 586, 2000. 89. Guiver, M., Levi, K., and Oppenheim, B.A., Rapid identi�cation of Candida species by TaqMan PCR. J. Clin. Pathol., 54, 362, 2001. 90. Stanley, K.K. and Szewczuk, E., Multiplexed tandem PCR: Gene pro�ling from small amounts of RNA using SYBR Green detection. Nucleic Acids Res., 33, e180, 2005. 91. Sandven, P. et al., Candidaemia in Norway, 1991 to 2003: Results from a nationwide study. J. Clin. Microbiol., 44, 1977, 2006. 92. Diekema, D.J. et al., Epidemiology of candidaemia: 3 year results from the emerging infections and the epidemiology of Iowa organisms study. J. Clin. Microbiol., 40, 1298, 2002. 93. Asmundsdottir, L.R., Erlendsdottir, H., and Gottfredsson, M., Increasing incidence of candidaemia: Results from 20 year study in Iceland. J. Clin. Microbiol., 40, 3489, 2002. 94. Asmundsdottir, L.R. et al., Molecular epidemiology of candidaemia: Evidence of clusters of smoldering nosocomial infections. Clin. Infect. Dis., 47, e17, 2008. 95. Poikonen, E. et al., Candidaemia in Finland, 1995–1999. Emerg. Infect. Dis., 9, 985, 2003.
96. Laupland, K.B. et al., Invasive Candida species infections: A 5 year population based assessment. J. Antimicrob. Chemother., 56, 532, 2005.
97. Almirante, B. et al., Epidemiology and predictors of mortality in cases of Candida bloodstream infection: Results from population based surveillance, Barcelona, Spain, from 2002 to 2003. J. Clin. Microbiol., 43, 1829, 2005.
98. Arendrup, M.C. et al., Seminational surveillance of fungemia in Denmark: Notably high rates of fungemia and number of isolates with reduced azole susceptibility. J. Clin. Microbiol., 43, 4434, 2005.
99. Arendrup, M.C. et al., Seminational surveillance of fungemia in Denmark 2004–2006: Increasing incidence of fungaemia and number of isolates with reduced azole susceptibility. Clin. Microbiol. Infect., 14, 487, 2008.
100. HCAI, CDR Weekley, 16, 42, 2006.
101. Odds, F.C. et al., One year prospective study of Candida bloodstream infections in Scotland. J. Med. Microbiol., 56, 1066, 2007.
102. Surveillance of Healthcare associated infections report. Health Protection Agency, U.K., 2007.
103. Pfaller, M.A. et al., In vitro susceptibilities of Candida spp. to caspofungin: Four years of global surveillance. J. Clin. Microbiol., 44, 760, 2006.
104. Lamagni, T.L. et al., Emerging trends in the epidemiology of invasive mycoses in England and Wales. Epidemiol. Infect., 126, 397, 2001.
105. Leroy, O. et al., Epidemiology, management and risk factors for death of invasive Candida infections in critical care: A multicentre, prospective, observational study in France (2005–2006). Crit. Care Med., 37, 1612, 2009. 106. Colombo, A.L. et al., Epidemiology of candidaemia in Brazil: A Nationwide sentinel surveillance of candidaemia in eleven medical centres. J. Clin. Microbiol., 44, 2816, 2006. 107. Al-Taw�q, J.A., Distribution and epidemiology of Candida species causing fungemia at a Saudi Arabian hospital, 1996– 2004. Int. J. Infect. Dis., 11, 239, 2007. 108. Klingspor, L. and Jalal, S., Molecular detection and identi�cation of Candida and Aspergillus spp. from clinical samples using real-time PCR. Clin. Microbiol. Infect., 12, 745, 2006. 109. Jordanides, N.E. et al., A prospective study of real-time panfungal PCR for the early diagnosis of invasive fungal infection in haemato-oncology patients. Bone Marrow Transplant., 35, 389, 2005. 110. Basková, L. et al., The Pan-AC assay: A single-reaction realtime PCR test for quantitative detection of a broad range of Aspergillus and Candida species. J. Med. Microbiol., 56, 1167, 2007. 111. Innings, A. et al., Multiplex real-time PCR targeting the RNase P RNA gene for detection and identi�cation of Candida species in blood. J. Clin. Microbiol., 45, 874, 2007. 112. Morace, G. et al., PCR-restriction enzyme analysis for detection of Candida DNA in blood from febrile patients with hematological malignancies. J. Clin. Microbiol., 37, 1871, 1999. 113. Shin, J.H. et al., Rapid identi�cation of up to three Candida species in a single reaction tube by a 5′ exonuclease assay using ¼uorescent DNA probes. J. Clin. Microbiol., 37, 165, 1999. 114. Khlif, M. et al., Evaluation of nested and real-time PCR assays in the diagnosis of candidaemia. Clin. Microbiol. Infect., 15, 656, 2009. 65 Chapter 65 - Debaryomyces
1. Barnett, J.A., Payne, R.W., and Yarrow, D. Yeasts: Characteristics and Identi¡cation, 3rd edn. Cambridge University Press, Cambridge, U.K., 2000.
2. Groenewald, M. et al. Polyphasic re-examination of Debaryomyces hansenii strains and reinstatement of D. hansenii, D. fabryi and D. subglobosus. Persoonia, 21, 17, 2008.
3. Prista, C. et al. Physiological basis for the high salt tolerance of Debaryomyces hansenii. Appl. Environ. Microbiol., 63, 4005, 1997.
4. Prista, C. et al. Mechanisms underlying the halotolerant way of Debaryomyces hansenii. FEMS Yeast Res., 5, 693, 2005.
5. Gardini, F. et al. A survey of yeasts in traditional sausages of southern Italy. FEMS Yeast Res., 1, 161, 2001. 6. Cocolin, L. et al. Study of the ecology of fresh sausages and characterization of populations of lactic acid bacteria by molecular methods. Appl. Environ. Microbiol., 70, 1883, 2004. 7. Fadda, M.E. et al. Occurrence and characterization of yeasts isolated from artisanal Fiore Sardo cheese. Int. J. Food Microbiol., 95, 51, 2004. 8. Simoncini, N. et al. Dynamics and characterization of yeasts during ripening of typical Italian dry-cured ham. Food Microbiol., 24, 577, 2007. 9. Warren, N.G. and Hazen, K.C. Candida, Cryptococcus, and other yeasts of medical importance. In: Manual of Clinical Microbiology, 7th edn., Murray, P.R., Ed. ASM Press, Washington, DC, 1998. 10. Wong, B. et al. Bone infection caused by Debaryomyces hansenii in a normal host: A case report. J. Clin. Microbiol., 16, 545, 1982. 11. Yamamoto, Y. et al. Extrinsic allergic alveolitis induced by the yeast Debaryomyces hansenii. Eur. Respir. J., 20, 1351, 2002. 12. Wagner, D. et al. Breakthrough invasive infection due to Debaryomyces hansenii (teleomorph Candida famata) and Scopulariopsis brevicaulis in a stem cell transplant patient receiving liposomal amphotericin B and caspofungin for suspected Aspergillosis. Infection, 33, 397, 2005. 13. Carrasco, L. et al. Isolation of Candida famata from a patient with acute zonal occult outer retinopathy. J. Clin. Microbiol., 43, 635, 2005. 14. Rao, N.A., Nerenberg, A.V., and Forster, D.J. Torulopsis candida (Candida famata) endophthalmitis simulating Propionibacterium acnes syndrome. Arch. Ophthalmol., 109, 1718, 1991. 15. Prinsloo, B., Weldhagen, G.F., and Blaine, R.W. Candida famata central nervous system infection. S. Afr. Med. J., 93, 601, 2003. 16. Klocker, A. Deux nouveaux genres de la famille des Saccharomycetes, CR. Trav. Lab. Carlsberg, 7, 273, 1909. 17. Kreger-Van Rij, N.J.W. The Yeast, a Taxonomic Study, 3rd edn. Elsevier Science Publishers, Amsterdam, the Netherlands, 1984. 18. Nakase, T. et al. Debaryomyces Lodder and Kreger-van Rij nom. cons. In: The Yeasts, a Taxonomic Study, 4th edn., Kurtzman, C.P. and Fell, J.W., Eds. Elsevier Science Publishers, Amsterdam, the Netherlands, 1998. 19. Phaff, H.J., Vaughan-Martini, A., and Starmer, W.T. Debaryomyces prosopidis sp. nov., a yeast from exudates of mesquite trees. Int. J. Syst. Bacteriol., 48, 1419, 1998. 20. Thanh, V.N., Van Dyk, M.S., and Wing�eld, M.J. Debaryomyces mycophilus sp. nov., a siderophore-dependent yeast isolated from woodlice. FEMS Yeast Res., 2, 415, 2002. 21. Saluja, P. and Prasad, G.S. Debaryomyces singareniensis sp. nov., a novel yeast species isolated from a coal mine soil in India. FEMS Yeast Res., 7, 482, 2007. 22. Nguyen, H.V. et al. Differentiation of Debaryomyces hansenii and Candida famata by rRNAgene intergenic spacer �ngerprinting and reassessment of phylogenetic relationships among D. hansenii, C. famata, D. fabryi, C. °areri (=D. subglobosus) and D. prosopidis: Description of D. vietnamensis sp. nov. closely related to D. nepalensis. FEMS Yeast Res., 9, 641, 2009. 23. Forrest, S.I., Robinow, C.F., and Lachance, M.A. Nuclear behaviour accompanying ascus formation in Debaryomyces polymorphus. Can. J. Microbiol., 33, 967, 1987.
24. Price, C.W., Fuson, G.B., and Phaff, H.J. Genome comparison in yeast systematics: Delimitation of species within the Genera Schwanniomyces, Saccharomyces, Debaryomyces and Pichia. Microbiol. Rev., 42, 161, 1978.
25. Corredor, M. et al. Chromosomal polymorphism in the yeast species Debaryomyces hansenii. Ant. Leeuwenhoek, 83, 215, 2003.
26. Cruz, J.M. et al. Dimorphic behaviour of Debaryomyces hansenii grown on barley bran acid hydrolyzates. Biotechnol. Lett., 22, 605, 2000.
27. Kurtzman, C.P., Smiley, M.J., and Baker, F.L. Scanning electron microscopy of ascospores of Debaryomyces and Saccharomyces. Mycopathol. Mycol. Appl., 55, 29, 1975.
28. Núñez, F. et al. Yeast population during ripening of dry-cured Iberian ham. Int. J. Food Microbiol., 29, 271, 1996.
29. Petersen, K.M. and Jespersen, L. Genetic diversity of the species Debaryomyces hansenii and the use of chromosome polymorphism for typing of strains isolated from surface ripened cheeses. J. Appl. Microbiol., 97, 205, 2004.
30. Nakase, T. and Suzuki, M. Taxonomic studies on Debaryomyces hansenii (Zopf) Lodder et Kreger-Van Rij and related species. II. Practical discrimination and nomenclature. J. Gen. Appl. Microbiol., 31, 71, 1985.
31. Kurtzman, C.P. and Robnett, C.J. Identi�cation of clinically important ascomycetous yeasts based on nucleotide divergence in the 5′ end of the large-subunit (26S) ribosomal DNA gene. J. Clin. Microbiol., 35, 1216, 1997.
32. Kurtzman, C.P. and Robnett, C.J. Identi�cation and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. Anton. Leeuwen., 73, 331, 1998.
33. Prillinger, H. et al. Phenotypic and genotypic identi�cation of yeasts from cheese. Anton. Leeuwen., 75, 267, 1999.
34. Jacques, N., Mallet, S., and Casaregola, S. Delimitation of the species of the Debaryomyces hansenii complex by intron sequence analysis. Int. J. Syst. Evol. Microbiol., 59, 1242, 2009.
35. Fabre, E. et al. Comparative genomics in hemiascomycete yeasts: Evolution of sex, silencing, and subtelomeres. Mol. Biol. Evol., 22, 856, 2005.
36. Fitzpatrick, D.A. et al. A fungal phylogeny based on 42 complete genomes derived from supertree and combined gene analysis. BMC Evol. Biol., 6, 99, 2006.
37. Onishi, H. Osmophilic yeasts. Adv. Food Res., 12, 53, 1963.
38. Yamada, Y. Identi�cation of coenzyme Q (ubiquinone) homologs. In: The Yeasts, a Taxonomic Study, 4th edn., Kurtzman, C.P. and Fell, J.W., Eds. Elsevier Science Publishers, Amsterdam, the Netherlands, 1998.
39. Lépingle, A. et al. Genomic exploration of the Hemiascomycetous yeasts: 14. Debaryomyces hansenii var. hansenii. FEBS Lett., 487, 82, 2000.
40. Ratledge, C. and Tan, K.-H. Oils and fats: Production, degradation and utilization by yeasts. In: Yeast Biotechnology and Biocatalysis, Verachtert, H.J. and De Mot, R., Eds. Marcel Dekker, New York, 1990.
41. Butinar, L. et al. Yeast diversity in hypersaline habitats. FEMS Microbiol. Lett. 244, 229, 2005.
42. Papauskova, K. and Sychrova, H. The co-action of osmotic and high temperature stresses results in a growth improvement of Debaryomyces hansenii cells. Int. J. Food Microbiol., 118, 1, 2007.
43. Davenport, R.R. Biology and Activities of Yeasts, Skinner, F.A., Passmore, S.M., and Davenport, R.R., Eds. Academic Press, London, U.K., 1980. 44. Van den Tempel, T. and Jacobsen, M. The technological characteristics of Debaryomyces hansenii and Yarrowia lipolytica and their potential as starter cultures for production of Danablu. Int. Dairy J., 10, 263, 2000. 45. Breuer, U. and Harms, H. Debaryomyces hansenii—An extremophilic yeast with biotechnological potential. Yeast, 23, 415, 2006. 46. Nishikawa, A. et al. Taxonomic position of clinical isolates of Candida famata. J. Med. Vet. Mycol., 34, 411, 1996. 47. Pisa, D. et al. Fungal infection in patients with serpiginous choroiditis or acute zonal occult outer retinopathy. J. Clin. Microbiol., 46, 130, 2008. 48. Kawakami, S. et al. Survey of fungemia cases during the past seventeen years at Teikyo University Hospital. J. Jpn. Assoc. Infect. Dis., 72, 105, 1998. 49. Viudes, A. et al. Candidemia at a tertiary-care hospital: Epidemiology, treatment, clinical outcome and risk factors for death. Eur. J. Clin. Microbiol. Infect. Dis., 21, 767, 2002. 50. Al-Hedaithy, S.S.A. The yeast species causing fungemia at a university hospital in Riyadh, Saudi Arabia, during a 10-year period. Mycoses, 46, 293, 2003. 51. Pfaller, M.A. and Diekema, D.J. Epidemiology of invasive candidiasis: A persistent public health problem. Clin. Microbiol. Rev., 20, 133, 2007. 52. Kurnatowska, A.J. The occurrence of fungi in ontocenosis of the oral cavity and mucosal changes. Mikologia Lekarska, 10, 295, 2003. 53. Findik, D. and Tuncer, U. Nosocomial fungal infections in a teaching hospital in turkey: Identi�cation of the pathogens and their antifungal susceptibility patterns. Turk. J. Med. Sci., 32, 35, 2002. 54. Saint Germain, G. and Laverdiere, M. Torulopsis candida, a new opportunistic pathogen. J. Clin. Microbiol., 24, 884, 1986. 55. Quindos, G. et al. Fatal Candida famata peritonitis in a patient undergoing continuous ambulatory peritoneal dialysis who was treated with ¼uconazole. Clin. Infect. Dis., 18, 658, 1994. 56. Carrega, G. et al. Candida famata fungemia in a surgical patient successfully treated with ¼uconazole. Eur. J. Clin. Microbiol. Infect. Dis., 16, 698, 1997. 57. Migliorati, C.A., Birman, E.G., and Cury, A.E. Oropharyngeal candidiasis in HIV-infected patients under treatment with protease inhibitors. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod., 98, 301, 2004. 58. Ahmed, I.M. et al. A fatal fungus. Ann. Thorac. Surg., 80, 723, 2005. 59. Gupta, A. et al. Fatal Candida famata peritonitis complicating sclerosing peritonitis in a peritoneal dialysis patient. Nephrol. Dial. Transplant., 21, 2037, 2006. 60. El-Zaatari, M. et al. Evaluation of the updated Vitek yeast identi�cation database. J. Clin. Microbiol., 28, 1938, 1990. 61. Törok, T. and King, A.D. Comparative study on the identi�cation of food-borne yeasts. Appl. Environ. Microbiol., 57, 1207, 1991. 62. Lopandic, K. et al. Identi�cation of yeasts associated with milk products using traditional and molecular techniques. Food Microbiol., 23, 341, 2006. 63. Fell, J.W. et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol., 50, 1351, 2000.
64. Vasdinyei, R. and Deák, T. Characterization of yeast isolates originating from Hungarian dairy products using traditional and molecular identi�cation techniques. Int. J. Food Microbiol., 86, 123, 2003.
65. Missoni, E.M. et al. Differentiation between Candida species isolated from diabetic foot by fatty acid methyl ester analysis using gas chromatography. J. Chromatogr. B, 822, 118, 2005.
66. Buesching, W.J., Kurek, K., and Roberts, G.D. Evaluation of the modi�ed API 20C system for identi�cation of clinically important yeasts. J. Clin. Microbiol., 9, 565, 1979.
67. Salkin, I.F. et al. Evaluation of YeastIdent and Uni-YeastTek yeast identi�cation systems. J. Clin. Microbiol., 25, 624, 1987.
68. Land, G.A. et al. Evaluation of the Baxter-MicroScan 4-hour enzyme based yeast identi�cation system. J. Clin. Microbiol., 29, 718, 1991.
69. St.-Germain, G. and Beauchesne, D. Evaluation of the MicroScan rapid yeast identi�cation panel. J. Clin. Microbiol., 29, 2296, 1991.
70. Rohm, H., Lechmer, F., and Lehner, M. Evaluation of the API ATB 32C system for the rapid identi�cation of foodborne yeasts. Int. J. Food Microbiol., 11, 215, 1990.
71. Latouche, G.N. et al. Comparison of use of phenotypic and genotypic characteristics for identi�cation of species of the anamorph genus Candida and related teleomorph yeast species. J. Clin. Microbiol., 35, 3171, 1997.
72. Álvarez-Martín, P. et al. Phenotypic and molecular identi�cation of yeast species associated with Spanish blue-veined Cabrales cheese. Int. Dairy J., 17, 961, 2007.
73. Loïez, C. et al. Evaluation of VITEK 2 colorimetric card for identi�cation of yeast. Diag. Microbiol. Inf. Dis., 56, 455, 2006.
74. Hata, D.J. et al. Multicenter evaluation of the new VITEK 2 advanced colorimetric yeast identi�cation card. J. Clin. Microbiol., 45, 1087, 2007.
75. De Silóniz, M.I., Valderrama, M.J., and Peinado, J.M., A chromogenic medium for the detection of yeasts with betagalactosidase and beta-glucuronidase activities from intermediate moisture foods. J. Food Prot., 68, 808, 2000.
76. Quirós, M. et al. A beta-glucuronidase-based agar medium for the differential detection of the yeast Debaryomyces hansenii from foods. J. Food Prot., 68, 808, 2005.
77. Kosse, D. et al. Identi�cation of yoghurt-spoiling yeasts with 18S rRNA-targeted oligonucleotide probes. Syst. Appl. Microbiol., 20, 468, 1997.
78. Davila, A.M. et al. Use of speci�c DNA probes for the rapid characterization of yeasts isolated from complex biotypes. Gen. Sel. Evol., 33, 353, 2001.
79. Del Bove, M. et al. Comparison of molecular and metabolomic methods as characterization tools of Debaryomyces hansenii cheese isolates. Food Microbiol., 26, 453, 2009.
80. Borst, A. et al. Detection of Candida spp in blood cultures using nucleic acid sequence-based ampli�cation (NASBA). Diag. Microbiol. Inf. Dis., 39, 155, 2001. 81. Andrade, M.J. et al. DNA typing methods for differentiation of yeasts related to dry-cured meat products. Int. J. Food Microbiol., 107, 48, 2006.
82. Senses-Ergul, S. et al. Characterization of some yeasts isolated from foods by traditional and molecular tests. Int. J. Food Microbiol., 108, 120, 2006. 83. Andrade, M.J. et al. Ef�ciency of mitochondrial DNA restriction analysis and RAPD-PCR to characterize yeasts growing on dry-cured Iberian ham at the different geographic areas of ripening. Meat Sci., 84, 377, 2010. 84. Andrade, M.J. et al. Differentiation of yeasts growing on drycured Iberian ham by mitochondrial DNA restriction analysis, RAPD-PCR and their volatile compounds production. Food Microbiol., 26, 578, 2009. 85. Capece, A. and Romano, P. “Pecorino di Filiano” cheese as a selective habitat for the yeast species, Debaryomyces hansenii. Int. J. Food Microbiol., 132, 180, 2009. 86. Pisa, D. et al. Evolution of antibody response and fungal antigens in the serum of a patient infected with Candida famata. J. Med. Microbiol., 56, 571, 2007. 87. Ayatollahi, S.A. et al. Rapid molecular diagnosis for Candida species using PCR-RFLP. Biotechnology, 6, 583, 2007. 88. Asadzadeh, M. et al. Rapid molecular differentiation and genotypic heterogeneity among Candida parapsilosis and Candida orthopsilosis strains isolated from clinical specimens in Kuwait. J. Med. Microbiol., 58, 745, 2009. 89. Tofalo, R. et al. Molecular identi�cation and osmotolerant pro�le of wine yeasts that ferment a high sugar grape must. Int. J. Food Microbiol., 130, 179, 2009. 90. Quirós, M. et al. PCR-RFLP analysis of the IGS region of rDNA: A useful tool for the practical discrimination between species of the genus Debaryomyces. Ant. Leeuwenhoek, 90, 211, 2006. 91. Querol, A., Barrio, E., and Ramón, D. A comparative study of different methods of yeast strain characterization. Syst. Appl. Microbiol., 15, 439, 1992. 92. Romano, A. et al. Use a RAPD and mitochondrial DNA RFLP for typing of Candida zeylanoides and Debaryomyces hansenii yeast strains isolated from cheese. Syst. Appl. Microbiol., 19, 255, 1996. 93. Martorell, P., Fernández-Espinar, M.T., and Querol, A. Molecular monitoring of spoilage yeasts during the production of candied fruit nougats to determined food contamination sources. Int. J. Food Microbiol., 101, 293, 2005. 94. Farkas, Z. et al. Genetic variability of Candida albicans isolates in a university hospital in Hungary. Mycoses, 52, 318, 2009. 95. Córdoba, J.J. et al. Debaryomyces. In: Molecular Detection of Foodborne Pathogens, Liu, D. Ed. CRC Press, Taylor & Francis Group, Boca Raton, FL, 2009. 96. Appel, D.J. and Gordon, T.R. Intraspeci�c variation within populations of Fusarium oxysporum based on RFLP analysis of the intergenic spacer region of the rDNA. Exp. Mycol., 19, 120, 1995. 97. Romero, P. et al. Differential detection of Debaryomyces hansenii isolated from intermediate-moisture foods by PCR-RFLP of the IGS region of rDNA. FEMS Yeast Res., 5, 455, 2005. 98. Quirós, M. Debaryomyces hansenii: Estudio de su capacidad para deteriorar alimentos y desarrollo de métodos para su detección rápida. Doctoral thesis, Universidad Complutense, Madrid, Spain, 2005. 99. López, V. et al. A simpli�ed procedure to analyse mitochondrial DNA from industrial yeasts. Int. J. Food Microbiol., 68, 75, 2001. 100. Casado, E.M. et al. Rapid characterization of yeasts isolated from Iberian ham by restriction analysis mitochondrial DNA. In: XX National Congress of Microbiology, Cáceres, Spain, 2005. 66 Chapter 66 - Geotrichum
19. Salkin, I.F. et al., Blastoschizomyces capitatus, a new combination. Mycotaxon, 22, 375, 1985.
20. Gueho, E. et al., Trichosporon on humans: A practical account. Mycoses, 37, 3, 1994.
21. Schiemann, R. et al., Geotrichum capitatum septicaemia in neutropenic patients: Case report and review of the literature. Mycoses, 41, 113, 1998.
22. O’Brien, M. et al., Fungi isolated from contaminated baled grass silage on farms in the Irish Midlands. FEMS Microbiol. Lett., 247, 131, 2005.
23. Samson, R. et al., Chapter 1: Identi�cation of the common food-borne fungi. In: Introduction to Food-Borne Fungi (Samson, R., Hoekstra, E., Frisvad, J., and Filtenborg, O., Eds.), 200pp. Centraalbureau voor Schimmelcultures, AG Barn, the Netherlands, 1996.
24. Mogensen, G. et al., Health bene�ts and safety evaluation of certain food components. Bull. Int. Dairy Fed., 377, 4, 2002.
25. Pottier, I. et al., Safety assessment of dairy microorganisms: Geotrichum candidum. Int. J. Food Microbiol., 126, 327, 2008.
26. Martino, P. et al., Blastoschizomyces capitatus: An emerging cause of invasive fungal disease in leukemia patients. Rev. Infect. Dis., 12, 570, 1990.
27. Martino, R. et al., Blastoschizomyces capitatus infection in patients with leukemia: Report of 26 cases. Clin. Infect. Dis., 38, 335, 2004.
28. Girmenia, C. et al., Invasive infections caused by Trichosporon species and Geotrichum capitatum in patients with hematological malignancies: A retrospective multicenter study from Italy and review of the literature. J. Clin. Microbiol., 43, 1818, 2005.
29. Hazen, K.C. et al., Comparison of the susceptibilities of Candida spp. to ¼uconazole and voriconazole in a 4-year global evaluation using disk diffusion. J. Clin. Microbiol., 41, 5623, 2003.
30. Bendove, R.A. and Ashe, B.I., Geotrichum septicemia. Arch. Intern. Med., 89, 107, 1952.
31. Kalish, S.R., Beene, M.L., and Mattman, L., Geotrichum in bloodstream of an infant. J. Am. Med. Assoc., 148, 1207, 1952.
32. Chang, W.W.L. and Buerger, L., Disseminated geotrichosis: Case report. Arch. Intern. Med., 113, 356, 1964.
33. Hrdy, D., Nassar, N., and Rinaldi, M., Traumatic joint infection due to Geotrichum candidum. Clin. Infect. Dis., 20, 468,1995.
34. Sfakianakis, A. et al., Invasive cutaneous infection with Geotrichum candidum: Sequential treatment with amphotericin B and voriconazole. Med. Mycol., 45, 81, 2007.
35. André, N. et al., Geotrichum candidum septicemia in a child with hepatoblastoma. Pediatr. Infect. Dis. J., 23, 86, 2004.
36. Depagne, C., Louerat, C., and Nesme, P., Herpes simplex and Geotrichum candidum pneumonia in a patient with moderate renal failure. Rev. Pneumol. Clin., 59, 297, 2003.
37. Kasantikul, V. and Chamsuwan, A., Brain abscesses due to Geotrichum candidum. Southeast Asian J. Trop. Med. Public Health, 26, 805, 1995.
38. Ng, K.P. et al., Disseminated Geotrichum infection. Med. J. Malaysia, 49, 424, 1994.
39. Heinic, G.S. et al., Oral Geotrichum candidum infection associated with HIV infection: A case report. Oral Surg. Oral Med. Oral Pathol., 73, 726, 1992.
40. Buchta, V. and Otcenásek, M., Geotrichum candidum—An opportunistic agent of mycotic diseases. Mycoses, 31, 363, 1988. 41. Kassamali, H. et al., Disseminated Geotrichum candidum infection. J. Clin. Microbiol., 25, 1782, 1987. 42. Jagirdar, J., Geller, S.A., and Bottone, E.J., Geotrichum candidum as a tissue invasive human pathogen. Hum. Pathol., 12, 668, 1981. 43. Gemeinhardt, H., Lungenpathogenitat von Trichosporon capitatum beim menschen. Zentbl. Bakteriol. A, 196, 121, 1965. 44. Viscoli, C., et al. Candidemia in cancer patients. A prospective, multicenter surveillance study by the Invasive Fungal Infection Group (IFIG) of the European Organization for Research and Treatment of Cancer (EORTC). Clin. Infect. Dis., 28, 1071, 1999. 45. De Pauw, B. et al., Revised de�nitions of invasive fungal disease from the European Organization for Research and Treatment of Cancer/Invasive Fungal Infections Cooperative Group and the National Institute of Allergy and Infectious Diseases Mycoses Study Group (EORTC/MSG) Consensus Group. Clin. Infect. Dis., 46, 1813, 2008. 46. Goodman, D. et al. Breakthrough trichosporonosis in a bone marrow transplant recipient receiving caspofungin acetate. Clin. Infect. Dis., 35, e35, 2002. 47. Perez-Sanchez, I. et al., Blastoschizomyces capitatus infection in acute leukemia patients. Leuk. Lymphoma, 39, 209, 2000. 48. Girmenia, C. et al., In vitro susceptibility testing of Geotrichum capitatum: Comparison of the E-test, disk diffusion, and Sensititre colorimetric methods with the NCCLS M27-A2 broth microdilution reference method. Antimicrob. Agents Chemother., 47, 3985, 2003. 49. Giacchino, M. et al., Aspergillus galactomannan enzymelinked immunosorbent assay cross-reactivity caused by invasive Geotrichum capitatum. J. Clin. Microbiol., 44, 3432, 2006. 50. Bonini, A. et al., Galactomannan detection in Geotrichum capitatum invasive infections: Report of 2 new cases and review of diagnostic options. Diagn. Microbiol. Infect. Dis., 62, 450, 2008. 51. Ahrazem, O. et al., Fungal cell-wall galactomannans isolated from Geotrichum spp. and their teleomorphs, Dipodascus and Galactomyces. Carbohydr. Res., 337, 2347, 2002. 52. Yeo, S.F. and Wong, B., Current status of nonculture methods for diagnosis of invasive fungal infections. Clin. Microbiol. Rev., 15, 465, 2002. 53. Ersoz, G. et al., An outbreak of Dipodascus capitatus infection in the ICU: Three case reports and review of the literature. Jpn. J. Infect. Dis., 57, 248, 2004. 54. Hattori, H. et al., A case of oral geotrichosis caused by Geotrichum capitatum in an old patient. Jpn. J. Infect. Dis., 60, 300, 2007. 55. Putignani, L. et al., Identi�cation of clinically relevant yeast species by DNA sequence analysis of the D2 variable region of the 25–28S rRNA gene. Mycoses, 51, 209, 2008. 56. Guarro, J., Gené, J., and Stchigel, A.M., Developments in fungal taxonomy. Clin. Microbiol. Rev., 12, 454, 1999. 57. Hinrikson, H.P. et al., Assessment of ribosomal large-subunit D1–D2, internal transcribed spacer 1, and internal transcribed spacer 2 regions as targets for molecular identi�cation of medically important Aspergillus species. J. Clin. Microbiol., 43, 2092, 2005. 58. Linton, C.J. et al., Molecular identi�cation of unusual pathogenic yeast isolates by large ribosomal subunit gene sequencing: 2 years of experience at the United kingdom mycology reference laboratory. J. Clin. Microbiol., 45, 1152, 2007.
59. Turenne, C.Y. et al., Rapid identi�cation of fungi by using the ITS2 genetic region and an automated ¼uorescent capillary electrophoresis system. J. Clin. Microbiol., 37, 1846, 1999.
60. Senses-Ergul, S. et al., Characterization of some yeasts isolated from foods by traditional and molecular tests. Int. J. Food Microbiol., 15, 108, 2006.
61. Florez, A.B. et al., Morphotypic and molecular identi�cation of �lamentous fungi from Spanish blue-veined cabrales cheese, and typing of Penicillium roqueforti and Geotrichum candidum isolates. Int. Dairy J., 17, 350, 2007.
62. Marklein, G. et al., Matrix-assisted laser desorption ionization-time of ¼ight mass spectrometry for fast and reliable identi�cation of clinical yeast isolates. J. Clin. Microbiol., 47, 2912, 2009.
63. D’Antonio, D. et al., Emergence of ¼uconazole-resistant strains of Blastoschizomyces capitatus causing nosocomial infections in cancer patients. J. Clin. Microbiol., 34, 753, 1996.
64. D’Antonio, D. et al., Onychomycosis caused by Blastoschizomyces capitatus. J. Clin. Microbiol., 37, 2927, 1999.
65. Marcellino, N. et al., Diversity of Geotrichum candidum strains isolated from traditional cheesemaking fabrications in France. Appl. Environ. Microbiol., 67, 4752, 2001.
66. Gente, S. et al., Genetic diversity among Geotrichum candidum strains from various substrates studied using RAM and RAPD-PCR. J. Appl. Microbiol., 92, 491, 2002. 67. Gente, S. et al., Intra-species chromosome-length polymorphism in Geotrichum candidum revealed by pulsed �eld gel electrophoresis. Int. J. Food Microbiol., 76, 127, 2002. 68. Bruford, M.W. and Wayne, R.K., Microsatellites and their application to population genetic studies. Curr. Opin. Genet. Dev., 3, 939, 1993. 69. Löf¼er, J. et al., Comparison of different methods for extraction of DNA of fungal pathogens from cultures and blood. J. Clin. Microbiol., 35, 3311, 1997. 70. Grif�n, D.W. et al., A rapid and ef�cient assay for extracting DNA from fungi. Lett. Appl. Microbiol., 34, 210, 2002. 71. Grif�ths, L.J. et al., Comparison of DNA extraction methods for Aspergillus fumigatus using real-time PCR. J. Med. Microbiol., 55, 1187, 2006. 72. Müller, F.M. et al., Rapid extraction of genomic DNA from medically important yeasts and �lamentous fungi by highspeed cell disruption. J. Clin. Microbiol., 36, 1625, 1998. 73. Löf¼er, J. et al., Contaminations occurring in fungal PCR assays. J. Clin. Microbiol., 37, 1200, 1999. 74. White, T.J. et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols: A Guide to Methods and Applications (Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J., Eds.). Academic Press, San Diego, CA, 1990. 67 Chapter 67 - Kluyveromyces
15. Leaw SN et al. Identi�cation of medically important yeast species by sequence analysis of the internal transcribed spacer regions. J Clin Microbiol. 2006;44(3):693–699.
16. Linton CJ et al. Molecular identi�cation of unusual pathogenic yeast isolates by large-ribosomal-subunit gene sequencing: 2 years of experience at the United kingdom mycology reference laboratory. J Clin Microbiol. 2007;45(4):1152–1158.
17. Bhardwaj S et al. PCR-based identi�cation and strain typing of Pichia anomala using the ribosomal intergenic spacer region IGS1. J Med Microbiol. 2007;56:185–189. 18. Borman AM et al. An improved protocol for the preparation of total genomic DNA from isolates of yeast and mould using Whatman FTA �lter papers. Mycopathologia 2010;169:445–449. 19. Pounder JI et al. Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J Clin Microbiol. 2007;45(2):568–571. 20. Lutwick LI, Phaff HJ, Stevens DA. Kluyveromyces fragilis as an opportunistic fungal pathogen in man. Sabouraudia 1980;18(1):69–73. 68 Chapter 68 - Pichia and Kodamaea
1. The UniProt Consortium. Available at http://www.uniprot.org/, accessed on August 1, 2010.
2. Yamada, Y. et al., 1995. The phylogeny of Yamadazyma ohmeri (Etchells et Bell) Billon-Grand based on the partial sequences of 18S and 26S ribosomal RNAs: The proposal of Kodomaea gen. nov. (Saccharomycetaceae). Biosci Biotechnol Biochem 59, 1172–1174.
3. Kurtzman, C.P. and Robnett, C.J. 1998. Identi�cation and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. Anton Leeuwen 73, 331–371. 4. Garcia-Martos, P. et al., 1996. Sexual forms of yeasts in clinical samples. Mycopathologia 136, 67. 5. Otag, F. et al., 2005. An outbreak of Pichia ohmeri infection in the paediatric intensive care unit: Case reports and review of the literature. Mycoses 48, 265–269. 6. Lee, J.S. et al., 2007. Kodamaea ohmeri isolates from patients in a university hospital: Identi�cation, antifungal susceptibility, and pulsed-�eld gel electrophoresis analysis. J Clin Microbiol 45(3), 1005–1010. 7. Moses, A. et al., 1991. Hansenula anomala infections in children: From asymptomatic colonization to tissue invasion. Pediatr Infect Dis J 10, 400–402. 8. Yamamura, M. et al., 2009. Polymerase chain reaction assay for speci�c identi�cation of Candida guilliermondii (Pichia guilliermondii). J Infect Chemother 15(4), 214–218. 9. Grenouillet, F. et al., 2010. Pichia fabianii fungemia in a neonate. Pediatr Infect Dis J 29, 191. 10. Thular, L.C. et al., 1997. Fungaemia caused by Hansenula anomala—An outbreak in a cancer hospital. Mycoses 40, 193–196. 11. Ma, J.S. et al., 2000. Neonatal fungemia caused by Hansenula anomala: A case report. J Microbiol Immunol Infect 33(4), 267–270. 12. Chakrabarti, A. et al., 2001. Outbreak of Pichia anomala infection in the pediatric service of a tertiary-care center in Northern India. J Clin Microbiol 39, 1702–1706. 13. Paula, C.R. et al., 2006. Nosocomial infection in newborns by Pichia anomala in a Brazilian intensive care unit. Med Mycol 44(5), 479–484. 14. Bakir, M. et al., 2003. Pichia anomala fungaemia in immunocompromised children. Mycoses 47, 231–235. 15. Pasqualotto, A.C. et al., 2005. An outbreak of Pichia anomala fungemia in a Brazilian pediatric intensive care unit. Infect Control Hosp Epidemiol 26(6), 553–558. 16. Kalenic, S. et al., 2001. Hansenula anomala outbreak at a surgical intensive care unit: A search for risk factors. Eur J Epidemiol 17, 491–496. 17. Park, K.A. et al., 2008. Pichia anomala fungal keratitis. Cornea 27(5), 619–620. 18. da Matta, V.L. et al., 2007. Antifungal drug susceptibility pro�le of Pichia anomala isolates from patients presenting with nosocomial fungemia. Antimicrob Agents Chemother 51, 1573–1576. 19. Bhally, H.S. et al., 2006. Infection in a neonate caused by Pichia fabianii: Importance of molecular identi�cation. Med Mycol 44, 185–187. 20. Hamal, P. et al., 2008. A case of endocarditis caused by the yeast Pichia fabianii with bio�lm production and developed in vitro resistance to azoles in the course of antifungal treatment. Med Mycol 46(6), 601–605. 21. Suzuki, C., Ando, Y., and Machida, S. 2001. Interaction of SMKT, a killer toxin produced by Pichia farinosa, with the yeast cell membranes. Yeast 18, 1471–1478. 22. Adler, A. et al., 2007. Pichia farinosa bloodstream infection in a lymphoma patient. J Clin Microbiol 45(10), 3456–3458. 23. Bergman, M.M., Gagnon, D., and Doern, G.V. 1998. Pichia ohmeri fungemia. Diagn Microbiol Infect Dis 30, 229–231. 24. Choy, B.Y. et al., 2000. Pichia ohmeri peritonitis in a patient with CAPD: Response to treatment with amphotericin (Letter). Perit Dial Int 20, 91. 25. Matute, A.J. et al., 2000. A case of disseminated infection with Pichia ohmeri. Eur J Clin Microbiol Infect Dis 19, 971–973. 26. Hitomi, S. et al., 2002. A case of central-venous-catheterassociated infection caused by Pichia ohmeri. J Hosp Infect 51, 75–77.
27. João, I. et al., 2002. Native valve endocarditis due to Pichia ohmeri. Heart Vessels 16, 260–263.
28. Puerto, J.L. et al., 2002. First report of urinary tract infection due to Pichia ohmeri. Eur J Clin Microbiol Infect Dis 21, 630–631.
29. Reina, J.P. et al., 2002. Pichia ohmeri prosthetic valve endocarditis and review of the literature. Scand J Infect Dis 34, 140–141.
30. Shin, D.H. et al., 2003. Pichia ohmeri fungemia associated with phlebitis: Successful treatment with amphotericin B. J Infect Chemother 9, 88–89.
31. Han, X.Y., Tarrand, J.J., and Escudero, E. 2004. Infections by the yeast Kodomaea (Pichia) ohmeri: Two cases and literature review. Eur J Clin Microbiol Infect 23, 127–130.
32. Ostronoff, F. et al., 2006. Pichia ohmeri fungemia in a hematologic patient: An emerging human pathogen. Leuk Lymphoma 47, 1949–1951. 33. Mahfouz, R.A. et al., 2008. Kodamaea (Pichia) ohmeri fungaemia complicating acute myeloid leukaemia in a patient with haemochromatosis. Pathology 40(1), 99–101.
34. Poojary, A. and Sapre, G., 2009. Kodamaea ohmeri infection in a neonate. Indian Pediatr 46, 629, 2009.
35. Yang, B.H. et al., 2009. Fluconazole-resistant Kodamaea ohmeri fungemia associated with cellulitis: Case report and review of the literature. Int J Infect Dis 13(6), e493–e497.
36. Taj-Aldeen, S.J., Doiphode, S.H., and Han, X.Y., 2006. Kodamaea (Pichia) ohmeri fungaemia in a premature neonate. J Med Microbiol 55, 237–239.
37. De Barros, J.D. et al., 2009. Kodamaea (Pichia) ohmeri fungemia in a pediatric patient admitted in a public hospital. Med Mycol 47(7), 775–779.
38. Latouche, G.N. et al., 1997. Comparison of use of phenotypic and genotypic characteristics for identi�cation of species of the anamorph genus Candida and related teleomorph yeast species. J Clin Microbiol 35, 3171–3180.
39. Buchaille, L. et al., 1998. Evaluation of six commercial systems for identi�cation of medically important yeasts. Eur J Clin Microbiol Infect Dis 17, 479–488. 40. Lott, T.J., Kuykendall, R.J., and Reiss, E. 1993. Nucleotide sequence analysis of the 5.8S rDNA and adjacent ITS2 region of Candida albicans and related species. Yeast 9, 1199–1206. 41. Lott, T.J. et al., 1998. Sequence analysis of the internal transcribed spacer 2 (ITS2) from yeast species within the genus Candida. Curr Microbiol 36, 63–69. 42. Kurtzman, C.P. and Robnett, C.J. 1997. Identi�cation of clinically important ascomycetous yeasts based on nucleotide divergence in the 5′ end of the large-subunit (26S) ribosomal DNA gene. J Clin Microbiol 35, 1216–1223. 43. Chen, Y.C. et al., 2000. Identi�cation of medically important yeasts using PCR-based detection of DNA sequence polymorphisms in the internal transcribed spacer 2 region of the rRNA genes. J Clin Microbiol 38(6), 2302–2310. 44. Naumov, G.I., Naumova, E.S., and Schnürer, J. 2001. Genetic characterization of the non-conventional yeast Hansenula anomala. Res Microbiol 152, 551–562. 45. Leaw, S.N. et al., 2006. Identi�cation of medically important yeast species by sequence analysis of the internal transcribed spacer regions. J Clin Microbiol 44(3), 693–699. 46. Passov, V. et al., 2006. Biotechnology, physiology and genetics of the yeast Pichia anomala. FEMS Yeast Res 6, 3–13. 47. Caggia, C. et al., 2001. Identi�cation of Pichia anomala isolated from yogurt by RFLP of the ITS region. Int J Food Microbiol 71, 71–73. 48. Sutar, R. et al., 2004. Comparison of ITS and IGS1 regions for strain typing of clinical and non-clinical isolates of Pichia anomala. J Med Microbiol 53, 119–123. 49. Bhardwaj, S. et al., 2007. PCR-based identi�cation and strain typing of Pichia anomala using the ribosomal intergenic spacer region IGS1. J Med Microbiol 56, 185–189. 50. Vollmer, T. et al., 2008. Evaluation of novel broad-range real-time PCR assay for rapid detection of human pathogenic fungi in various clinical specimens. J Clin Microbiol 46, 1919–1912. 51. Pounder, J.I. et al., 2007. Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J Clin Microbiol 45, 568–571. 69 Chapter 69 - Pneumocystis
1. Chagas, C., Nova tripanozomiaze humana. Mem Inst Oswaldo Cruz 1, 159–218 (1909).
2. Delanoe, P. and Delanoe, M., Sur les rapports des kystes de Carini du poumon des rats avec le Trypanosoma lewisi. C R Acad Sci Gen 155, 658–660 (1912).
3. Van der Meer, G. and Brug, S.L., Infection a Pneumocystis chez l’homme et chez les animaux. Ann Soc Belg Med Trop 22, 301–307 (1942).
4. Walzer, P.D. et al., Pneumocystis carinii pneumonia in the United States: Epidemiologic, diagnostic, and clinical features. Ann Intern Med 80, 83–93 (1974).
5. Pneumocystis pneumonia—Los Angeles. MMWR, 30, 250– 252 (1981).
6. Gottlieb, M.S. et al., Pneumocystis carinii pneumonia and mucosal candidiasis in previously healthy homosexual men: Evidence of a new acquired cellular immunode�ciency. N Engl J Med 305, 1425–1431 (1981).
7. Morris, A. et al., Current epidemiology of Pneumocystis pneumonia. Emerg Infect Dis 10, 1713–1720 (2004).
8. Edman, J.C. et al., Ribosomal RNA sequence shows Pneumocystis carinii to be a member of the fungi. Nature 334, 519–522 (1988).
9. Stringer, J.R., Pneumocystis carinii: What is it, exactly? Clin Microbiol Rev 9, 489–498 (1996).
10. Stringer, J. et al., A new name (Pneumocystis jiroveci) for Pneumocystis from humans. Emerg Infect Dis 8, 891–896 (2002).
11. Huang, L. et al., An of�cial ATS workshop summary: Recent advances and future directions in Pneumocystis pneumonia (PCP). Proc Am Thorac Soc 3, 655–664 (2006).
12. Thomas, C.F. Jr. and Limper, A.H., Current insights into the biology and pathogenesis of Pneumocystis pneumonia. Nat Rev Microbiol 5, 298–308 (2007).
13. Thomas, C.F. and Limper, A.H., Pneumocystis pneumonia. N Engl J Med 350, 2487–2498 (2004). 14. Kovacs, J.A. et al., Pneumocystis carinii pneumonia: A comparison between patients with the acquired immunode�ciency syndrome and patients with other immunode�ciencies. Ann Intern Med 100, 663–671 (1984).
15. Sepkowitz, K.A., Opportunistic infections in patients with and patients without acquired immunode�ciency syndrome. Clin Infect Dis 34, 1098–1107 (2002).
16. Fei, M.W. et al., Predicting mortality from HIV-associated Pneumocystis pneumonia at illness presentation: An observational cohort study. Thorax 64, 1070–1076 (2009).
17. Walzer, P.D. et al., Early predictors of mortality from Pneumocystis jirovecii pneumonia in HIV-infected patients: 1985–2006. Clin Infect Dis 46, 625–633 (2008).
18. Mansharamani, N.G. et al., Management and outcome patterns for adult Pneumocystis carinii pneumonia, 1985 to 1995: Comparison of HIV-associated cases to other immunocompromised states. Chest 118, 704–711 (2000).
19. Ng, V.L., Yajko, D.M., and Hadley, W.K., Extrapulmonary pneumocystosis. Clin Microbiol Rev 10, 401–418 (1997). 20. Mandell, G., Bennett, J., and Dolin, R., Principles and Practice of Infectious Diseases, Churchill Livingstone, New York, 2004. 21. Vargas, S.L. et al., Search for primary infection by Pneumocystis carinii in a cohort of normal, healthy infants. Clin Infect Dis 32, 855–861 (2001). 22. Morris, A., et al., Epidemiology and clinical signi�cance of Pneumocystis colonization. J Infect Dis 197, 10–17 (2008). 23. Kovacs, J.A. and Masur, H., Evolving health effects of Pneumocystis: One hundred years of progress in diagnosis and treatment. JAMA 301, 2578–2585 (2009). 24. Skelly, M.J., Holzman, R.S., and Merali, S., S-adenosylmethionine levels in the diagnosis of Pneumocystis carinii pneumonia in patients with HIV infection. Clin Infect Dis 46, 467–471 (2008). 25. Kutty, G. et al., Pneumocystis encodes a functional S-adenosylmethionine synthetase gene. Eukaryot Cell 7, 258–267 (2008). 26. Watanabe, T. et al., Serum (1→3) beta-D-glucan as a noninvasive adjunct marker for the diagnosis of Pneumocystis pneumonia in patients with AIDS. Clin Infect Dis 49, 1128–1131 (2009). 27. Shelhamer, J.H. et al., The laboratory evaluation of opportunistic pulmonary infections. Ann Intern Med 124, 585–599 (1996). 28. Kovacs, J.A. et al., Diagnosis of Pneumocystis carinii pneumonia: Improved detection in sputum with use of monoclonal antibodies. N Engl J Med 318, 589–593 (1988). 29. Armbruster, C., Pokieser, L., and Hassl, A., Diagnosis of Pneumocystis carinii pneumonia by bronchoalveolar lavage in AIDS patients. Comparison of Diff-Quik, fungi¼uor stain, direct immuno¼uorescence test and polymerase chain reaction. Acta Cytol 39, 1089–1093 (1995). 30. Wake�eld, A.E. et al., Detection of Pneumocystis carinii with DNA ampli�cation. Lancet 336, 451–453 (1990). 31. Lu, J.J. et al., Typing of Pneumocystis carinii strains that infect humans based on nucleotide sequence variations of internal transcribed spacers of rRNA genes. J Clin Microbiol 32, 2904–2912 (1994). 32. Lipschik, G.Y. et al., Improved diagnosis of Pneumocystis carinii infection by polymerase chain reaction on induced sputum and blood. Lancet 340, 203–206 (1992). 33. Larsen, H.H. et al., Development of a rapid real-time PCR assay for quantitation of Pneumocystis carinii f. sp. carinii. J Clin Microbiol 40, 2989–2993 (2002). 34. Brancart, F.O. et al., Quantitative TaqMan PCR for detection of Pneumocystis jiroveci. J Microbiol Meth 61, 381–387 (2005). 35. Alvarez-Martínez, M. et al., Sensitivity and speci�city of nested and real-time PCR for the detection of Pneumocystis jiroveci in clinical specimens. Diagn Microbiol Infect Dis 56, 153–160 (2006). 36. Arcenas, R. et al., A real-time polymerase chain reaction assay for detection of Pneumocystis from bronchoalveolar lavage ¼uid. Diagn Microbiol Infect Dis 54, 169–175 (2006). 37. Palladino, S. et al., Use of real-time PCR and the LightCycler system for the rapid detection of Pneumocystis carinii in respiratory specimens. Diagn Microbiol Infect Dis 39, 233– 236 (2001). 38. Bandt, D. and Monecke, S., Development and evaluation of a real-time PCR assay for detection of Pneumocystis jiroveci. Transplant Infect Dis 9, 196–202 (2007). 39. Maher, N.H. et al., Development and characterization of a molecular viability assay for Pneumocystis carinii f sp hominis. J Infect Dis 183, 1825–1827 (2001).
40. de Oliveira, A. et al., Performance of a molecular viability assay for the diagnosis of Pneumocystis pneumonia in HIV-infected patients. Diagn Microbiol Infect Dis 57, 169–176 (2007).
41. Cartwright, C.P., Nelson, N.A., and Gill, V.J., Development and evaluation of a rapid and simple procedure for detection of Pneumocystis carinii by PCR. J Clin Microbiol 32, 1634– 1638 (1994).
42. Ortona, E. et al., Detection of Pneumocystis carinii in respiratory specimens by PCR-solution hybridization enzyme-linked immunoassay. J Clin Microbiol 35, 1589–1591 (1997).
43. Uemura, N. et al. Development of a loop-mediated isothermal ampli�cation method for diagnosing Pneumocystis pneumonia. J Med Microbiol 57, 50–57 (2008).
44. Torres, J. et al., Diagnosis of Pneumocystis carinii pneumonia in human immunode�ciency virus-infected patients with polymerase chain reaction: A blinded comparison to standard methods. Clin Infect Dis 30, 141–145 (2000).
45. Kitada, K. et al., Detection of Pneumocystis carinii sequences by polymerase chain reaction: Animal models and clinical application to noninvasive specimens. J Clin Microbiol 29, 1985–1990 (1991).
46. Olsson, M. et al., Detection of Pneumocystis carinii DNA in sputum and bronchoalveolar lavage samples by polymerase chain reaction. J Clin Microbiol 31, 221–226 (1993).
47. Huang, S.N. et al., Development of a PCR assay for diagnosis of Pneumocystis carinii pneumonia based on ampli�cation of the multicopy major surface glycoprotein gene family. Diagn Microbiol Infect Dis 35, 27–32 (1999).
48. Larsen, H.H. et al., Development and evaluation of a quantitative, touch-down, real-time PCR assay for diagnosing Pneumocystis carinii pneumonia. J Clin Microbiol 40, 490– 494 (2002).
49. Lu, J.J. et al., Comparison of six different PCR methods for detection of Pneumocystis carinii. J Clin Microbiol 33, 2785– 2788 (1995).
50. Weig, M. et al., Correlation of Pneumocystis carinii PCR with clinical diagnosis in immunocompromised patients. Lancet 347, 1266 (1996).
51. Gupta, R. et al., Diagnostic signi�cance of nested polymerase chain reaction for sensitive detection of Pneumocystis jirovecii in respiratory clinical specimens. Diagn Microbiol Infect Dis 64, 381–388 (2009).
52. Helweg-Larsen, J. et al., Diagnostic use of PCR for detection of Pneumocystis carinii in oral wash samples. J Clin Microbiol 36, 2068–2072 (1998).
53. Schluger, N. et al., Application of DNA ampli�cation to pneumocystosis: Presence of serum Pneumocystis carinii DNA during human and experimentally induced Pneumocystis carinii pneumonia. J Exp Med 176, 1327–1333 (1992).
54. Atzori, C. et al., Diagnosis of Pneumocystis carinii pneumonia in AIDS patients by using polymerase chain reactions on serum specimens. J Infect Dis 172, 1623–1626 (1995).
55. Ortona, E. et al., Non speci�c PCR products using rat-derived Pneumocystis carinii dihydrofolate reductase gene-speci�c primers in DNA ampli�cation of human respiratory samples. Mol Cell Probes 10, 187–190 (1996).
56. Ma, L. et al., Pneumocystis carinii dihydropteroate synthase but not dihydrofolate reductase gene mutations correlate with prior trimethoprim-sulfamethoxazole or dapsone use. J Infect Dis 180, 1969–1978 (1999).
57. Fischer, S. et al., The use of oral washes to diagnose Pneumocystis carinii pneumonia: A blinded prospective study using a polymerase chain reaction-based detection system. J Infect Dis 184, 1485–1488 (2001). 58. Fillaux, J. et al., Accuracy of a routine real-time PCR assay for the diagnosis of Pneumocystis jirovecii pneumonia. J Microbiol Meth 75, 258–261 (2008). 59. Larsen, H.H. et al., A prospective, blinded study of quantitative touch-down polymerase chain reaction using oral-wash samples for diagnosis of Pneumocystis pneumonia in HIVinfected patients. J Infect Dis 189, 1679–1683 (2004). 60. Huggett, J.F. et al., Development and evaluation of a real-time PCR assay for detection of Pneumocystis jirovecii DNA in bronchoalveolar lavage ¼uid of HIV-infected patients. Thorax 63, 154–159 (2008). 61. Flori, P. et al., Comparison between real-time PCR, conventional PCR and different staining techniques for diagnosing Pneumocystis jiroveci pneumonia from bronchoalveolar lavage specimens. J Clin Microbiol 53, 603–607 (2004). 62. Linssen, C. et al., Inter-laboratory comparison of three different real-time PCR assays for the detection of Pneumocystis jiroveci in bronchoalveolar lavage ¼uid samples. J Med Microbiol 55, 1229–1235 (2006). 63. Robberts, F.J., Liebowitz, L.D., and Chalkley, L.J., Polymerase chain reaction detection of Pneumocystis jiroveci: Evaluation of 9 assays. Diagn Microbiol Infect Dis 58, 385–392 (2007). 64. Lane, B.R. et al., Dihydropteroate synthase polymorphisms in Pneumocystis carinii. J Infect Dis 175, 482–485 (1997). 65. Takahashi, T. et al., Relationship between mutations in dihydropteroate synthase of Pneumocystis carinii f. sp. hominis isolates in Japan and resistance to sulfonamide therapy. J Clin Microbiol 38, 3161–3164 (2000). 66. Wake�eld, A.E., DNA sequences identical to Pneumocystis carinii f. sp. carinii and Pneumocystis carinii f. sp. hominis in samples of air spora. J Clin Microbiol 34, 1754–1759 (1996). 67. Mathis, A. et al., Simpli�ed sample processing combined with a sensitive one-tube nested PCR assay for detection of Pneumocystis carinii in respiratory specimens. J Clin Microbiol 35, 1691–1695 (1997). 68. Tamburrini, E. et al., Detection of Pneumocystis carinii DNA in blood by PCR is not of value for diagnosis of P. carinii pneumonia. J Clin Microbiol 34, 1586–1588 (1996). 69. Rabodonirina, M. et al., Detection of Pneumocystis carinii DNA in blood specimens from human immunode�ciency virus-infected patients by nested PCR. J Clin Microbiol 37, 127–131 (1999). 70. Nyamande, K. et al., Low sensitivity of a nested polymerase chain reaction in oropharyngeal washings for the diagnosis of pneumocystis pneumonia in HIV-infected patients. Chest 128, 167–171 (2005). 71. Azoulay, E. et al., Polymerase chain reaction for diagnosing Pneumocystis pneumonia in non-HIV immunocompromised patients with pulmonary in�ltrates. Chest 135, 655–661 (2009). 72. Weig, M. et al., Usefulness of PCR for diagnosis of Pneumocystis carinii pneumonia in different patient groups. J Clin Microbiol 35, 1445–1449 (1997). 73. Sing, A. et al., Evaluation of diagnostic value and epidemiological implications of PCR for Pneumocystis carinii in different immunosuppressed and immunocompetent patient groups. J Clin Microbiol 38, 1461–1467 (2000). 74. Fujisawa, T. et al., Real-time PCR is more speci�c than conventional PCR for induced sputum diagnosis of Pneumocystis pneumonia in immunocompromised patients without HIV infection. Respirology 14, 203–209 (2009). 75. De la Horra, C. et al., Comparison of single and touchdown PCR protocols for detecting Pneumocystis jirovecii DNA in paraf�n-embedded lung tissue samples. J Eukaryot Microbiol 53, S98 (2006).
76. Lee, C.H. et al., Ampli�cation of Pneumocystis carinii DNA on specimens scraped from slides. Diagn Microbiol Infect Dis 18, 197–199 (1994).
77. Lee, C.H. et al., Update on Pneumocystis carinii f. sp. hominis typing based on nucleotide sequence variations in internal transcribed spacer regions of rRNA genes. J Clin Microbiol 36, 734–741 (1998).
78. Robberts, F.J., Liebowitz, L.D., and Chalkley, L.J., Genotyping and coalescent phylogenetic analysis of Pneumocystis jiroveci from South Africa. J Clin Microbiol 42, 1505–1510 (2004).
79. Nimri, L.F. et al., Genetic diversity of Pneumocystis carinii f. sp. hominis based on variations in nucleotide sequences of internal transcribed spacers of rRNA genes. J Clin Microbiol 40, 1146–1151 (2002). 80. Beser, J., Hagblom, P., and Fernandez, V., Frequent in vitro recombination in internal transcribed spacers 1 and 2 during genotyping of Pneumocystis jirovecii. J Clin Microbiol 45, 881–886 (2007). 81. Huang, L. et al., Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance. Emerg Infect Dis 10, 1721–1728 (2004). 82. Kaiser, K., Rabodonirina, M., and Picot, S., Real time quantitative PCR and RT-PCR for analysis of Pneumocystis carinii hominis. J Microbiol Methods 45, 113–118 (2001). 70 Chapter 70 - Saccharomyces
11. MacKenzie, D.A. et al., Relatedness of medically important strains of Saccharomyces cerevisiae as revealed by phylogenetics and metabolomics, Yeast, 25, 501, 2008.
12. Muller, L.A. and McCusker, J.H., Microsatellite analysis of genetic diversity among clinical and nonclinical Saccharomyces cerevisiae isolates suggests heterozygote advantage in clinical environments, Mol. Ecol., 18, 2779, 2009.
13. Dujon, B., The yeast genome project: What did we learn?, Trends Genet., 12, 263, 1996.
14. Wei, W. et al., Genome sequencing and comparative analysis of Saccharomyces cerevisiae strain YJM789, PNAS, 104, 12825, 2007.
15. Palecek, S.P. et al., Depression of Saccharomyces cerevisiae invasive growth on non-glucose carbon sources requires the Snf1 kinase, Mol. Microbiol., 45, 453, 2002.
16. Reynolds, T.B. and Fink, G.R., Bakers’ yeast, a model for fungal bio�lm formation, Science, 291, 878, 2001.
17. Casalone, E. et al., Characterization of Saccharomyces cerevisiae natural populations for pseudohyphal growth and colony morphology, Res. Microbiol., 156, 191, 2005.
18. Douglas, L.M. et al., Expression and characterization of the ¼occulin Flo11/Muc1, a Saccharomyces cerevisiae mannoprotein with homotypic properties of adhesion, Eukaryot. Cell, 6, 2214, 2007.
19. Byron, J.K. et al., Pathogenicity of Saccharomyces cerevisiae in complement factor �ve-de�cient mice, Infect. Immun., 63, 478, 1995.
20. McCusker, J.H. et al., Saccharomyces cerevisiae virulence phenotype as determined with CD-1 mice is associated with the ability to grow at 42°C and form pseudohyphae, Infect. Immun., 62, 5447, 1994.
21. de Llanos, R., Fernandez-Espinar, M.T., and Querol, A., A comparison of clinical and food Saccharomyces cerevisiae isolates on the basis of potential virulence factors. Anton Leeuwen, 90, 221, 2006.
22. Verstrepen, K.J. et al., Intragenic tandem repeats generate functional variability. Nat. Genet., 37, 986, 2005.
23. Snoek, I.S. and Steensma, H.Y., Factors involved in anaerobic growth of Saccharomyces cerevisiae, Yeast, 24, 1, 2007.
24. Pfeiffer, T. et al., Cooperation and competition in the evolution of ATP-producing pathways, Science, 292, 504, 2001.
25. Pretorius, I.S., Tailoring wine yeast for the new millennium: novel approaches to the ancient art of winemaking, Yeast, 16, 675, 2000.
26. Klar, A.J., The mother-daughter mating type switching asymmetry of budding yeast is not conferred by the segregation of parental HO gene DNA strands, Genes Dev., 1, 1059, 1987.
27. Brauer, M.J. et al., Coordination of growth rate, cell cycle, stress response, and metabolic activity in yeast, Mol. Biol. Cell, 19, 352, 2008.
28. Ma, J. et al., An interrelationship between autophagy and �lamentous growth in budding yeast, Genetics, 177, 205, 2007.
29. Iyer, R.S. et al., Pseudohyphal differentiation defect due to mutations in GPCR and ammonium signaling is suppressed by low glucose concentration: a possible integrated role for carbon and nitrogen limitation, Curr. Genet., 54, 71, 2008.
30. Boeckstaens, M. et al., The yeast ammonium transport protein Mep2 and its positive regulator, the Npr1 kinase, play an important role in normal and pseudohyphal growth on various nitrogen media through retrieval of excreted ammonium, Mol. Microbiol., 64, 534, 2007. 31. Almanza, L. et al., Quatre heures pour un record, ou une cellulite vraiment foudroyante: Saccharomyces cerevisiae peut-elle en être la cause?, Ann. Fr. Anesfh. Rianim., 1, 130, 1998. 32. Pérez González, E., Peritonitis caused by Saccharomyces cerevisiae in an ambulatory peritoneal dialysis patient, Nefrología, 29, 371, 2009. 33. Savini, V. et al., Two cases of vaginitis caused by itraconazoleresistant Saccharomyces cerevisiae and a review of recently published studies, Mycopathologia, 166, 47, 2008. 34. McCullough, M.J. et al., Epidemiological investigation of vaginal Saccharomyces cerevisiae isolates by a genotypic method, J. Clin. Microbiol., 36, 557, 1998. 35. Enache-Angoulvant, A. and Hennequin, C., Invasive Saccharomyces infection: A comprehensive review. Clin. Infect. Dis., 41, 1559, 2005. 36. Swinne, D. et al., Bloodstream yeast infections: A 15-month survey, Epidemiol. Infect., 137, 1037. 2009. 37. Klingberg, T.D. et al., Comparison of Saccharomyces cerevisiae strains of clinical and nonclinical origin by molecular typing and determination of putative virulence traits, FEMS Yeast Res., 8, 631, 2008. 38. Cairoli, R. et al., Saccharomyces cerevisiae fungemia with granulomas in the bone marrow in a patient undergoing BMT, Bone Marrow Transpl., 15, 785, 1995. 39. Clemons, K.V. et al., Comparative pathogenesis of clinical and nonclinical isolates of Saccharomyces cerevisiae, J. Infect. Dis., 169, 859, 1994. 40. van Burik, J.H. and Magee, P., Aspects of fungal pathogenesis in humans, Annu. Rev. Microbiol., 55, 743, 2001. 41. Mir, S.S. et al., Ssd1 is required for thermotolerance and Hsp104-mediated protein disaggregation in Saccharomyces cerevisiae, Mol. Cell Biol., 29, 187, 2009. 42. Diezmann. S. and Dietrich, F.S., Saccharomyces cerevisiae: population divergence and resistance to oxidative stress in clinical, domesticated and wild isolates, PLoS One, 4, 5317, 2009. 43. Jain, C. et al., A pathogenesis assay using Saccharomyces cerevisiae and Caenorhabditis elegans reveals novel roles for yeast AP-1, Yap1, and host dual oxidase BLI-3 in fungal pathogenesis, Eukaryot. Cell., 8, 1218, 2009. 44. Belet, N. et al., Catheter-related fungemia caused by Saccharomyces cerevisiae in a newborn, Pediatr. Infect. Dis. J., 24, 1125, 2005. 45. Smith, D. et al., Fatal Saccharomyces cerevisiae aortic graft infection, J. Clin. Microbiol., 2691, 2691, 2002. 46. Graf, C. and Gavazzi, G., Saccharomyces cerevisiae fungemia in an immunocompromised patient not treated with Saccharomyces boulardii preparation, J. Infect., 54, 310, 2007. 47. Salonen, J.H. et al., Fungal colonization of haematological patients receiving cytotoxic chemotherapy: Emergence of azole-resistant Saccharomyces cerevisiae, J. Hosp. Infect., 45, 293, 2000. 48. Olver, W.J. et al., Nosocomial transmission of Saccharomyces cerevisiae in bone marrow transplant patients, J. Hosp. Infect., 52, 268, 2002. 49. Cesaro, S. et al., Saccharomyces cerevisiae fungemia in a neutropenic patient treated with Saccharomyces boulardii, Support Care Cancer, 8, 504, 2000. 50. Cassone, M. et al., Outbreak of Saccharomyces cerevisiae subtype boulardii fungemia in patients neighboring those treated with a probiotic preparation of the organism, J. Clin. Microbiol., 41, 5340, 2003.
51. Opinion of the Scienti�c Committee on a request from EFSA on the introduction of a Quali�ed Presumption of Safety (QPS) approach for assessment of selected microorganisms referred to EFSA. EFSA J., 587, 1, 2007.
52. Ghelardi, E. et al., Ef�cacy of Chromogenic Candida Agar for isolation and presumptive identi�cation of pathogenic yeast species, Clin. Microbiol. Infect., 14, 141, 2008.
53. Martorell, P. et al., Rapid identi�cation and enumeration of Saccharomyces cerevisiae cells in wine by real-time PCR, Appl. Environ. Microbiol., 71, 6823, 2005.
54. Chang, H.W. et al., Quantitative real time PCR assays for the enumeration of Saccharomyces cerevisiae and the Saccharomyces sensu stricto complex in human feces, J. Microbiol. Methods, 71, 191, 2007.
55. Salinas, F. et al., Taqman real-time PCR for the detection and enumeration of Saccharomyces cerevisiae in wine, Food Microbiol., 26, 328, 2009.
56. Campa, D. et al., A DNA microarray based on arrayed-primer extension (APEX) technique for identi�cation of pathogenic fungi responsible for invasive and super�cial mycoses, J. Clin. Microbiol., 46, 909, 2008.
57. Esteve-Zarzoso, B. et al., Identi�cation of yeasts by RFLP analysis of the 5.8S rRNA gene and the two ribosomal internal transcribed spacers, Int. J. Syst. Bacteriol., 49, 329, 1999. 58. Clemons, K.V. et al., Application of DNA typing methods and genetic analysis to epidemiology and taxonomy of Saccharomyces, J. Clin. Microbiol., 35, 1822, 1997. 59. Hennequin, C. et al., Microsatellite typing as a new tool for identi�cation of Saccharomyces cerevisiae strains, J. Clin. Microbiol., 39, 551, 2001. 60. Vaudano, E. and Moruno-Garcia, E., Discrimination of Saccharomyces cerevisiae wine strains using microsatellite multiplex PCR and band pattern analysis, Food Microbiol., 25, 56, 2008. 61. Posteraro, B. et al., Molecular tools for differentiating probiotic and clinical strains of Saccharomyces cerevisiae, Int. J. Food Microbiol., 103, 295, 2005. 62. Marinangeli, P. et al., Minisatellites in Saccharomyces cerevisiae genes encoding cell wall proteins: a new way towards wine strains characterisation, FEMS Yeast Res., 4, 427, 2004. 63. Karakousis, A. et al., An assessment of the ef�ciency of fungal DNA extraction methods for maximizing the detection of medically important fungi using PCR, J. Microbiol. Methods, 65, 38, 2006. 64. Lee, K.S. et al., The Saccharomyces cerevisiae PLB1 gene encodes a protein required for lysophospholipase and phospholipase B activity, J. Biol. Chem., 269, 19725, 1994.
Part II
Bastidiomycota 71 Chapter 71 - Coprinopsis and Hormographiella
1. The UniProt Consortium. Available at http://www.uniprot. org/, accessed on August 1, 2010.
2. Guarro, J. et al. (1992). Hormographiella, a new genus of hyphomycetes from clinical sources. Mycotaxon, 45, 179–190.
3. Gené, J. et al. (1996). Molecular characterization, relatedness and antifungal susceptibility of the basidiomycetous Hormographiella species and Coprinus cinereus from clinical and environmental sources. Anton Leeuwen, 70(1), 49–57.
4. Abuali, M. M. et al. (2009). Rhizomucor variabilis var. regularior and Hormographiella aspergillata infections in a leukemic bone marrow transplant recipient with refractory neutropenia. J. Clin. Microbiol., 47(12), 4176–4179. Erratum in: J. Clin. Microbiol., 2010;48:1018.
5. Rampazzo, A. et al. (2009). Hormographiella aspergillata keratomycosis in a dog. Vet. Ophthalmol., 12, 43–47.
6. Speller, D. E. and MacIver, A. G. (1971). Endocarditis caused by a Coprinus species: A fungus of the toadstool group. J. Med. Microbiol., 4, 370–374. 7. Bartz-Schmidt, K. U. et al. (1996). Chronic basidiomycetous endophthalmitis after extracapsular cataract extraction and intracapsular lens implantation. Graefe’s Arch. Clin. Exp. Ophthalmol., 234, 591–593. 8. Nenoff, P. et al. (1997). Rare fatal simultaneous mould infection of the lung caused by Aspergillus °avus and the basidiomycete Coprinus sp. in a leukemic patient. J. Med. Vet. Mycol., 35, 65–69. 9. Verweij, P. E. et al. (1997). Fatal pulmonary infection caused by the basidiomycete Hormographiella aspergillata. J. Clin. Microbiol., 35, 2675–2678. 10. Surmont, I. et al. (2002). A pulmonary infection caused by Coprinus cinereus (Hormographiella aspergillata) diagnosed after a neutropenic episode. Med. Mycol., 40, 217–219. 11. Lagrou, K. et al. (2005). Fatal pulmonary infection in a leukaemic patient caused by Hormographiella aspergillata. J. Med. Microbiol., 54, 685–688. 12. Conen, A. et al. (2010). Hormographiella aspergillata: An emerging mould in acute leukaemia patients? Clin. Microbiol. Infect., Published Online: May 18, 2010. 13. Greer, E.L. et al. (2008). Truf¼e’s revenge: A pig-eating fungus. Cardiovasc. Pathol., 17(5), 342–343. 14. De Baere, T. et al. (2002). Identi�cation of cultured isolates of clinically important yeast species using ¼uorescent fragment length analysis of the ampli�ed internally transcribed rRNA spacer 2 region (ITS2). BMC Microbiol., 2, 21. 15. Scorzetti G. et al. (2002). Systematics of basidiomycetous yeasts: A comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions. FEMS Yeast Res., 2(4), 495–517. 16. Romanelli, A. M. et al. (2010). Sequence-based identi�cation of �lamentous basidiomycetous fungi from clinical specimens: A cautionary note. J. Clin. Microbiol., 48(3), 741–752. 17. Zeng, J.S. et al. (2007). Spectrum of clinically relevant Exophiala species in the United States. J. Clin. Microbiol., 45(11), 3713–3720. 72 Chapter 72 - Cryptococcus
1. Barnett, J., Payne, R., and Yarrow, D., Yeasts: Characteristics and Identi¡cation, 2nd edn. Cambridge, MA: Cambridge University Press; 1990.
2. Kwon-Chung, K.J., Morphogenesis of Filobasidiella neoformans, sexual state of Cryptococcus neoformans. Mycologia, 68, 821, 1976.
3. Kwon-Chung, K.J., A new species of Filobasidiella, the sexual state of Cryptococcus neoformans B and C serotypes. Mycologia, 68, 943, 1976.
4. Wickes, B.L. et al., Dimorphism and haploid fruiting in Cryptococcus neoformans: Association with the alpha-mating type. Proc. Natl. Acad. Sci. U.S.A., 93, 7327, 1996.
5. Lin, X., Hull, C.M., and Heitman, J., Sexual reproduction between partners of the same mating type in Cryptococcus neoformans. Nature, 434, 1017, 2005.
6. Casadevall, A. and Perfect, J., Cryptococcus neoformans. Washington, DC: American Society for Microbiology; 1990.
7. Nielsen, K., De Obaldia, A.L., and Heitman, J., Cryptococcus neoformans mates on pigeon guano: Implications for the realized ecological niche and globalization. Eukar. Cell, 6, 949, 2007. 8. Lin, X. and Heitman, J., The biology of the Cryptococcus neoformans species complex. Ann. Rev. Microbiol., 60, 69, 2006. 9. Goldman, D.L. et al., Phenotypic switching in the human pathogenic fungus Cryptococcus neoformans is associated with changes in virulence and pulmonary in¼ammatory response in rodents. Proc. Natl. Acad. Sci. U.S.A., 95, 14967, 1998. 10. Jain, N. and Fries, B.C., Phenotypic switching of Cryptococcus neoformans and Cryptococcus gattii. Mycopathologia, 166, 181, 2008. 11. Kidd, S.E. et al., Characterization of environmental sources of the human and animal pathogen Cryptococcus gattii in British Columbia, Canada, and the Paci�c northwest of the United States. Appl. Environ. Microbiol., 73, 1433, 2007. 12. Meyer, W. et al., IberoAmerican Cryptococcal S. Molecular typing of IberoAmerican Cryptococcus neoformans isolates. Emerg. Infect. Dis., 9, 189, 2003. 13. Viviani, M.A. et al., Identi�cation by polymerase chain reaction �ngerprinting of Cryptococcus neoformans serotype AD. J. Med. Vet. Mycol., 35, 355, 1997. 14. Boekhout, T. et al., Hybrid genotypes in the pathogenic yeast Cryptococcus neoformans. Microbiology, 147, 891, 2001. 15. Fraser, J.A. et al., Same-sex mating and the origin of the Vancouver Island Cryptococcus gattii outbreak. Nature, 437, 1360, 2005. 16. Litvintseva, A.P. et al., Multilocus sequence typing reveals three genetic subpopulations of Cryptococcus neoformans var. grubii (Serotype A), including a unique population in Botswana. Genetics, 172, 2223, 2006.
TABLE 72.1
Multilocus Sequence Typing Scheme
Gene Locus and Primer Sequence (5′-3′)
(Reference) PCR Cycling Conditions Start Sequence End Sequence Sequence Length (bp) rRNA intergenic spacer 1 (IGS1)
IGS1F ATCCTTTGCAGACGACTTGA
IGS1R GTGATCAGTGCATTGCATGA [16] 94°C 3 min—35 cycles: 94°C 30 s, 60°C 30 s, 72°C 1 min—72°C 10 min TAAGCCCTTGTTAA AGATTTATTG 723
Glyceraldehyde-3-phosphate dehydrogenase (GPD1)
GPD1F CCACCGAACCCTTCTAGGATA
GPD1R CTTCTTGGCACCTCCCTTGAG [15] 94°C 3 min—35 cycles: 94°C 45 s, 63°C 1 min, 72°C 2 min—72°C 10 min GGTTTCGGTACGG GACCCTGCCAA 543
Laccase (LAC1)
LAC1F AACATGTTCCCTGGGCCTGTG
LAC1R ATGAGAATTGAATCGCCTTGT [15] 94°C 3 min—30 cycles: 94°C 30 s, 58°C 30 s, 72°C 1 min—72°C 10 min GTAAGTATCAGCT CAAGCTAAACA 469
Phospholipase B (PLB1)
PLB1F CTTCAGGCGGAGAGAGGTTT
PLB1R GATTTGGCGTTGGTTTCAGT [16] 94°C 3 min, 30 cycles: 94°C 45 s, 61°C 45 s, 72°C 1 min—72°C 5 min TGTTACTTGGATT CTGGAACATCG 532
Orotidine monophosphate pyrophosphorylase (URA5)
URA5F ATGTCCTCCCAAGCCCTCGAC
URA5R TTAAGACCTCTGAACACCGTACTC [12] 94°C 3 min—35 cycles: 94°C 45 s, 63°C 1 min, 72°C 2 min—72°C 5 min TTTTCGGCAACTCT TGGAAAGCTC 601
Capsule-associated protein (CAP59)
CAP59F CTCTACGTCGAGCAAGTCAAG
CAP59R TCCGCTGCACAAGTGATACCC [15] 94°C 3 min—35 cycles: 94°C 30 s, 56°C 30 s, 72°C 1 min—72°C 5 min ACGGTACGCGCC GAGACAGAATG 559
Cu, Zn superoxyde dismutase (SOD1)
SOD1CNF AAGCCTCTCATCCATATCTT
SOD1CNR TTCAACCACGAATATGTA
SOD1CGF GATCCTCACGCCATTACG
SOD1CGR GAATGATGCGCTTAGTTGGA [54] 94°C 3 min—35 cycles: 94°C 30 s, 52°C 30 s, 72°C 1 min 30 s—72°C 5 min CCACGTGCTCGCA CCTGTCAATGC 700
17. Bovers, M. et al., Six monophyletic lineages identi�ed within Cryptococcus neoformans and Cryptococcus gattii by multi-locus sequence typing. Fungal Genet. Biol., 45, 400, 2008.
18. Viviani, M.A. et al., Molecular analysis of 311 Cryptococcus neoformans isolates from a 30-month ECMM survey of cryptococcosis in Europe. FEMS Yeast Res., 6, 614, 2006.
19. Yan, Z., Li, X.G., and Xu, J.P., Geographic distribution of mating type alleles of Cryptococcus neoformans in four areas of the United States. J. Clin. Microbiol., 40, 965, 2002.
20. Jain, N. et al., Molecular epidemiology of clinical Cryptococcus neoformans strains from India. J. Clin. Microbiol., 43, 5733, 2005.
21. Hironaga, M. et al., Mating types and serotypes of Cryptococcus neoformans isolated in Japan. Sabouraudia-J. Med. Vet. Mycol., 21, 73, 1983. 22. Lengeler, K.B., Cox, G.M., and Heitman, J., Serotype AD strains of Cryptococcus neoformans are diploid or aneuploid and are heterozygous at the mating-type locus. Infect. Immun., 69, 115, 2001.
23. Cogliati, M. et al., Origin of Cryptococcus neoformans var. neoformans diploid strains. J. Clin. Microbiol., 39, 3889, 2001.
24. Lin, X. et al., Diploids in the Cryptococcus neoformans serotype A population homozygous for the alpha mating type originate via unisexual mating. PLOS Pathog., 5, 1, 2009.
25. Ma, H.S. and May, R.C., Virulence in Cryptococcus Species. Adv. Appl. Mircobiol., 67, 131, 2009.
26. Williamson, P.R., Laccase and melanin in the pathogenesis of Cryptococcus neoformans. Front. Biosci., 2, 99, 1997.
27. van Duin, D., Casadevall, A., and Nosanchuk, J.D., Melanization of Cryptococcus neoformans and Histoplasma capsulatum reduces their susceptibilities to amphotericin B and caspofungin. Antimicrob. Agents Chemother., 46, 3394, 2002.
28. Kwon-Chung, K.J., Edman, J.C., and Wickes, B.L., Genetic association of mating types and virulence in Cryptococcus neoformans. Infect. Immun., 60, 602, 1992.
29. Barchiesi, F.et al., Comparative analysis of pathogenicity of Cryptococcus neoformans serotypes A, D and AD in murine cryptococcosis. J. Infect., 51, 10, 2005.
30. Nielsen, K. et al., Sexual cycle of Cryptococcus neoformans var. grubii and virulence of congenic a and alpha isolates. Infect. Immun., 71, 4831, 2003.
31. Casadevall, A., Antibody immunity and invasive fungal infections. Infect. Immun., 63, 4211, 1995.
32. Mukherjee, J., Scharff, M.D., and, Casadevall, A., Protective murine monoclonal antibodies to Cryptococcus neoformans. Infect. Immun., 60, 4534, 1992.
33. Syme, R.M. et al., Primary dendritic cells phagocytose Cryptococcus neoformans via mannose receptors and Fc gamma receptor II for presentation to T lymphocytes. Infect. Immun., 70, 5972, 2002. 34. Graybill, J.R. et al., Diagnosis and management of increased intracranial pressure in patients with AIDS and cryptococcal meningitis. Clin. Infect. Dis., 30, 47, 2000.
35. Patterson, T.F. and Andriole, V.T., Current concepts in cryptococcosis. Eur. J. Clin. Microbiol. Infect. Dis., 8, 457, 1989.
36. Park, B.J. et al., Estimation of the current global burden of cryptococcal meningitis among persons living with HIV/ AIDS. Aids, 23, 525, 2009. 37. Speed, B. and Dunt, D., Clinical and host differences between infections with the 2 varieties of Cryptococcus neoformans. Clin. Infect. Dis., 21, 28, 1995. 38. Datta, K. et al., Spread of Cryptococcus gattii into Paci�c Northwest Region of the United States. Emerg. Infect. Dis., 15, 1185, 2009. 39. Kwon-Chung, K. and Bennett, J., Medical Mycology. Philadelphia, PA: Lea & Febiger; 1992. 40. Jarvis, J.N. et al., Screening for cryptococcal antigenemia in patients accessing an antiretroviral treatment program in South Africa. Clin. Infect. Dis., 48, 856, 2009. 41. De Pauw, B. et al., Revised de�nitions of invasive fungal disease from the European Organization for Research and Treatment of Cancer/Invasive Fungal Infections Cooperative Group and the National Institute of Allergy and Infectious Diseases Mycoses Study Group (EORTC/MSG) Consensus Group. Clin. Infect. Dis., 46, 1813, 2008. 42. Prariyachatigul, C. et al., Assessment of a PCR technique for the detection and identi�cation of Cryptococcus neoformans. J. Med. Vet. Mycol., 34, 251, 1996. 43. Rappelli, P. et al., Development of a nested PCR for detection of Cryptococcus neoformans in cerebrospinal ¼uid. J. Clin. Microbiol., 36, 3438, 1998. 44. Paschoal, R.C. et al., Neurocryptococcosis: Diagnosis by PCR method. Rev. Inst. Med. Trop. Sao Paulo, 46, 203, 2004. 45. Saha, D.C. et al., Detection of Cryptococcus by conventional, serological and molecular methods. J. Med. Microbiol., 58, 1098, 2009. 46. Posteraro, B. et al., Reverse cross blot hybridization assay for rapid detection of PCR-ampli�ed DNA from Candida species, Cryptococcus neoformans, and Saccharomyces cerevisiae in clinical samples. J. Clin. Microbiol., 38, 1609, 2000. 47. Abbott, J.J., Hamacher, K.L., and Ahmed, I., In situ hybridization in cutaneous deep fungal infections: A valuable diagnostic adjunct to fungal morphology and tissue cultures. J. Cutan. Pathol., 33, 426, 2006. 48. Lau, A. et al., Multiplex tandem PCR: A novel platform for rapid detection and identi�cation of fungal pathogens from blood culture specimens. J. Clin. Microbiol., 46, 3021, 2008. 49. Veron, V. et al., Real-time polymerase chain reaction detection of Cryptococcus neoformans and Cryptococcus gattii in human samples. Diagn. Microbiol. Infect. Dis., 65, 69, 2009. 50. Meyer, W. et al., Consensus multi-locus sequence typing scheme for Cryptococcus neoformans and Cryptococcus gattii. Med. Mycol., 47, 561, 2009. 51. Hendolin, P.H. et al., Panfungal PCR and multiplex liquid hybridization for detection of fungi in tissue specimens. J. Clin. Microbiol., 38, 4186, 2000. 52. Bialek, R. et al., Detection of Cryptococcus neoformans DNA in tissue samples by nested and real-time PCR assays. Clin. Diagn. Lab. Immunol., 9, 461, 2002. 53. White, T. et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols: A Guide to Methods and Applications. Innis, M., Gelfand, D., Sninsky, J., and White, T. (Eds.), San Diego, CA: Academic Press, Inc.; 1990. 54. D’Souza, C.A. et al., Investigation of the basis of virulence in serotype A strains of Cryptococcus neoformans from apparently immunocompetent individuals. Curr. Genet., 46, 92, 2004. 73 Chapter 73 - Malassezia
1. Guého E, Midgley G, Guillot J. The genus Malassezia with description of four new species. Antonie Van Leeuwenhock 69, 337–355, 1996.
2. Guillot J, Hadina S, Guého E. The genus Malassezia: Old facts and new concepts. Parassitologia 50, 77–79, 2008.
3. Xu J et al. Dandruff-associated Malassezia genomes reveal convergent and divergent virulence traits shared with plant and human fungal pathogens. Proc. Natl. Acad. Sci. U.S.A. 104, 18730–18735, 2007.
4. Ashbee HR. Update on the genus Malassezia. Med. Mycol. 45, 287–303, 2007.
5. Faergemann J. Atopic dermatitis and fungi. Clin. Microbiol. Rev. 15, 545–563, 2002.
6. Batra R et al. Malassezia Baillon, emerging clinical yeasts. FEMS Yeast Res. 5, 1101–1113, 2005.
7. Takashima M. Importance of nomenclature for medically important fungi. Nippon Ishinkin Gakkai Zasshi 50, 263–267, 2009.
8. Sugita T et al. Molecular analysis of Malassezia micro¼ora on the skin of atopic dermatitis patients and healthy subjects. J. Clin. Microbiol. 39, 3486–3490, 2001.
9. Tajima M et al. Molecular analysis of Malassezia micro¼ora in seborrheic dermatitis patients: Comparison with other diseases and healthy subjects. J. Invest. Dermatol. 128, 345–351, 2008.
10. Morishita N, Sei Y, Sugita T. Molecular analysis of Malassezia micro¼ora from patients with pityriasis versicolor. Mycopathologia 161, 61–65, 2006.
11. Amaya M et al. Molecular analysis of Malassezia micro¼ora in the lesional skin of psoriasis patients. J. Dermatol. 34, 619– 624, 2007.
12. Takahata Y et al. Quantitative analysis of Malassezia in the scale of patients with psoriasis using a real-time polymerase chain reaction assay. Br. J. Dermatol. 157, 670–673, 2007.
13. Sugita T et al. Quantitative analysis of the cutaneous Malassezia microbiota in 770 healthy Japanese by age and gender using a real-time PCR assay. Med. Mycol. 48, 229– 233, 2010.
14. Lindborg M et al. Selective cloning of allergens from the skin colonizing yeast Malassezia furfur by phage surface display technology. J. Invest. Dermatol. 113, 156–161, 1999.
15. Schmidt M et al. The complete cDNA sequence and expression of the �rst major allergenic protein of Malassezia furfur, Mal f 1. Eur. J. Biochem. 246, 181–185, 1997.
16. Rasool O et al. Cloning, characterization and expression of complete coding sequences of three IgE binding Malassezia furfur allergens, Mal f 7, Mal f 8 and Mal f 9. Eur. J. Biochem. 267, 4355–4361, 2000.
17. Ishibashi Y et al. Identi�cation of the major allergen of Malassezia globosa relevant for atopic dermatitis. J. Dermatol. Sci. 55, 185–192, 2009.
18. Hamid Q, Boguniewicz M, Leung DY. Differential in situ cytokine gene expression in acute versus chronic atopic dermatitis. J. Clin. Invest. 94, 870–876, 1994.
19. Leung DY. Atopic dermatitis. New insights and opportunities for therapeutic intervention. J. Allergy Clin. Immunol. 105, 860–876, 2000.
20. Chen L et al. Early up-regulation of Th2 cytokines and late surge of Th1 cytokines in an atopic dermatitis model. Clin. Exp. Immunol. 138, 375–387, 2004.
21. Grone A. Keratinocytes and cytokines. Vet. Immunol. Immunopathol. 88, 1–12, 2002. 22. Watanabe S et al. The effects of Malassezia yeasts on cytokine production by human keratinocytes. J. Invest. Dermatol. 116, 769–773, 2001. 23. Ishibashi Y, Sugita T, Nishikawa A. Cytokine secretion pro�le of human keratinocytes exposed to Malassezia yeasts. FEMS Immunol. Med. Microbiol. 48, 400–409, 2006. 24. Witmer-Pack MD et al. Granulocyte-macrophage colonystimulating factor is essential for the viability and function of cultured murine epidermal Langerhans cells. J. Exp. Med. 166, 1484–1498, 1987. 25. Morales J et al. CTACK, a skin-associated chemokine that preferentially attracts skin-homing memory T cells. Proc. Natl. Acad. Sci. U.S.A. 96, 14470–14475, 1999. 26. Kakinuma T et al. Increased serum cutaneous T cell-attracting chemokine (CCL27) levels in patients, with atopic dermatitis and psoriasis vulgaris. J. Allergy Clin. Immunol. 111, 592– 597, 2003. 27. Kaneko T et al. Revised culture-based system for identi�cation of Malassezia species. J. Clin. Microbiol. 45, 3737–3742, 2007. 28. Kaneko T et al. Tween 40-based precipitate production observed on modi�ed chromogenic agar and development of biological identi�cation kit for Malassezia species. Med. Mycol. 44, 227–231, 2006. 29. Sugita T et al. Sequence diversity of the intergenic spacer region of the rRNA gene of Malassezia globosa colonizing the skin of patients with atopic dermatitis and healthy individuals. J. Clin. Microbiol. 41, 3022–3027, 2003. 30. Sugita T et al. Genotype analysis of Malassezia restricta as the major cutaneous ¼ora in patients with atopic dermatitis and healthy subjects. Microbiol. Immunol. 48, 755–759, 2004. 31. Sugita T et al. DNA sequence diversity of intergenic spacer I region in the non-lipid-dependent species Malassezia pachydermatis isolated from animals. Med. Mycol. 43, 21–26, 2005. 32. Sugita T et al. Sequence analysis of the ribosomal DNA intergenic spacer 1 regions of Trichosporon species. J. Clin. Microbiol. 40, 1826–1830, 2002. 33. Sugita T, Ikeda R, Nishikawa A. Analysis of Trichosporon isolates obtained from the houses of patients with summertype hypersensitivity pneumonitis. J. Clin. Microbiol. 42, 5467–5471, 2004. 34. Rodriguez-Tudela JL et al. Genotype distribution of clinical isolates of Trichosporon asahii based on sequencing of intergenic spacer 1. Diagn. Microbiol. Infect. Dis. 58, 435–440, 2007. 35. Kalkanci A et al. Molecular identi�cation, genotyping, and drug susceptibility of the basidiomycetous yeast pathogen Trichosporon isolated from Turkish patients. Med. Mycol. 48, 141–146, 2010. 36. Mekha N et al. Genotyping and antifungal drug susceptibility of the pathogenic yeast Trichosporon asahii isolated from Thai patients. Mycopathologia 169, 67–70, 2010. 37. Diaz MR et al. Molecular sequence analyses of the intergenic spacer (IGS) associated with rDNA of the two varieties of the pathogenic yeast, Cryptococcus neoformans. Syst. Appl. Microbiol. 23, 535–545, 2000. 38. Sugita T, Ikeda R, Shinoda T. Diversity among strains of Cryptococcus neoformans var. gattii as revealed by a sequence analysis of multiple genes and a chemotype analysis of capsular polysaccharide. Microbiol. Immunol. 45, 757– 768, 2001.
39. Boekhout T, Kamp M, Guého E. Molecular typing of Malassezia species with PFGE and RAPD. Med. Mycol. 36, 365–372, 1998. 40. Theelen B et al. Identi�cation and typing of Malassezia yeasts using ampli�ed fragment length polymorphism (AFLP), random ampli�ed polymorphic DNA (RAPD) and denaturing gradient gel electrophoresis (DGGE). FEMS Yeast Res. 1, 79–86, 2001.
41. Gaitanis G, Robert V, Velegraki A. Veri�able single nucleotide polymorphisms of the internal transcribed spacer 2 region for the identi�cation of 11 Malassezia species. J. Dermatol. Sci. 43, 214–217, 2006.
42. Mirhendi H et al. A simple PCR-RFLP method for identi�cation and differentiation of 11 Malassezia species. J. Microbiol. Methods 61, 281–284, 2005.
43. Gemmer CM et al. Fast, noninvasive method for molecular detection and differentiation of Malassezia yeast species on human skin and application of the method to dandruff microbiology. J. Clin. Microbiol. 40, 3350–3357, 2002. 44. Gaitanis G et al. Distribution of Malassezia species in pityriasis versicolor and seborrhoeic dermatitis in Greece. Typing of the major pityriasis versicolor isolate M. globosa. Br. J. Dermatol. 154, 854–859, 2006. 45. Sugita T et al. Quantitative analysis of cutaneous Malassezia in atopic dermatitis patients using real-time PCR. Microbiol. Immunol. 50, 549–552, 2006. 46. Takahata Y et al. Cutaneous Malassezia ¼ora in atopic dermatitis differs between adults and children. Br. J. Dermatol. 157, 1178–1182, 2007. 47. Paulino LC, Tseng CH, Blaser MJ. Analysis of Malassezia microbiota in healthy super�cial human skin and in psoriatic lesions by multiplex real-time PCR. FEMS Yeast Res. 8, 460– 471, 2008. 48. Akaza N et al. Malassezia folliculitis is caused by cutaneous resident Malassezia species. Med. Mycol. 47, 618–624, 2009. 74 Chapter 74 - Rhodotorula
14 Vancanneyt, M. et al., A taxonomic study of the basidiomycetous yeast genera Rhodosporidium Banno and Rhodotorula Harrison based on whole-cell protein patterns, DNA base compositions and coenzyme Q types, J. Gen. Appl. Microbiol., 38, 363, 1992.
15 Sampaio, J.P. et al., Polyphasic taxonomy of the basidiomycetous yeast genus Rhodosporidium: Rhodosporidium kratochvilovae and related anamorphic species, Int. J. Syst. Evol. Microbiol., 51, 687, 2001.
16 Gadanho, M. and Sampaio, J.P., Polyphasic taxonomy of the basidiomycetous yeast genus Rhodotorula: R. glutinis sensu stricto and R. dairenensis comb. nov., FEMS Yeast Res., 2, 47, 2002.
17 Libkind, D. et al., Mycosporines in carotenogenic yeasts, Syst. Appl. Microbiol., 28, 749, 2005.
18 Sampaio, J.P., Utilization of low molecular weight ligninrelated aromatic compounds for the selective isolation of yeasts: Rhodotorula vanillica, a new basidiomycetous yeast species, Syst. Appl. Microbiol., 17, 613, 1994.
19 Sláviková, E. and Vadkertiová, R., The occurrence of yeasts in the forest soils, J. Basic Microbiol., 40, 207, 2000.
20 Polyakova, A.V., Chernov, I.Y., and Panikov, N.W.S., Yeast diversity in hydromorphic soils with reference to a grasssphagnum wetland in western Siberia and hummocky Tundra Region at Cape Barrow (Alaska), Mikoobiologia, 70, 714, 2001.
21 Fonseca, A. and Inácio, J., Phylloplane yeasts, in Biodiversity and Ecophysiology of Yeasts, Rosa, C.A. and Gabor, P. (Eds.), p. 263, Springer, Berlin, Germany, 2006.
22 Libkind, D. et al., Molecular characterization of carotenogenic yeasts from aquatic environments in Patagonia, Argentina, Anton. Leeuwen., 84, 313, 2003.
23 de Almeida, J.M., Yeast community survey in the Tagus estuary, FEMS Microbiol. Ecol., 53, 295, 2005.
24 Gadanho, M., Almeida, J.M., and Sampaio, J.P., Assessment of yeast diversity in a marine environment in the south of Portugal by microsatellite-primed PCR, Anton. Leeuwen., 84, 217, 2003.
25 Nagahama, T., Distribution and identi�cation of red yeasts in deep-sea environments around the northwest Paci�c Ocean, Anton. Leeuwen., 80, 101, 2001.
26 Gadanho, M. and Sampaio, J.P., Occurrence and diversity of yeasts in the mid-Atlantic ridge hydrothermal �elds near the Azores Archipelago, Microb. Ecol., 50, 408, 2005.
27 Gadanho, M., Libkind, D., and Sampaio, J.P., Yeast diversity in the extreme acidic environments of the Iberian Pyrite Belt, Microb. Ecol., 52, 552, 2006.
28 Russo, G. et al., Yeast diversity at the Volcanic acidic environment of the Lake Caviahue and Rio Agrio (Patagonia, Argentina), FEMS Microbiol. Ecol., 65, 415, 2008.
29 de Silóniz, M.I. et al., Environmental adaptation factors of two yeasts isolated from the leachate of a uranium mineral heap, FEMS Microbiol. Lett., 210, 233, 2002.
30 Butinar, L., Spencer-Martins, I., and Gunde-Cimerman, N., Yeasts in high Arctic glaciers: The discovery of a new habitat for eukaryotic microorganisms, Anton. Leeuwen., 91, 277, 2007.
31 Starmer, W.T. et al., Yeasts in the genus Rhodotorula recovered from the Greenland ice sheet, in Life in Ancient Ice, Rogers, S.O. and Castello, J.D. (Eds.), p. 181, Princeton University Press, Princeton, NJ, 2005.
32 de García, V. et al., Biodiversity of cold-adapted yeasts from glacial meltwater rivers in Patagonia, Argentina, FEMS Microbiol. Ecol., 59, 331, 2007. 33 Tournas, V.H., Heeres, J., and Burgess, L., Moulds and yeasts in fruit salads and fruit juices, Food Microbiol., 23, 684, 2006. 34 Venturini, M.E., Oria, R., and Blanco, D., Micro¼ora of two varieties of sweet cherries: Burlat and Sweetheart, Food Microbiol., 19, 15, 2002. 35 Las Heras-Vazquez, F.J. et al., Identi�cation of yeast species from orange fruit and juice by RFLP and sequence analysis of the 5.8S rRNA gene and the two internal transcribed spacers, FEMS Yeast Res., 3, 3, 2003. 36 Deak, T. and Beuchat, L., Handbook of Food Spoilage Yeasts, CRC, Boca Raton, FL, 1996. 37 Fleet, G.H., Yeasts in fruit and fruit products, in Yeasts in Food: Bene¡cial and Detrimental Aspects, Boekhout, T. and Robert, V. (Eds.), p. 267, Behr, Hamburg, 2003. 38 Senses-Ergul, S. et al., Characterization of some yeasts isolated from foods by traditional and molecular tests, Int. J. Food Microbiol., 108, 120, 2006. 39 Welthagen, J.J. and Viljoen, B.C., The isolation and identi�cation of yeasts obtained during the manufacture and ripening of Cheddar cheese, Food Microbiol., 16, 63, 1999. 40 Viljoen, B.C. and Greyling, T., Yeasts associated with Cheddar and Gouda making, Int. J. Food Microbiol., 28, 79, 1995. 41 Gardini, F. et al., A survey of yeasts in traditional sausages of southern Italy, FEMS Yeast Res., 1, 161, 2001. 42 Kajikazawa, T. et al., Detection of pathogenic yeasts from processed fresh edible sea urchins sold in a �sh market, Nipp. Ishin. Gak. Zas., 48, 169, 2007. 43 Eklund, M.W. et al., Characteristics of yeasts isolated from Paci�c crab meat, Appl. Microbiol., 13, 985, 1965. 44 Callon, C. et al., Stability of microbial communities in goat milk during a lactation year: Molecular approaches, Syst. Appl. Microbiol., 30, 547, 2007. 45 Mackenzie, D.W.R., Yeasts from human sources, Med. Mycol., 1, 8, 1962. 46 Alliot, C. et al., Opportunistic infection with Rhodotorula in cancer patients treated by chemotherapy: Two case reports, Clin. Oncol., 12, 115, 2000. 47 Braun, D.K. and Kaufmann, C.A., Rhodotorula fungemia: A lifethreatening complication of indwelling central venous catheters, Mycoses, 35, 305, 1999. 48 Galan-Sanchez, F. et al., Microbiological characteristics and susceptibility patterns of strains of Rhodotorula isolated from clinical specimens, Mycopathologia, 145, 109, 1999. 49 Hsueh, P.R. et al., Catheter-related sepsis due to Rhodotorula glutinis, J. Clin. Microbiol., 41, 857, 2003. 50 Strausbaugh, L.J. et al., High frequency of yeast carriage on hands of hospital personnel, J. Clin. Microbiol., 32, 2299, 1994. 51 Strausbaugh, L.J. et al., Comparison of three methods for recovery of yeasts from hands of health-care workers, J. Clin. Microbiol., 34, 471, 1996. 52 Rose, H.D. and Kurup, V.P., Colonization of hospitalized patients with yeast-like organisms, Med. Mycol., 15, 251, 1977. 53 Lo Re, V., Fishman, N.O., and Nachamkin, I., Recurrent catheter-related Rhodotorula rubra infection, Clin. Microbiol. Infect., 9, 897, 2003. 54 Hagan, M.E. et al., A pseudoepidemic of Rhodotorula rubra: A marker for microbial contamination of the bronchoscope, Infect. Control Hosp. Epidemiol., 16, 727, 1995. 55 Pfaller, M.A. and Diekema, D.J., Rare and emerging opportunistic fungal pathogens: Concern for resistance beyond Candida albicans and Aspergillus fumigatus, J. Clin. Microbiol., 42, 4419, 2004.
56 Hazen, K.C., New and emerging yeast pathogens, Clin. Microbiol. Rev., 8, 462, 1995.
57 Samonis, G. et al., Transient fungemia due to Rhodotorula rubra in a cancer patient: Case report and review of the literature, Infection, 29, 173, 2001.
58 Lunardi, L.W. et al., Epidemiology and outcome of Rhodotorula fungemia in a tertiary care hospital, Clin. Infect. Dis., 43, 60, 2006.
59 Maeder, M., et al., Aortic homograft endocarditis caused by Rhodotorula mucilaginosa, Infection, 31, 181, 2003.
60 Thanos, L. et al., Multifocal skeletal tuberculosis with Rhodotorula minuta co-infection, Scand. J. Infect. Dis., 38, 309, 2006.
61 Sabino, R. et al., Epidemiology of candidemia in oncology patients: A 6-year survey in a Portuguese central hospital, Med. Mycol., 5, 1–10, DOI: 10.1080/13693780903161216, 2009.
62 Louria, D.B. et al., Fungemia caused by ‘nonpathogenic’ yeasts, Arch. Intern. Med., 119, 247, 1967.
63 Anaissie, E. and Bodey, G.P., Nosocomial fungal infections: Old problems and new challenges, Infect. Dis. Clin. North Am., 3, 867, 1989.
64 Kiehn, T.E. and Armstrong, D., Changes in the spectrum of organisms causing bacteremia and fungemia in immunocompromised patients due to venous access devices, Eur. J. Clin. Microbiol. Infect. Dis., 9, 869, 1990.
65 Kiehn, T.E. et al., Sepsis due to Rhodotorula related to use of indwelling central venous catheters, Clin. Infect. Dis., 14, 841, 1992.
66 Tuon, F.F., Duboc de Almeida, G.M., and Costa, S.F., Central venous catheter-associated fungemia due to Rhodotorula spp.—A systematic review, Med. Mycol., 45, 441, 2007.
67 Romano, A. et al., Yeasts in external ocular in¼ammations, Ophthalmology, 170, 13, 1975.
68 Guerra, R. et al., Rhodotorula glutinis keratidis, Int. Ophtalmol., 16, 187, 1992.
69 Panda, A. et al., Rhodotorula sp. infection in corneal interface following lamellar keratoplasty—A case report, Acta Ophthalmol. Scand., 77, 227, 1999.
70 Gregory, J.K. and Haller, J.A., Chronic postoperative Rhodotorula endophthalmitis, Arch. Ophthalmol., 110, 1686, 1992.
71 Muralidhar, S. and Sulthana, C.M., Rhodotorula causing chronic Dacryocystitis: A case report, Ind. J. Ophthalmol., 43, 196, 1995.
72 Pore, R.S. and Chen, J., Meningitis caused by Rhodotorula, Sabouraudia, 14, 331, 1976.
73 Gyaurgieva, O.H., Bogomolova, T.S., and Gorshkova, G.I., Meningitis caused by Rhodotorula rubra in an HIV-infected patient, J. Med. Vet. Mycol., 34, 357, 1996.
74 Lanzafame, M. et al., Rhodotorula glutinis-related meningitis, J. Clin. Microbiol., 39, 410, 2001.
75 Flemming, R.V., Walsh, T.J., and Anaissie, E.J., Emerging and less common fungal pathogens, Infect. Dis. Clin. N. Am., 16, 915, 2002.
76 Thakur, K. et al., Meningitis caused by Rhodotorula rubra in an human immunode�ciency virus infected patient, Indian J. Med. Microbiol., 25, 166, 2007.
77 Baradkar, V.P. and Kumar, S., Meningitis caused by Rhodotorula mucilaginosa in human immunode�ciency virus seropositive patient, Ann. Indian Acad. Neurol., 11, 245, 2008.
78 Eisenberg, E.S. et al., Rhodotorula rubra peritonitis in patients undergoing continuous ambulatory peritoneal dialysis, Am. J. Med. 75, 349, 1983. 79 Ünal, A. et al., CAPD-related peritonitis caused by Rhodotorula mucilaginosa, Perit. Dial. Int., 29, 581, 2009. 80 Naveh, Y. et al., Endocarditis caused by Rhodotorula successfully treated with 5-¼uorocytosine, Br. Heart J., 37, 101, 1975. 81 Donald, F.E. and Sharp, J.F., Rhodotorula rubra ventriculitis, J. Infect., 16, 187, 1988. 82 Anaissie, E. et al., New spectrum of fungal infections in patients with cancer, Rev. Infect. Dis., 11, 369, 1989. 83 Kiraz, N., Gulbas, Z., and Akgun, Y., Case report: Rhodotorula mucilaginosa fungaemia due to use of indwelling venous catheters, Mycoses, 43, 209, 2000. 84 Zaas, A.K. et al., Risk of fungemia due to Rhodotorula and antifungal susceptibility testing of Rhotodorula isolates, J. Clin. Microbiol., 41, 5233, 2003. 85 Duboc De Almeida, G.M. et al., Rhodotorula spp. isolated from blood cultures: Clinical and microbiological aspects, Med. Mycol., 12, 1, 2008. 86 Neofytos, D., Horn, D., and De Simone, J.A. Jr., Rhodotorula mucilaginosa catheter-related fungemia in a patient with sickle cell disease: Case presentation and literature review, South Med. J., 100, 198, 2007. 87 Pien, F.D. et al., Rhodotorula septicemia: Two cases and a review of the literature, Mayo Clin. Proc., 55, 258, 1980. 88 Savini, V. et al., Femoral prosthesis infection by Rhodotorula mucilaginosa, J. Clin. Microbiol., 46, 3544, 2008. 89 Cutrona, A.F. et al., Rhodotorula minuta: An unusual fungal infection in hip joint prosthesis, Am. J. Orthop., 31, 137, 2002. 90 Lui, A.Y. et al., Amphotericin B lipid complex therapy in an AIDS patient with Rhodotorula rubra fungemia, Clin. Infect. Dis., 27, 892, 1998. 91 Papadogeorgakis, H. et al., Rhodotorula rubra fungaemia in an immunocompromised patient, J. Eur. Acad. Dermatol. Venerol., 12, 169, 1999. 92 Polo, R., Disseminated Rhodotorula rubra infection in an HIV-infected drug abuser, Eur. J. Med., 2, 252, 1993. 93 Rusthoven, J.J., Feld, R., and Tuffnell, P.G., Systemic infection by Rhodotorula spp. in the immunocompromised host, J. Infect., 8, 241, 1984. 94 Kofteridis, D. et al., Rhodotorula glutinis fungemia successfully treated with ¼uconazole: report of two cases, Int. J. Infect. Dis., 11, 179, 2006. 95 Riedel, D.J., Johnson, J.K., and Forrest, G.N., Rhodotorula glutinis fungemia in a liver kidney transplant patient, Transpl. Infect. Dis., 10, 197, 2008. 96 da Cunha, M.M.L. et al., Identi�cation, antifungal susceptibility and scanning electron microscopy of a keratinolytic strain of Rhodotorula mucilaginosa: A primary causative agent of onychomycosis, FEMS Immunol. Med. Microbiol., 55, 396, 2009. 97 Fung, H.B. et al., Rhodotorula mucilaginosa lymphadenitis in an HIV-infected patient, Int. J. Infect. Dis., 13, 27, 2009. 98 Tuon, F.F. and Costa, S.F., Rhodotorula infection. A systematic review of 128 cases from literature, Rev. Iberoam. Micol., 25, 135, 2008. 99 Krcmery, V. et al., Aetiology, antifungal susceptibility, risk factors and outcome in 201 fungaemic children: Data from a 12-year prospective national study from Slovakia, J. Med. Microbiol., 51, 110, 2002. 100. Nucci, M. et al., Fungal infections in neutropenic patients: A 8-year prospective study, Rev. Inst. Med. Trop. Sao Paulo, 37, 397, 1995.
101. Pfaller, M.A. et al., Results from the ARTEMIS DISK global antifungal surveillance study, 1997 to 2005: An 8.5-year analysis of susceptibilities of Candida species and other yeast species to ¼uconazole and voriconazole determined by CLSI standardized disk diffusion testing, J. Clin. Microbiol., 47, 117, 2009.
102. Goyal, R. et al., Rhodotorula mucilaginosa as a cause of persistent femoral nonunion, J. Postgrad. Med., 54, 25, 2008.
103. Walsh, T.J. et al., Infections due to emerging and uncommon medically important fungal pathogens, Clin. Microbiol. Infect., 10, 48, 2004.
104. Petrocheilou-Paschou, et al., Rhodotorula septicemia: Case report and minireview, Clin. Microbiol. Infect. Dis., 7, 88, 2001.
105. Ahmed, A. et al., A fatal case of Rhodotorula meningitis in AIDS, Med. Health R I, 81, 22, 1998.
106. Krcmery, V., Krupova, I., and Denning, D.W., Invasive yeast infections other than Candida spp. in acute leukaemia, J. Hosp. Infect., 41, 181, 1999.
107. Samonis, G. and Bafaloukos, D., Fungal infections in cancer patients: An escalating problem, In Vivo, 6, 183, 1992.
108. Vartivarian, S.E., Anassie, E.J., and Bodey, G.P., Emerging fungal pathogens in immunocompromising patients: Classi�cation, diagnosis, and management, Clin. Infect. Dis., 17, 487, 1993.
109. Georgiev, V.S., Opportunistic Infections: Treatment and Prophylaxis. Humana Press, Totowa, NJ, 2003.
110. Leeber, D.A. and Scher, I., Rhodotorula fungemia presenting as ‘endotoxic’ shock, Arch. Intern. Med., 123, 78, 1969.
111. Wheeler, R.T. et al., A Saccharomyces cerevisiae mutant with increased virulence, Proc. Natl. Acad. Sci. U.S.A., 100, 2766, 2003.
112. Garcia-Martos, P. et al., Asimilación de carbohidratos por cepas de Rhodotorula glutinis de origen clínico y ambiental, Rev. Iberoam. Micol., 21, 90, 2004.
113. Brizzio, S. et al., Extracellular enzymatic activities of basidiomycetous yeasts isolated from glacial and subglacial waters of northwest Patagonia (Argentina), Can. J. Microbiol., 53, 519, 2007.
114. Cafarchia, C. et al., Phospholipase activity of yeasts from wild birds and possible implications for human disease, Med. Mycol., 46, 429, 2008.
115. Diekema, D.J. et al., Activities of available and investigational antifungal agents against Rhodotorula species, J. Clin. Microbiol., 43, 476, 2005.
116. Gomez-Lopez, A. et al., Pharmacotherapy of yeast infections, Expert Opin. Pharmacother., 9, 2801, 2008.
117. Goldani, L.Z., Craven, D.E., and Sugar, A.M., Central venous catheter infection with Rhodotorula minuta in a patient with AIDS taking suppressive doses of ¼uconazole, J. Med. Vet. Mycol., 33, 267, 1995.
118. Marinova, I. et al., Rhodotorula spp. fungemia in a immunocompromised boy after neurosurgery successfully treated with miconazole and 5-¼ucytosine: Case report and review of the literature, Chemother., 40, 287, 1994.
119. Fanci, R. et al., Treatment of fungemia due to unusual pathogens in neutropenic patients: Report of two cases, J. Chemother., 9, 427, 1997.
120. Lanternier, F. and Lortholary, O., Liposomal amphotericin B: What is its role in 2008? Clin. Microbiol. Infect., 14, 71, 2008.
121. Navarro, J.T., Lauzurica, R., and Gimenez, M., Rhodotorula rubra infection in a kidney transplant patient with pancytopenia, Haematologia, 86, 111, 2001. 122. Preney, L. et al., Experimental evaluation of antifungal and antiseptic agents against Rhodotorula spp., Mycoses, 46, 492, 2003. 123. Thompson, G.R. et al., In vitro activity of isavuconazole against Trichosporon, Rhodotorula, Geotrichum, Saccharomyces and Pichia species, J. Antimicrob. Chemoth., 64, 79, 2009. 124. Silici, S., Antifungal activities of propolis collected by different races of honeybees against yeasts isolated from patients with super�cial mycoses, J. Pharmacol. Sci., 99, 39, 2005. 125. Giusiano, G. et al., Fluconazole and itraconazole resistance of yeasts isolated from the bloodstream and catheters of hospitalized pediatric patients, Chemotherapy, 52, 254, 2006. 126. Fleet, G., Spoilage yeasts, Crit. Rev. Biotechnol., 12, 1, 1992. 127. Dooley, D.P., Beckius, M.L., and Jeffrey, B.S., Misidenti�cation of clinical yeast isolates by using the updated Vitek Yeast Biochemical Card, J. Clin. Microbiol., 32, 2889, 1994. 128. Ramani, R. et al., Ef�cacy of API 20C and ID 32C systems for identi�cation of common and rare clinical yeast isolates, J. Clin. Microbiol., 36, 3396, 1998. 129. Chen, Y.C. et al., Identi�cation of medically important yeasts using PCR-based detection of DNA sequence polymorphisms in the internal transcribed spacer 2 region of the rRNA genes, J. Clin. Microbiol., 38, 2302, 2000. 130. Chen, Y.C. et al., Polymorphic internal transcribed spacer region 1 DNA sequences identify medically important yeasts, J. Clin. Microbiol., 39, 4042, 2001. 131. Coignard, C. et al., Resolution of discrepant results for Candida species identi�cation by using DNA probes, J. Clin. Microbiol., 42, 858, 2004. 132. Li, Y.L. et al., Rapid identi�cation of yeasts commonly found in positive blood cultures by ampli�cation of the internal transcribed spacer regions 1 and 2, Eur. J. Clin. Microbiol. Infect. Dis., 22, 693, 2003. 133. Ciardo, D.E. et al., Internal transcribed spacer sequencing versus biochemical pro�ling for identi�cation of medically important yeasts, J. Clin. Microbiol., 44, 77, 2006. 134. Massonet, C. et al., Comparison of VITEK 2 with ITS2fragment length polymorphism analysis for identi�cation of yeast species, J. Clin. Microbiol., 42, 2209, 2004. 135. Szabó, Z. et al., Evaluation of the new Micronaut-Candida system compared to the API ID32C method for yeast identi�cation, J. Clin. Microbiol., 46, 1824, 2008. 136. Hsiue, H.-C. et al., Rapid identi�cation of fungal pathogens in positive blood cultures using oligonucleotide array hybridization, Clin. Microbiol. Infect., 16, 493–500, DOI: 10.1111/j.1469–0691.2009.02828.x, 2009. 137. Reiss, E. et al., Molecular diagnosis and epidemiology of fungal infections, Med. Mycol., 36, 249, 1998. 138. Fell, J.W., Rapid identi�cation of yeast species using three primers in a polymerase chain reaction, Mol. Mar. Biol. Biotech., 2, 174, 1993. 139. Fell, J.W., rDNA targeted oligonucleotide primers for the identi�cation of pathogenic yeasts in a polymerase chain reaction, J. Ind. Microbiol., 14, 475, 1995. 140. Elie, C.M. et al., Rapid identi�cation of Candida species with species-speci�c DNA probes, J. Clin. Microbiol., 36, 3260, 1998. 141. Luo, G. and Mitchell, T.G., Rapid identi�cation of pathogenic fungi directly from cultures by using multiplex PCR, J. Clin. Microbiol., 40, 2860, 2002. 142. Innings, A. et al., Multiplex real-time PCR targeting the RNase P RNA gene for detection and identi�cation of Candida species in blood, J. Clin. Microbiol., 45, 874, 2007.
143. Schabereiter-Gurtner, C. et al., Development of novel realtime PCR assays for detection and differentiation of eleven medically important Aspergillus and Candida species in clinical specimens, J. Clin. Microbiol., 45, 906, 2007.
144. Libkind, D. et al., Studies on the heterogeneity of the carotenogenic yeast Rhodotorula mucilaginosa from Patagonia, Argentina, J. Basic Microbiol., 48, 93, 2008.
145. Loef¼er, J. et al., Detection of PCR-ampli�ed fungal DNA by using a PCR-ELISA system, Med. Mycol., 36, 275, 1998.
146. Wang, Q.-M. et al., Rapid differentiation of phenotypically similar yeast species by single-strand conformation polymorphism analysis of ribosomal DNA, Appl. Environ. Microbiol., 74, 2604, 2008.
147. McCullough, M.J. et al., Intergenic transcribed spacer PCR ribotyping for differentiation of Saccharomyces species and interspeci�c hybrids, J. Clin. Microbiol., 36, 1035, 1998.
148. Esteve-Zarzoso, B. et al., Identi�cation of yeasts by RFLP analysis of the 5.8S rRNA gene and the two ribosomal internal transcribed spacers, Int. J. Syst. Bacteriol., 49, 329, 1999.
149. de Llanos Frutos, R., Fernandez-Espinar, M.T., and Querol., A., Identi�cation of species of the genus Candida by analysis of the 5.8S rRNA gene and the two ribosomal internal transcribed spacers, Anton. Leeuwen., 85, 175, 2004.
150. Bai, F.-Y., Liang, H.-Y., and Jia, J.-H., Taxonomic relationships among the taxa in the Candida guilliermondii complex, as revealed by comparative electrophoretic karyotyping, Int. J. Syst. Evol. Microbiol., 50, 417, 2000.
151. Boekhout, T. et al., The use of karyotyping in the systematics of yeasts, Anton. Leeuwen., 63, 157, 1993.
152. Saracli, M.A. et al., Genotyping of clinical Rhodotorula mucilaginosa isolates by pulsed �eld gel electrophoresis, Mycoses, 46, 487, 2003.
153. Gadanho, M. and Sampaio, J.P., Application of temperature gradient gel electrophoresis to the study of yeast diversity in the estuary of the Tagus river, Portugal, FEMS Yeast Res., 5, 253, 2004.
154. Gadanho, M. and Sampaio, J.P., Microeukaryotic diversity in the extreme environments of the Iberian Pyrite Belt: A comparison between universal and fungi-speci�c primer sets, temperature gradient gel electrophoresis and cloning, FEMS Microbiol. Ecol., 57, 139, 2006.
155. Theelen, B. et al., Identi�cation and typing of Malassezia yeasts using ampli�ed fragment length polymorphism (AFLP), random ampli�ed polymorphic DNA (RAPD) and denaturing gradient gel electrophoresis (DGGE), FEMS Yeast Res., 1, 79, 2001.
156. Manzano, M. et al., PCR-DGGE differentiation of strains of Saccharomyces sensu stricto, Anton. Leeuwen., 85, 23, 2004.
157. Aquilanti, L. et al., The microbial ecology of a typical Italian salami during its natural fermentation, Int. J. Food Microbiol., 120, 136, 2007.
158. Prakitchaiwattana, C.J., Fleet, G.H., and Heard, G.M., Application and evaluation of denaturing gradient gel electrophoresis to analyse the yeast ecology of wine grapes, FEMS Yeast Res., 4, 865, 2004.
159. Gupta, A.K. et al., Identi�cation and typing of Malassezia species by ampli�ed fragment length polymorphism and sequence analyses of the internal transcribed spacer and largesubunit regions of ribosomal DNA, J. Clin. Microbiol., 42, 4253, 2004.
160. Bovers, M. et al., Identi�cation of genotypically diverse Cryptococcus neoformans and Cryptococcus gattii isolates by Luminex xMAP technology, J. Clin. Microbiol., 45, 1874, 2007. 161. Diaz, M.R. et al., Microcoding and ¼ow cytometry as a highthroughput fungal identi�cation system for Malassezia species, J. Med. Microbiol., 55, 1197, 2006. 162. Page, B.T. et al., Rapid identi�cation of ascomycetous yeasts from clinical specimens by a molecular method based on ¼ow cytometry and comparison with identi�cations from phenotypic assays, J. Clin. Microbiol., 44, 3167, 2006. 163. Leaw, S.N. et al., Identi�cation of medically important Candida and non-Candida yeast species by an oligonucleotide array, J. Clin. Microbiol., 45, 2220, 2007. 164. Leinberger, D.M. et al., Development of a DNA microarray for detection and identi�cation of fungal pathogens involved in invasive mycoses, J. Clin. Microbiol., 43, 4943, 2005. 165. Campa, D. et al., A DNA microarray based on Arrayed-Primer Extension (APEX) technique for identi�cation of pathogenic fungi responsible for invasive and super�cial mycoses, J. Clin. Microbiol., 46, 909, 2008. 166. Fell, J.W. et al., Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis, Int. J. Syst. Evol. Microbiol., 50, 1351, 2000. 167. Scorzetti, G. et al., Systematics of basidiomycetous yeasts: A comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions, FEMS Yeast Res., 2, 495, 2002. 168. Latouche, G.N. et al., Comparison of use of phenotypic and genotypic characteristics for identi�cation of species of the anamorph genus Candida and related teleomorph yeast species, J. Clin. Microbiol., 35, 3171, 1997. 169. San-Blas, G. and Niño-Vega, G., New approaches in the diagnosis of medically relevant mycoses: Fungal identi�cation by molecular techniques, in Pathogenic Fungi: Insights in Molecular Biology, San-Blas, G. and Calderone, R.A. (Eds.), Chap. 8, Caister Academic Press, Wymondham, U.K., 2008. 170. Villa-Carvajal, M., Querol, A., and Belloch, C., Identi�cation of species in the genus Pichia by restriction of the internal transcribed spacers (ITS1 and ITS2) and the 5.8S ribosomal DNA gene, Anton. Leeuwen., 90, 171, 2006. 171. Linton, C.J., Molecular identi�cation of unusual pathogenic yeast isolates by large ribosomal subunit gene sequencing: 2 years of experience at the United Kingdom mycology reference laboratory, J. Clin. Microbiol., 45, 1152, 2007. 172. Leaw, S.N. et al., Identi�cation of medically important yeast species by sequence analysis of the internal transcribed spacer regions, J. Clin. Microbiol., 44, 693, 2006. 173. Silva, J.O. et al., Performance of selective and differential media in the primary isolation of yeasts from different biological samples, Mycopathology, 157, 29, 2004. 174. Guillamón, J.M. et al., Rapid identi�cation of wine yeast species based on RFLP analysis of the ribosomal internal transcribed spacer (ITS) region, Arch. Microbiol., 169, 387, 1998. 175. Sabate, J. et al., Isolation and identi�cation of yeasts associated with vineyard and winery by RFLP analysis of ribosomal genes and mitochondrial DNA, Microbiol Res., 157, 267, 2002. 176. Kurtzman, C. and Fell, J.W., Yeast systematics and phylogeny—Implications of molecular identi�cation methods for studies in ecology, in Biodiversity and Ecophysiology of Yeasts, Rosa, C.A. and Gabor, P. (Eds.), Chap. 2, Springer, Berlin, Germany, 2006. 177. James, S.A., Collins, M.D., and Roberts, I.N., Use of an rRNA internal transcribed spacer region to distinguish phylogenetically closely related species of the genera Zygosaccharomyces and Torulaspora, Int. J. Syst. Bacteriol., 46, 189, 1996.
178. Kurtzman, C.P. and Robnett, C.J., Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses, FEMS Yeast Res., 3, 417, 2003.
179. Altschul, S.F. et al., Gapped BLAST and PSI-BLAST: A new generation of protein database search programs, Nucleic Acids Res., 25, 3389, 1997.
180. Salvarangan, R. et al., Rapid identi�cation of commonly encountered Candida species directly from blood culture bottles, J. Clin. Microbiol., 41, 5660, 2003.
181. Spiess, B. et al., DNA microarray-based detection and identi�cation of fungal pathogens in clinical samples from neutropenic patients, J. Clin. Microbiol., 45, 3743, 2007.
182. Vollmer, T. et al., Evaluation of novel broad-range real-time PCR assay for rapid detection of human pathogenic fungi in various clinical specimens, J. Clin. Microbiol., 46, 1919, 2008.
183. Wilson, D.A. et al., Multicenter evaluation of a Candida albicans peptide nucleic acid ¼uorescent in situ hybridization probe for characterization of yeast isolates from blood cultures, J. Clin. Microbiol., 43, 2909, 2005.
184. Herzberg, M., Fischer, R., and Titze, A., Con¼icting results obtained by RAPD-PCR and large-subunit rDNA sequences in determining and comparing yeast strains isolated from ¼owers: A comparison of two methods, Int. J. Syst. Evol. Microbiol., 52, 1423, 2002.
185. Vermitsky, J.-P. et al., Survey of vaginal-¼ora Candida species isolates from women of different age groups by use of speciesspeci�c PCR detection, J. Clin. Microbiol., 46, 1501, 2008. 186. Walsh, T.J. et al., PCR and single-strand conformational polymorphism for recognition of medically important opportunistic fungi, J. Clin. Microbiol., 33, 3216, 1995. 187. Sugita, T. et al., Sequence analysis of the ribosomal DNA intergenic spacer 1 regions of Trichosporon species, J. Clin. Microbiol., 40, 1826, 2002. 188. Sugita, T. et al., Sequence diversity of the intergenic spacer region of the rRNA gene of Malassezia globosa colonizing the skin of patients with atopic dermatitis and healthy individuals, J. Clin. Microbiol., 41, 3022, 2003. 189. Biswas, S.K. et al., Molecular phylogenetics of the genus Rhodotorula and related basidiomycetous yeasts inferred from the mitochondrial cytochrome b gene, Int. J. Syst. Evol. Microbiol., 51, 1191, 2001. 190. Trnovsky, J. et al., Rapid and accurate identi�cation of Candida albicans isolates by use of PNA FISH Flow , J. Clin. Microbiol., 46, 1537, 2008. 191. Montero, C.I. et al., Evaluation of Pyrosequencing ® technology for the identi�cation of clinically relevant non-dematiaceous yeasts and related species, Eur. J. Clin. Microbiol. Infect. Dis., 27, 821, 2008. 192. Diaz, M.R. et al., Molecular sequence analyses of the intergenic spacer (IGS) associated with rDNA of the two varieties of the pathogenic yeast, Cryptococcus neoformans, Syst. Appl. Microbiol., 23, 535, 2000. 75 Chapter 75 - Schizophyllum
1 O’Brien, M. et al., Fungi isolated from contaminated baled grass silage on farms in the Irish Midlands, FEMS Microbiol. Lett., 247, 131, 2005.
2 Han, C.H. et al., A novel homodimeric lactose-binding lectin from the edible split gill medicinal mushroom Schizophyllum commune, Biochem. Biophys. Res. Commun., 336, 252, 2005.
3 Ishiguro, T. et al., Pulmonary Schizophyllum commune infection developing mucoid impaction of the bronchi, Yale J. Biol. Med., 80, 105, 2007.
4 Chumkhunthod, P. et al., Puri�cation and characterization of an N-acetyl-d-galactosamine-speci�c lectin from the edible mushroom Schizophyllum commune, Biochim. Biophys. Acta, 1760, 326, 2006.
5 Adejoye, B.C. et al., Physicochemical studies on Schizophyllum commune (Fries) a Nigerian edible fungus, World Appl. Sci. J., 2, 73, 2007.
6 Dijk, H., Onguene, N.A., and Kuyper, T.W., Knowledge and utilization of edible mushrooms by local populations of the rain forest of South Cameroon, AMBIO, 32, 19, 2003.
7 Ruan-Soto, F., Garibay-Orijel, R., and Cifuentes, J., Process and dynamics of traditional selling wild edible mushrooms in tropical Mexico, J. Ethnobiol. Ethnomed., 2, 3, 2006.
8 Wasser, S.P. and Weis, A.L., Therapeutic effects of substances occurring in higher Basidiomycetes mushrooms: A modern perspective, Crit. Rev. Immunol., 19, 65, 1999.
9 Borchers, A.T. et al., The immunobiology of mushrooms, Exp. Biol. Med. (Maywood), 233, 259, 2008. 10 Miyazaki, K. et al., Activated (HLA-DR+) T-lymphocyte subsets in cervical carcinoma and effects of radiotherapy and immunotherapy with sizo�ran on cell-mediated immunity and survival, Gynecol. Oncol., 56, 412, 1995. 11 Casselton, L.A. and Olesnicky, N.S., Molecular genetics of mating recognition in basidiomycete fungi, Microbiol. Mol. Biol. Rev., 62, 55, 1998. 12 Schubert, D. et al., Ras GTPase-activating protein gap1 of the homobasidiomycete Schizophyllum commune regulates hyphal growth orientation and sexual development, Eukaryot. Cell, 5, 683, 2006. 13 de Hoog, G.S., Filamentous basidiomycetes, Atlas of Clinical Fungi, 2nd edn., p. 242, Universitat Rovira i Virgili, Reus, 2000. 14 Raper, J.R., Boyd, D.H., and Raper, C.A., Primary and secondary mutations at the incompatibility loci in Schizophyllum, Proc. Natl. Acad. Sci. U.S.A., 53, 1324, 1965. 15 Fowler, T.J. et al., Crossing the boundary between the Balpha and Bbeta mating-type loci in Schizophyllum commune, Fungal Genet. Biol., 41, 89, 2004. 16 Sigler, L. et al., Maxillary sinusitis caused by medusoid form of Schizophyllum commune, J. Clin. Microbiol., 37, 3395, 1999. 17 Vaillancourt, L.J. et al., Multiple genes encoding pheromones and a pheromone receptor de�ne the B beta 1 mating-type speci�city in Schizophyllum commune, Genetics, 146, 541, 1997. 18 Raper, C.A. and Raper, J.R., Mutations modifying sexual morphogenesis in Schizophyllum, Genetics, 54, 1151, 1966. 19 Wendland, J. et al., The mating-type locus B alpha 1 of Schizophyllum commune contains a pheromone receptor gene and putative pheromone genes, EMBO J., 14, 5271, 1995. 20 Wang, C.S. and Raper, J.R., Isozyme patterns and sexual morphogenesis in Schizophyllum, Proc. Natl. Acad. Sci. U.S.A., 66, 882, 1970. 21 Gola, S. and Kothe, E., The little difference: in vivo analysis of pheromone discrimination in Schizophyllum commune, Curr. Genet., 42, 276, 2003. 22 Fowler, T.J. et al., Multiple sex pheromones and receptors of a mushroom-producing fungus elicit mating in yeast, Mol. Biol. Cell, 10, 2559, 1999. 23 Gola, S., Hegner, J., and Kothe, E., Chimeric pheromone receptors in the basidiomycete Schizophyllum commune, Fungal Genet. Biol., 30, 191, 2000. 24 Kothe, E., Gola, S., and Wendland, J., Evolution of multispeci�c mating-type alleles for pheromone perception in the homobasidiomycete fungi, Curr. Genet., 42, 268, 2003. 25 Kothe, E., Mating types and pheromone recognition in the homobasidiomycete Schizophyllum commune, Fungal Genet. Biol., 27, 146, 1999. 26 Yue, C. et al., The speci�city determinant of the Y matingtype proteins of Schizophyllum commune is also essential for Y-Z protein binding, Genetics, 145, 253, 1997. 27 Kligman, A.M., A basidiomycete probably causing onychomycosis, J. Invest. Dermatol., 14, 67, 1950. 28 Kamei, K. et al., Allergic bronchopulmonary mycosis caused by the basidiomycetous fungus Schizophyllum commune, Clin. Infect. Dis., 18, 305, 1994. 29 Rosenthal, J. et al., Chronic maxillary sinusitis associated with the mushroom Schizophyllum commune in a patient with AIDS, Clin. Infect. Dis., 14, 46, 1992. 30 Marlier, S. et al., Chronic sinusitis caused by Schizophyllum commune in AIDS, Presse Med., 22, 1107, 1993.
31 Sigler, L. et al., Diagnostic dif�culties caused by a nonclamped Schizophyllum commune isolate in a case of fungus ball of the lung, J. Clin. Microbiol., 33, 1979, 1995.
32 Rihs, J.D., Padhye, A.A., and Good, C.B., Brain abscess caused by Schizophyllum commune: An emerging basidiomycete pathogen, J. Clin. Microbiol., 34, 1628, 1996.
33 Perkins, J.H. and Raper, J.R., Morphogenesis in Schizophyllum commune. 3. A mutation that blocks initiation of fruiting, Mol. Gen. Genet., 106, 151, 1970.
34 Raper, J.R. and Krongelb, G.S., Genetic and environmental aspects of fruiting in Schizophyllum commune, Mycologia, 50, 707, 1958.
35 Sigler, L. et al., Maxillary sinusitis caused by Schizophyllum commune and experience with treatment, J. Med. Vet. Mycol., 35, 365, 1997.
36 Tullio, V. et al., Schizophyllum commune: An unusual of agent bronchopneumonia in an immunocompromised patient, Med. Mycol., 46, 735, 2008.
37 Buzina, W. et al., Development of molecular methods for identi�cation of Schizophyllum commune from clinical samples, J. Clin. Microbiol., 39, 2391, 2001.
38 Summerbell, R.C., The benomyl test as a fundamental diagnostic method for medical mycology, J. Clin. Microbiol., 31, 572, 1993.
39 Iizasa, T. et al., Colonization with Schizophyllum commune of localized honeycomb lung with mucus, Respiration, 68, 201, 2001.
40 Ahmed, M.K. et al., Bilateral allergic fungal rhinosinusitis caused by Schizophillum commune and Aspergillus niger. A case report, Rhinology, 47, 217, 2009.
41 de Hoog, G.S. and Gerrits van den Ende, A.H., Molecular diagnostics of clinical strains of �lamentous Basidiomycetes, Mycoses, 41, 183, 1998.
42 Batista, A.C., Maia, J.A., and Singer, R., Basidioneuromycosis on man, An. Soc. Biol., 13, 52, 1995.
43 Restrepo, A. et al., Ulceration of the palate caused by a basidiomycete Schizophyllum commune, Sabouraudia, 11, 201, 1973.
44 Kern, M.E. and Uecker, F.A., Maxillary sinus infection caused by the homobasidiomycetous fungus Schizophyllum commune, J. Clin. Microbiol., 23, 1001, 1986.
45 Catalano, P. et al., Basidiomycetous (mushroom) infection of the maxillary sinus, Otolaryngol. Head Neck Surg., 102, 183, 1990.
46 Clark, S. et al., Schizophyllum commune: An unusual isolate from a patient with allergic fungal sinusitis, J. Infect., 32, 147, 1996.
47 Amitani, R. et al., Bronchial mucoid impaction due to the monokaryotic mycelium of Schizophyllum commune, Clin. Infect. Dis., 22, 146, 1996. 48 Tomita, K. et al., Allergic bronchopulmonary mycosis caused by Schizophyllum commune, Nihon Kyobu Shikkan Gakkai Zasshi, 34, 804, 1996. 49 Ikushima, S., Case of allergic bronchopulmonary mycosis caused by Schizophyllum commune, Jpn. J. Antibiot., 50, 47, 1997. 50 Yamashina, S., Case of allergic bronchopulmonary mycosis caused by Schizophyllum commune, Jpn. J. Antibiot., 50, 51, 1997. 51 Miyazaki, Y. et al., Mucoid impaction caused by monokaryotic mycelium of Schizophyllum commune in association with bronchiectasis, Intern. Med., 39, 160, 2000. 52 Itou, Y. et al., A case of mucoid impaction of bronchi (MIB) due to Schizophyllum commune, Nihon Kokyuki Gakkai Zasshi, 39, 266, 2001. 53 Yamasaki, A. et al., A case of allergic bronchopulmonary mycosis caused by Schizophyllum commune, Arerugi, 51, 439, 2002. 54 Kawayama, T. et al., Chronic eosinophilic pneumonia associated with Schizophyllum commune, Respirology, 8, 529, 2003. 55 Kawano, T. et al., Two cases of allergic bronchopulmonary mycosis caused by Schizophyllum commune in young asthmatic patients, Nihon Kokyuki Gakkai Zasshi, 41, 233, 2003. 56 Roh, M.L. et al., Sphenocavernous syndrome associated with Schizophyllum commune infection of the sphenoid sinus, Ophthal. Plast. Reconstr. Surg., 21, 71, 2005. 57 Baron, O. et al., Nucleotide sequencing for diagnosis of sinusal infection by Schizophyllum commune, an uncommon pathogenic fungus, J. Clin. Microbiol., 44, 3042, 2006. 58 Bulajic, N. et al., Schizophyllum commune associated with bronchogenous cyst, Mycoses, 49, 343, 2006. 59 Taguchi, K. et al., Allergic fungal sinusitis caused by Bipolaris spicifera and Schizophyllum commune, Med. Mycol., 45, 559, 2007. 60 Roan, J.N. et al., Pulmonary nodules caused by Schizophyllum commune after cardiac transplantation, J. Infect., 58, 164, 2009. 61 White, T.J. et al., Ampli�cation and direct sequencing of fungal ribosomal genes for phylogenetics, in PCR Protocols: A Guide to Methods and Applications, Innis, M.A. et al., eds., 2nd edn., p. 315, Academic Press Inc., San Diego, CA, 1990. 62 Pounder, J.I. et al., Discovering potential pathogens among fungi identi�ed as nonsporulating molds, J. Clin. Microbiol., 45, 568, 2007. 63 Loef¼er, J. et al., Comparison between plasma and whole blood specimens for detection of Aspergillus DNA by PCR, J. Clin. Microbiol., 38, 3830, 2000. 76 Chapter 76 - Sporobolomyces
1. Misra VC, Randhawa HS. Sporobolomyces salmonicolor var. ¡scherii, a new yeast. Arch. Microbiol. 1976;108(1):141–143.
2. Nakase T, Suzuki M. Sporobolomyces inositophilus, a new species of ballistosporous yeast isolated from a dead leaf of Sasa sp. in Japan. Anton Leeuwen 1987;53(4):245–251.
3. Nakase T, Suzuki M. Sporobolomyces yuccicola, a new species of ballistosporous yeast equipped with ubiquinone-9. Anton Leeuwen 1988;54(1):47–55.
4. Nakase T et al. The expanding realm of ballistosporous yeasts. Anton Leeuwen 1993;63(2):191–200.
5. Nakase T et al. Sporobolomyces magnisporus sp. nov., a new yeast species in the Erythrobasidium cluster isolated from plants in Taiwan. J. Gen. Appl. Microbiol. 2003;49(6):337–344.
6. Nakase T et al. Sporobolomyces diospyroris sp. nov., Sporobolomyces lophatheri sp. nov. and Sporobolomyces pyrrosiae sp. nov., three new species of ballistoconidium-forming yeasts in the Agaricostilbum lineage isolated from plants in Taiwan. J. Gen. Appl. Microbiol. 2005;51(5):277–286.
7. Sláviková E, Grabinska-Loniewska A. Sporobolomyces lactosus, a new species of ballistosporous yeast equipped with ubiquinone-10. Anton Leeuwen 1992;61(3):245–248.
8. Bai FY et al. Reclassi�cation of the Sporobolomyces roseus and Sporidiobolus pararoseus complexes, with the description of Sporobolomyces phaf¡i sp. nov. Int. J. Syst. Evol. Microbiol. 2002;52:2309–2314.
9. Fell JW et al. Recognition of the basidiomycetous yeast Sporobolomyces ruberrimus sp. nov. as a distinct species based on molecular and morphological analyses. FEMS Yeast Res. 2002;1:265–270.
10 Hamamoto M, Thanh VN, Nakase T. Bannoa hahajimensis gen. nov., sp. nov., and three related anamorphs, Sporobolomyces bischo¡ae sp. nov., Sporobolomyces ogasawarensis sp. nov. and Sporobolomyces syzygii sp. nov., yeasts isolated from plants in Japan. Int. J. Syst. Evol. Microbiol. 2002;52:1023–1032. 11 Zhao JH et al. Sporobolomyces bannaensis, a novel ballistoconidium-forming yeast species in the Sporidiobolus lineage. Int. J. Syst. Evol. Microbiol. 2003;53:2091–2093.
12 Wang QM, Bai FY. Four new yeast species of the genus Sporobolomyces from plant leaves. FEMS Yeast Res. 2004;4(6):579–586.
13 Libkind D et al. Sporidiobolus longiusculus sp. nov. and Sporobolomyces patagonicus sp. nov., novel yeasts of the Sporidiobolales isolated from aquatic environments in Patagonia, Argentina. Int. J. Syst. Evol. Microbiol. 2005;55:503–509. 14 Satoh K, Makimura K. Sporobolomyces koalae sp. nov., a basidiomycetous yeast isolated from nasal smears of Queensland koalas kept in a Japanese zoological park. Int. J. Syst. Evol. Microbiol. 2008;58:2983–2986. 15 Valério E, Gadanho M, Sampaio JP. Reappraisal of the Sporobolomyces roseus species complex and description of Sporidiobolus metaroseus sp. nov. Int. J. Syst. Evol. Microbiol. 2008;58:736–741. 16 Moore JE et al. Edible dates (Phoenix dactylifera), a potential source of Cladosporium cladosporioides and Sporobolomyces roseus: Implications for public health. Mycopathologia 2002;154(1):25–28. 17 Cockcroft DW et al. Sporobolomyces: A possible cause of extrinsic allergic alveolitis. J. Allergy Clin. Immunol. 1983;72(3):305–309. 18 Bergman AG, Kauffman CA. Dermatitis due to Sporobolomyces infection. Arch. Dermatol. 1984;120(8):1059–1060. 19 Bross JE et al. Pseudomeningitis caused by Sporobolomyces salmonicolor. Am. J. Infect. Control. 1986;14(5):220–223. 20 Morris JT, Beckius M, McAllister CK. Sporobolomyces infection in an AIDS patient. J. Infect. Dis. 1991;164:623–624. 21 Plazas J et al. Sporobolomyces salmonicolor lymphadenitis in an AIDS patient. Pathogen or passenger? AIDS 1994;8(3):387–388. 22 Seuri M et al. An outbreak of respiratory diseases among workers at a water-damaged building—A case report. Indoor Air 2000;10(3):138–145. 23 Sharma V, Shankar J, Kotamarthi V. Endogeneous endophthalmitis caused by Sporobolomyces salmonicolor. Eye (Lond.) 2006;20(8):945–946. 24 Serena C et al. In vitro antifungal susceptibilities of uncommon basidiomycetous yeasts. Antimicrob. Agents Chemother. 2004;48(7):2724–2726. 25 Serena C et al. In vitro interaction of micafungin with conventional and new antifungals against clinical isolates of Trichosporon, Sporobolomyces and Rhodotorula. J. Antimicrob. Chemother. 2005;55(6):1020. 26 Suh SO, Nakase T. Phylogenetic analysis of the ballistosporous anamorphic genera Udeniomyces and Bullera, and related basidiomycetous yeasts, based on 18S rDNA sequence. Microbiology 1995;141:901–906. 27 Wang QM et al. Rapid differentiation of phenotypically similar yeast species by single-strand conformation polymorphism analysis of ribosomal DNA. Appl. Environ. Microbiol. 2008;74(9):2604–2611. 28 Chen Y-C et al. Identi�cation of medically important yeasts using PCR-based detection of DNA sequence polymorphisms in the internal transcribed spacer region 2 of the rRNA genes. J. Clin. Microbiol. 2000;38:2302–2310. 20 Chen Y-C et al. Polymorphic internal transcribed spacer region 1 DNA sequences identify medically important yeasts. J. Clin. Microbiol. 2001;39:4042–4051. 30 Linton CJ et al. Molecular identi�cation of unusual pathogenic yeast isolates by large ribosomal subunit gene sequencing: 2 years of experience at the United Kingdom mycology reference laboratory. J. Clin. Microbiol. 2007;45(4):1152–1158. 31 Pounder JI et al. Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J. Clin. Microbiol. 2007;45:568–571. 32 Morrow JD. Prosthetic cranioplasty infection due to Sporobolomyces. J. Tenn. Med. Assoc. 1994;87(11):466–467. 77 Chapter 77 - Trichosporon
1. Sugita T. The genus Trichosporon. In The Yeasts, A Taxonomic Study, 5th edn., Boekhout T, Fell JW, Kurtzman CP (eds.). Elsevier, Amsterdam, the Netherlands, 2011, pp. 2015–2061.
2. Guého E et al. Trichosporon on humans: A practical account. Mycoses 37, 3–10, 1994.
3. Sugita T et al. Taxonomic position of deep-seated, mucosaassociated, and super�cial isolates of Trichosporon cutaneum from trichosporonosis patients. J. Clin. Microbiol. 33, 1368– 1370, 1995.
4. Sugita T et al. Taxonomic studies on clinical isolates from super�cial trichosporonosis patients by DNA relatedness. Jpn. J. Med. Mycol. 37, 107–110, 1996.
5. Watson KC, Kallichurum S. Brain abscess due to Trichosporon cutaneum. J. Med. Microbiol. 3, 191–193, 1970.
6. Goodman D et al. Breakthrough trichosporonosis in a bone marrow transplant recipient receiving caspofungin acetate. Clin. Infect. Dis. 35, E35–E36, 2002. 7. Matsue K et al. Breakthrough trichosporonosis in patients with hematologic malignancies receiving micafungin. Clin. Infect. Dis. 42, 753–757, 2006. 8. Asada N et al. Successful treatment of breakthrough Trichosporon asahii fungemia with voriconazole in a patient with acute myeloid leukemia. Clin. Infect. Dis. 43, e39–e41, 2006. 9. Bayramoglu G et al. Breakthrough Trichosporon asahii fungemia in neutropenic patient with acute leukemia while receiving caspofungin. Infection 36, 68–70, 2008. 10. Mekha N et al. Genotyping and antifungal drug susceptibility of the pathogenic yeast Trichosporon asahii isolated from Thai patients. Mycopathologia 169, 67–70, 2010. 11. Kalkanci A et al. Molecular identi�cation, genotyping, and drug susceptibility of the basidiomycetous yeast pathogen Trichosporon isolated from Turkish patients. Med. Mycol. 48, 141–146, 2010. 12. Sugita T et al. Sequence analysis of the ribosomal DNA intergenic spacer 1 regions of Trichosporon species. J. Clin. Microbiol. 40, 1826–1830, 2002. 13. Kustimur S et al. Nosocomial fungemia due to Trichosporon asteroides: Firstly described bloodstream infection. Diagn. Microbiol. Infect. Dis. 43, 167–170, 2002. 14. Sugita T et al. Two new yeasts, Trichosporon debeurmannianum sp. nov. and Trichosporon dermatis sp. nov., transferred from the Cryptococcus humicola complex. Int. J. Syst. Evol. Microbiol. 51, 1221–1228, 2001. 15. Koyanagi T et al. Autopsy case of disseminated Trichosporon inkin infection identi�ed with molecular biological and biochemical methods. Pathol. Int. 56, 738–743, 2006. 16. David C et al. Disseminated Trichosporon inkin and Histoplasma capsulatum in a patient with newly diagnosed AIDS. J. Am. Acad. Dermatol. 59, S13–S15, 2008. 17. Ağirbasli H et al. Two possible cases of Trichosporon infections in bone-marrow-transplanted children: The �rst case of T. japonicum isolated from clinical specimens. Jpn. J. Infect. Dis. 61, 130–132, 2008. 18. Marty FM, Barouch DH, Coakley EP, Baden LR. Disseminated trichosporonosis caused by Trichosporon loubieri. J. Clin. Microbiol. 41, 5317–5320, 2003. 19. Padhye AA et al. Trichosporon loubieri infection in a patient with adult polycystic kidney disease. J. Clin. Microbiol. 41, 479–482, 2003. 20. Lacasse A, Cleveland KO. Trichosporon mucoides fungemia in a liver transplant recipient: Case report and review. Transpl. Infect. Dis. 11, 155–159, 2009. 21. Ando M et al. Summer-type hypersensitivity pneumonitis. Intern. Med. 34, 707–712, 1995. 22. Sugita T, Ikeda R, Nishikawa A. Analysis of Trichosporon isolates obtained from the houses of patients with summer-type TABLE 77.4 Laboratory Features of Trichosporonosis in the Patient Day after transplant 59 61 62 68 72 75 76 78 81 83 86 90 104 Blood culture − + − − Urine culture + + + − Beta-d-glucan (pg/dL) ND 95 60 22 ND Serum glucuronoxylomannan − + + + − PCR (number of plasmid copy) ND 63 480 642 190 52 ND Note: ND, not detected. hypersensitivity pneumonitis. J. Clin. Microbiol. 42, 5467– 5471, 2004.
23. Sugita T et al. Genetic diversity and biochemical characteristics of Trichosporon asahii isolated from clinical specimens, houses of patients with summer-type-hypersensitivity pneumonitis, and environmental materials. J. Clin. Microbiol. 39, 2405–2411, 2001.
24. Gross JW, Kan VL. Trichosporon asahii infection in an advanced AIDS patient and literature review. AIDS 22, 793– 795, 2008.
25. Tokimatsu I, Kadota J. Emerging deep-seated fungal infection, trichosporonosis. Kansenshogaku Zasshi 80, 196–202, 2006.
26. Walsh TJ. Trichosporonosis. Infect. Dis. Clin. North Am. 3, 43–52, 1989.
27. Suzuki K et al. Fatal Trichosporon fungemia in patients with hematologic malignancies. Eur. J. Haematol. 84, 441–447, 2010.
28. Girmenia C et al. GIMEMA Infection Program. Invasive infections caused by Trichosporon species and Geotrichum capitatum in patients with hematological malignancies: A retrospective multicenter study from Italy and review of the literature. J. Clin. Microbiol. 43, 1818–1828, 2005.
29. Ruan SY, Chien JY, Hsueh PR. Invasive trichosporonosis caused by Trichosporon asahii and other unusual Trichosporon species at a medical center in Taiwan. Clin. Infect. Dis. 49, e11–e17, 2009.
30. Sugita T et al. Identi�cation of medically relevant Trichosporon species based on sequences of internal transcribed spacer regions and construction of a database for Trichosporon identi�cation. J. Clin. Microbiol. 37, 1985–1893, 1999. 31. Peterson SW, Kurtzman CP. Ribosomal RNA sequence divergence among sibling species of yeasts. Syst. Appl. Microbiol. 14, 124–129, 1991. 32. Diaz MR, Fell JW. High-throughput detection of pathogenic yeasts of the genus Trichosporon. J. Clin. Microbiol. 42, 3696–3706, 2004. 33. Nagai H et al. PCR detection of DNA speci�c for Trichosporon species in serum of patients with disseminated trichosporonosis. J. Clin. Microbiol. 37, 694–699, 1999. 34. Sugita T et al. A nested PCR assay to detect DNA in sera for the diagnosis of deep-seated trichosporonosis. Microbiol. Immunol. 45, 143–148, 2001. 35. Nakajima M, Sugita T, Mikami Y. Granuloma associated with Trichosporon asahii infection in the lung: Unusual pathological �ndings and PCR detection of Trichosporon DNA. Med. Mycol. 45, 641–644, 2007. 36. Sano M et al. Supplemental utility of nested PCR for the pathological diagnosis of disseminated trichosporonosis. Virchows Arch. 451, 929–935, 2007. 37. Hosoki K et al. Early detection of breakthrough trichosporonosis by serum PCR in a cord blood transplant recipient being prophylactically treated with voriconazole. J. Pediatr. Hematol. Oncol. 30, 917–919, 2008. 38. Mekha N et al. Real-time PCR assay to detect DNA in sera for the diagnosis of deep-seated trichosporonosis. Microbiol. Immunol. 51, 633–635, 2007. 39. Tsuji Y et al. Quantitative PCR assay used to monitor serum Trichosporon asahii DNA concentrations in disseminated trichosporonosis. Pediatr. Infect. Dis. J. 27, 1035–1037, 2008. 78 Chapter 78 - Ustilago and Pseudozyma
20. Biswas, S.K. et al. (2001). Molecular phylogenetics of the genus Rhodotorula and related basidiomycetous yeasts inferred from the mitochondrial cytochrome b gene. Int. J. Syst. Evol. Microbiol. 51, 1191–1199.
21. Stoll, M. et al. (2003). Molecular phylogeny of Ustilago and Sporisorium species (Basidiomycota, Ustilaginales) based on internal transcribed spacer (ITS) sequences. Can. J. Bot. 81(9), 976–984.
22. Martínez-Espinoza, A.D. et al. (2003). Use of PCR to detect infection of differentially susceptible maize cultivars using Ustilago maydis strains of variable virulence. Int. Microbiol. 6(2), 117–120. 23. Pounder, J.I. et al. (2007). Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J. Clin. Microbiol. 45, 568–571. 24. Zeng, J.S. et al. (2007). Spectrum of clinically relevant Exophiala species in the United States. J. Clin. Microbiol. 45(11), 3713–3720. 25. Leaw, S.N. et al. (2006). Identi�cation of medically important yeast species by sequence analysis of the internal transcribed spacer regions. J. Clin. Microbiol. 44(3), 693–699. 26. Valverde, M.E. et al. (1995). Huitlacoche (Ustilago maydis) as a food source—biology, composition, and production. Crit. Rev. Food Sci. Nutr. 35, 191–229. 79 Chapter 79 - Wallemia
1. The UniProt Consortium. Available at http://www.uniprot. org/, accessed on August 1, 2010.
2. Zalar, P. et al. (2005). Taxonomy and phylogeny of the osmophilic genus Wallemia (Wallemiomycetes and Wallemiales, cl. et ord. nov.). Anton Leeuwen 87:311.
3. Moore, R.T. (1986). A note on Wallemia sebi. Anton Leeuwen 52:183–187.
4. Reboux, G. et al. (2001). Role of molds in farmer’s lung disease in Eastern France. Am. J. Respir. Crit. Care Med. 163:1534–1539. 5. Vindelov, J. and N. Arneberg. (2001). Interactions between Zygosaccharomyces mellis and Wallemia sebi in diluted molasses. Int. J. Food Microbiol. 63:73–79. 6. Hanhela, R., K. Louhelainen, and A.-L. Pasanen. (1995). Prevalence of microfungi in Finnish cow barns and some aspects of the occurrence of Wallemia sebi and Fusaria. Scand. J. Work Environ. Health 21:223–228. 7. Lappalainen, S. et al. (1998). Serum IgG antibodies against Wallemia sebi and Fusarium species in Finnish farmers. Ann. Allergy Asthma Immunol. 81:585–592. 8. Sakamoto, T. et al. (1989a). Allergenic and antigenic activities of the osmophilic fungus Wallemia sebi asthmatic patients. Arerugi 38:352–359. 9. Sakamoto, T. et al. (1989b). Studies on the osmophilic fungus Wallemia sebi as an allergen evaluated by skin prick test and radioallergosorbent test. Int. Arch. Allergy Appl. Immunol. 90:368–372. 10. Roussel, S. et al. (2004). Microbiological evolution of hay and relapse in patients with farmer’s lung. Occup. Environ. Med. 61(1):e3. 11. Roussel, S. et al. (2005a). Evaluation of salting as a hay preservative against farmer’s lung disease agents. Ann. Agric. Environ. Med. 12:217–221. 12. Roussel, S. et al. (2005b). Farmer’s lung disease and microbiological composition of hay: A case-control study. Mycopathologia 160(4):273–279. 13. Gbaguidi-Haore, H. et al. (2009). Multilevel analysis of the impact of environmental factors and agricultural practices on the concentration in hay of microorganisms responsible for farmer’s lung disease. Ann. Agric. Environ. Med. 16:219–225. 14. Guarro, J. et al. (2008). Subcutaneous phaeohyphomycosis caused by Wallemia sebi in an immunocompetent host. J. Clin. Microbiol. 46(3):1129–1131. 15. Wood, G.M. et al. (1990). Studies on a toxic metabolite from the mould Wallemia. Food Addit. Contam. 7:69–77. 16. Wu, Z. et al. (2003). 18S rRNA gene variation among common airborne fungi, and development of speci�c oligonucleotide probes for the detection of fungal isolates. Appl. Environ. Microbiol. 69:5389–5397. 17. Pounder, J.I. et al. (2007). Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J. Clin. Microbiol. 45(2):568–571. 18. Bagyalakshmi, R. et al. (2008). Newer emerging pathogens of ocular non-sporulating molds (NSM) identi�ed by polymerase chain reaction (PCR)-based DNA sequencing technique targeting internal transcribed spacer (ITS) region. Curr. Eye Res. 33(2):139–147. 19. Zeng, Q.-Y. et al. (2004). Detection and quanti�cation of Wallemia sebi in aerosols by real-time PCR, conventional PCR, and cultivation. Appl. Environ. Microbiol. 70:7295–7302. 20. Zeng, J.S. et al. (2007). Spectrum of clinically relevant Exophiala species in the United States. J. Clin. Microbiol. 45(11):3713–3720.
Part III
Entomohpthoromycotina and Mucoromyotina 80 Chapter 80 - Apophysomyces
1. Misra, P.C., Srivastava, K.J., and Lata, K., Apophysomyces, a new genus of the Mucorales, Mycotaxon, 8, 377, 1979.
2. Ellis, J.J. and Ajello, L., An unusual source for Apophysomyces elegans and a method for stimulating sporulation of Saksenia vasiformis, Mycologia, 74, 144, 1982.
3. Winn, R.E., Ramsey, P.D., and Adams, E.D. Jr., Traumatic mucormycosis secondary to Apophysomyces elegans, a new genus of Mucorales [abstract], Clin. Res., 30, 382A, 1982.
4. Winn, R.E. et al., Traumatic zygomycosis due to Apophysomyces elegans, a new genus of the Mucorales [abstract no F-29], in: Proceedings of the 84th Annual Meeting of the American Society for Microbiology (St. Louis), Washington, DC, Am. Soc. Microbiol., p. 297, 1984.
5. Wieden, M.A. et al., Zygomycosis caused by Apophysomyces elegans, J. Clin. Microbiol., 22, 522, 1985.
6. Ellis, D.H., Systemic zygomycosis, in Topley and Wilson’s Microbes and Microbial Products, 10th edn., Volume 6: Medical Mycology, Merz, W.G., Hay, R.I. (Eds.), ASM Publisher, Washington DC, pp. 662–663. 7. Padhye, A.A. and Ajello, L., Simple method of inducing sporulation by Apophysomyces elegans and Saksenaea vasiformis, J. Clin. Microbiol., 26, 1861, 1988. 8. Cooter, R.D. et al., Burn wound zygomycosis caused by Apophysomyces elegans, J. Clin. Microbiol., 28, 2151, 1990. 9. Reddy, I.S. et al., Primary cutaneous mucormycosis (zygomycosis) caused by Apophysomyces elegans, Indian J. Dermatol. Venereol. Leprol., 74, 367, 2008. 10. Meis, J.F. et al., Severe osteomyelitis due to the zygomycete Apophysomyces elegans, J. Clin. Microbiol., 32, 3078, 1994. 11. Eaton, M.E. et al., Osteomyelitis of the sternum caused by Apophysomyces elegans. J. Clin. Microbiol., 32, 2827, 1994. 12. Lakshmi, V. et al., Zygomycotic necrotizing fasciitis caused by Apophysomyces elegans, J. Clin. Microbiol., 31, 1368, 1993. 13. Pasarell, L. and McGinnis, M.R., Viability of fungal cultures maintained at −70°C, J. Clin. Microbiol., 30, 1000, 1992. 14. Sedralis, T., Krishnan, S., and Holland J., Martini glass mucormycosis: Apophysomyces elegans infection in an immunocompetent host, Aust. J. Otolaryngol., 2, 600, 1997. 15. Saravia-Flores, M., Guaran, D.M., and Argueta, V., Invasive cutaneous infection caused by Apophysomyces elegans associated with a spider bite, Mycoses, 53, 259, 2010. 16. Burrell, S.R. et al., Apophysomyces elegans infection associated with cactus spine injury in an immunocompetent pediatric patient, Pediatr. Infect. Dis. J., 17, 663, 1998. 17. Lesueur, B.W., Warschaw, K., and Fredrikson, L., Necrotizing cellulitis caused by Apophysomyces elegans at a patch test site, Am. J. Contact Dermat., 13, 140, 2002. 18. Robeck, T.R. and Dalton, L.M., Saksenaea vasiformis and Apophysomyces elegans zygomycotic infections in bottlenose dolphins (Tursiops truncatus), a killer whale (Orcinus orca), and paci�c white-sided dolphins (Lagenorhynchus obliquidens), J. Zoo Wildlife Med., 33, 356, 2002. 19. Chakrabarti, A. et al., Apophysomyces elegans: An emerging zygomycete in India, J. Clin. Microbiol., 41, 783, 2003. 20. Kindo, A.J. et al., Fatal cellulitis caused by Apophysomyces elegans. Indian J. Med. Microbiol., 25, 285, 2007. 21. Mathews, M.S., Raman, A., and Nair, A., Nosocomial zygomycotic post-surgical necrotizing fasciitis in a healthy adult caused by Apophysomyces elegans in south India, J. Med. Vet. Mycol., 35, 61, 1997. 22. Chakrabarti, A. et al., Ten years’ experience in zygomycosis at a tertiary care centre in India. J. Infect., 42, 261, 2001. 23. Chakrabarti, A. et al., Primary cutaneous zygomycosis due to Saksenaea vasiformis and Apophysomyces elegans, Clin. Infect. Dis., 24, 580, 1997. 24. Thomas, A.J. et al., Apophysomyces elegans—Renal mucormycosis in a healthy host: A case report from south India, Indian J. Med. Microbiol., 26, 269, 2008. 25. Devi, S.C. et al., Favorable outcome of amphotericin B treatment of zygomycotic necrotizing fascitis caused by Apophysomyces elegans, Int. J. Dermatol., 47, 407, 2008. 26. Goyal, A. et al., Apophysomyces elegans causing acute otogenic cervicofacial zygomycosis involving salivary glands, Med. Mycol., 45, 457, 2007. 27. Suryanarayan Rao S. et al., Sinoorbital mucormycosis due to Apophysomyces elegans in immunocompetent individuals—An increasing trend, Am. J. Otolaryngol., 27, 366, 2006. 28. Chakrabarti, A. et al., The rising trend of invasive zygomycosis in patients with uncontrolled diabetes mellitus, Med. Mycol., 44, 335, 2006.
29. Jain, D. et al., Zygomycotic necrotizing fasciitis in immunocompetent patients: A series of 18 cases, Mod. Pathol., 19, 1221, 2006.
30. Sridhara, S.R. et al., Mucormycosis in immunocompetent individuals: An increasing trend, J. Otolaryngol., 34, 402, 2005.
31. Chakrabarti, A. et al., Craniofacial zygomycosis caused by Apophysomyces elegans. Mycoses, 40, 419, 1997.
32. Chugh, K.S. et al., Renal zygomycosis in otherwise healthy hosts, J. Mycol. Med., 6, 22, 1996.
33. Weinberg, W.G. et al., Invasive infection due to Apophysomyces elegans in immunocompetent hosts, Clin. Infect. Dis., 17, 881, 1993.
34. Radner, A.B., Witt, M.D., and Edwards, J.E. Jr., Acute invasive rhinocerebral zygomycosis in an otherwise healthy patient: Case report and review, Clin. Infect. Dis., 20, 163, 1995.
35. Snell, B.J. and Tavakoli, K., Necrotizing fasciitis caused by Apophysomyces elegans complicating soft-tissue and pelvic injuries in a tsunami survivor from Thailand, Plast. Reconstr. Surg., 119, 448, 2007.
36. Andresen, D. et al., Multifocal cutaneous mucormycosis complicating polymicrobial wound infections in a tsunami survivor from Sri Lanka, Lancet, 365, 876, 2005.
37. Liang, K.P. et al., Rhino-orbitocerebral mucormycosis caused by Apophysomyces elegans, J. Clin. Microbiol., 44, 892, 2006.
38. Naguib, M.T. et al., Apophysomyces elegans infection in a renal transplant recipient, Am. J. Kidney Dis., 26, 381, 1995.
39. Schütz, P. et al., Fatal rhino-orbito-cerebral zygomycosis caused by Apophysomyces elegans in a healthy patient, J. Oral Maxillofac. Surg., 64, 1795, 2006.
40. Brown, S.R., Shah, I.A., and Grinstead, M. Rhinocerebral mucormycosis caused by Apophysomyces elegans. Am. J. Rhinol., 12, 289, 1998.
41. Carter, J.E. and Ulusarac, O., Widespread cutaneous involvement by invasive Apophysomyces elegans in a gravid patient following trauma, Cutis, 72, 221, 2003.
42. Okhuysen, P.C. et al., Successful treatment of extensive posttraumatic soft-tissue and renal infections due to Apophysomyces elegans, Clin. Infect. Dis., 19, 329, 1994.
43. Cáceres, A.M. et al., Apophysomyces elegans limb infection with a favorable outcome: Case report and review, Clin. Infect. Dis., 25, 331, 1997.
44. Dannaoui, E. et al., Ef�cacy of antifungal therapy in a nonneutropenic murine model of zygomycosis, Antimicrob. Agents Chemother., 46, 1953, 2002.
45. Kordy, F.N. et al., Successful treatment of a child with posttraumatic necrotizing fasciitis caused by Apophysomyces elegans: Case report and review of literature, Pediatr. Infect. Dis. J., 23, 877, 2004.
46. Lawrence, R.M. et al., Systemic zygomycosis caused by Apophysomyces elegans, J. Med. Vet. Mycol., 24, 57, 1986.
47. Pitisuttithum, P. et al., Activity of posaconazole in the treatment of central nervous system fungal infections, J. Antimicrob. Chemother., 56, 745, 2005.
48. Jones, K.W. and Kaufman, L., Development and evaluation of an immunodiffusion test for diagnosis of systemic zygomycosis: Preliminary report, J. Clin. Microbiol., 7, 97, 1978. 49. Kaufman, L., Turner, L.F., and McLauglin, D.W., Indirect enzyme-linked immunosorbent assay for zygomycosis, J. Clin. Microbiol., 27, 1979, 1989. 50. Lombardi, G. et al., Exoantigen tests for the rapid and speci�c identi�cation of Apophysomyces elegans and Saksenaea vasiformis, J. Med. Vet. Mycol., 27, 113, 1989. 51. Voigt, K., Cigelnik, E., and O’donnell, K., Phylogeny and PCR identi�cation of clinically important zygomycetes based on nuclear ribosomal-DNA sequence data, J. Clin. Microbiol., 37, 3957, 1999. 52. Hata, D.J. et al., Real-time PCR method for detection of zygomycetes, J. Clin. Microbiol., 46, 2353, 2008. 53. Ribes, J.A., Vanover-Sams, C.L., and Baker, D.J., Zygomycetes in human disease, Clin. Microbiol. Rev., 13, 236, 2000. 54. Roden, M.M. et al., Epidemiology and outcome of zygomycosis: A review of 929 reported cases, Clin. Infect. Dis., 41, 634, 2005. 55. Spellberg, B., Edwards, J. Jr., and Ibrahim, A., Novel perspectives on mucormycosis: Pathophysiology, presentation and management, Clin. Microbiol. Rev., 18, 556, 2005. 56. Ibrahim, A.S. et al., Rhizopus oryzae adheres to, is phagocytosed by, and damages endothelial cells in vitro, Infect. Immun., 73, 778, 2005. 57. Ferguson, T.D. et al., Posaconazole treatment for Apophysomyces elegans rhino-orbital zygomycosis following trauma for a male with well-controlled diabetes, J. Clin. Microbiol., 45, 1648, 2007. 58. Garcia-Covarrubias, L. et al., Rhino-orbitocerebral mucormycosis attributable to Apophysomyces elegans in an immunocompetent individual: Case report and review of the literature, J. Trauma, 50, 353, 2001. 59. Newton, W.D., Cramer, F.S., and Norwood, S.H., Necrotizing fasciitis from invasive phycomycetes, Crit. Care Med., 15, 331, 1987. 60. Kimura, M., Smith, M.B., and McGinnis, M.R., Zygomycosis due to Apophysomyces elegans: Report of 2 cases and review of the literature, Arch. Pathol. Lab. Med., 123, 386, 1999. 61. Huffnagle, K.E. et al., Apophysomyces elegans as an agent of zygomycosis in a patient following trauma, J. Med. Vet. Mycol., 30, 83, 1992. 62. McGinnis, M.R. et al., Necrotizing fasciitis caused by Apophysomyces elegans, J. Mycol. Med., 3, 175, 1993. 63. Fairley, C. et al., Survival after rhino-orbital-cerebral mucormycosis in an immunocompetent patient, Ophthalmology, 107, 555, 2000. 64. Page, R., Gardam D.J., and Heath C.H., Severe cutaneous mucormycosis (Zygomycosis) due to Apophysomyces elegans, ANZ J. Surg., 71, 184, 2001. 65. Wang, J. et al., Systemic Apophysomyces elegans after trauma: Case report and literature review, Surg. Infect. (Larchmt.), 3, 283, 2002. 66. Blair, J.E. et al., Locally invasive cutaneous Apophysomyces elegans infection acquired from snapdragon patch test, Mayo Clin. Proc., 77, 717, 2002. 67. Ruiz, C.E. et al., Necrotizing fasciitis in an immunocompetent patient caused by Apophysomyces elegans, Biomedica, 24, 239, 2004. 81 Chapter 81 - Cokeromyces
1. Hibbett DS et al., A higher-level phylogenetic classi�cation of the fungi. Mycol Res. 2007;111:509–547.
2. Elgart ML. Zygomycosis. Dermatol Clin. 1996;14:141–146.
3. Ribes JA, Vanover-Sams CL, Baker DJ. Zygomycetes in human disease. Clin Microbiol Rev. 2000;13:236–301.
4. The UniProt Consortium. Available at http://www.uniprot. org/, accessed on August 1, 2010.
5. Kwon-Chung KJ, Bennett JE. Medical Mycology. Philadelphia, PA: Lea & Febiger; 1992.
6. Kemna ME et al., Cokeromyces recurvatus, a mucoraceous zygomycete rarely isolated in clinical laboratories. J Clin Microbiol. 1994;32(3):843–845.
7. Weitzman I et al., Zygospores: The last word in identi�cation of rare or atypical zygomycetes isolated from clinical specimens. J Clin Microbiol. 1995;33:781–783. 8. de Hoog GS et al., Atlas of Clinical Fungi. Baarn, the Netherlands: Centraalbureau voor Schimmelcultures; 2000. 9. Nielsen C et al., Isolation of Cokeromyces recurvatus, initially misidenti�ed as Coccidioides immitis, from peritoneal ¼uid in a cat with jejunal perforation. J Vet Diagn Invest. 2005;17:372–378. 10. Ryan LJ et al., Fatal Cokeromyces recurvatus Pneumonia: Report of a case highlighting the potential for histopathologic misdiagnosis as Coccidioides. Int J Surg Pathol. 2009. 11. Ramani R et al., Cokeromyces recurvatus as a human pathogenic fungus: Case report and critical review of the published literature. Pediatr Infect Dis J. 2000;19:155–158. 12. Axelrod P et al., Chronic cystitis due to Cokeromyces recurvatus: A case report. J Infect Dis. 1987;155(5):1062–1064. 13. Alvarez OA et al., Severe diarrhea due to Cokeromyces recurvatus in a bone marrow transplant recipient. Am J Gastroenterol. 1995;90(8):1350–1351. 14. Munipalli B, Rinaldi MG, Greenberg SB. Cokeromyces recurvatus isolated from pleural and peritoneal ¼uid: Case report. J Clin Microbiol. 1996;34(10):2601–2603. 15. Tsai TW et al., Cokeromyces recurvatus infection in a bone marrow transplant recipient. Bone Marrow Transplant. 1997;19(3):301–302. 16. Makimura K, Murayama SY, Yamaguchi H. Detection of a wide range of medically important fungi by the polymerase chain reaction. J Med Microbiol. 1994;40:358–364. 17. Haynes KA, et al., Rapid detection and identi�cation of pathogenic fungi by polymerase chain reaction ampli�cation of large subunit ribosomal DNA. J Med Vet Mycol. 1995;33:319–325. 18. Sandhu GS et al., Molecular probes for diagnosis of fungal infections. J Clin Microbiol. 1995;33:2913–2919. 19. Leaw SN et al., Identi�cation of medically important yeast species by sequence analysis of the internal transcribed spacer regions. J Clin Microbiol. 2006;44:693–699. 20. Voigt K, Cigelnik E, O’donnell K. Phylogeny and PCR identi�cation of clinically important Zygomycetes based on nuclear ribosomal-DNA sequence data. J Clin Microbiol. 1999;37(12):3957–3964. 21. White TJ et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA et al., Eds., PCR Protocols: A Guide to Methods and Applications. San Diego, CA: Academic Press, Inc.; 1990, pp. 315–322. 82 Chapter 82 - Cunninghamella
1. Weitzman, I. and Crist, M.Y., Studies with clinical isolates of Cunninghamella. I. Mating behavior, Mycologia, 71, 1024, 1979.
2. Jayasuriya, N.S. et al., An unusual presentation of rhinofacial zygomycosis due to Cunninghamella sp. in an immunocompetent patient: A case report and literature review, Oral Dis., 12, 67, 2006.
3. Ribes, J.A., Vanover-Sams, C.L., and Baker, D.J., Zygomycetes in human disease, Clin. Microbiol. Rev., 13, 236, 2000. 4. Richardson, M.D. and Koukila-Kahkola, P., Rhizopus, Rhizomucor, Absidia, and other agents of systemic and subcutaneous Zygomyceses, in Manual of Clinical Microbiology, p. 1839, Murray, P.R., Baron, E.J., Jorgensen, J.H., Landry, M.L., and Pfaller, M.A. (Eds.), ASM Press, Washington, DC, 2007. 5. Roden, M.M. et al., Epidemiology and outcome of zygomycosis: A review of 929 reported cases, Clin. Infect. Dis., 41, 634, 2005. 6. Frater, J.L., Hall, G.S., and Procop, G.W., Histologic features of zygomycosis: Emphasis on perineural invasion and fungal morphology, Arch. Pathol. Lab. Med., 125, 375, 2001. 7. Ortin, X. et al., Cunninghamella bertholletiae infection (mucormycosis) in a patient with acute T-cell lymphoblastic leukemia, Leuk. Lymphoma, 45, 617, 2004. 8. Darrisaw, L. et al., Cunninghamella infection post bone marrow transplant: Case report and review of the literature, Bone Marrow Transplant., 25, 1213, 2000. 9. Andrade, V.S. et al., A factorial design analysis of chitin production by Cunninghamella elegans, Can. J. Microbiol., 46, 1042, 2000. 10. Pothuluri, J.V. et al., Metabolism of metolachlor by the fungus Cunninghamella elegans, Arch. Environ. Contam. Toxicol., 32, 117, 1997. 11. Lisowska, K. and Dlugonski, J., Concurrent corticosteroid and phenanthrene transformation by �lamentous fungus Cunninghamella elegans, J. Steroid Biochem. Mol. Biol., 85, 63, 2003. 12. Parshikov, I.A. et al., Transformation of artemisinin by Cunninghamella elegans, Appl. Microbiol. Biotechnol., 64, 782, 2004. 13. Motohashi, K. et al., Cutaneous zygomycosis caused by Cunninghamella bertholletiae in a patient with chronic myelogenous leukemia in blast crisis, Am. J. Hematol., 84, 447, 2009. 14. Rickerts, V. et al., Cluster of pulmonary infections caused by Cunninghamella bertholletiae in immunocompromised patients, Clin. Infect. Dis., 31, 910, 2000. 15. Kontoyiannis, D.P. et al., Zygomycosis in a tertiary-care cancer center in the era of Aspergillus-active antifungal therapy: A case-control observational study of 27 recent cases, J. Infect. Dis., 191, 1350, 2005. 16. Prabhu, R.M. and Patel, R., Mucormycosis and entomophthoramycosis: A review of the clinical manifestations, diagnosis and treatment, Clin. Microbiol. Infect., 10, S31, 2004. 17. Marr, K.A. et al., Epidemiology and outcome of mould infections in hematopoietic stem cell transplant recipients, Clin. Infect. Dis., 34, 909, 2002. 18. Walsh, T.J. et al., Infections due to emerging and uncommon medically important fungal pathogens, Clin. Microbiol. Infect., 10, S48, 2004. 19. Gonzalez, C.E., Rinaldi, M.G., and Sugar, A.M., Zygomycosis, Infect. Dis. Clin. North Am., 16, 895, 2002. 20. Garey, K.W. et al., Cunninghamella bertholletiae infection in a bone marrow transplant patient: Amphotericin lung penetration, MIC determinations, and review of the literature, Pharmacotherapy, 21, 855, 2001. 21. Ibrahim, A.S., Spellberg, B., and Edwards, J. Jr., Iron acquisition: A novel perspective on mucormycosis pathogenesis and treatment, Curr. Opin. Infect. Dis., 21, 620, 2008. 22. Kanafani, Z.A. and Perfect, J.R., Antimicrobial resistance: Resistance to antifungal agents: Mechanisms and clinical impact, Clin. Infect. Dis., 46, 120, 2008.
23. Canuto, M.M. and Rodero, F.G., Antifungal drug resistance to azoles and polyenes, Lancet Infect. Dis., 2, 550, 2002.
24. Perlin, D.S., Resistance to echinocandin-class antifungal drugs, Drug Resist. Updat., 10, 121, 2007.
25. Larone, D.H., Medically Important Fungi: A Guide to Identi¡cation, ASM Press, Washington, DC, 2002.
26. Alastruey-Izquierdo, A. et al., Activity of posaconazole and other antifungal agents against Mucorales strains identi�ed by sequencing of internal transcribed spacers, Antimicrob. Agents Chemother., 53, 1686, 2009.
27. Alastruey-Izquierdo, A. et al., Prevalence and susceptibility testing of new species of Pseudallescheria and Scedosporium in a collection of clinical mold isolates, Antimicrob. Agents Chemother., 51, 748, 2007.
28. Alvarez, E. et al., Spectrum of zygomycete species identi�ed in clinically signi�cant specimens in the United States, J. Clin. Microbiol., 47, 1650, 2009.
29. Mitchell, T.G. et al., Unique oligonucleotide primers in PCR for identi�cation of Cryptococcus neoformans, J. Clin. Microbiol., 32, 253, 1994.
30. Viebahn, M. et al., Assessment of differences in ascomycete communities in the rhizosphere of �eld-grown wheat and potato, FEMS Microbiol. Ecol., 53, 245, 2005. 31. Gilgado, F. et al., Molecular phylogeny of the Pseudallescheria boydii species complex: Proposal of two new species, J. Clin. Microbiol., 43, 4930, 2005. 32. Voigt, K., Cigelnik, E., and O’Donnell, K., Phylogeny and PCR identi�cation of clinically important Zygomycetes based on nuclear ribosomal-DNA sequence data, J. Clin. Microbiol., 37, 3957, 1999. 33. Kobayashi, M. et al., Molecular polymerase chain reaction diagnosis of pulmonary mucormycosis caused by Cunninghamella bertholletiae, Respirology, 9, 397, 2004. 34. Bialek, R. et al., PCR based identi�cation and discrimination of agents of mucormycosis and aspergillosis in paraf�n wax embedded tissue, J. Clin. Pathol., 58, 1180, 2005. 35. Rickerts, V. et al., Comparison of histopathological analysis, culture, and polymerase chain reaction assays to detect invasive mold infections from biopsy specimens, Clin. Infect. Dis., 44, 1078, 2007. 36. Hata, D.J. et al., Real-time PCR method for detection of zygomycetes, J. Clin. Microbiol., 46, 2353, 2008. 37. Kasai, M. et al., Detection of a molecular biomarker for zygomycetes by quantitative PCR assays of plasma, bronchoalveolar lavage, and lung tissue in a rabbit model of experimental pulmonary zygomycosis, J. Clin. Microbiol., 46, 3690, 2008. 83 Chapter 83 - Entomophthorales
1. James, T.Y. et al., Reconstructing the early evolution of fungi using a six-gene phylogeny, Nature, 443, 818, 2006.
2. Hibbett, D.S. et al., A higher-level phylogenetic classi�cation of the fungi, Mycol. Res., 111, 509, 2007.
3. Nagahama, T. et al., Phylogenetic divergence of the Entomophthoralean fungi: Evidence from nuclear 18S ribosomal RNA gene sequences, Mycologia, 87, 203, 1995.
4. Winter, G., Rabenhorst’s Kryptogamen-Flora, PilzeSchizomyceten, Saccharomyceten und Basidiomyceten, 2nd edn., Eduard Kummer Verlag, Leipzig, 1880, p. 74.
5. Tanabe, Y. et al., Molecular phylogeny of Zygomycota based on EF-1α and RPB1 sequences: Limitations and utility of alternative markers to rDNA, Mol. Phylogenet. Evol., 30, 438, 2004.
6. Taylor, J.W. et al., Phylogenetic species recognition and species concepts in fungi, Fungal Genet. Biol., 31, 21, 2000.
7. Kirk, P.M. et al., Ainsworth & Bisby’s Dictionary of the Fungi, Vol. 10, CAB International, Wallingford, U.K., 2008.
8. Thielke, C. and Institut für den wissenschaftlichen Film: Entwicklung von Basidiobolus ranarum (Entomophthoraceae), Film C 1546 des IWF, Göttingen 1984, Publikation von Thielke C, Publ. Wiss. Film., Sekt. Biol., Ser. 18, Nr. 15/C 1546 (1986), 16pp. 9. Pfaller, M.A. and Diekema, D.J., Unusual fungal and pseudofungal infections of humans, J. Clin. Microbiol, 43, 1495, 2005. 10. Yang, X. et al., Rhinofacial conidiobolomycosis caused by Conidiobolus coronatus in a Chinese rice farmer, Mycoses: Letter to the Editor, April 2009. 11. Larone, D.H., Medically Important Fungi: A Guide to Identi¡cation, Vol. 4, ASM Press, Washington, DC, 2002. 12. Drechsler, C., An Entomophthoraceous tardigrade parasite producing small conidia on propulsive cells in spicate heads, B. Torrey. Bot. Club, 78, 183, 1951. 13. Wheeler, A.G., “Violent deaths” of soldier beetles (Coleoptera: Cantharidae) revisited: New records of the fungal pathogen Eryniopsis lampyridarum (Zygomycetes: Entomophthoraceae), Coleopterists Bull., 43, 233, 1988. 14. Scholte, E.J. et al., Entomopathogenic fungi for mosquito control: A review, J. Insect Sci., 4, 19, 2004. 15. Miller, R. and Pott, B., Phycomycosis of the horses caused by Basidiobolus haptosporus, Aust. Vet. J., 56, 224, 1980. 16. Sutton, D.A., Fothergill, A.W., and Rinaldi, M.G., Guide to Clinically Signi¡cant Fungi, The Williams and Wilkins Co., Baltimore, MD, 1998. 17. Silva, S.M.M.S. et al., Conidiobolomycosis in sheep in Brazil, Vet. Pathol., 44, 314, 2007. 18. Ribes, J.A., Vanover-Sams, C.L., and Baker, D.J., Zygomycetes in human disease, Clin. Microbiol. Rev., 13, 236, 2000. 19. Beneke, E.S. and Rogers, A.L., Medical Mycology and Human Mycoses, Star Publishing Co., Belmont, CA, 1996, pp. 182–206. 20. Mendoza, L. and Alfaro, A.A., Equine subcutaneous zygomycosis in Costa Rica, Mykosen, 28, 545, 1985. 21. Morris, R.J., Müller, C.B., and Godfray, H.C.J., Field experiments testing for apparent competition between primary parasitoids mediated by secondary parasitoids, J. Anim. Ecol., 70, 301, 2001. 22. Rippon, J.W., Medical Mycology: The Pathogenic Fungi and Actinomycetes, The W.B. Saunders Co., Philadelphia, PA, 1987, pp. 690–699. 23. Roy, A.D. and Cameroon, H.M., Rhinophycomycosis Entomophthorae occurring in a chimpanzee in the wild in East Africa, Am. J. Trop. Med. Hyg., 21, 234, 1972. 24. Yendol, W.G., Factors affecting the germination of Entomophthora coronatus, J. Invertebr. Pathol., 10, 111, 1968. 25. Dismukes, W.E., Pappas, P.G., and Sobel, J.D., Clinical Mycology, Oxford University Press, New York, 2003. 26. Fischer, N. et al., Rhinofacial Conidiobolus coronatus infection presenting with nasal enlargement, Infection, 36, 594, 2008. 27. Busapakum, R. et al., Disseminated infection with Conidiobolus incongruus, Sabouraudia, 21, 323, 1983. 28. Eidam, E., Basidiobolus, eine neue Gattung der Entomophthoraceen, Biol. P°anz., 4, 181, 1886. 29. Chaturvedi, V.P. et al., Prevalence of Basidiobolus ranarum Eidam in the intestinal tract of an insectivorous bat Rhinopoma hardwicki hardwicki, in Delhi, Sabouraudia, 22, 185, 1984. 30. Miller, R.I. and Turnwald, G.H., Disseminated basidiobolomycosis in a dog, Vet. Pathol., 21, 117, 1984. 31. Krishnan, S.G.S. et al., Entomophthoromycosis in India: A 4-year study, Mycoses, 41, 55, 1998. 32. Lyon, G.M. et al., Gastrointestinal basidiobolomycosis in Arizona: Clinical and epidemiology characteristics and review of the literature, Clin. Infect. Dis., 32, 1448, 2001.
33. Khan, Z.U. et al., Basidiobolus ranarum as an etiologic agent of gastrointestinal zygomycosis, J. Clin. Microbiol., 39, 2360, 2001.
34. Van den Berk, G.E. et al., A fatal pseudo-tumour: Disseminated basidiobolomycosis, BMC Infect. Dis., 6, 140, 2006.
35. Walker, S.D. et al., Fatal disseminated Conidiobolus coronatus infection in a renal transplant patient, Am. J. Clin. Pathol., 98, 559, 1992.
36. Gugnani, H.C., A review of zygomycosis due to Basidiobolus ranarum, Eur. J. Epidemiol., 15, 923, 1999.
37. Bigliazzi, C. et al., Disseminated basidiobolomycosis in an immunocompetent woman, J. Clin. Microbiol., 42, 1367, 2004.
38. Al Jarie, A. et al., Pediatric gastrointestinal basidiobolomycosis, Pediatr. Infect. Dis. J., 22, 1007, 2003.
39. Valle, A.C.F. et al., Entomophthoramycosis by Conidiobolus coronatus. Report of a case successfully treated with the combination of itraconazole and ¼uconazole, Rev. Inst. Med. Trop. Sao Paulo, 43, 233, 2001.
40. Eckert, H.L. et al., Deep Entomophthora phycomycotic infection reported for the �rst time in the United States, Chest, 61, 392, 1972.
41. Kamalam, A. and Thambiah, A.S., Lymph node invasion by Conidiobolus coronatus and its spore formation in vivo, Sabouraudia, 16, 175, 1978.
42. Walsh, T.J. et al., Invasive zygomycosis due to Conidiobolus incongruus, Clin. Infect. Dis., 19, 423, 1994.
43. Bittencourt, A.L., Marback, R., and Nossa, L.M.B., Mucocutaneous Entomophthoramycosis acquired by conjunctival inoculation of the fungus, Am. J. Trop. Med. Hyg., 75, 936, 2006.
44. Pasha, T.M. et al., Basidiobolomycosis: An unusual fungal infection mimicking in¼ammatory bowel disease, Gastroenterology, 112, 250, 1997.
45. Geramizadeh, B. et al., Gastrointestinal zygomycosis: A report of three cases, Mycopathologia, 164, 35, 2007.
46. Rüchel, R. et al., Vereinfachte Pilzdetektion—Screeningmethode mit optischem Aufheller, Pathologe, 25, 235, 2004.
47. Maeda, H. and Ishida, N., Speci�city of binding of hexopyranosyl polysaccharides with ¼uorescent brightener, J. Biochemistry, 62, 276, 1967.
48. Hussein, M.R., Mucocutaneous Splendore-Hoeppli phenomenon, J. Cutan. Pathol., 35, 979, 2008.
49. Costa, A.R. et al., Rhinofacial zygomycosis caused by Conidiobolus coronatus. A case report, Mycopathologia, 115, 1, 1991.
50. Splendore, A., Sobre a cultura d’una nova especie de cogumello pathogenico (Sporotrichose de Splendore), Rev. Soc. Sao Paulo, 3, 62, 1908.
51. Hoeppli, R., Histological observations in experimental Schistosomiasis japonica, Chin. Med. J., 46, 1179, 1932.
52. Kaufman, L., Mendoza, L., and Standard, P.G., Immunodiffusion test for serodiagnosing subcutaneous zygomycosis, J. Clin. Microbiol., 28, 1887, 1990. 53. Voigt, K., Cigelnik, E., and O’Donnell, K., Phylogeny and PCR identi�cation of clinically important zygomycetes based on nuclear ribosomal-DNA sequence data, J. Clin. Microbiol., 37, 3957, 1999. 54. Beckstead, J.H., A simple technique for preservation of �xation-sensitive antigens in paraf�n-embedded tissues, J. Histochem. Cytochem., 42, 1127, 1994. 55. Huppert, M., Oliver, D.J., and Sun, S.H., Combined methenamine–silver nitrate and hematoxylin and eosin stain for fungi in tissues, J. Clin. Microbiol., 8, 598, 1978. 56. McManus, J.F.A., The periodic acid routine applied to the kidney, Am. J. Path., 23, 907, 1947. 57. McManus, J.F.A., Histological and histochemical uses of periodic acid, Stain. Tech., 23, 99, 1948. 58. Kligman, A.M. and Mescon, H., The periodic-acid-Schiff stain for the demonstration of fungi in animal tissue, J. Bacteriol., 60, 415, 1950. 59. Cenis, J.L., Rapid extraction of fungal DNA for PCR ampli�cation, Nucleic Acids Res., 20, 2380, 1993. 60. Raeder, U. and Broda, P., Rapid preparation of DNA from �lamentous fungi, Lett. Appl. Microbiol., 1, 17, 1985. 61. Bassam, B.J., Caetano-Annoles, G., and Gresshof, P.M., Fast and sensitive silver staining of DNA in polyacrylamide gels, Anal. Biochem., 196, 80, 1991. 62. Hoffmann, K. et al., Diversity, genotypic identi�cation, ultrastructural and phylogenetic characterization of zygomycetes from different ecological habitats and climatic regions: Limitations and utility of nuclear ribosomal DNA barcode markers, in Current Advances in Molecular Mycology, Gherbawy, Y., Mach, R.L., Rai, M. (Eds.), Nova Science Publishers, Inc., New York, 2009, p. 263. 63. White, T.J. et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics, in PCR Protocols: A Guide to Methods and Applications, Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J. (Eds.), Academic Press, San Diego, CA, 1990, p. 315. 64. O’Donnell, K., Cigelnik, E., and Benny, G.L., Phylogenetic relationships among Harpellales and Kickxellales, Mycologia, 90, 624, 1998. 65. Sierotzki, H. et al., Biological characteristics of selected Erynia neoaphidis isolates, Mycol. Res., 104, 213, 2000. 66. Kaufman, L., Turner, L.F., and McLaughlin, D.W., Indirect enzyme-linked immunosorbent assay for zygomycosis, J. Clin. Microbiol., 27, 1979, 1989. 67. Imhof, A. et al., Rapid detection of pathogenic fungi from clinical specimens using LightCycler real-time ¼uorescence PCR, Eur. J. Clin. Microbiol. Infect. Dis., 22, 558, 2003. 68. Kriegsmann, J. et al., Molekularpathologische Diagnostik von Gelenkinfektionen, Orthopäde, 38, 531, 2009. 69. Brown, J., Zygomycosis: An emerging fungal infection, Am. J. Health Syst. Pharm., 62, 2593, 2005. 70. O’Donnell, K., Fusarium and its near relatives, in The Fungal Holomorph: Mitotic, Meiotic and Pleomorphic Speciation in Fungal Systematics, Reynolds, D.R. and Taylor, J.W (Eds.), CAB International, Wallingford, U.K., 1993, p. 225. 84 Chapter 84 - Lichtheimia (Absidia-Like Fungi)
5. Hoffmann, K., Discher, S., and Voigt, K., Revision of the genus Absidia (Mucorales, Zygomycetes) based on physiological, phylogenetic, and morphological characters; thermotolerant Absidia spp. form a coherent group, Mycocladiaceae fam. nov., Mycol. Res., 111, 1169, 2007.
6. Hoffmann, K. and Voigt, K., Absidia parricida plays a dominant role in biotrophic fusion parasitism among mucoralean fungi (Zygomycetes): Lentamyces, a new genus for A. parricida and A. zychae, Plant Biol., 11, 537, 2009.
7. Schipper, M.A.A., Notes on Mucorales—I. Observations on Absidia, Persoonia, 14, 133, 1990.
8. Kwaśna, H. and Nirenberg, H.I., Siepmannia, a new genus in the Mucoraceae, Mycologia, 100, 259, 2008.
9. Kwaśna, H. and Nirenberg, H.I., Validation of the genus Siepmannia (Mucoraceae) and its four species, Pol. Bot. J., 53, 187, 2008.
10. Hoffmann, K., Identi�cation of the genus Absidia (Mucorales, Zygomycetes), a comprehensive taxonomic revision, in Molecular Identi¡cation of Fungi, p. 439, Gherbawy, Y., Voigt, K. (Eds.), Springer-Verlag, Heidelberg, 2010.
11. Van Tieghem, P., Troisiéme mémoire sur les Mucorinées, Ann. Sci. Nat. Bot., 4, 312, 1876.
12. Hoffmann, K. et al., Diversity, genotypic identi�cation, ultrastructural and phylogenetic characterization of zygomycetes from different ecological habitats and climatic regions: Limitations and utility of nuclear ribosomal DNA barcode markers, in Current Advances in Molecular Mycology, p. 263, Gherbawy, Y., Mach, R.L., Rai, M. (Eds.), Nova Science Publishers, Inc., New York, 2009.
13. Kwaśna, H., Ward, E., and Bateman, G.L., Phylogenetic relationships among Zygomycetes from soil based on ITS1/2 rDNA sequences, Mycol. Res., 110, 501, 2006.
14. Hesseltine, C.W., Mahoney, M.K., and Peterson, S.W., A new species of Absidia from an alkali bee brood chamber, Mycologia, 82, 523, 1990. 15. Von Arx, J.A., On Mucoraceae s. str. and other families of the Mucorales, Sydowia, 35, 10, 1982.
16. Ellis, J.J. and Hesseltine, C.W., The genus Absidia: Globosespored species, Mycologia, 57, 222, 1965.
17. Ellis, J.J. and Hesseltine, C.W., Species of Absidia with ovoid sporangiospores II, Sabouraudia, 5, 57, 1966.
18. Zycha, H., Pilze II. Mucorineae, Krypt. Fl. Mark Brandenburg 6a, Leipzig, Germany, 1935.
19. Beauverie, J., Mycocladus verticillatus, Ann. Univ. Lyon, 3, 162, 1900.
20. Zycha, H., Siepmann, R., and Linnemann, G., Mucorales. Eine Beschreibung aller Gattungen und Arten dieser Pilzgruppe, J Cramer Publishing Co., Lehre, Germany, 1969.
21. Hesseltine, C.W. and Ellis, J.J., Species of Absidia with ovoid sporangiospores, I., Mycologia, 58, 761, 1966.
22. Hesseltine, C.W. and Ellis, J.J., The genus Absidia: Gongronella and cylindrical-spored species of Absidia, Mycologia, 56, 568, 1964.
23. Mirza, J.H. et al., Mucorales of Pakistan, University of Agriculture, Faisalabad, Pakistan, 1979.
24. Vánová, M., Nomen novum, nomenclatural changes and taxonomic rearrangements in Mucorales, Ceská Mykologie, 45, 25, 1991.
25. Hoffmann, K., Walther, G., and Voigt, K., Mycocladus vs Lichtheimia: A correction (Lichtheimiaceae fam. nov., Mucorales, Mucoromycotina), Mycol. Res., 113, 277, 2009.
26. Bainier, G., Sur quelques espèces de Mucorinées nouvelles ou peu connues, Bull. Soc. Mycol. France, 19, 153, 1903. 27. Vuillemin, P., Le genre Tieghemella et la série de Absidées, Bull. Soc. Mycol. France, 19, 119, 1903. 28. Bainier, G., Étude sur les Mucorinées. Thèse, Paris, France, 1882. 29. Sydow, H., (Referate und kritische Besprechungen), Ann. Mycol., 1, 371, 1903. 30. Vuillemin, P., Le Lichtheimia ramosa (Mucor ramosus Lindt) champignon pathogène, distinct du L. corymbifera, Arch. Parasitol., 8, 562, 1904. 31. Cohn, F.J., Mucor corymbifer, In Über pathogene Mucorineen und die durch sie erzeugten Mykosen des Kaninchens, Lichtheim, L. (ed.), Z. Klin. Med., 7, 149, 1884. 32. Alastruey-Izquierdo, A. et al., Species recognition and clinical relevance of the zygomycetous genus Lichtheimia (syn. Absidia pro parte, Mycocladus) J. Clin. Microbiol., 48, 2154, 2010. 33. Garcia-Hermoso, D. et al., Molecular and phenotypic evaluation of Lichtheimia corymbifera (ex. Absidia corymbifera) complex isolates associated with human mucormycosis: Rehabilitation of L. ramosa, ex synonym of L. corymbifera, J. Clin. Microbiol., 47, 3862, 2009. 34. Nottebrock, H., Scholer, H.J., and Wall, M., Taxonomy and identi�cation of mucormycosis-causing fungi I. synonymity of Absidia ramosa with A. corymbifera, Sabouraudia, 12, 64, 1974. 35. Chen, G.Q. and Zheng, R.Y., A new thermophilic variety of Absidia idahoensis from China, Mycotaxon, 69, 173, 1998. 36. Voigt, K. et al., Revision of the family structure of the Mucorales (Mucoromycotina, Zygomycetes) based on multigene-genealogies: Phylogenetic analyses suggest a bigeneric Phycomycetaceae with Spinellus as sister group to Phycomyces, in Current Advances in Molecular Mycology, p. 263, Gherbawy, Y., Mach, R.L., Rai, M. (Eds.), Nova Science Publishers, Inc., New York, 2009. 37. Kirk, P.M. et al., Dictionary of the Fungi, 10th edn., CABI Publishing, Wallingford, U.K., 2008. 38. Benjamin, R.K., Zygomycetes and their spores, in The Whole Fungus: The Sexual-Asexual Synthesis, Kendrick, B. (Ed.), National Museum of Natural Science, National Museums of Canada and the Kananaskis Foundation, Ottawa, Ontario, Canada, 1979. 39. Benny, G.L., Humber, R.A., and Morton, J.B., Zygomycota: Zygomycetes, in The Mycota. Part A. Systematics and Evolution, Vol. VII, p. 113, McLaughlin, D.J., McLaughlin, E.G., Lemke, P.A. (Eds.), Springer-Verlag, Berlin, Heidelberg, 2001. 40. Taylor, J.W. et al., Phylogenetic species recognition and species concepts in fungi, Fungal. Genet. Biol., 31, 21, 2000. 41. Crous, P.W. et al., MycoBank: An online initiative to launch mycology into the 21st century, Stud. Mycol., 50, 19, 2004. 42. Robert, V., Stegehuis, G., and Stalpers, J., The MycoBank engine and related databases, http://www.mycobank.org, 2005. 43. Lendner, A., Les Mucorinées de la Suisse, Mater. Flore Crypt. Suisse, 3, 1, 1908. 44. Roden, M.M. et al., Epidemiology and outcome of zygomycosis: A review of 929 reported cases, Clin. Infect. Dis., 41, 634, 2005. 45. Platauf, A.P., Mycosis mucorina, Virchows Arch., 102, 543, 1885. 46. Barr, A. et al., Rhinoorbital and pulmonary zygomycosis post pulmonary aspergilloma in a patient with chronic lymphocytic leukaemia, Acta Biomed., 77(suppl 4), 13, 2006. 47. Singh, G. et al., Sequential pathological studies in Asian water buffaloes infected intratracheally with Absidia corymbifera, Rev. Iberoam. Micol., 15, 146, 1998. 48. Sondhi, J., Gupta, P.P., and Sood, N., Effect of immunosuppression on the pathogenesis of respiratory zygomycoses in rabbits intranasally infected with Absidia corymbifera, Rev. Iberoam. Micol., 16, 107, 1999.
49. Stas, K.J.F. et al., Isolated zygomycosis in a bought living unrelated kidney transplant, Transplant. Int., 9, 600, 1996.
50. Jantunen, E. et al., Case Report. Invasive cutaneous mucormycosis caused by Absidia corymbifera after allogenic bone marrow transplantation, Bone Marrow Transplant., 18, 229, 1996.
51. Leong, K.W. et al., Cutaneous mucormycosis due to Absidia corymbifera occurring after bone marrow transplantation, Bone Marrow Transplant., 19, 513, 1997.
52. Lopes, J.O. et al., Cutaneous zygomycosis caused by Absidia corymbifera in a leukemic patient, Mycopathologia, 130, 89, 1995.
53. Lake, F.R., McAleer, R., and Tribe, A.E., Pulmonary mucormycosis without underlying systemic disease, Med. J. Aust., 149, 323, 1988.
54. Marshall, D.H. et al., Post-traumatic corneal mucormycosis caused by Absidia corymbifera, Ophthamology, 104, 1107, 1997.
55. Kontoyiannis, D.P. et al., Zygomycosis in a tertiary-care cancer center in the era of Aspergillus active antifungal therapy: A case-control observational study of 27 recent cases, J. Infect. Dis., 191(8), 1350, 2005.
56. Tri�lio, S. et al., Breakthrough fungal infections after allogeneic hematopoietic stem cell transplantation in patients on prophylactic voriconazole, Bone Marrow Transplant., 40(5), 451, 2007.
57. Chayakulkeeree, M., Ghannoum, M.A., and Perfect, J.R., Zygomycosis: The re-emerging fungal infection, Eur. J. Clin. Microbiol. Infect. Dis., 25, 215, 2006.
58. Balajee, S.A., Sigler, L., and Brandt, M.E., DNA and the classical way: Identi�cation of medically important molds in the 21st century, Med. Mycol., 45, 475, 2007.
59. Boekhout, T. et al., Fungal taxonomy: New developments in medically important fungi, Curr. Fungal Infect. Reports, 3, 170, 2009.
60. Singh, J., Rimek, D., and Kappe, R., In vitro susceptibility of 15 strains of Zygomycetes to nine antifungal agents as determined by the NCCLS M38-A microdilution method, Mycoses, 48, 246, 2005.
61. O’Donnell, K., Zygomycetes in Culture, Palfrey Contributions in Botany no. 2. Department of Botany, University of Georgia, Athens, GA, 1979.
62. Benny, G.L., Zygomycetes, in Synopsis and Classi¡cation of Living organisms, Vol. 1, Parker, S.P. (Ed.), McGraw-Hill Book Company, Inc., New York, 1982.
63. Hesseltine, C.W. and Ellis, J.J., Notes on Mucorales, especially on Absidia, Mycologia, 53, 406, 1961.
64. Kleppe, K. et al., Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA’s as catalyzed by DNA polymerases, J. Mol. Biol., 56, 341, 1971.
65. Mullis, K.B., The unusual origin of the polymerase chain reaction, Sci. Am., 262, 56, 1990.
66. Gherbawy, Y. et al., Molecular barcoding of microscopic fungi with emphasis on the mucoralean genera Mucro and Rhizopus, in Molecular Identi¡cation of Fungi, p. 213, Gherbawy, Y., Voigt, K. (Eds.), Springer-Verlag, Heidelberg, 2010.
67. Skouboe, P. et al., Phylogenetic analysis of nucleotide sequences from the ITS region of terverticillate Penicillium species, Mycol. Res., 103, 873, 1999. 68. Schwarz, P. et al., Molecular identi�cation of Zygomycetes from culture and experimentally infected tissues, J. Clin. Microbiol., 44, 340, 2006. 69. Clinical and Laboratory Standards Institute. Interpretive criteria for bacteria and fungi identi�cation by DNA target sequencing, Approved Guideline MM-18A. CLSI, 2007. 70. Voigt, K., Cigelnik, E., and O’Donnell, K., Phylogeny and PCR identi�cation of clinically important Zygomycetes based on nuclear ribosomal-DNA sequence data, J. Clin. Microbiol., 37, 3957, 1999. 71. O’Donnell, K. et al., Evolutionary relationships among mucoralean fungi (Zygomycota): Evidence for family polyphyly on a large scale, Mycologia, 93, 286, 2001. 72. Voigt, K. and Wöstemeyer, J., Phylogeny and origin of 82 Zygomycetes from all 54 genera of the Mucorales and Mortierellales based on combined analysis of actin and translation elongation factor EF-1a genes, Gene, 270, 113, 2001. 73. Nyilasi, I. et al., High af�nity iron permease (FTR1) gene sequence-based molecular identi�cation of clinically important Zygomycetes, Clin. Microbiol. Infect., 14, 393, 2008. 74. Machouart, M. et al., Genetic identi�cation of the main opportunistic Mucorales by PCR-restriction fragment length polymorphism, J. Clin. Microbiol., 44, 805, 2006. 75. Nagao, K. et al., Genetic identi�cation and detection of human pathogenic Rhizopus species, a major mucormycosis agent, by multiplex PCR based on internal transcribed spacer region of rRNA gene, J. Dermatol. Sci., 39, 23, 2005. 76. Hata, D.J. et al., A real-time PCR method for detection of Zygomycetes, J. Clin. Microbiol., 46, 2353, 2008. 77. Lass-Flörl, C., Zygomycosis: Conventional laboratory diagnosis, Clin. Microbiol. Infect. Suppl., 5, 60, 2009. 78. Bridge, P.D. et al., On the unreliability of published DNA sequences, New Phytol., 160, 43, 2003. 79. Rüchel, R. and Schaffrinski, M., Veratile ¼uorescent staining of fungi in clinical specimens by using the optical brightener Blankophor, J. Clin. Microbiol., 37, 2694, 1999. 80. Kappe, R. et al., Molecular detection of pathogenic fungi in the presence of human tissue, J. Med. Microbiol., 47, 811, 1998. 81. Kontoyiannis, D.P. et al., Zygomycosis in the 1990s in a tertiary-care cancer center, Clin. Infect. Dis., 30, 851, 2000. 82. de Hoog, G.S., Guarro, J., Gené, J., and Figueras, M.J., Atlas of Clinical Fungi, 2nd edn., Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands, 2000. 83. Baker, J.R., The structure and chemical composition of the Golgi element, Quart. J. Micr. Sci., 85, 1, 1944. 84. Beckstead, J.H., A simple technique for preservation of �xation-sensitive antigens in paraf�n-embedded tissues, J. Histochem. Cytochem., 42, 1127, 1994. 85. Luna, L.G., Manual of Histological Staining Methods of the Armed Forces Institute of Pathology, 3rd edn., McGraw Hill Book Company, New York, 1968. 86. Chandler, F.W., Histopathologic and immunohistologic diagnosis of mycotic diseases, in Advances in Medical Mycology, p. 201, Mukherji, K.G., Srivastava, A.K., Singh, K.P., Garg, K.L. (Eds.), Aditya Books, New Delhi, India, 1992. 87. Sehgal, S., Immunohistochemical studies and detection of immune complexes, in A Handbook of Practical and Clinical Immunology, p. 346, Talwar, G.P., Gupta, S.K. (Eds.), Vol. I, 2nd edn., CBS Publishers, New Delhi, India, 1992.
88. Roberts, G.D., Detection of fungi in clinical specimens by phase contrast microscopy, J. Clin. Microbiol., 2, 261, 1975. 89. Santos, M.J.S., Trufem, S.F.B., and de Oliveira, P.C., Viability and morphological stability of Absidia strains during longterm maintenance under mineral oil, J. Basic Microbiol., 40, 133, 2000.
90. Santos, M.J.S., de Oliveira, P.C., and Trufem, S.F.B., Morphological observations on Absidia corymbifera and Absidia blakesleenana strains preserved under mineral oil, Mycoses, 46, 402, 2002.
91. Cenis, J.L., Rapid DNA extraction of fungal DNA for PCR ampli�cation, Nucleic Acids Res., 20, 2380, 1993.
92. Raeder, U. and Broda, P., Rapid preparation of DNA from �lamentous fungi, Lett. Appl. Microbiol., 1, 17, 1985.
93. Sambrook, J. and Russell, D.W., Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2001.
94. White, T.J. et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics, in PCR Protocols: A Guide to Methods and Applications, p. 315, Innis, M.A., et al. (Eds.), Academic Press, New York, 1990.
95. Gerrits van den Ende, A.H.G. and de Hoog, G.S., Variability and molecular diagnostics of the neurotropic species Cladophialophora bantiana, Stud. Mycol., 43, 151, 1999.
96. Vogelstein, B. and Gillespie, D., Preparative and analytical puri�cation of DNA from agarose, Proc. Nat. Acad. Sci., USA, 76, 615, 1979.
97. Balajee, S.A. et al., Sequence-based identi�cation of Aspergillus, Fusarium and Mucorales species in the clinical mycology laboratory: Where are we and where should we go from here? J. Clin. Microbiol., 47, 877, 2009. 98. Almaslamani, M. et al., An increasing trend of zygomycosis caused by Mycocladus corymbifer (formerly Absidia corymbifera): Report of two cases and review of primary cutaneous Mycocladus infections, Med. Mycol., 31, 1, 2009. 99. Antoniadou, A., Outbreaks of zygomycosis in hospitals, Clin. Microbiol. Infect., 15, 55, 2009. 100. Landlinger, C. et al., Species-speci�c identi�cation of a wide range of clinically relevant fungal pathogens by use of Luminex xMAP technology, J. Clin. Microbiol., 47, 1063, 2009. 101. Lau, A. et al., Development and clinical application of a panfungal PCR assay to detect and identify fungal DNA in tissue specimens, J. Clin. Microbiol., 45, 380, 2007. 102. Bainier, G., Sur l’Absidia caerulea, Bull. Soc. Bot. France, 36, 184, 1889. 103. Lendner, A., Sur quelques Mucorinées, Bull. Her. Boiss., Sér. II, 7, 249, 1907. 104. Hagem, O., Untersuchungen über norwegische Mucorineen, Math.-Nat. Kl., 7, 1, 1908. 105. Ling-Young, M., Étude biologique des phénomènes de la sexualité chez les Mucorinées, Rev. Gén. Bot., 42, 730, 1930. 106. Linnemann, G., Beitrag zu einer Flora der Mucorineae Marburgs, Flora (Regensburg), 130, 176, 1936. 107. Boedijn, K.B., Notes of the Mucorales of Indonesia, Sydowia, 12, 321, 1958. 108. Orr, G.F. and Plunkett, O.A., A new species of Absidia from Californica, Mycologia, 51, 203, 1959. 109. Rall, G. and Solheim, W.G., A variety of Absidia isolated from Comandra pallida, Mycologia, 56, 99, 1964. 110. Vánová, M., Contribution to the taxonomy of the genus Absidia (Mucorales) I. Absidia macrospora sp. nov., Ceská Mykol., 22, 296, 1968. 85 Chapter 85 - Mortierella
FIGURE 85.2 Restriction maps for molecular diagnosis of M. wol¡i and M. polycephala. Restriction enzymes used for the endonucleolytic digestions are: HaeIII, HinfI, RsaI, and Sau3AI. Restriction sites present in both strains are indicated between both schematic sequences, whereas unique restriction sites are displayed aside the schematic nucleotide sequences. (A) Restriction map based on the sequences NCBI
AF113425 (M. wol¡i) and X89436 (M. polycephala) coding for 18S rRNA. (B) Restriction map based on the sequences NCBI AF113465,
AB154774, AB154775, AB154776 (M. wol¡i), and AF113464 (M. polycephala) coding for 28S rRNA. (C) Restriction map based on the sequences NCBI AJ287171 (M. wol¡i) and AJ287169 (M. polycephala) coding for actin (cDNA).
5. O’Donnell, K. et al., Evolutionary relationships among mucoralean fungi (Zygomycota): Evidence for family polyphyly on a large scale, Mycologia, 93, 286, 2001.
6. Kwaśna, H., Ward, E., and Bateman, G.L., Phylogenetic relationships among Zygomycetes from soil based on ITS1/2 rDNA sequences, Mycol. Res., 110, 501, 2006.
7. White, M.M. et al., Phylogeny of the Zygomycota based on nuclear ribosomal sequence data, Mycologia, 98, 872, 2006.
8. Voigt, K. and Wöstemeyer, J., Phylogeny and origin of 82 Zygomycetes from all 54 genera of the Mucorales and Mortierellales based on combined analysis of actin and translation elongation factor EF-1a genes, Gene, 270, 113, 2001.
9. Benny, G.L., Zygomycetes, published on the Internet at http:// www.zygomycetes.org, 2005, accessed on November 11, 2009.
10. Gams, W., A key to the species of Mortierella, Persoonia, 9, 381, 1977.
11. Zycha, H., Siepmann, R., and Linnemann, G., Mucorales. Eine Beschreibung aller Gattungen und Arten dieser Pilzgruppe, J Cramer, Lehre, 1969.
12. de Ruiter, G.A. et al., Approaches to the classi�cation of the Mortierella isabellina group: Antigenic extracellular polysaccharides, Mycol. Res., 97, 690, 1993.
13. Amano, N. et al., Chemotaxonomic signi�cance of fatty acid composition in the genus Mortierella (Zygomycetes, Mortierellaceae), Mycotaxon, 44, 257, 1992.
14. Weete, J.D. and Gandhi, S.R., Sterols and fatty acids of the Mortierellaceae: Taxonomic implications, Mycologia, 91, 642, 1999.
15. Meyer, W. and Gams, W., Delimitation of Umbelopsis (Mucorales, Umbelopsidaceae fam. nov.) based on ITS sequence and RFLP data, Mycol. Res., 107, 339, 2003.
16. Domsch, K.H., Gams, W., and Anderson, T.H., Compendium of Soil Fungi, vols. 1, 2, Academic Press, New York, 1980.
17. Nyilasi, I. et al., Phylogenetic and physiological characterization of �lamentous fungi belonging to the order Mortierellales, Acta Microbiol. Immunol. Hung., 56, 219, 2009.
18. Papp, T. et al., Molecular identi�cation and phylogeny of Mortierella wol¡i, Acta Microbiol. Immunol. Hung., 56, 224, 2009.
19. Hoffmann, K. et al., Diversity, genotypic identi�cation, ultrastructural and phylogenetic characterization of zygomycetes from different ecological habitats and climatic regions: Limitations and utility of nuclear ribosomal DNA barcode markers, in: Current Advances in Molecular Mycology, Gherbawy, Y., Mach, R.L., and Rai, M., Eds., Nova Science Publishers, Inc., New York, pp. 263–312, 2009.
20. Schipper, M.A.A. and Stalpers, J.A., Zygomycetes: The order Mucorales. in: Pathogenic Fungi in Humans and Animals, 2nd edn., Mycology Series, vol. 16, Howard, D.H., Ed., Marcel Dekker, New York, 2002, pp. 67–125.
21. de Hoog, D.S. et al., Atlas of Clinical Fungi, 2nd edn., Centraalbureau voor Schimmelcultures, the Netherlands, 2000.
22. Ribes, J.A., Vanover-Sams, C.L., and Baker, D.J., Zygomycetes in human disease, Clin. Microbiol. Rev., 13, 236, 2000.
23. Carter, M.E. et al., Fungi isolated from bovine mycotic abortion and pneumonia with special reference to Mortierella wol¡i, Res. Vet. Sci., 14, 201, 1973.
24. Seviour, R.J., Cooper, A.L., and Skilbeck, N.W., Identi�cation of Mortierella wol¡i, a causative agent of mycotic abortion in cattle, Med. Mycol., 25, 115, 1987. 25. Connole, M.D., Review of animal mycoses in Australia, Mycopathology, 111, 133, 1990. 26. Gabor, L.J., Mycotic pneumonia in a dairy cow caused by Mortierella wol¡i, Aust. Vet. J., 81, 409, 2003. 27. Komoda, M. et al., An infection of cow with Mortierella wol¡i, Mycopathology, 101, 89, 1988. 28. Knudtson, W.U. and Kirkbride, C.A., Fungi associated with bovine abortion in the northern plains states (USA), J. Vet. Diagn. Invest., 4, 181, 1992. 29. Munday, J.S. et al., Meningoencephalitis in an adult cow due to Mortierella wol¡i, J. Vet. Diagn. Invest., 18, 619–622, 2006. 30. Uzal, F.A. et al., Mortierella wol¡i isolated from the liver of a cow in Australia, Vet. Rec., 145, 260, 1999. 31. Davey, G., Smith, J.M., and Kalmakoff, J., Puri�cation and properties of a toxin isolated from Mortierella wol¡i, Infect. Immun., 8, 882, 1973. 32. Davey, G. and Kalmakoff, J., Evidence that the nephrotoxin from the fungus Mortierella wol¡i is a protein, Can. J. Microbiol., 20, 1513, 1974. 33. Corbel, M.J. and Edades, S.M., Observations on the experimental pathogenicity and toxigenicity of Mortierella wol¡i strains of bovine origin, Br. Vet. J., 147, 504, 1991. 34. McCausland, I.P., Slee, K.J., and Hirst, F.S., Mycotic abortion in cattle. Aust. Vet. J., 64, 129, 1987. 35. di Menna, M.E., Carter, M.E., and Cordes, D.O., The identi�cation of Mortierella wol¡i isolated from cases of abortion and pneumonia in cattle and a search for its infection source, Res. Vet. Sci., 13, 439, 1972. 36. Hugh-Jones, M.E. and Austwick, P.C.K., Epidemiological studies in bovine mycotic abortion. I. The effect of climate on incidence, Vet. Rec., 85, 273, 1967. 37. MacDonald, S.M. and Corbel, M.J., Mortierella wol¡i infections in cattle in Britain. Vet. Rec., 109, 419, 1981. 38. Johnson, C.T., Lupson, G.R., and Lawrence, K.E., The bovine placentome in bacterial and mycotic abortions, Vet. Rec., 12, 263, 1994. 39. Smith, J.M., An interesting bovine mycotic complex in New Zealand, N. Z. Vet. J., 14, 226, 1966. 40. Streekstra, H., On the safety of Mortierella alpina for the production of food ingredients, such as arachidonic acid, J. Biotechnol., 56, 153, 1997. 41. Skilbeck, N.W., Serological diagnosis of bovine abortion due to Mortierella wol¡i. Aust. Vet. J., 61, 238, 1984. 42. Kaufman, L., Turner, L.F., and McLaughlin, D.W., Indirect enzyme linked immunosorbent assay for zygomycosis, J. Clin. Microbiol., 27, 1979, 1989. 43. Hessian, P. and Smith, J.M.B., Antigenic characterization of some potentially pathogenic mucoraceous fungi, Sabouraudia, 20, 209, 1982. 44. Balajee, S.A. et al., Sequence-based identi�cation of Aspergillus, Fusarium and Mucorales species in the clinical mycology laboratory: Where are we and where should we go from here?, J. Clin. Microbiol., 47, 877, 2009. 45. Summerbell, R.C. et al., Microcoding: The second step in DNA barcoding, Philos. Trans. R. Soc. Lond. B. Biol. Sci., 360,1897, 2005. 46. Roberts, G.D., Detection of fungi in clinical specimens by phase contrast microscopy, J. Clin. Microbiol., 2, 261, 1975. 47. Rüchel, R. and Schaffrinski, M., Versatile ¼uorescent staining of fungi in clinical specimens by using the optical brightener Blankophor, J. Clin. Microbiol., 37, 2694, 1999. 48. Baker, J.R., The structure and chemical composition of the Golgi element, Quart. J. Micr. Sci., 85, 1, 1944.
49. Beckstead, J.H., A simple technique for preservation of �xation-sensitive antigens in paraf�n-embedded tissues, J. Histochem. Cytochem., 42, 1127, 1994.
50. Luna, L.G., Manual of Histological Staining Methods of the Armed Forces Institute of Pathology, 3rd edn., McGraw Hill Book Company, New York, 1968.
51. Chandler, F.W., Histopathologic and immunohistologic diagnosis of mycotic diseases, in Advances in Medical Mycology, Mukherji, K.G. et al., Eds., Aditya Books, New Delhi, India, pp. 201–210, 1992.
52. Santos, M.J.S., Trufem, S.F.B., and de Oliveira, P.C., Viability and morphological stability of Absidia strains during longterm maintenance under mineral oil, J. Basic Microbiol., 40, 133, 2000.
53. Santos, M.J.S., de Oliveira, P.C., and Trufem, S.F.B., Morphological observations on Absidia corymbifera and Absidia blakesleenana strains preserved under mineral oil, Mycoses, 46, 402, 2002.
54. Kontoyiannis, D.P. et al., Zygomycosis in the 1990s in a tertiary-care cancer center, Clin. Infect. Dis., 30, 851, 2000.
55. Gonzalez, C.E., Rinaldi, M.G., and Sugar, A.M., Zygomycosis, Infect. Dis. Clin. North. Am., 16, 895, 2002. 56. Mehrotra, B.S. and Baijal, U., Species of Mortierella from India—III, Mycopath. Mycol. Appl., 20, 49, 1962. 57. O’Donnell, K., Zygomycetes in Culture, Palfrey Contributions in Botany No. 2, Department of Botany, University of Georgia, Athens, GA, 1979, p. 257. 58. Riddell, R.W., Permanent stained mycological preparations obtained by slide culture, Mycologia, 42, 265, 1950. 59. Coemans, E., Quelques hyphomycètes nouveaux.—Ire.—I. Mortierella polycephala et II. Martensella pectinata, Bull. l’Acad. Royale Sci., Lett., Beaux-Arts Belgique Sér. 2. 15, 536, 1863. 60. Roden, M.M. et al., Epidemiology and outcome of zygomycosis: A review of 929 reported cases, Clin. Infect. Dis., 41, 634, 2005. 61. Pandian, J.D. et al., Rhizomycosis infection in the basal ganglia, Arch. Neurol., 64, 134, 2007. 62. Scholz, H.D. and Meyer, L., Mortierella polycephala als Erreger einer Lungenmykose beim Rind, Berl. Münch. Tierärtzl. Wschr., 78, 27, 1965. 63. Chayakulkeeree, M., Ghannoum, M.A., and Perfect, J.R., Zygomycosis: The re-emerging fungal infection, Eur. J. Clin. Microbiol. Infect. Dis., 25, 215, 2006. 86 Chapter 86 - Mucor
1. Almyroudis, N.G. et al. Zygomycosis in solid organ transplant recipients in a tertiary transplant center and review of the literature. Am J Transplant 6, 2365–2374 (2006).
2. Alvarez, E. et al. Spectrum of zygomycete species identi�ed in clinically signi�cant specimens in the United States. J Clin Microbiol 47, 1650–1656 (2009).
3. Michael, R.C., Michael, J.S., Ashbee, R.H., and Mathews, M.S. Mycological pro�le of fungal sinusitis: An audit of specimens over a 7-year period in a tertiary care hospital in Tamil Nadu. Indian J Pathol Microbiol 51, 493–496 (2008).
4. Roden, M.M. et al. Epidemiology and outcome of zygomycosis: A review of 929 reported cases. Clin Infect Dis 41, 634–653 (2005). 5. Zaoutis, T.E. et al. Zygomycosis in children: A systematic review and analysis of reported cases. Pediatr Infect Dis J 26, 723–727 (2007). 6. Chayakulkeeree, M., Ghannoum, M.A., and Perfect, J.R. Zygomycosis: The re-emerging fungal infection. Eur J Clin Microbiol Infect Dis 25, 215–229 (2006). 7. Greenberg, R.N., Scott, L.J., Vaughn, H.H., and Ribes, J.A. Zygomycosis (mucormycosis): Emerging clinical importance and new treatments. Curr Opin Infect Dis 17, 517–525 (2004). 8. Brown, J. Zygomycosis: An emerging fungal infection. Am J Health Syst Pharm 62, 2593–2596 (2005). 9. Eucker, J., Sezer, O., Graf, B., and Possinger, K. Mucormycoses. Mycoses 44, 253–260 (2001). 10. Freifeld, A.G. and Iwen, P.C. Zygomycosis. Sem Resp CritCare Med 25, 221–231 (2004). 11. Ribes, J.A., Vanover-Sams, C., and Baker, D.J. Zygomycetes in human disease. Clin Microbiol Rev 13, 236–301 (2000). 12. Takakura, S. Zygomycosis. Nippon Rinsho 66, 2356–2361 (2008). 13. James, T.Y. et al. Reconstructing the early evolution of fungi using a six-gene phylogeny. Nature 443, 818–822 (2006). 14. O’Donnell, K., Lutzoni, F.M., Ward, T.J., and Benny, G.L. Evolutionary relationships among mucoralean fungi (Zygomycota): Evidence for family polyphyly on a large scale. Mycologia 93, 286–296 (2001). 15. Tanabe, Y., Watanabe, M.M., and Sugiyama, J. Evolutionary relationships among basal fungi (Chytridiomycota and Zygomycota): Insights from molecular phylogentics. J Gen Appl Microbiol 51, 267–276 (2005). 16. White, M.M. et al. Phylogeny of the Zygomycota based on nuclear ribosomal sequence data. Mycologia 98, 872–884 (2006). 17. Hibbett, D.S. et al. A higher-level phylogenetic classi�cation of the fungi. Mycol Res 111, 509–547 (2007). 18. de Hoog, G.S., Guarro, J., Gene, J., and Figueras, M.J. In Atlas of Clinical Fungi, pp. 84–93, Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands, 2000. 19. Iwen, P.C., Hinrichs, S.H., and Rupp, M.E. Utilization of the internal transcribed spacer regions as molecular targets to detect and identify human fungal pathogens. Med Mycol 40, 87–109 (2002). 20. Landlinger, C. et al. Species-speci�c identi�cation of a wide range of clinically relevant fungal pathogens by use of Luminex xMAP technology. J Clin Microbiol 47, 1063–1073 (2009). 21. Rakeman, J.L. et al. Multilocus DNA sequence comparisons rapidly identify pathogenic molds. J Clin Microbiol 43, 3324– 3333 (2005). 22. Schwarz, P. et al. Molecular identi�cation of zygomycetes from culture and experimentally infected tissues. J Clin Microbiol 44, 340–349 (2006). 23. Balajee, S.A. et al. Sequence-based identi�cation of Aspergillus, Fusarium, and Mucorales species in the clinical mycology laboratory: Where are we and where should we go from here? J Clin Microbiol 47, 877–884 (2009). 24. Voigt, K., Cigelnik, E., and O’Donnell, K. Phylogeny and PCR identi�cation of clinically important zygomycetes based on nuclear ribosomal-DNA sequence data. J Clin Microbiol 37, 3957–3964 (1999). 25. Iwen, P.C., Sigler, L., Noel, R.K., and Freifeld, A.G. Mucor circinelloides was identi�ed by molecular methods as a cause of primary cutaneous zygomycosis. J Clin Microbiol 45, 636– 640 (2007).
26. Schipper, M.A.A. On Mucor circinelloides, Mucor racemosus and related species. Stud Mycol 12, 1–40 (1976).
27. Kwasna, H., Ward, E., and Bateman, G.L. Phylogenetic relationships among zygomycetes from soil based on ITS1/2 rDNA sequences. Mycol Res 110, 501–510 (2006).
28. Mantadakis, E. and Samonis, G. Clinical presentation of zygomycosis. Clin Microbiol Infect 15(Suppl 5), 15–20 (2009).
29. Aboltins, C.A., Pratt, W.A., and Solano, T.R. Fungemia secondary to gastrointestinal Mucor indicus infection. Clin Infect Dis 42, 154–155 (2006).
30. Rogers, T.R. Treatment of zygomycosis: Current and new options. J Antimicrob Chemother 61(Suppl 1), i35–i40 (2008).
31. Schalk, E. et al. Zygomycoses in patients with acute leukaemia. Ann Hematol 85, 327–332 (2006).
32. Sridhara, S.R., Paragache, G., Panda, N.K., and Chakrabarti, A. Mucormycosis in immunocompetent individuals: An increasing trend. J Otolaryngol 34, 402–406 (2005).
33. Neofytos, D. et al. Epidemiology and outcome of invasive fungal infection in adult hematopoietic stem cell transplant recipients: Analysis of Multicenter Prospective Antifungal Therapy (PATH) Alliance registry. Clin Infect Dis 48, 265– 273 (2009).
34. Chandra, S. and Woodgyer, A. Primary cutaneous zygomycosis due to Mucor circinelloides. Aust J Dermatol 43, 39–42 (2002).
35. Chan-Tack, K.M., Nemoy, L.L., and Perencevich, E.N. Central venous catheter-associated fungemia secondary to mucormycosis. Scand J Infect Dis 37, 925–927 (2005).
36. Del Palacio, A. et al. Five cases of zygomycosis (Spanish). Rev Iberoam Micol 16, 50–56 (1999).
37. Dizbay, M. et al. Fungemia and cutaneous zygomycosis due to Mucor circinelloides in an intensive care unit patient: Case report and review of literature. Jpn J Infect Dis 62, 146–148 (2009).
38. Fingeroth, J.D., Roth, R.S., Talcott, J.A., and Rinaldi, M.G. Zygomycosis due to Mucor circinelloides in a neutropenic patient receiving chemotherapy for acute myelogenous leukemia. Clin Infect Dis 19, 135–137 (1994).
39. Khan, Z.U., Ahmad, S., Brazda, A., and Chandy, R. Mucor circinelloides as a cause of invasive maxillofacial zygomycosis: An emerging dimorphic pathogen with reduced susceptibility to posaconazole. J Clin Microbiol 47, 1244–1248 (2009).
40. Wang, J.J., Satoh, H., Takahashi, H., and Hasegawa, A. A case of cutaneous mucormycosis in Shanghai, China. Mycoses 33, 311–315 (1990).
41. de Repentigny, L., St-Germain, G., Charest, H., Kokta, V., and Vobecky, S. Fatal zygomycosis caused by Mucor indicus in a child with an implantable left ventricular assist device. Pediatr Infect Dis J 27, 365–369 (2008).
42. Deja, M. et al. Gastrointestinal zygomycosis caused by Mucor indicus in a patient with acute traumatic brain injury. Med Mycol 44, 683–687 (2006).
43. Douvin, D., Le�choux, Y., and Huguet, C. Gastric phycomycosis. Early anatomo-pathological and mycological diagnosis. Favorable course under medical then surgical treatment (French). Arch Anat Pathol (Paris) 23, 133–138 (1975).
44. Mata-Essayag, S. et al. Mucor indicus necrotizing fasciitis. Int J Dermatol 40, 406–408 (2001).
45. Oliver, M.R., Van Voorhis, W.C., Boeckh, M., Mattson, D., and Bowden, R.A. Hepatic mucormycosis in a bone marrow transplant recipient who ingested naturopathic medicine. Clin Infect Dis 22, 521–524 (1996). 46. ter Borg, F., Kuijper, E.J., and van der Lelie, H. Fatal mucormycosis presenting as an appendiceal mass with metastatic spread to the liver during chemotherapy-induced granulocytopenia. Scand J Infect Dis 22, 499–501 (1990). 47. Costa, A.R. et al. Subcutaneous mucormycosis caused by Mucor hiemalis Wehmer f. luteus (Linnemann) Schipper 1973. Mycoses 33, 241–246 (1990). 48. de Oliveira-Neto, M.P. et al. Cutaneous mucormycosis in a young, immunocompetent girl. Med Mycol 44, 567–570 (2006). 49. Prevoo, R.L.M.A., Starink, T.M., and de Haan, P. Primary cutaneous mucormycosis in a healthy young girl. Report of a case caused by Mucor hiemalis Wehmer. J Am Acad Dermatol 24, 882–885 (1991). 50. Bullock, J.D., Jampol, L.M., and Fezza, A.J. Two cases of orbital phycomycosis with recovery. Am J Ophthalmol 78, 811–815 (1974). 51. Vignale, R., Mackinnon, J.E., Casella de Vilaboa, E., and Burgoa, F. Chronic, destructive, mucocutaneous phycomycosis in man. Sabouraudia 3, 143–147 (1964). 52. Weitzman, I., Della-Latta, P., Housey, G., and Rebatta, G. Mucor ramosissimus Samutsevitsch isolated from a thigh lesion. J Clin Microbiol 31, 2523–2525 (1993). 53. Stewart, N.J., Munday, B.L., and Hawkesford, T. Isolation of Mucor circinelloides from a case of ulcerative mycosis of platypus (Ornithorhynchus anatinus), and a comparison of the response of Mucor circinelloides and Mucor amphibiorum to different culture temperatures. Med Mycol 37, 201–206 (1999). 54. Wolff, A.M., Appel, K.F., Petersen, J.B., Poulsen, U., and Arnau, J. Identi�cation and analysis of genes involved in the control of dimorphism in Mucor circinelloides (syn. racemosus). FEMS Yeast Res 2, 203–213 (2002). 55. Balajee, S.A., Sigler, L., and Brandt, M.E. DNA and the classical way: Identi�cation of medically important molds in the 21st century. Med Mycol 45, 475–490 (2007). 56. Voigt, K. and Wostemeyer, J. Phylogeny and origin of 82 zygomycetes from all 54 genera of the Mucorales and Mortierellales based on combined analysis of actin and translation elongation factor EF-1alpha genes. Gene 270, 113–120 (2001). 57. Weitzman, I., Whittier, S., McKitrich, J.C., and Della-Latta, P. Zygospores: The last word in identi�cation of rare or atypical zygomycetes isolated from clinical specimens. J Clin Microbiol 33, 781–783 (1995). 58. Borman, A.M., Linton, C.J., Miles, S.J., and Johnson, E.M. Molecular identi�cation of pathogenic fungi. J Antimicrob Chemother 61(Suppl 1), i7–i12 (2008). 59. Iwen, P.C. Molecular detection and typing of fungal pathogens. Clin Lab Med 23, 781–799 (2003). 60. Yeo, S.F. and Wong, B. Current status of nonculture methods for diagnosis of invasive fungal infections. Clin Microbiol Rev 15, 465–484 (2002). 61. Hall, L., Wohl�el, S., and Roberts, G.D. Experience with the MicroSeq D2 large-subunit ribosomal DNA sequencing kit for identi�cation of �lamentous fungi encountered in the clinical laboratory. J Clin Microbiol 42, 622–626 (2004). 62. Kasai, M. et al. Detection of a molecular biomarker for zygomycetes by quantitative PCR assays of plasma, bronchoalveolar lavage, and lung tissue in a rabbit model of experimental pulmonary zygomycosis. J Clin Microbiol 46, 3690–3702 (2008). 63. Vollmer, T., Stormer, M., Kleesiek, K., and Dreier, J. Evaluation of novel broad-range real-time PCR assay for rapid detection of human pathogenic fungi in various clinical specimens. J Clin Microbiol 46, 1919–1926 (2008).
64. Machouart, M. et al. Genetic identi�cation of the main opportunistic Mucorales by PCR-restriction fragment length polymorphism. J Clin Microbiol 44, 805–810 (2006).
65. Spiess, B. et al. Development of a LightCycler PCR assay for detection and quanti�cation of Aspergillus fumigatus DNA in clinical samples from neutropenic patients. J Clin Microbiol 41, 1811–1818 (2003).
66. Spiess, B. et al. DNA microarray-based detection and identi�cation of fungal pathogens in clinical samples from neutropenic patients. J Clin Microbiol 45, 3743–3753 (2007).
67. Hata, D.J., Buckwalter, S.P., Pritt, B.S., Roberts, G.D., and Wengenack, N.L. Real-time PCR method for detection of zygomycetes. J Clin Microbiol 46, 2353–2358 (2008).
68. Nyilasi, I. et al. High-af�nity iron permease (FTR1) gene sequence-based molecular identi�cation of clinically important zygomycetes. Clin Microbiol Infect 14, 393–397 (2008).
69. Peterson, S.W. Phylogenetic analysis of Aspergillus species using DNA sequences from four loci. Mycologia 100, 205– 226 (2008).
70. O’Donnell, K. et al. Phylogenetic diversity and microsphere array-based genotyping of human pathogenic fusaria, including isolates from the multistate contact lens-associated U.S. keratitis outbreaks of 2005 and 2006. J Clin Microbiol 45, 2235–2248 (2007).
71. Borman, A.M., Linton, C.J., Miles, S.J., Campbell, C.K., and Johnson, E.M. Ultra-rapid preparation of total genomic DNA from isolates of yeast and mould using Whatman FTA �lter paper technology—A reusable DNA archiving system. Med Mycol 44, 389–398 (2006).
72. Karakousis, A., Tan, L., Ellis, D., Alexiou, H., and Wormald, P.J. An assessment of the ef�ciency of fungal DNA extraction methods for maximizing the detection of medically important fungi using PCR. J Microbiol Methods 65, 38–48 (2006).
73. Tamura, K., Dudley, J., Nei, M., and Kumar, S. MEGA4: Molecular evolutional genetics analysis (MEGA) software version 4.0. Mol Biol Evol 24, 1596–1599 (2007). 74. Almyroudis, N.G., Sutton, D.A., Fothergill, A.W., Rinaldi, M.G., and Kusen, S. In vitro susceptibilities of 217 clinical isolates of zygomycetes to conventional and new antifungal agents. Antimicrob Agents Chemother 51, 2587–2590 (2007). 75. Greenberg, R.N. et al. Posaconazole as salvage therapy for zygomycosis. Antimicrob Agents Chemother 50, 126–133 (2006). 76. Page, A.V. and Liles, W.C. Posaconazole: A new agent for the prevention and management of severe, refractory, or invasive fungal infections. Can J Infect Dis Med Microbiol 19, 297– 305 (2008). 77. Page, R.L. 2nd., Schwiesow, J., and Hilts, A. Posaconazole as salvage therapy in a patient with disseminated zygomycosis: Case report and review of the literature. Pharmacotherapy 27, 290–298 (2007). 78. van Burik, J.A., Hare, R.S., Solomon, H.F., Corrado, M.L., and Kontoyiannis, D.P. Posaconazole is effective as salvage therapy in zygomycosis: A retrospective summary of 91 cases. Clin Infect Dis 42, e61–e65 (2006). 79. Marr, K.A., Carter, R.A., Crippa, F., Wald, A., and Corey, L. Epidemiology and outcome of mould infections in hematopoietic stem cell transplant recipients. Clin Infect Dis 34, 909–917 (2002). 80. Tri�lio, S.M. et al. Breakthrough zygomycosis after voriconazole administration among patients with hematologic malignancies who receive hematopoietic stem-cell transplants or intensive chemotherapy. Bone Marrow Transplant 39, 425– 429 (2007). 81. Sharma, R., Sekhon, A.S., and Premachandra, B.R. In vitro susceptibility of Mucor ramosissimus Samutsevitsch, a rare fungal pathogen, to antimycotics. Chemotherapy 41, 200–203 (1995). 87 Chapter 87 - Rhizopus
5. Anstead GM et al. Disseminated zygomycosis due to Rhizopus schipperae after heatstroke. J Clin Microbiol. 1999;37:2656.
6. Cheng VC et al. Outbreak of intestinal infection due to Rhizopus microsporus. J Clin Microbiol. 2009;47(9):2834–2843.
7. De Hoog GS, Guarro J, Gené J, and Figueras MJ. Atlas of Clinical Fungi, 2nd edn., pp. 62–67, 101–111. Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands, 2000.
8. Ma LJ et al. Genomic analysis of the basal lineage fungus Rhizopus oryzae reveals a whole-genome duplication. PLoS Genet. 2009;5(7):e1000549.
9. St-Germain G et al. Infection due to Rhizomucor pusillus: Report of four cases in patients with leukemia and review. Clin Infect Dis. 1993;16:640–645.
10. Hagensee ME et al. Brain abscess following marrow transplantation: Experience at the Fred Hutchinson Cancer Research Center, 1984–1992. Clin Infect Dis. 1994;19:402–408.
11. Ferguson BJ. Mucormycosis of the nose and paranasal sinuses. Otolaryngol Clin N Am. 2000;33:349–365.
12. Grossi P et al. Prevalence and outcome of invasive fungal infections in 1,963 thoracic organ transplant recipients—A multicenter retrospective study. Transplantation. 2000;70:112–116.
13. Nosari A et al. Mucormycosis in hematologic malignancies: An emerging fungal infection. Haematologica. 2000;85:1068–1071.
14. Kantarcioğlu AS et al. A Rhizopus oryzae strain isolated from resected bone and soft tissue specimens from a sinonasal and palatal mucormycosis case. Report of a case and in vitro experiments of yeastlike cell development. Med Mycol. 2006;44(6):515–521.
15. Chawla R et al. A rare case of mucormycosis of median sternotomy wound caused by Rhizopus arrhizus. Indian J Med Microbiol. 2007 October;25(4):419–421. 16. Kontogiorgi M et al. Fatal post-traumatic zygomycosis in an immunocompetent young patient. J Med Microbiol. 2007;56:1243–1245.
17. Mohadjer Y, Smith ME, and Akduman L. Mucormycosis endophthalmitis after cataract surgery. Ocul Immunol In°amm. 2007 March–April;15(2):117–120.
18. Raizman NM et al. Mucormycosis of the upper extremity in a patient with alcoholic encephalopathy. J Hand Surg Am. 2007 March;32(3):384–388.
19. Romano C et al. Primary subcutaneous zygomycosis due to Rhizopus oryzae in a 71-year-old man with normal immune status. Mycoses. 2007 January;50(1):82–84.
20. Uçkay I et al. Invasive zygomycosis in transplant recipients. Clin Transplant. 2007;21:577–582.
21. Ustun C et al. Early fatal Rhizopus infection on voriconazole prophylaxis following allogeneic stem cell transplantation. Bone Marrow Transplant. 2007 June;39(12):807–808.
22. Zaoutis TE et al. Zygomycosis in children: A systematic review and analysis of reported cases. Pediatr Infect Dis J. 2007;26(8):723–727.
23. Bonifaz A et al. Palatal zygomycosis: Experience of 21 cases. Oral Dis. 2008;14(6):569–574.
24. Clauss H and Samuel R. Simultaneous mold infections in an orthotopic heart transplant recipient. Transpl Infect Dis. 2008;10(5):343–345.
25. Johnson KE et al. An atypical case of fatal zygomycosis: Simultaneous cutaneous and laryngeal infection in a patient with a non-neutropenic solid prostatic tumor. Ear Nose Throat J. 2008;87(3):152. 26. Martín-Moro JG et al. Rhinoorbitocerebral mucormycosis: A case report and literature review. Med Oral Patol Oral Cir Bucal. 2008 December 1;13(12):E792–E795. 27. Page AV et al. Primary cutaneous mucormycosis in a lung transplant recipient: Case report and concise review of the literature. Transpl Infect Dis. 2008;10(6):419–425. 28. Popa G, Blag C, and Sasca F. Rhinocerebral mucormycosis in a child with acute lymphoblastic leukemia: A case report. J Pediatr Hematol Oncol. 2008;30(2):163–165. 29. Song KR, Wong MS, and Yeung C. Primary cutaneous zygomycosis in an immunode�cient infant: A case report and review of the literature. Ann Plast Surg. 2008;60(4):433–436. 30. Antoniadou A. Outbreaks of zygomycosis in hospitals. Clin Microbiol Infect. 2009;15(5):55–59. 31. de Mol P and Meis JF. Disseminated Rhizopus microsporus infection in a patient on oral corticosteroid treatment: A case report. Neth J Med. 2009 January;67(1):25–28. 32. Roilides E et al. Zygomycosis in neonates: An uncommon but life-threatening infection. Am J Perinatol. 2009 Sep;26(8):565–573. 33. Wilkins RM, Hahn DB, and Blum R. Bread mold osteomyelitis in the femur. Orthopedics. 2009;32(5):362. 34. Garg J et al. Nosocomial cutaneous zygomycosis in a patient with diabetic ketoacidosis. Int J Infect Dis. 2009;13(6):e508–e510. 35. Lekakis LJ et al. Fatal rhizopus pneumonia in allogeneic stem cell transplant patients despite posaconazole prophylaxis: Two cases and review of the literature. Biol Blood Marrow Transplant. 2009;15(8):991–995. 36. Tilak R et al. Cutaneous zygomycosis: A possible postoperative complication in immunocompetent individuals. Indian J Dermatol Venereol Leprol. 2009;75:596–599. 37. Monecke S et al. A case of peritonitis caused by Rhizopus microsporus. Mycoses. 2006;49(2):139–142. 38. Rodríguez MM et al. Posaconazole combined with amphotericin B, an effective therapy for a murine disseminated infection caused by Rhizopus oryzae. Antimicrob Agents Chemother. 2008 October;52(10):3786–3788. 39. Yassin MA et al. Rhino-orbital zygomycosis secondary to Rhizopus oryzae in a renal transplant recipient successfully treated with liposomal amphotericin B. Chang Gung Med J. 2008 July–August;31(4):407–411. 40. Kok J et al. Early use of posaconazole in the successful treatment of rhino-orbital mucormycosis caused by Rhizopus oryzae. J Infect. 2007 September;55(3):e33–e36. 41. Peel T et al. Posaconazole as �rst line treatment for disseminated zygomycosis. Mycoses. 2008;51(6):542–545. 42. Schlemmer F et al. Breakthrough Rhizopus infection on posaconazole prophylaxis following allogeneic stem cell transplantation. Bone Marrow Transplant. 2008;42(8):551–552. 43. Vyzantiadis TA et al. Rhino-cerebral zygomycosis resistant to antimycotic treatment: A case report. Mycoses. 2009;52(1):87–90. 44. Bialek R et al. PCR based identi�cation and discrimination of agents of mucormycosis and aspergillosis in paraf�n wax embedded tissue. J Clin Pathol. 2005 November;58(11):1180–1184. 45. Machouart M et al. Genetic identi�cation of the main opportunistic Mucorales by PCR-restriction fragment length polymorphism. J Clin Microbiol. 2006;44(3):805–810.
46. Schwarz PS et al. Molecular identi�cation of zygomycetes from culture and experimentally infected tissues. J Clin Microbiol. 2006;44:340–349.
47. Landlinger C et al. Identi�cation of fungal species by fragment length analysis of the internally transcribed spacer 2 region. Eur J Clin Microbiol Infect Dis. 2009;28(6):613–622.
48. Landlinger C et al. Species-speci�c identi�cation of a wide range of clinically relevant fungal pathogens by use of Luminex xMAP technology. J Clin Microbiol. 2009;47:1063–1073.
49. Spiess B et al. DNA microarray-based detection and identi�cation of fungal pathogens in clinical samples from neutropenic patients. J Clin Microbiol. 2007;45(11):3743–3753.
50. Hata DJ et al. Real-time PCR method for detection of zygomycetes. J Clin Microbiol. 2008;46(7):2353–2358.
51. Nyilasi I et al. High-af�nity iron permease (FTR1) gene sequence-based molecular identi�cation of clinically important Zygomycetes. Clin Microbiol Infect. 2008;14(4):393–397.
52. Balajee SA et al. Sequence-based identi�cation of Aspergillus, fusarium, and mucorales species in the clinical mycology laboratory: Where are we and where should we go from here? J Clin Microbiol. 2009 April;47(4):877–884.
53. Dannaoui E et al. Molecular detection and identi�cation of Zygomycetes species from paraf�n-embedded tissues in a murine model of disseminated zygomycosis—A collaborative ESCMID Fungal Infection Study Group (EFISG) evaluation. J Clin Microbiol. 2010;48:2043.
54. Hofman V et al. Usefulness of molecular biology performed with formaldehyde-�xed paraf�n embedded tissue for the diagnosis of combined pulmonary invasive mucormycosis and aspergillosis in an immunocompromised patient. Diagn Pathol. 2010;5:1. 55. Woo PC et al. Internal transcribed spacer region sequence heterogeneity in Rhizopus microsporus: Implications for molecular diagnosis in clinical microbiology laboratories. J Clin Microbiol. 2010;48(1):208–214. 56. Van Burik J-A et al. Panfungal PCR assay for detection of fungal infection in human blood specimens. J Clin Microbiol. 1998;36:1169–1175. 57. Voigt K, Cigelnik E, and O’donnell K. Phylogeny and PCR identi�cation of clinically important Zygomycetes based on nuclear ribosomal-DNA sequence data. J Clin Microbiol. 1999;37(12):3957–3964. 58. Larché J et al. Diagnosis of cutaneous mucormycosis due to Rhizopus microsporus by an innovative PCR-restriction fragment length polymorphism method. Clin Infect Dis. 2005;41:1362–1365. 59. Nagao K et al. Genetic identi�cation and detection of human pathogenic Rhizopus species, a major mucormycosis agent, by multiplex PCR based on internal transcribed spacer region of rRNA gene. J Dermatol Sci. 2005;39:23–31. 60. Lau A et al. Development and clinical application of a panfungal PCR assay to detect and identify fungal DNA in tissue specimens. J Clin Microbiol. 2007;45(2):380–385. 61. Francesconi A et al. Automated and manual methods of DNA extraction for Aspergillus fumigatus and Rhizopus oryzae analyzed by quantitative real-time PCR. J Clin Microbiol. 2008;46(6):1978–1984. 62. Kasai M et al. Detection of a molecular biomarker for zygomycetes by quantitative PCR assays of plasma, bronchoalveolar lavage, and lung tissue in a rabbit model of experimental pulmonary zygomycosis. J Clin Microbiol. 2008;46(11):3690–3702. 88 Chapter 88 - Rhizomucor
3. Vágvölgyi, C. et al., Rhizomucor tauricus: A questionable species of the genus, Mycol. Res., 103, 1318, 1999.
4. Joshi, M.C., A new species of Rhizomucor from India, Sydowia, 35, 100, 1982.
5. Qureshi, M.S.A. and Mirza, J.H., Rhizomucor pakistanicus Qureshi & Mirza sp. nov, Biologia, 29, 343, 1983.
6. Mouchacca, J., Thermophilic fungi and applied research: A synopsis of name changes and synonymies, World J. Microbiol. Biotechnol., 16, 881, 2000.
7. Zheng, R. and Jiang, H., Rhizomucor endophyticus sp. nov., an endophytic Zygomycetes from higher plants, Mycotaxon, 56, 455, 1995.
8. Zheng, R. and Chen, G., A non-thermophilic Rhizomucor causing human primary cutaneous mucormycosis, Mycosystema, 4, 45, 1991.
9. Zheng, R. and Chen, G., Another non-thermophilic Rhizomucor causing human primary cutaneous mucormycosis, Mycosystema, 6, 1, 1993.
10. Lu, X. et al., Primary cutaneous zygomycosis caused by Rhizomucor variabilis: A new endemic zygomycosis? A case report and review of 6 cases reported from China, Clin. Infect. Dis., 49, e39, 2009.
11. Voigt, K., Cigelnik, E., and O’Donnell, K., Phylogeny and PCR identi�cation of clinically important Zygomycetes based on nuclear ribosomal-DNA sequence data, J. Clin. Microbiol., 37, 3957, 1999.
12. Voigt, K. and Wöstemeyer, J., Phylogeny and origin of 82 zygomycetes from all 54 genera of the Mucorales and Mortierellales based on combined analysis of actin and translation elongation factor EF-1 alpha genes, Gene, 270, 113, 2001.
13. Hoffmann, K. et al., Diversity, genotypic identi�cation, ultrastructural and phylogenetic characterization of zygomycetes from different ecological habitats and climatic regions: Limitations and utility of nuclear ribosomal DNA barcode markers, in Current Advances in Molecular Mycology, Gherbawy, Y., Mach, R.L., and Rai, M., Eds., Nova Science Publishers, New York, 2009.
14. Schwarz, P. et al., Carbon assimilation pro�les as a tool for identi�cation of Zygomycetes, J. Clin. Microbiol., 45, 1433, 2007.
15. de Hoog, D.S. et al., Atlas of Clinical Fungi, 2nd edn., Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands, 2000.
16. Crous, P.W. et al., MycoBank: An online initiative to launch mycology into the 21st century, Stud. Mycol., 50, 19, 2004.
17. Robert, V., Stegehuis, G., and Stalpers, J., The MycoBank engine and related databases, http://www.mycobank.org, 2005.
18. Domsch, K.H., Gams, W., and Anderson, T., Compendium of Soil Fungi, vol. 1, Academic Press, London, U.K., 1980.
19. Scholer, H.J., Muller, E., and Schipper, M.A.A., Mucorales, in Fungi Pathogenic for Humans and Animals, Howard, D.H., Ed., pp. 9–59, Marcel Dekker, New York, 1983.
20. Ma, B. et al., Cure of pulmonary Rhizomucor pusillus infection in a patient with hairy-cell leukemia: Role of liposomal amphotericin B and GM-CSF, Leuk. Lymph. 42, 6, 1393, 2001.
21. Björkholm, M. et al., Liposomal amphotericin B and surgery in the successful treatment of invasive pulmonary mucormycosis in a patient with acute T-lymphoblastic leukemia, Scand. J. Inf. Dis., 33, 316, 2001.
22. Chakrabarti, A. et al., Ten years’ experience in zygomycosis at a tertiary care centre in India, Infection, 42, 261, 2001. 23. Abbas, A.A.H., Fryer, C.J.H., and Felimban, S.K., Fatal rhinocerebral mucormycosis in a leukaemic child presenting with sudden loss of vision: A case report, Haema, 5, 341, 2002. 24. Iwen, P.C. et al., Molecular identi�cation of Rhizomucor pusillus as a cause of sinus-orbital zygomycosis in a patient with acute myelogenous leukemia, J. Clin. Microbiol., 43, 5819, 2005. 25. Pasticci, M.B. et al., Nosocomial post-traumatic Rhizomucor soft tissue and bone infection treated with liposomal amphotericin B: Case report, J. Orthopaed. Traumatol., 8, 82, 2007. 26. del Palacio-Hernanz, A. et al., Nosocomial infection by Rhizomucor pusillus in a clinical haematology unit, J. Hosp. Infect., 4, 45, 1983. 27. Severo, L.C., Job, F., and Mattos, T.C., Systemic zygomycosis: Nosocomial infection by Rhizomucor pusillus, Mycopathologia, 113, 79, 1991. 28. St. Germain, G. et al., Infection due to Rhizomucor pusillus: Report of four cases in patients with leukemia and review, Clin. Infect. Dis., 16, 640, 1993. 29. Wickline, C.L., Cornitus, T.G., and Butler, T., Cellulitis caused by Rhizomucor pusillus in a diabetic patient receiving continuous insulin infusion pump therapy, South Med. J., 82, 1432, 1989. 30. Dannaoui, E. et al., In vitro susceptibilities of zygomycetes to conventional and new antifungals, J. Antimicrob. Chem., 51, 45, 2003. 31. Schipper, M.A.A. and Stalpers, J.A., Zygomycetes: The Order Mucorales, in: Pathogenic Fungi in Humans and Animals, 2nd edn., Howard, D.H., Ed., pp. 67–125, Mycology Series, Vol. 16, Marcel Dekker, New York, 2002. 32. Wang, A. et al., A case report of destructive mucosal and cutaneous mucormycosis caused by Rhizomucor variabilis, Chin. J. Dermatol. 27, 51, 1994 (Chinese). 33. Li, C., Li, Y., and Hu, Z., A case report of primary cutaneous mucormycosis caused by Rhizomucor variabilis, J. Clin. Dermatol., 33, 158, 2004 (Chinese). 34. Fu, M. et al., Facial Mucormycosis due to Rhizomucor variabilis: A case report, Int. J. Dermatol. Venereol., 32, 67, 2006 (Chinese). 35. Zhao, Y. et al., Primary cutaneous mucormycosis caused by Rhizomucor variabilis in an immunocompetent patient, Mycopathologia, 168, 243, 2009. 36. Eucker, J. et al., Mucormycoses, Mycoses, 44, 253, 2001. 37. Freifeld, A.G. and Iwen, P.C. Zygomycosis, Semin. Respir. Crit. Care Med. 25, 221, 2004. 38. Papp, T. et al., Molecular studies on Zygomycetes fungi causing opportunistic infections, Rev. Med. Microbiol., 19, 47, 2008. 39. Walsh, T.J. et al., Infections due to emerging and uncommon medically important fungal pathogens, Clin. Microbiol. Infect., 10(Suppl. 1), 48, 2004. 40. Chayakulkeeree, M., Ghannoum, M.A., and Perfect, J.R., Zygomycosis: The re-emerging fungal infection, Eur. J. Clin. Microbiol. Infect. Dis., 25, 215, 2006. 41. Kontoyiannis, D.P. et al., Zygomycosis in a tertiary-care cancer center in the era of Aspergillus active antifungal therapy: A case-control observational study of 27 recent cases, J. Infect. Dis., 191, 350, 2005. 42. Weitzman, I. et al., Zygospores: The last word in identi�cation of rare or atypical Zygomycetes isolated from clinical specimens, J. Clin. Microbiol., 33, 781, 1995. 43. Tansey, M.R., Kamel, S.M., and Shamsai, R., The number of nuclei in sporangiospores of Rhizomucor species: Taxonomic and biological signi�cance, Mycologia, 76, 1089, 1984.
44. Vastag, M. et al., Differentiation of Rhizomucor species by means of carbon source utilization and isoenzyme analysis, J. Clin. Microbiol., 36, 2153, 1998.
45. Lukács, Gy. et al., Differentiation of Rhizomucor species on the basis of their different sensitivities to lovastatin, J. Clin. Microbiol., 42, 5400, 2004.
46. Vastag, M. et al., Intraspeci�c variation in two species of Rhizomucor assessed by random ampli�ed polymorphic DNA analysis, J. Basic Microbiol., 40, 269, 2000.
47. Papp, T. et al., Identi�cation of Rhizomucor species by means of biochemical and molecular methods, Clin. Microbiol. Infect. 10(Suppl. 3), 508, 2004.
48. Balajee, S.A., Sigler, L., and Brandt, M.E., DNA and the classical way: Identi�cation of medically important molds in the 21st century, Med. Mycol., 45, 475, 2007.
49. Hall, L., Wohl�el, S., and Roberts, G.D., Experience with the MicroSeq D2 Large-Subunit Ribosomal Sequencing Kit for identi�cation of �lamentous fungi encountered in the clinical laboratory, J. Clin. Microbiol., 42, 622, 2004.
50. Balajee, S.A. et al., Sequence-based identi�cation of Aspergillus, Fusarium, and Mucorales species in the clinical mycology laboratory: Where are we and where should we go from here?, J. Clin. Microbiol., 47, 877, 2009.
51. Hsiao, C.R. et al., Identi�cation of medically important molds by an oligonucleotide array, J. Clin. Microbiol., 43, 3760, 2005. 52. Schwarz, P. et al., Molecular identi�cation of Zygomycetes from culture and experimentally infected tissues, J. Clin. Microbiol., 44, 340, 2006. 53. O’Donnell, K. et al., Evolutionary relationships among mucoralean fungi (Zygomycota): Evidence for family polyphyly on a large scale, Mycologia, 93, 286, 2001. 54. Nyilasi, I. et al., High-af�nity iron permease (FTR1) gene sequence-based molecular identi�cation of clinically important Zygomycetes, Clin. Microbiol. Infect., 14, 393, 2008. 55. Henry, T., Iwen, P.C., and Hinrichs S.H., Identi�cation of Aspergillus species using internal transcribed spacer regions 1 and 2, J. Clin. Microbiol., 38, 1510, 2000. 56. White, T. et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics, in PCR Protocols. A Guide to Methods and Applications, Innis, D.H.G.M.A., Sninsky, J.J., and White, T.J., Eds., pp. 315–322, Academic Press, San Diego, CA, 1990. 57. Gerrits van den Ende, A.H.G. and de Hoog, G.S., Variability and molecular diagnostics of the neurotropic species Cladophialophora bantiana, Stud. Mycol., 43, 151, 1999. 58. Altschul, S.F. et al., Gapped BLAST and PSIBLAST: A new generation of protein database search programs, Nucleic Acids Res., 25, 3389, 1997. 89 Chapter 89 - Saksenaea
1. Saksena, S. B. A new genus of the Mucorales. Mycologia, 45, 426, 1953.
2. Ellis, J. J. and Hesseltine, C. W. Two new families of mucorales. Mycologia, 66, 87, 1974.
3. Voigt, K., Cigelnik, E., and O’Donnell, K. Phylogeny and PCR identi�cation of clinically important Zygomycetes based on nuclear ribosomal-DNA sequence data. J. Clin. Microbiol., 37, 3957, 1999.
4. Voigt, K. and Wostemeyer, J. Phylogeny and origin of 82 zygomycetes from all 54 genera of the Mucorales and Mortierellales based on combined analysis of actin and translation elongation factor EF-1alpha genes. Gene, 270, 113, 2001.
5. O’Donnell, K. et al. Evolutionary relationships among mucoralean fungi (Zygomycota): Evidence for family polyphyly on a large scale. Mycologia, 93, 286, 2001.
6. Lechevalier, P. et al. Molecular diagnosis of Saksenaea vasiformis cutaneous infection after scorpion sting in an immunocompetent adolescent. J. Clin. Microbiol., 46, 3169, 2008.
7. Schipper, M. A. A. and Stalpers, J. A. Zygomycetes. The order Mucorales. In Pathogenic Fungi in Humans and Animals, 2nd edn., D. H. Howard, Ed., Marcel Dekker, New York, 67, 2003.
8. Chien, C.-Y., Bhat, D. J., and Kendrick, W. B. Mycological observations on Saksenaea vasiformis (Saksenaeaceae, Mucorales). Trans. Mycol. Soc. Jpn., 33, 443, 1992.
9. Baijal, U. A physiological study of Saksenaea vasiformis Saksena. Mycopathol. Mycol. Appl., 33, 289, 1967.
10. Lombardi, G. et al. Exoantigen tests for the rapid and speci�c identi�cation of Apophysomyces elegans and Saksenaea vasiformis. J. Med. Vet. Mycol., 27, 113, 1989.
11. Giannopoulou, P. et al. Fatal cutaneous zygomycosis from Saksenaea vasiformis in a young patient after a car accident. First isolation in Greece. Paper presented at: 19th European Congress of Clinical Microbiology and Infectious Diseases (ECCMID), Helsinki, 2009.
12. Pierce, P. F. et al. Saksenaea vasiformis osteomyelitis. J. Clin. Microbiol., 25, 933, 1987.
13. Stewardson, A. J. et al. Cutaneous zygomycosis caused by Saksenaea vasiformis following water-related wound in a 24-year-old immunocompetent woman. Mycoses, 52, 547, 2009.
14. Parker, C., Kaminski, G., and Hill, D. Zygomycosis in a tattoo, caused by Saksenaea vasiformis. Aust. J. Dermatol., 27, 107, 1986.
15. Clinical and laboratory Standards Institute (CLSI) 2008. Reference method for broth dilution antifungal susceptibility testing of �lamentous fungi: Approved standard. Document M-38A2, Clinical and Laboratory Standards Institute, Wayne, PA.
16. Sun, Q. N. et al. In vitro activities of posaconazole, itraconazole, voriconazole, amphotericin B, and ¼uconazole against 37 clinical isolates of zygomycetes. Antimicrob. Agents Chemother., 46, 1581, 2002.
17. Subcommittee on Antifungal Susceptibility Testing (AFST) of the ESCMID European Committee for Antimicrobial Susceptibility Testing (EUCAST) et al. EUCAST Technical Note on the method for the determination of broth dilution minimum inhibitory concentrations of antifungal agents for conidia-forming moulds. Clin. Microbiol. Infect., 14, 982, 2008. 18. Blanchet, D. et al. Saksenaea vasiformis infection, French Guiana. Emerg. Infect. Dis., 14, 342, 2008. 19. Gomez-Lopez, A. et al. In vitro susceptibility of clinical isolates of Zygomycota to amphotericin B, ¼ucytosine, itraconazole and voriconazole. J. Antimicrob. Chemother., 48, 919, 2001. 20. Dannaoui, E. et al. In vitro susceptibilities of zygomycetes to conventional and new antifungals. J. Antimicrob. Chemother., 51, 45, 2003. 21. Dannaoui, E. et al. In vitro susceptibilities of Zygomycota to polyenes. J. Antimicrob. Chemother., 49, 741, 2002. 22. Pillai, C. M. Saksenaea vasiformis, an ecologically important fungus on rice from India. Curr. Sci., 65, 291, 1993. 23. Parthasarathi, K. et al. Diversity of micro¼ora in the gut and casts of tropical composting earthworms reared on different substrates. J. Environ. Biol., 28, 87, 2007. 24. Hodges, C. S. Fungi isolated from southern forest tree nursery soils. Mycologia, 54, 221, 1962. 25. Farrow, W. M. Tropical soil fungi. Mycologia, 46, 632, 1954. 26. Mo, C. L., Salas, I., and Caballero, M. Are fungi and bacteria responsible for Olive Ridley’s egg loss? In Proceedings of the Tenth Annual Workshop on See Turtle Biology and Conservation. NOAA Technical Memorandum NMFSSEFC-278, T. H. Richardson, J. I. Richardson, and M. Donnelly, Eds., p. 249, 1990. 27. Goos, R. D. Further observation on soil fungi in Honduras. Mycologia, 55, 142, 1963. 28. Joffe, A. Z. and Borut, S. Y. Soil and kernel myco¼ora of groundnut �elds in Israel. Mycologia, 58, 629, 1966. 29. Watanabe, T. Pictorial atlas of soil and seed fungi. In Morphologies of Cultured Fungi and Key to Species, 2nd edn., CRC Press, Boca Raton, FL, 2002. 30. Watanabe, T. Fungi isolated from the rhizosphere soils of wilted pineapple plant in Okinawa. Trans. Mycol. Soc. Jpn., 12, 35, 1971. 31. Roden, M. M. et al. Epidemiology and outcome of zygomycosis: A review of 929 reported cases. Clin. Infect. Dis., 41, 634, 2005. 32. Aarset, H. et al. Acute renal infarction in a woman with slight asthma. Nephrol. Dial. Transplant., 16, 1711, 2001. 33. Ajello, L., Dean, D. F., and Irwin, R. S. The zygomycete Saksenaea vasiformis as a pathogen of humans with a critical review of the etiology of zygomycosis. Mycologia, 68, 52, 1976. 34. Al-Hedaithy, M. Cutaneous zygomycosis due to Saksenaea vasiformis: Case report and literature review. Ann. Saudi Med., 18, 428, 1998. 35. Baradkar, V. P. et al. Fatal rhino-orbito-cerebral infection caused by Saksenaea vasiformis in an immunocompetent individual: First case report from India. Indian J. Med. Microbiol., 26, 385, 2008. 36. Bearer, E. A. et al. Cutaneous zygomycosis caused by Saksenaea vasiformis in a diabetic patient. J. Clin. Microbiol., 32, 1823, 1994. 37. Cefai, C. et al. Zygomycetic gangrenous cellulitis. Lancet, 2, 1337, 1987. 38. Chakrabarti, A. et al. Primary cutaneous zygomycosis due to Saksenaea vasiformis and Apophysomyces elegans. Clin. Infect. Dis., 24, 580, 1997.
39. Ellis, D. H. and Kaminski, G. W. Laboratory identi�cation of Saksenaea vasiformis: A rare cause of zygomycosis in Australia. Sabouraudia, 23, 137, 1985.
40. Dean, D. F. et al. Cranial zygomycosis caused by Saksenaea vasiformis. Case report. J. Neurosurg., 46, 97, 1977.
41. Campelo, C., de Miguel, S., and del Palacio, A. Zigomicosis rinocerebral causada por Saksenaea vasiformis en un paciente diabético. Enferm. Infect. Microbiol. Clin., 23(Suppl. 1), 77, Abstract, 2005.
42. Garcia-Martinez, J. et al. Rhinocerebral zygomycosis caused by Saksenae vasiformis in a diabetic patient. Mycoses, 51, 549, 2008.
43. Goldschmied-Reouven, A. et al. Saksenaea vasiformis infection in a burn wound. J. Med. Vet. Mycol., 27, 427, 1989.
44. Gomez Merino, E. et al. Necrotic lesion in scalp after injury. Rev. Clin. Esp., 203, 451, 2003.
45. Gonis, G. and Starr, M. Fatal rhinoorbital mucormycosis caused by Saksenaea vasiformis in an immunocompromised child. Pediatr. Infect. Dis. J., 16, 714, 1997.
46. Hay, R. J. et al. Disseminated zygomycosis (mucormycosis) caused by Saksenaea vasiformis. J. Infect., 7, 162, 1983.
47. Holland, J. Emerging zygomycoses of humans: Saksenaea vasiformis and Apophysomyces elegans. Curr. Top. Med. Mycol., 8, 27, 1997.
48. Kauffmann-Lacroix, C. et al. Mucormycose cutanée à Saksenaea vasiformis: Diagnostic mycologique [Abstract]. J. Mycol. Med., 18, 57, 2008.
49. Kaufman, L., Padhye, A. A., and Parker, S. Rhinocerebral zygomycosis caused by Saksenaea vasiformis. J. Med. Vet. Mycol., 26, 237, 1988.
50. Koren, G., Polacheck, I., and Kaplan, H. Invasive mucormycosis in a non-immunocompromised patient. J. Infect., 12, 165, 1986.
51. Lye, G. R., Wood, G., and Nimmo, G. Subcutaneous zygomycosis due to Saksenaea vasiformis: Rapid isolate identi�cation using a modi�ed sporulation technique. Pathology, 28, 364, 1996.
52. Mathews, M. S. et al. Subcutaneous zygomycosis caused by Saksenaea vasiformis in India. A case report and review of the literature. J. Mycol. Med., 3, 95, 1993.
53. Oberle, A. D. and Penn, R. L. Nosocomial invasive Saksenaea vasiformis infection. Am. J. Clin. Pathol., 80, 885, 1983.
54. Padhye, A. A. et al. First case of subcutaneous zygomycosis caused by Saksenaea vasiformis in India. Diagn. Microbiol. Infect. Dis., 9, 69, 1988. 55. Padmaja, I. J., Ramani, T. V., and Kalyani, S. Cutaneous zygomycosis: Necrotising fascitis due to Saksenaea vasiformis. Indian J. Med. Microbiol., 24, 58, 2006.
56. Patino, J. F. et al. Mucormycosis: A fatal case by Saksenaea vasiformis. World J. Surg., 8, 419, 1984.
57. Pouget-Jasson, C. et al. A necrotic calf lesion. Ann. Dermatol. Vénéréol., 136, 549, 2009.
58. Pritchard, R. C. et al. Subcutaneous zygomycosis due to Saksenaea vasiformis in an infant. Med. J. Aust., 145, 630, 1986.
59. Ridley, L. et al. Cardiac mucormycosis revealed on imaging. AJR Am. J. Roentgenol., 174, 1469, 2000.
60. Solano, T. et al. Disseminated mucormycosis due to Saksenaea vasiformis in an immunocompetent adult. Clin. Infect. Dis., 30, 942, 2000. 61. Tanphaichitr, V. S. et al. Subcutaneous mucormycosis caused by Saksenaea vasiformis in a thalassaemic child: First case report in Thailand. Mycoses, 33, 303, 1990. 62. Torell, J., Cooper, B. H., and Helgeson, N. G. Disseminated Saksenaea vasiformis infection. Am. J. Clin. Pathol., 76, 116, 1981. 63. Trotter, D. J. et al. Disseminated Saksenaea vasiformis in an immunocompetent host. Med. J. Aust., 189, 519, 2008. 64. Upton, A. et al. A patient with cutaneous zygomycosis due to Saksenaea vasiformis. Infect. Dis. Clin. Pract., 11, 137, 2002. 65. Vega, W. et al. Saksenaea vasiformis infections: Case report and literature review. Mycopathologia, 162, 289, 2006. 66. Wierzbicka-Hainaut, E. et al. Mucormycose cutanée granulomateuse à Saksenaea vasiformis avec ostéite: Premier cas français. Abstract P122. Ann. Dermatol. Vénéréol., 135(Suppl.), A207, 2008. 67. Wilson, M. et al. Saksenaea vasiformis breast abscess related to gardening injury. Aust. N. Z. J. Med., 28, 845, 1998. 68. Wilson, P. A. Zygomycosis due to Saksenaea vasiformis caused by a magpie peck. Med. J. Aust., 189, 521, 2008. 69. Edsander-Nord, A. Wound complications from the tsunami disaster: A reminder of indications for delayed closure. Eur. J. Trauma Emerg. Surg., 34, 457, 2008. 70. Hill, B. D. et al. Bovine cranial zygomycosis caused by Saksenaea vasiformis. Aust. Vet. J., 69, 173, 1992. 71. Robeck, T. R. and Dalton, L. M. Saksenaea vasiformis and Apophysomyces elegans zygomycotic infections in bottlenose dolphins (Tursiops truncatus), a killer whale (Orcinus orca), and paci�c white-sided dolphins (Lagenorhynchus obliquidens). J. Zoo. Wildl. Med., 33, 356, 2002. 72. Ellis, J. J. and Ajello, L. An unusual source of Apophysomyces elegans and a method of stimulating sporulation of Saksenea vasiformis. Mycologia, 74, 144, 1982. 73. Padhye, A. A. and Ajello, L. Simple method of inducing sporulation by Apophysomyces elegans and Saksenaea vasiformis. J. Clin. Microbiol., 26, 1861, 1988. 74. Dannaoui, E. Molecular tools for identi�cation of Zygomycetes and the diagnosis of zygomycosis. Clin. Microbiol. Infect., 15(Suppl. 5), 66, 2009. 75. Schwarz, P. et al. Molecular identi�cation of Zygomycetes from culture and experimentally infected tissues. J. Clin. Microbiol., 44, 340, 2006. 76. Balajee, S. A. et al. Sequence-based identi�cation of Aspergillus, Fusarium, and mucorales species in the clinical mycology laboratory: Where are we and where should we go from here? J. Clin. Microbiol., 47, 877, 2009. 77. Clinical and laboratory Standards Institute (CLSI). Interpretive criteria for bacteria and fungi identi�cation by DNA target sequencing; Approved guideline MM-18A. 2007. 78. Hata, D. J. et al. Real-time PCR method for detection of zygomycetes. J. Clin. Microbiol., 46, 2353, 2008. 79. Dannaoui, E. et al. Molecular detection and identi�cation of zygomycetes species from paraf�n-embedded tissues in a murine model of disseminated zygomyeosis: a collaborative European Society of Clinical Microbiology and Infections Diseases (ESCMID) Fungal Infection Study Group (EFISG) evaluation: J. Clin. Microbiol., 48, 2043, 2010. 80. Nilsson, R. H. et al. Taxonomic reliability of DNA sequences in public sequence databases: A fungal perspective. PLoS One, 1, e59, 2006. 90 Chapter 90 - Syncephalastrum
4. Rao CY et al. Characterization of airborne molds, endotoxins, and glucans in homes in New Orleans after Hurricanes Katrina and Rita. Appl. Environ. Microbiol. 2007; 73(5): 1630–1634.
5. Rao CY et al. Implications of detecting the mold Syncephalastrum in clinical specimens of New Orleans residents after Hurricanes Katrina and Rita. J. Occup. Environ. Med. 2007; 49: 411.
6. Kamalam A, Thambiah AS. Cutaneous infection by Syncephalastrum. Sabouraudia, 1980; 18: 19.
7. Pavlović MD, Bulajić N. Great toenail onychomycosis caused by Syncephalastrum racemosum. Dermatol. Online J. 2006; 12(1): 7.
8. Amatya R, Khanal B, Rijal A. Syncephalastrum species producing mycetoma-like lesions. Indian J. Dermatol. Venereol. Leprol. 2010; 76(3): 284–286.
9. Schlebusch S, Looke DF. Intraabdominal zygomycosis caused by Syncephalastrum racemosum infection successfully treated with partial surgical debridement and high-dose amphotericin B lipid complex. J. Clin. Microbiol. 2005; 43(11): 5825–5827.
10. Baradkar VP et al. Sino-orbital infection by Syncephalastrum racemosum in chronic hepatorenal disease. J. Oral Maxillofac. Pathol. 2008; 12: 45–47.
11. Gupta AK et al. Utility of inoculum counting (Walshe and English criteria) in clinical diagnosis of onychomycosis caused by nondermatophytic �lamentous fungi. J. Clin. Microbiol. 2001; 39: 2115–2121.
12. Gupta AK et al. Non-dermatophyte onychomycosis. Dermatol. Clin. 2003; 21: 257–268. 13. Haynes KA et al. Rapid detection and identi�cation of pathogenic fungi by polymerase chain reaction ampli�cation of large subunit ribosomal DNA. J. Med. Vet. Mycol. 1995; 33: 319. 14. Vander Straten RM, Balkis MM, Ghannoum AM. The role of nondermatophyte molds in onychomycosis: Diagnosis and treatment. Dermatol. Ther. 2002; 15: 89–98. 15. Jensen AB et al. Relationships of the insect-pathogenic order Entomophthorales (Zygomycota, Fungi) based on phylogenetic analyses of nuclear small subunit ribosomal DNA sequences (SSU rDNA). Fungal Genet. Biol. 1998; 24: 325–334. 16. Voigt K, Cigelnik E, O’donnell K. Phylogeny and PCR identi�cation of clinically important Zygomycetes based on nuclear ribosomal-DNA sequence data. J. Clin. Microbiol. 1999; 37: 3957. 17. Nyilasi I et al. High-af�nity iron permease (FTR1) gene sequence-based molecular identi�cation of clinically important Zygomycetes. Clin. Microbiol. Infect. 2008; 14(4): 393–397. 18. Pounder JI et al. Discovering potential pathogens among fungi identi�ed as nonsporulating molds. J. Clin. Microbiol. 2007; 45(2): 568–571. 19. Zeng JS et al. Spectrum of clinically relevant Exophiala species in the United States. J. Clin. Microbiol. 2007; 45(11): 3713–3720. 20. Leaw SN et al. Identi�cation of medically important yeast species by sequence analysis of the internal transcribed spacer regions. J. Clin. Microbiol. 2006; 44: 693.
Part IV
Microsporidia 91 Chapter 91 - Anncaliia (Brachiola)
1. Canning, E.U. and Lom, J. The Microsporidia of Vertebrates. Academic Press, London, U.K., 1986.
2. Wittner, M. and Weiss, L.M. The Microsporidia and Microsporidiosis. ASM Press, Washington, DC, 1999.
3. Baker, M.D. et al. Phylogenetic relationships among Vairimorpha and Nosema species (Microspora) based on ribosomal RNA sequence data. J. Invertebr. Pathol. 64:100–106, 1994.
4. Katinka, M.D. et al. Genome sequence and gene compaction of the eukaryote parasite Encephalitozoon cuniculi. Nature 414:450–453, 2001.
5. Keeling, P.J. and Slamovits, C.H. Simplicity and complexity of microsporidian genomes. Eukaryot. Cell 3:1363–1369, 2004.
6. Gill, E.E. and Fast, N.M. Assessing the microsporidia-fungi relationship: Combined phylogenetic analysis of eight genes. Gene 375:103–109, 2006.
7. CDC Tubulinosema Bern, C. Personal communication.
8. Matsubayashi, H. et al. A case of Encephalitozoon-like body infection in man. Arch. Pathol. 67:181–187, 1959.
9. Didier, E.S. and Weiss, L.M. Microsporidiosis: Current status. Curr. Opin. Infect. Dis. 19:485–492, 2006.
10. Desportes, I. et al. Occurrence of a new microsporidian: Enterocytozoon bieneusi n.g., n. sp., in enterocytes of a human patient with AIDS. J. Protozool. 32:250–254, 1985.
11. Cali, A. et al. Corneal microsporidiosis: Characterization and identi�cation. J. Protozool. 38:215S–217S, 1991.
12. Visvesvara, G.S. et al. Isolation of Nosema algerae from the cornea of an immunocompetent patient. J. Eukaryot. Microbiol. 46:10S, 1999. 13. Cali, A. et al. Brachiola vesicularum, n.g., n. sp., a new microsporidium associated with AIDS and myosits. J. Eukaryot. Microbiol. 45:240–251, 1989. 14. Margileth, A.M. et al. Disseminated nosematosis in an immunologically compromised infant. Arch. Pathol. 95:145– 150, 1973. 15. Sprague, V. Nosema connori n. sp. A microsporidian parasite of man. Trans. Am. Microsc. Soc. 93:400–403, 1974. 16. Visvesvara, G.S. et al. Public health importance of Brachiola algerae (Microsporidia)—An emerging pathogen of humans. Folia Parasitol. 52:83–94, 2005. 17. Coyle, C.M. et al. Fatal myositis due to the microsporidian Brachiola algerae, a mosquito pathogen. N. Engl. J. Med. 351:42–47, 2004. 18. Cali, A. et al. Human vocal cord infection with the microsporidian Anncaliia algerae. J. Eukaryot. Microbiol. 57:562–567, 2010. 19. Vávra, J. and Undeen, A.H. Nosema algerae n.sp. (Cnidospora, Microsporida) a pathogen in laboratory colony of Anopheles stephensi Liston (Diptera, Culicidae). J. Protozool. 17:240– 249, 1970. 20. Undeen, A.H. and Maddox, J.V. The infection of nonmosquito hosts by injection with spores of the microsporidian Nosema algerae. J. Invertebr. Pathol. 22:258–265, 1973. 21. Undeen, A.H. Growth of Nosema algerae in pig kidney cell cultures. J. Protozool. 22:107–110, 1975. 22. Undeen, A.H. and Alger, N.E. Nosema algerae: Infection of the white mouse by the mosquito parasite. Exp. Parasitol. 40:86–88, 1976. 23. Muller, A. et al. Ribosomal RNA of Nosema algerae and phylogenetic relationship to other microsporidia. Parasitol. Res. 86:18–23, 2000. 24. Lowman, P.M. et al. The effects of elevated temperatures and various time-temperature combinations on the development of Brachiola (Nosema) algerae n. comb. In mammalian cell culture. J. Eukaryot. Microbiol. 47:221–234, 2000. 25. Franzen, C. et al. Transfer of the members of the genus Brachiola (Microsporidia) to the genus Anncaliia based on ultrastructural and molecular data. J. Eukaryot. Microbiol. 53:26–35, 2006. 26. Issi, I.V. et al. The ultrastructure of the microsporidium Nosema meligethi and establishment of the new genus Anncaliia. Parazitologia 27:127–133, 1993. 27. Franzen, C. et al. Morphological and molecular investigation of Tubulinosema ratisbonensis gen. nov., sp. nov. (Microsporidia:Tubulinosematidae fam. nov.), a parasite infecting a laboratory colony of Drosophila melanogaster (Diptera: Drosophilidae). J. Eukaryot. Microbiol. 52:141– 152, 2005. 28. Koudela, B. et al. The human isolate of Brachiola algerae (Phylum Microspora): Development in SCID mice and description of its �ne structure. Parasitology 123:153–162, 2001. 29. Moura, H. et al. Characterization of Nosema algerae isolates after continuous cultivation in mammalian cells at 37°C. J. Eukaryot. Microbiol. 46:14S–16S, 1999. 30. Trammer, T. In vitro replication of Nosema algerae (Microsporidia), a parasite of anopheline mosquitoes, in human cells above 36°C. J. Eukaryot. Microbiol. 46:464–468, 1999. 31. Cali, A. et al. Brachiola algerae spore membrane systems, their activity during extrusion, and a new structural entity, the multilayered interlaced network, associated with the polar tube and sporoplasm. J. Eukaryot. Microbiol. 49:164–174, 2002.
32. Cali, A. et al. An analysis of the microsporidian genus Brachiola, with comparisons of human and insect isolates of Brachiola algerae. J. Eukaryot. Microbiol. 51:678–685, 2004.
33. Takvorian, P.M. et al. The early events of Brachiola algerae (Microsporidia) infection: Spore germination, sporoplasm structure, and development within host cells. Folia Parasitol. 52:118–129, 2005.
34. Visvesvara, G.S. In vitro cultivation of microsporidia of clinical importance. Clin. Microbiol. Rev. 15:401, 2002.
35. Belkorchia, A. et al. In vitro propagation of the microsporidian pathogen Brachiola algerae and studies of its chromosome and ribosomal DNA organization in the context of the complete genome sequencing project. Parasitol. Int. 57:62–71, 2008.
36. Kucerova, Z. et al. Differences between Brachiola (Nosema) algerae isolates of human and insect origin when tested using an in vitro spore germination assay and a cultured cell infection assay. J. Eukaryot. Microbiol. 51:339–343, 2004.
37. Trammer, T. Opportunistic properties of Nosema algerae (Microspora) a mosquito parasite, in immunocompromised mice. J. Eukaryot. Microbiol. 44:258–262, 1997.
38. Kelley, J.F. and Anthony, D.W. Susceptibility of spores of the microsporidian Nosema algerae to sunlight and germicidal ultraviolet radiation. J. Invertebr. Pathol. 34:164–169, 1979. 39. Avery, S.W. and Undeen, A.H. The isolation of microsporidia and other pathogens from concentrated ditch water. J. Am. Mosq. Control Assoc. 3:54–58, 1987. 40. Undeen, A.H. and Vander Meer, R.K. The effect of ultraviolet radiation on the germination of Nosema algerae Vávra and Undeen (Microsporida: Nosematidae) spores. J. Protozool. 37:194–199, 1990. 41. Fogla, R. et al. Chronic microsporidial stromal keratitis in an immunocompetent, non contact lens wearer. Ind. J. Ophthalmol. 53:123–125, 2005. 42. Curry, A. et al. A case of bilateral microsporidial keratitis from Bangladesh—Infection by an insect parasite from the genus Nosema. J. Med. Microbiol. 56:1250–1252, 2007. 43 Weber, R. et al. Improved light microscopical detection of microsporidia spores in stool and duodenal aspirates. N. Engl. J. Med. 326:161–166, 1992. 44. Moura, H. et al. A new and improved “quick-hot Gram chromotrope” technique that differentially stains microsporidian spores in clinical samples including paraf�n-embedded tissue sections. Arch. Pathol. Lab. Med. 121:888–893, 1997. 45. Didier, E.S. et al. Comparison of three staining methods for detecting microsporidia in ¼uids. J. Clin. Microbiol. 33:3138– 3145, 1995. 92 Chapter 92 - Encephalitozoon
1. Franzen, C. and Muller, A. Molecular techniques for detection, species differentiation, and phylogenetic analysis of microsporidia. Clin Microbiol Rev 12, 243–285 (1999).
2. Franzen, C. and Muller, A. Microsporidiosis: Human diseases and diagnosis. Microbes Infect 3, 389–400 (2001).
3. Kamaishi, T. et al. Protein phylogeny of translation elongation factor EF-1 alpha suggests microsporidians are extremely ancient eukaryotes. J Mol Evol 42, 257–263 (1996).
4. Peyretaillade, E. et al. Microsporidia, amitochondrial protists, possess a 70-kDa heat shock protein gene of mitochondrial evolutionary origin. Mol Biol Evol 15, 683–689 (1998).
5. Keeling, P.J. Congruent evidence from alpha-tubulin and beta-tubulin gene phylogenies for a zygomycete origin of microsporidia. Fungal Genet Biol 38, 298–309 (2003).
6. Babenko, V.N. and Krylov, D.M. Comparative analysis of complete genomes reveals gene loss, acquisition and acceleration of evolutionary rates in Metazoa, suggests a prevalence of evolution via gene acquisition and indicates that the evolutionary rates in animals tend to be conserved. Nucleic Acids Res 32, 5029–5035 (2004).
7. Fedorov, A. and Hartman, H. What does the microsporidian E. cuniculi tell us about the origin of the eukaryotic cell? J Mol Evol 59, 695–702 (2004).
8. Thomarat, F., Vivares, C.P., and Gouy, M. Phylogenetic analysis of the complete genome sequence of Encephalitozoon cuniculi supports the fungal origin of microsporidia and reveals a high frequency of fast-evolving genes. J Mol Evol 59, 780–791 (2004).
9. Didier, E.S. and Weiss, L.M. Microsporidiosis: Current status. Curr Opin Infect Dis 19, 485–492 (2006).
10. Weiss, L.M. Microsporidia: Emerging pathogenic protists. Acta Trop 78, 89–102 (2001).
11. Garcia, L.S. Laboratory identi�cation of the microsporidia. J Clin Microbiol 40, 1892–1901 (2002). 12. Orenstein, J.M. Microsporidiosis in the acquired immunode�ciency syndrome. J Parasitol 77, 843–864 (1991).
13. Vossbrinck, C.R. and Debrunner-Vossbrinck, B.A. Molecular phylogeny of the Microsporidia: Ecological, ultrastructural and taxonomic considerations. Folia Parasitol (Praha) 52, 131–142; discussion 130 (2005).
14. Franzen, C. et al. Transfer of the members of the genus Brachiola (microsporidia) to the genus Anncaliia based on ultrastructural and molecular data. J Eukaryot Microbiol 53, 26–35 (2006).
15. Katinka, M.D. et al. Genome sequence and gene compaction of the eukaryote parasite Encephalitozoon cuniculi. Nature 414, 450–453 (2001).
16. Keeling, P.J. and Fast, N.M. Microsporidia: Biology and evolution of highly reduced intracellular parasites. Annu Rev Microbiol 56, 93–116 (2002). 17. Keeling, P.J. and Slamovits, C.H. Simplicity and complexity of microsporidian genomes. Eukaryot Cell 3, 1363–1369 (2004). 18. Hartskeerl, R.A. et al. Genetic and immunological characterization of the microsporidian Septata intestinalis Cali, Kotler and Orenstein, 1993: Reclassi�cation to Encephalitozoon intestinalis. Parasitology 110 (Pt 3), 277–285 (1995). 19. Cali, A., Weiss, L.M., and Takvorian, P.M. Microsporidian taxonomy and the status of Septata intestinalis. J Eukaryot Microbiol 43, 106S–107S (1996). 20. Dowd, S.E., Gerba, C.P., and Pepper, I.L. Con�rmation of the human-pathogenic microsporidia Enterocytozoon bieneusi, Encephalitozoon intestinalis, and Vittaforma corneae in water. Appl Environ Microbiol 64, 3332–3335 (1998). 21. Dowd, S.E. et al. Con�rmed detection of Cyclospora cayetanesis, Encephalitozoon intestinalis and Cryptosporidium parvum in water used for drinking. J Water Health 1, 117–123 (2003). 22. Furuya, K. Spore-forming microsporidian encephalitozoon: Current understanding of infection and prevention in Japan. Jpn J Infect Dis 62, 413–422 (2009). 23. Franzen, C. et al. Genetic evidence for latent Septata intestinalis infection in human immunode�ciency virus-infected patients with intestinal microsporidiosis. J Infect Dis 173, 1038–1040 (1996). 24. Didier, E.S. Microsporidiosis: An emerging and opportunistic infection in humans and animals. Acta Trop 94, 61–76 (2005). 25. Mathis, A., Weber, R., and Deplazes, P. Zoonotic potential of the microsporidia. Clin Microbiol Rev 18, 423–445 (2005). 26. Didier, E.S. et al. Identi�cation and characterization of three Encephalitozoon cuniculi strains. Parasitology 111(Pt 4), 411–421 (1995). 27. Xiao, L. et al. Genotyping Encephalitozoon cuniculi by multilocus analyses of genes with repetitive sequences. J Clin Microbiol 39, 2248–2253 (2001). 28. Mathis, A. et al. Genetic and phenotypic intraspeci�c variation in the microsporidian Encephalitozoon hellem. Int J Parasitol 29, 767–770 (1999). 29. Xiao, L. et al. Genotyping Encephalitozoon hellem isolates by analysis of the polar tube protein gene. J Clin Microbiol 39, 2191–2196 (2001). 30. Hoffman, R.M. et al. Identi�cation and characterization of two subpopulations of Encephalitozoon intestinalis. Appl Environ Microbiol 69, 4966–4970 (2003). 31. Kotler, D.P. and Orenstein, J.M. Clinical syndromes associated with microsporidiosis. Adv Parasitol 40, 321–349 (1998). 32. Weber, R., Deplazes, P., and Schwartz, D. Diagnosis and clinical aspects of human microsporidiosis. Contrib Microbiol 6, 166–192 (2000). 33. Weber, R. et al. Improved light-microscopical detection of microsporidia spores in stool and duodenal aspirates. The Enteric Opportunistic Infections Working Group. N Engl J Med 326, 161–166 (1992). 34. Katzwinkel-Wladarsch, S. et al. Comparison of polymerase chain reaction with light microscopy for detection of microsporidia in clinical specimens. Eur J Clin Microbiol Infect Dis 16, 7–10 (1997). 35. Li, X. et al. Ef�ciency for recovering Encephalitozoon intestinalis spores from waters by centrifugation and immuno¼uorescence microscopy. J Eukaryot Microbiol 50(Suppl), 579–580 (2003). 36. Chan, K.S. and Koh, T.H. Extraction of microsporidial DNA from modi�ed trichrome-stained clinical slides and subsequent species identi�cation using PCR sequencing. Parasitology 135, 701–703 (2008).
37. Didier, E.S. et al. Comparison of three staining methods for detecting microsporidia in ¼uids. J Clin Microbiol 33, 3138–3145 (1995).
38. Barbosa, J., Rodrigues, A.G., and Pina-Vaz, C. Cytometric approach for detection of Encephalitozoon intestinalis, an emergent agent. Clin Vaccine Immunol 16, 1021–1024 (2009).
39. van Gool, T. et al. Septata intestinalis frequently isolated from stool of AIDS patients with a new cultivation method. Parasitology 109 (Pt 3), 281–289 (1994).
40. Visvesvara, G.S. et al. In vitro culture and serologic and molecular identi�cation of Septata intestinalis isolated from urine of a patient with AIDS. J Clin Microbiol 33, 930–936 (1995).
41. Joseph, J. and Sharma, S. In vitro culture of various species of microsporidia causing keratitis: Evaluation of three immortalized cell lines. Indian J Med Microbiol 27, 35–39 (2009).
42. De Groote, M.A. et al. Polymerase chain reaction and culture con�rmation of disseminated Encephalitozoon cuniculi in a patient with AIDS: Successful therapy with albendazole. J Infect Dis 171, 1375–1378 (1995).
43. Beckers, P.J. et al. Encephalocytozoon intestinalis-speci�c monoclonal antibodies for laboratory diagnosis of microsporidiosis. J Clin Microbiol 34, 282–285 (1996).
44. Deplazes, P. et al. Immunologic and molecular characteristics of Encephalitozoon-like microsporidia isolated from humans and rabbits indicate that Encephalitozoon cuniculi is a zoonotic parasite. Clin Infect Dis 22, 557–559 (1996).
45. Mo, L. and Drancourt, M. Monoclonal antibodies for speci�c detection of Encephalitozoon cuniculi. Clin Diagn Lab Immunol 11, 1060–1063 (2004).
46. Jordan, C.N. et al. Direct agglutination test for Encephalitozoon cuniculi. Vet Parasitol 135, 235–240 (2006).
47. Furuya, K. et al. Recognition pro�les of microsporidian Encephalitozoon cuniculi polar tube protein 1 with human immunoglobulin M antibodies. Parasite Immunol 30, 13–21 (2008).
48. Owen, R.L. Polymerase chain reaction of stool: A powerful tool for speci�c diagnosis and epidemiologic investigation of enteric microsporidia infections. AIDS 11, 817–818 (1997).
49. Hester, J.D. et al. Species-speci�c detection of three human-pathogenic microsporidial species from the genus Encephalitozoon via ¼uorogenic 5′ nuclease PCR assays. Mol Cell Probes 16, 435–444 (2002).
50. Wang, Z., Orlandi, P.A., and Stenger, D.A. Simultaneous detection of four human pathogenic microsporidian species from clinical samples by oligonucleotide microarray. J Clin Microbiol 43, 4121–4128 (2005).
51. Verweij, J.J. et al. Multiplex detection of Enterocytozoon bieneusi and Encephalitozoon spp. in fecal samples using real-time PCR. Diagn Microbiol Infect Dis 57, 163–167 (2007). 52. Fedorko, D.P., Nelson, N.A., and Cartwright, C.P. Identi�cation of microsporidia in stool specimens by using PCR and restriction endonucleases. J Clin Microbiol 33, 1739–1741 (1995). 53. Kock, N.P. et al. Species-speci�c identi�cation of microsporidia in stool and intestinal biopsy specimens by the polymerase chain reaction. Eur J Clin Microbiol Infect Dis 16, 369–376 (1997). 54. Liguory, O. et al. Diagnosis of infections caused by Enterocytozoon bieneusi and Encephalitozoon intestinalis using polymerase chain reaction in stool specimens. AIDS 11, 723–726 (1997). 55. Ombrouck, C. et al. Speci�c PCR assay for direct detection of intestinal microsporidia Enterocytozoon bieneusi and Encephalitozoon intestinalis in fecal specimens from human immunode�ciency virus-infected patients. J Clin Microbiol 35, 652–655 (1997). 56. Raynaud, L. et al. Identi�cation of Encephalitozoon intestinalis in travelers with chronic diarrhea by speci�c PCR ampli�cation. J Clin Microbiol 36, 37–40 (1998). 57. Ghosh, K. and Weiss, L.M. Molecular diagnostic tests for microsporidia. Interdiscip Perspect Infect Dis 2009, 926521 (2009). 58. Muller, A. et al. A powerful DNA extraction method and PCR for detection of microsporidia in clinical stool specimens. Clin Diagn Lab Immunol 6, 243–246 (1999). 59. Coyle, C.M. et al. Prevalence of microsporidiosis due to Enterocytozoon bieneusi and Encephalitozoon (Septata) intestinalis among patients with AIDS-related diarrhea: Determination by polymerase chain reaction to the microsporidian small-subunit rRNA gene. Clin Infect Dis 23, 1002–1006 (1996). 60. Chabchoub, N. et al. Genetic identi�cation of intestinal microsporidia species in immunocompromised patients in Tunisia. Am J Trop Med Hyg 80, 24–27 (2009). 61. Da Silva, A.J. et al. Detection of Septata intestinalis (Microsporidia) Cali et al. 1993 using polymerase chain reaction primers targeting the small submit subunit ribosomal RNA coding region. Mol Diagn 2, 47–52 (1997). 62. Menotti, J. et al. Development of a real-time polymerase-chainreaction assay for quantitative detection of Enterocytozoon bieneusi DNA in stool specimens from immunocompromised patients with intestinal microsporidiosis. J Infect Dis 187, 1469–1474 (2003). 63. Visvesvara, G.S. et al. Polyclonal and monoclonal antibody and PCR-ampli�ed small-subunit rRNA identi�cation of a microsporidian, Encephalitozoon hellem, isolated from an AIDS patient with disseminated infection. J Clin Microbiol 32, 2760–2768 (1994). 64. Wolk, D.M. et al. Real-time PCR method for detection of Encephalitozoon intestinalis from stool specimens. J Clin Microbiol 40, 3922–3928 (2002). 93 Chapter 93 - Enterocytozoon
17. Franzen, C. and Muller A., Molecular techniques for detection, species differentiation, and phylogenetic analysis of microsporidia. Clin. Microbiol. Rev., 12, 243, 1999.
18. Zhu, X. et al., Small subunit rRNA sequence of Enterocytozoon bieneusi and its potential diagnostic role with use of the polymerase chain reaction. J. Infect. Dis., 168, 1570, 1993.
19. Katzwinkel-Wladarsch, S. et al., Direct ampli�cation and species determination of microsporidian DNA from stool specimens. Trop. Med. Int. Health, 1, 373, 1996.
20. Wolk, D.M. et al., Real-time PCR method for detection of Encephalitozoon intestinalis from stool specimens. J. Clin. Microbiol., 40, 3922, 2002.
21. Menotti, J. et al., Development of a real-time polymerase-chainreaction assay for quantitative detection of Enterocytozoon bieneusi DNA in stool specimens from immunocompromised patients with intestinal microsporidiosis. J. Infect. Dis., 187, 1469, 2003.
22. Menotti, J. et al., Development of a real-time PCR assay for quantitative detection of Encephalitozoon intestinalis DNA. J. Clin. Microbiol., 41, 1410, 2003.
23. Franzen, C. and Muller, A., Microsporidiosis: Human diseases and diagnosis. Microbes Infect., 3, 389, 2001.
24. Notermans, D.W. et al., Detection and identi�cation of Enterocytozoon bieneusi and Encephalitozoon species in stool and urine specimens by PCR and differential hybridization. J. Clin. Microbiol., 43, 610, 2005. 25. Verweij, J.J. et al., Multiplex detection of Enterocytozoon bieneusi and Encephalitozoon spp. in fecal samples using realtime PCR. Diagn. Microbiol. Infect. Dis., 57, 163, 2007. 26. Mathis, A. et al., Two Encephalitozoon cuniculi strains of human origin are infectious to rabbits. Parasitology, 114, 29, 1997. 27. Akiyoshi, D.E. et al., Analysis of the beta-tubulin genes from Enterocytozoon bieneusi isolates from a human and rhesus macaque. J. Eukaryot. Microbiol., 54, 38, 2007. 28. Mathis, A. et al., Genetic and phenotypic intraspeci�c variation in the microsporidian Encephalitozoon hellem. Int. J. Parasitol., 29, 767, 1999. 29. Mathis, A., Weber, R., and Deplazes, P., Zoonotic potential of the microsporidia. Clin. Microbiol. Rev., 18, 423, 2005. 30. Santin, M. and Fayer, R., Enterocytozoon bieneusi genotype nomenclature based on the internal transcribed spacer sequence: A consensus. J. Eukaryot. Microbiol., 56, 34, 2009. 31. Li, J. et al., Tubulin genes from AIDS-associated microsporidia and implications for phylogeny and benzimidazole sensitivity. Mol. Biochem. Parasitol., 78, 289, 1996. 32. Katiyar, S.K. et al., Antiprotozoal activities of benzimidazoles and correlations with beta-tubulin sequence. Antimicrob. Agents Chemother., 38, 2086, 1994. 33. Verweij, J.J. et al., Determining the prevalence of Oesophagostomum bifurcum and Necator americanus infections using speci�c PCR ampli�cation of DNA from faecal samples. Trop. Med. Int. Health, 6, 726, 2001. 94 Chapter 94 - Nosema, Vittaforma, and Microsporidium
11. Chan, C.M.L. et al. 2003. Microsporidial keratitis in healthy individuals. Ophthalmology 110:1420–1425.
12. Bryan, R.T. et al. 1991. Microsporidia: Opportunistic pathogens in patients with AIDS. Prog. Clin. Parasitol. 2:1–26.
13. Joseph, J. et al. 2006. Microsporidial keratitis in India: 16S rRNA gene-based PCR assay for diagnosis and species identi�cation of microsporidia in clinical samples. Invest. Ophthalmol. Vis. Sci. 47:4468–4473.
14. Curry, A. et al. 2007. A case of bilateral microsporidial keratitis from Bangladesh—Infection by an insect parasite from the genus Nosema. J. Med. Microbiol. 56:1250–1252.
15. Hutin, Y.J. et al. 1998. Risk factors for intestinal microsporidiosis in patients with human immunode�ciency virus infection: A case control study. J. Infect. Dis. 178:904–907.
16. Davis, R.M. et al. 1990. Corneal microsporidiosis: A case report including ultrastructural observations. Ophthalmology 97:953–957.
17. Shadduck, J.A. et al. 1990. Isolation of a microsporidian from a human patient. J. Infect. Dis. 162:773–776.
18. Silveira, H. and Canning, E.U. 1995. Vittaforma corneae n. comb. for the human microsporidium Nosema corneum Shadduck, Meccoli, Davis & Font, 1990, based on its ultrastructure in the liver of experimentally infected athymic mice. J. Eukaryot. Microbiol. 42(2):158–165.
19. Silveira, H., Canning, E.U., and Shadduck, J.A. 1993. Experimental infection of athymic mice with the human microsporidian Nosema corneum. Parasitology 107:489–496.
20. Deplazes, P. et al. 1998. Dual microsporidial infection due to Vittaforma corneae and Encephalitozoon hellem in a patient with AIDS. Clin. Infect. Dis. 27:1521–1524.
21. Font, R.L. et al. 2000. Corneal microsporidiosis: Report of case, including electron microscopic observations. Ophthalmology 107:1769–1775.
22. Font, R.L., Su, G.W., and Matoba, A.Y. 2003. Microsporidial stromal keratitis. Arch. Ophthalmol. 121:1045–1047.
23. Irshad, M. et al. 2003. Identi�cation of a new microsporidian parasite related to Vittaforma corneae in HIV-Positive and HIV-Negative Patients from Portugal. J. Eukaryot. Microbiol. 50(6):586–590.
24. Garcia, L.S. 2002. Laboratory identi�cation of the microsporidia. J. Clin. Microbiol. 40(6):1892–1901.
25. Visvesvara, G.S. 2002. In vitro cultivation of microsporidia of clinical importance. Clin. Microbiol. Rev. 15(3):401–413.
26. Baker, M.D. et al. 1994. Phylogenetic relationships among Vairimorpha and Nosema species (microspora) based on ribosomal RNA sequence data. J. Invertebr. Pathol. 64:100–106.
27. Franzen, C. and Müller, A. 1999. Molecular techniques for detection, species differentiation, and phylogenetic analysis of microsporidia. Clin. Microbiol. Rev. 12:243–285. 28. Keeling, P.J. 2003. Congruent evidence from α-tubulin and β-tubulin gene phylogenies for a zygomycete origin of microsporidia. Fungal Genet. Biol. 38:298–309. 29. Chan, K.S. and Koh, T.H. 2008. Extraction of microsporidial DNA from modi�ed trichrome-stained clinical slides and subsequent species identi�cation using PCR sequencing. Parasitology 135(6):701–703. 30. Franzen, C. and Salzberger, B. 2008. Analysis of the β-tubulin gene from Vittaforma corneae suggests Benzimidazole resistance. Antimicrob. Agents Chemother. 52:790. 31. Ghosh, K. and Weiss, L.M. 2009. Molecular diagnostic tests for microsporidia. Interdiscip. Perspect. Infect. Dis. 2009:926521. 32. Reddy, A.K. et al. 2011. Polymerase chain reaction for the diagnosis and species identi�cation of microsporidia in patients with keratitis. Clin. Microbiol. Infect. (in press). 33. Chen, Y.P. et al. 2009. Morphological, molecular, and phylogenetic characterization of Nosema ceranae, a microsporidian parasite isolated from the European honey bee, Apis mellifera. J. Eukaryot. Microbiol. 56(2):142–147. 34. Klee, J., Tay, W.T., and Paxton, R.J. 2006. Speci�c and sensitive detection of Nosema bombi (Microsporidia: Nosematidae) in bumble bees (Bombus spp.; Hymenoptera: Apidae) by PCR of partial rRNA gene sequences. J. Invertebr. Pathol., 91:98. 35. Muller, A. et al. 1999. A powerful DNA extraction method and PCR for detection of microsporidia in clinical stool specimens. Clin. Diagn. Lab. Immunol. 6:243–246. 36. Visvesvara, G.S. et al. 1994. Polyclonal and monoclonal antibody and PCR-ampli�ed small subunit rRNA identi�cation of a microsporidian, Encephalitozoon hellem, isolated from an AIDS patient with disseminated infection. J. Clin. Microbiol. 32:2760–2768. 37. de Groote, M.A. et al. 1995. Polymerase chain reaction and culture con�rmation of disseminated Encephalitozoon cuniculi in a patient with AIDS: Successful therapy with albendazole. J. Infect. Dis. 171:1375–1378. 38. Da Silva, A.J. et al. 1997. Detection of Septata intestinalis (microsporidia) Cali et al. 1993 using polymerase chain reaction primers targeting the small subunit ribosomal RNA coding region. Mol. Diagn. 2:47–52. 39. Zhu, X. et al. 1994. Ribosomal RNA sequences of Enterocytozoon bieneusi, Septata intestinalis and Ameson michaelis: Phylogenetic construction and structural correspondence. J. Eukaryot. Microbiol. 41:204–209. 40. Vemuganti, G.K. et al. 2005. Is microsporidial keratitis an emerging cause of stromal keratitis? A case series study. BMC Ophthalmol. 5:19–33. 95 Chapter 95 - Pleistophora and Trachipleistophora
1. The UniProt Consortium. Available at http://www.uniprot.org/, accessed on August 1, 2010.
2. Cali A, Takvorian PM. Ultrastructure and development of Pleistophora ronnea¡ei n. sp., a microsporidium (Protista) in the skeletal muscle of an immune-compromised individual. J. Eukaryot. Microbiol. 2003;50(2):77–85.
3. Cheney SA, Lafranchi-Tristem NJ, Canning EU. Phylogenetic relationships of Pleistophora-like microsporidia based on small subunit ribosomal DNA sequences and implications for the source of Trachipleistophora hominis infections. J. Eukaryot. Microbiol. 2000;47:280–287.
4. Horák A et al. Trachipleistophora extenrec n. sp. a new microsporidian (fungi: microsporidia) infecting mammals. J. Eukaryot. Microbiol. 2006;53(6):464–476.
5. Vavra J et al. Microsporidia of the genus Trachipleistophora— Causative agents of human microsporidiosis: Description of Trachipleistophora anthropophthera n. sp. (protozoa: microsporidia). J. Eukaryot. Microbiol. 1998;45:273–283.
6. Hollister WS et al. Development and ultrastructure of Trachipleistophora hominis n.g., n.sp. after in vitro isolation from an AIDS patient and inoculation into athymic mice. Parasitology 1996;112(Pt 1):143–154. 7. Koudela B, Vávra J, Canning EU. Experimental infection of severe combined immunode�cient (SCID) mice with the human microsporidian Trachipleistophora hominis. Parasitology 2004;128:377–384. 8. Cali A, Weiss LM, Takvorian PM. A review of the development of two types of human skeletal muscle infections from microsporidia associated with pathology in invertebrates and cold-blooded vertebrates. Folia Parasitol. (Praha) 2005;52(1–2):51–61. 9. Lom J, Nilsen F. Fish microsporidia: Fine structural diversity and phylogeny. Int. J. Parasitol. 2003;33(2):107–127. 10. Canning EU et al. New diplokaryotic microsporidia (Phylum Microsporidia) from freshwater bryozoans (Bryozoa, Phylactolaemata). Eur. J. Protistol. 2002;38:247–265. 11. Weidner E et al. Mosquito (Diptera: Culicidae) host compatibility and vector competency for the human myositic parasite Trachipleistophora hominis (Phylum Microspora). J. Med. Entomol. 1999;36(4):522–525. 12. Ledford DK et al. Microsporidiosis myositis in a patient with acquired immunode�ciency syndrome. Ann. Intern. Med. 1985;102:628–630. 13. Chupp GL et al. Myositis due to Pleistophora (Microsporidia) in a patient with AIDS. Clin. Infect. Dis. 1993;16(1):15–21. 14. Field AS et al. Myositis associated with a newly described microsporidian, Trachipleistophora hominis, in a patient with AIDS. J. Clin. Microbiol. 1996;34(11):2803–2811. 15. Curry A et al. Trachipleistophora hominis infection in the myocardium and skeletal muscle of a patient with AIDS. J. Infect. 2005;51(3):e139–el44. 16. Rauz S et al. Ultrastructural examination of two cases of stromal microsporidial keratitis. Med. Microbiol. 2004;53(Pt 8):775–781. 17. Juarez SI et al. A species of microsporidium isolated from an HIV-infected patient and identi�ed as Trachipleistophora anthropophthera by transmission electron microscopy. J. Eukaryot. Microbiol. 2003;50:S576. 18. Juarez SI et al. In vitro cultivation and electron microscopy characterization of Trachipleistophora anthropophthera isolated from the cornea of an AIDS patient. J. Eukaryot. Microbiol. 2005;52(3):179–190. 19. Pariyakanok L, Jongwutiwes S. Keratitis caused by Trachipleistophora anthropopthera. J. Infect. 2005;51(4): 325–328. 20. Didier ES et al. Comparison of three staining methods for detecting microsporidia in ¼uids. J. Clin. Microbiol. 1995;33(12):3138–3145 [PubMed]. 21. Garcia LS. Laboratory identi�cation of the microsporidia. J. Clin. Microbiol. 2002;40(6):1892–1901. 22. Cheney SA et al. Serological differentiation of microsporidia with special reference to Trachipleistophora hominis. Parasite 2001;8(2):91–97. 23. Lafranchi-Tristem NJ et al. Growth of Trachipleistophora hominis (Microsporidia: Pleistophoridae) in C2,C12 mouse myoblast cells and response to treatment with albendazole. Folia Parasitol. (Praha) 2001;48(3):192–200. 24. Visvesvara GS. In vitro cultivation of microsporidia of clinical importance. Clin. Microbiol. Rev. 2002;15(3):401–413. 25. Fedorko DP, Nelson NA, Cartwright CP. Identi�cation of microsporidia in stool specimens by using PCR and restriction endonucleases. J. Clin. Microbiol. 1995;33(7): 1739–1741. 26. Williams BA et al. A mitochondrial remnant in the microsporidian Trachipleistophora hominis. Nature 2002;418(6900):865–869.
27. Baker MD et al. Small subunit ribosomal DNA phylogeny of various microsporidia with emphasis on AIDS related forms. J. Eukaryot. Microbiol. 1995;42(5):564–570.
28. Weiss LM, Vossbrinck CR. Microsporidiosis: Molecular and diagnostic aspects. Adv. Parasitol. 1998;40:351–395.
29. Franzen C, Müller A. Microsporidiosis: Human diseases and diagnosis. Microbes Infect. 2001;3:389–400.
30. Keeling PJ. Congruent evidence from alpha-tubulin and betatubulin gene phylogenies for a zygomycete origin of microsporidia. Fungal Genet. Biol. 2003;38:298–309.
31. Ghosh K, Weiss LM. Molecular diagnostic tests for microsporidia. Interdiscip. Perspect. Infect. Dis. 2009; 2009:926521.
32. Joseph J et al. Microsporidial keratitis in India: 16S rRNA gene-based PCR assay for diagnosis and species identi�cation of microsporidia in clinical samples. Invest. Ophthalmol. Vis. Sci. 2006;47:4468–4473. 33. Xiao L et al. Genotyping Encephalitozoon cuniculi by multilocus analyses of genes with repetitive sequences. J. Clin. Microbiol. 2001;39:2248–2253. 34. Hatakeyama Y, Hayasaka S. Speci�c ampli�cation of microsporidian DNA fragments using multiprimer PCR. JARQ 2002;36:97. 35. Weiss LM et al. Utility of microsporidian rRNA in diagnosis and phylogeny: A review. Folia Parasitol. (Praha) 1994;41(2):81–90. 36. Ironside JE, Wilkinson TJ, Rock J. Distribution and Host Range of the Microsporidian Pleistophora mulleri. J. Eukaryot. Microbiol. 2008;55(4):355–362.
Part V
Oomycota, Chlorophyta, and Mesomycetozoea 96 Chapter 96 - Pythium
1. De Cock, A.W. et al., Pythium insidiosum sp. nov., the etiologic agent of pythiosis, J. Clin. Microbiol., 25, 344, 1987. 2. Mendoza, L., Ajello, L., and McGinnis, M.R., Infection caused by the Oomycetous pathogen Pythium insidiosum, J. Mycol. Med., 6, 151, 1996. 3. Austwick, P.K. and Copland, J.W., Swamp cancer, Nature, 250, 84, 1974. 4. Shipton, W.A., Pythium destruens sp. nov., an agent of equine pythiosis, J. Med. Vet. Mycol., 25, 137, 1987. 5. Murdoch, D. and Parr, D., Pythium insidiosum keratitis, Aust. N. Z. J. Ophthalmol., 25, 177, 1997. 6. Krajaejun, T. et al., Clinical and epidemiological analyses of human pythiosis in Thailand, Clin. Infect. Dis., 43, 569, 2006. 7. Badenoch, P.R. et al., Pythium insidiosum keratitis con�rmed by DNA sequence analysis, Br. J. Ophthalmol., 85, 502, 2001. 8. Triscott, J.A., Weedon, D., and Cabana, E., Human subcutaneous pythiosis, J. Cutan. Pathol., 20, 267, 1993. 9. Shenep, J.L. et al., Successful medical therapy for deeply invasive facial infection due to Pythium insidiosum in a child, Clin. Infect. Dis., 27, 1388, 1998. 10. Bosco Sde, M. et al., Human pythiosis, Brazil, Emerg. Infect. Dis., 11, 715, 2005. 11. Virgile, R. et al., Human infectious corneal ulcer caused by Pythium insidiosum, Cornea, 12, 81, 1993. 12. Mendoza, L., Prasla, S.H., and Ajello, L., Orbital pythiosis: A non-fungal disease mimicking orbital mycotic infections, with a retrospective review of the literature, Mycoses, 47, 14, 2004. 13. Schlosser, E. and Gottlieb, D., Sterols and the sensitivity of Pythium species to �lipin, J. Bacteriol., 91, 1080, 1966. 14. Kwon-Chung, K.J., Phylogenetic spectrum of fungi that are pathogenic to humans, Clin. Infect. Dis., 19(Suppl. 1), S1, 1994. 15. Pereira, D.I., Caspofungin in vitro and in vivo activity against Brazilian Pythium insidiosum strains isolated from animals, J. Antimicrob. Chemother., 60, 1168, 2007. 16. Kamoun, S., Molecular genetics of pathogenic oomycetes, Eukaryot. Cell., 2, 191, 2003. 17. Keeling, P.J. et al., The tree of eukaryotes, Trends. Ecol. Evol., 20, 670, 2005. 18. Mendoza, L., Hernandez, F., and Ajello, L., Life cycle of the human and animal oomycete pathogen Pythium insidiosum, J. Clin. Microbiol., 31, 2967, 1993. 19. Mendoza, L. and Prendas, J., A method to obtain rapid zoosporogenesis of Pythium insidiosum, Mycopathologia, 104, 59, 1988. 20. Chaiprasert, A. et al., Induction of zoospore formation in Thai isolates of Pythium insidiosum, Mycoses, 33, 317, 1990. 21. Kaufman, L., Penicilliosis marneffei and pythiosis: Emerging tropical diseases, Mycopathologia, 143, 3, 1998. 22. Thianprasit, M., Chaiprasert, A., and Imwidthaya, P., Human pythiosis, Curr. Top. Med. Mycol., 7, 43, 1996. 23. Sathapatayavongs, B. et al., Human pythiosis associated with thalassemia hemoglobinopathy syndrome, J. Infect. Dis., 159, 274, 1989. 24. Tanphaichitra, D., Tropical disease in the immunocompromised host: Melioidosis and pythiosis, Rev. Infect. Dis., 11(Suppl. 7), S1629, 1989. 25. Chetchotisakd, P. et al., Human pythiosis in Srinagarind Hospital: One year’s experience, J. Med. Assoc. Thai., 75, 248, 1992. 26. Wanachiwanawin, W. et al., Fatal arteritis due to Pythium insidiosum infection in patients with thalassaemia, Trans. R. Soc. Trop. Med. Hyg., 87, 296, 1993.
27. Thitithanyanont, A. et al., Use of an immunotherapeutic vaccine to treat a life-threatening human arteritic infection caused by Pythium insidiosum, Clin. Infect. Dis., 27, 1394, 1998.
28. Prasertwitayakij, N. et al., Human pythiosis, a rare cause of arteritis: Case report and literature review, Semin. Arthritis. Rheum., 33, 204, 2003.
29. Krajaejun, T. et al., Ocular pythiosis: Is it under-diagnosed? Am. J. Ophthalmol., 137, 370, 2004.
30. Wanachiwanawin, W. et al., Ef�cacy of immunotherapy using antigens of Pythium insidiosum in the treatment of vascular pythiosis in humans, Vaccine, 22, 3613, 2004.
31. Pupaibool, J. et al., Human pythiosis, Emerg. Infect. Dis., 12, 517, 2006.
32. Miller, R.I., Investigations into the biology of three ‘phycomycotic’ agents pathogenic for horses in Australia, Mycopathologia, 81, 23, 1983.
33. Supabandhu, J. et al., Isolation and identi�cation of the human pathogen Pythium insidiosum from environmental samples collected in Thai agricultural areas, Med. Mycol., 18, 1, 2007.
34. Schurko, A.M. et al., Evidence for geographic clusters: Molecular genetic differences among strains of Pythium insidiosum from Asia, Australia, and the Americas are explored, Mycologia, 95, 200, 2003.
35. Schurko, A.M. et al., A molecular phylogeny of Pythium insidiosum, Mycol. Res., 107, 537, 2003.
36. Mendoza, L. et al., Evaluation of two vaccines for the treatment of pythiosis insidiosi in horses, Mycopathologia, 119, 89, 1992.
37. Mendoza, L., Mandy, W., and Glass, R., An improved Pythium insidiosum-vaccine formulation with enhanced immunotherapeutic properties in horses and dogs with pythiosis, Vaccine, 21, 2797, 2003.
38. Dixon, D.M. et al., Development of vaccines and their use in the prevention of fungal infections, Med. Mycol., 36(Suppl. 1), 57, 1998.
39. Mendoza, L. and Newton, J.C., Immunology and immunotherapy of the infections caused by Pythium insidiosum, Med. Mycol., 43, 477, 2005.
40. Brown, C.C. and Roberts, E.D., Intestinal pythiosis in a horse, Aust. Vet. J., 65, 88, 1988.
41. Patton, C.S. et al., Esophagitis due to Pythium insidiosum infection in two dogs, J. Vet. Intern. Med., 10, 139, 1996.
42. Rivierre, C. et al., Pythiosis in Africa, Emerg. Infect. Dis., 11, 479, 2005.
43. Reis, J.L. Jr. et al., Disseminated pythiosis in three horses, Vet. Microbiol., 96, 289, 2003.
44. Mendoza, L. and Alfaro, A.A., Equine pythiosis in Costa Rica: Report of 39 cases, Mycopathologia, 94, 123, 1986.
45. Meireles, M.C. et al., Cutaneous pythiosis in horses from Brazil, Mycoses, 36,139, 1993.
46. Miller, R.I. and Campbell, R.S., The comparative pathology of equine cutaneous phycomycosis, Vet. Pathol., 21, 325, 1984.
47. Miller, R.I. and Campbell, R.S., Clinical observations on equine phycomycosis, Aust. Vet. J., 58, 221, 1982.
48. Sohn, Y. et al., Enteric pythiosis in a Jindo dog, Korean J. Vet. Res., 36, 447, 1996.
49. Bentinck-Smith, J. et al., Canine pythiosis—Isolation and identi�cation of Pythium insidiosum, J. Vet. Diagn. Invest., 1, 295, 1989.
50. Hnilica, K.A., Dif�cult dermatologic diagnosis. Pythiosis, J. Am. Vet. Med. Assoc., 212, 1192, 1998.
51. Dykstra, M.J. et al., A description of cutaneous-subcutaneous pythiosis in �fteen dogs, Med. Mycol., 37, 427, 1999. 52. Berryessa, N.A. et al., Gastrointestinal pythiosis in 10 dogs from California, J. Vet. Intern. Med., 22, 1065, 2008. 53. Graham, J.P. et al., Ultrasonographic features of canine gastrointestinal pythiosis, Vet. Radiol. Ultrasound., 41, 273, 2000. 54. Helman, R.G. and Oliver, J. 3rd., Pythiosis of the digestive tract in dogs from Oklahoma, J. Am. Anim. Hosp. Assoc., 35, 111, 1999. 55. Rakich, P.M., Grooters, A.M., and Tang, K.N., Gastrointestinal pythiosis in two cats, J. Vet. Diagn. Invest., 17, 262, 2005. 56. Pérez, R.C. et al., Epizootic cutaneous pythiosis in beef calves, Vet. Microbiol., 109, 121, 2005. 57. Santurio, J.M. et al., Cutaneous Pythiosis insidiosi in calves from the Pantanal region of Brazil, Mycopathologia, 141, 123, 1998. 58. Miller, R.I., Olcott, B.M., and Archer, M., Cutaneous pythiosis in beef calves, J. Am. Vet. Med. Assoc., 186, 984, 1985. 59. Tabosa, I.M. et al., Outbreaks of pythiosis in two ¼ocks of sheep in northeastern Brazil, Vet. Pathol., 41, 412, 2004. 60. Wellehan, J.F. et al., Pythiosis in a dromedary camel (Camelus dromedarius), J. Zoo. Wildl. Med., 35, 564, 2004. 61. Buergelt, C., Powe, J., and White, T., Abdominal pythiosis in a Bengal tiger (Panthera tigris tigris), J. Zoo. Wildl. Med., 37, 186, 2006. 62. Camus, A.C., Grooters, A.M., and Aquilar, R.E., Granulomatous pneumonia caused by Pythium insidiosum in a central American jaguar, Panthera onca, J. Vet. Diagn. Invest., 16, 567, 2004. 63. Miller, R.I. and Campbell, R.S., Experimental pythiosis in rabbits, Sabouraudia, 21, 331, 1983. 64. Ravishankar, J.P. et al., Mechanics of solid tissue invasion by the mammalian pathogen Pythium insidiosum, Fungal. Genet. Biol., 34, 167, 2001. 65. Wanachiwanawin, W., Infections in E-beta thalassemia, J. Pediatr. Hematol. Oncol., 22, 581, 2000. 66. Farmakis, D. et al., Pathogenetic aspects of immune de�ciency associated with beta-thalassemia, Med. Sci. Monit., 9, 19, 2003. 67. Walker, E.M. Jr. and Walker, S.M., Effects of iron overload on the immune system, Ann. Clin. Lab. Sci., 30, 354, 2000. 68. Pracharktam, R. et al., Immunodiffusion test for diagnosis and monitoring of human Pythiosis insidiosi, J. Clin. Microbiol., 29, 2661, 1991. 69. Imwidthaya, P. and Srimuang, S., Immunodiffusion test for diagnosing human pythiosis, Mycopathologia, 106, 109, 1989. 70. Mendoza, L., Kaufman, L., and Standard, P.G., Immunodiffusion test for diagnosing and monitoring pythiosis in horses, J. Clin. Microbiol., 23, 813, 1986. 71. Krajaejun, T. et al., Development and evaluation of an inhouse enzyme-linked immunosorbent assay for early diagnosis and monitoring of human pythiosis, Clin. Diagn. Lab. Immunol., 9, 378, 2002. 72. Mendoza, L. et al., Serodiagnosis of human and animal pythiosis using an enzyme-linked immunosorbent assay, Clin. Diagn. Lab. Immunol., 4, 715, 1997. 73. Grooters, A.M. et al., Development and evaluation of an enzyme-linked immunosorbent assay for the serodiagnosis of pythiosis in dogs, J. Vet. Intern. Med., 16, 142, 2002. 74. Krajaejun, T. et al., Identi�cation of a novel 74-kiloDalton immunodominant antigen of Pythium insidiosum recognized by sera from human patients with pythiosis, J. Clin. Microbiol., 44, 1674, 2006. 75. Mendoza, L., Nicholson, V., and Prescott, J.F., Immunoblot analysis of the humoral immune response to Pythium insidiosum in horses with pythiosis, J. Clin. Microbiol., 30, 2980, 1992.
76. Krajaejun, T. et al., Development of an immunochromatographic test for rapid serodiagnosis of human pythiosis, Clin. Vac. Immunol., 16, 506, 2009.
77. Jindayok, T. et al., Hemagglutination test for rapid serodiagnosis of human pythiosis, Clin. Vaccine. Immunol., 16, 1047, 2009.
78. Supabandhu, J. et al., Application of immunoblot assay for rapid diagnosis of human pythiosis, J. Med. Assoc. Thai., 92, 1063, 2009.
79. Vanittanakom, N. et al., Identi�cation of emerging humanpathogenic Pythium insidiosum by serological and molecular assay-based methods, J. Clin. Microbiol., 42, 3970, 2004.
80. Grooters, A.M. and Gee, M.K., Development of a nested polymerase chain reaction assay for the detection and identi�cation of Pythium insidiosum, J. Vet. Intern. Med., 16, 147, 2002.
81. Znajda, N.R., Grooters, A.M., and Marsella, R., PCR-based detection of Pythium and Lagendium DNA in frozen and ethanol-�xed animal tissues, Vet. Dermatol., 13, 187, 2002.
82. Brown, C.C. et al., Use of immunohistochemical methods for diagnosis of equine pythiosis, Am. J. Vet. Res., 49, 1866, 1988.
83. Schurko, A.M. et al., Development of a species-speci�c probe for Pythium insidiosum and the diagnosis of pythiosis, J. Clin. Microbiol., 42, 2411, 2004.
84. Grooters, A.M. et al., Evaluation of microbial culture techniques for the isolation of Pythium insidiosum from equine tissues, J. Vet. Diagn. Invest., 14, 288, 2002.
85. Davis, D.J. et al., Relationship between temperature optima and secreted protease activities of three Pythium species and pathogenicity toward plant and animal hosts, Mycol. Res., 110, 96, 2006. 86. Mendoza, L., Kaufman, L., and Standard, P., Antigenic relationship between the animal and human pathogen Pythium insidiosum and nonpathogenic Pythium species, J. Clin. Microbiol., 25, 2159, 1987. 87. White, T.J. et al., Ampli�cation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M., Gelfand, D., Sninsky, J., and White, T. (Eds.), PCR Protocols A Guide to Methods and Applications. pp. 315–322, San Diego, CA: Academic Press, 1990. 88. Crawford, A.R. et al., Evolutionary relationships among Phytophthora species deduced from rDNA sequence analysis, Mycol. Res., 100, 437, 1996. 89. Jackson, C.J., Barton, R.C., and Evans, E.G., Species identi�cation and strain differentiation of dermatophyte fungi by analysis of ribosomal-DNA intergenic spacer regions, J. Clin. Microbiol., 37, 931, 1999. 90. Pannanusorn, S. et al., Random ampli�ed polymorphic DNA typing and phylogeny of Pythium insidiosum clinical isolates in Thailand, Southeast Asian J. Trop. Med. Public Health, 38, 383, 2007. 91. Hogan, L.H. and Klein, B.S., Transforming DNA integrates at multiple sites in the dimorphic fungal pathogen Blastomyces dermatitidis, Gene, 186, 219, 1997. 92. Woods, J.P. et al., Fast DNA isolation from Histoplasma capsulatum: Methodology for arbitrary primer polymerase chain reaction-based epidemiological and clinical studies, J. Clin. Microbiol., 31, 463, 1993. 93. Hata, D.J. et al., Real-time PCR method for detection of zygomycetes, J. Clin. Microbiol., 46, 2353, 2008. 94. Nagamine, K. et al., Loop-mediated isothermal ampli�cation reaction using a nondenatured template, Clin. Chem., 47, 1742, 2001. 97 Chapter 97 - Prototheca
1. Lerche, M., Eine durch Algen (Prototheca) hervorgerufene Mastitis der Kuh, Berl. Münch. Tierärztl. Wochenschr., 4, 64, 1952.
2. Krüger, W., Kurze Charakteristik einiger niederer Organismen im Saft¼usse der Laubbäume, Hedwigia, 33, 16, 1894.
3. Cooke, W.B., Studies in the genus Prototheca, J. Mitch. Soc., 84, 213, 1968.
4. Roesler, U. et al., Diversity within the current algal species Prototheca zop¡i: A proposal for two Prototheca zop¡i genotypes and description of a novel species, Prototheca blaschkeae sp. nov., Int. J. Syst. Evol. Micr., 56, 1419, 2006.
5. Lass-Flörl, C. and Mayr, A., Human protothecosis, Clin. Microbiol. Rev., 20, 230, 2007.
6. Möller, A., Truyen, U., and Roesler U., Prototheca zop¡i genotype 2: The causative agent of bovine protothecal mastitis? Vet. Microbiol., 120, 370, 2007.
7. Roth, K., Aetiological role of Prototheca zop¡i genotype 2 in bovine Prototheca mastitis, Doctoral thesis, Free University Berlin, 2009.
8. Janosi, S. et al., Review of the microbiological, pathological, and clinical aspects of bovine mastitis caused by the alga Prototheca zop¡i, Vet. Q., 23, 58, 2001.
9. Callely, A.G. and Lloyd, D., The metabolism of acetate in the colorless alga, Prototheca zop¡i, Biochem. J., 90, 483, 1964.
10. Lloyd, D. and Callely, A.G., The assimilation of acetate and propionate by Prototheca zop¡i. Biochem. J., 97, 176, 1965.
11. Ciferri, O., Thiamine-de�ciency of Prototheca, a yeast like achloric alga. Nature, 178, 1475, 1956.
12. Pore, R.S., Prototheca taxonomy, Mycopathologia, 90, 129, 1985. 13. Blaschke-Hellmessen, R. and Schuster, H., Untersuchungen zur Überlebensfähigkeit von Prototheca zop¡i und Prototheca wickerhamii unter verschiedenen Umweltbedingungen, Mh. Vet. Med., 39, 852, 1984. 14. Melville, P.A. et al., Evaluation of the susceptibility of Prototheca zop¡i to milk pasteurization, Mycopathologia, 146, 79, 1999. 15. Enders, F. and Weber, A., Pilotstudie zum Vorkommen von Prototheken in Kotproben von Pferden, Berl. Münch. Tierärztl. Wochenschr., 106, 264, 1993. 16. Enders, F. and Weber, A., Untersuchungen zum Vorkommen von Prototheken in Kotproben von Rindern, Berl. Münch. Tierärztl. Wochenschr., 106, 165, 1993. 17. Lass-Flörl, C. et al., Disseminated infection with Prototheca zop¡i after unrelated stem cell transplantation for leukemia, J. Clin. Microbiol., 42, 4907, 2004. 18. Marques, S. et al., Bovine mastitis associated with Prototheca blaschkeae, J. Clin. Microbiol., 46, 1941, 2008. 19. Thompson, G. et al., Algaemia in a dairy cow by Prototheca blaschkeae, Med. Mycol., 19, 1, 2009. 20. Thiele, D. and Bergmann, A., Protothecosis in human medicine, Int. J. Hyg. Envir. Health, 204, 297, 2002. 21. Tsuji, K. et al., Protothecosis in a patient with systemic lupus erythematosus. Intern. Med., 32, 540, 1993. 22. Osumi, T. et al., Prototheca zop¡i genotypes isolated from cow barns and bovine mastitis in Japan, Vet. Microbiol., 15, 131, 419, 2008. 23. Bergmann, A., Experimentelle Prototheken-Mastitis beim Rind und Therapie mit Tetramisolhydrochlorid, Berl. Münch. Tierärztl. Wochenschr., 106, 257, 1993. 24. Costa, E.O. et al., Infectious bovine mastitis caused by environmental organisms, J. Vet. Med. B., 45, 65, 1998. 25. Rösler, U. and Hensel, A., Eradication of Prototheca zop¡i infection in a dairy cattle herd, Deutsch. Tierärztl. Wochenschr., 110, 374, 2003. 26. Cook, J.R. et al., Disseminated protothecosis causing acute blindness and deafness in a dog, J. Am. Vet. Med. Assoc., 184, 1266, 1984. 27. Ginel, P.J. et al., Cutaneous protothecosis in a dog, Vet. Rec., 140, 651, 1997. 28. Rallis, T.S. et al., Protothecal colitis in a German shepherd dog, Aust. Vet. J., 80, 406, 2002. 29. Salvadori, C. et al., Protothecal granulomatous meningoencephalitis in a dog, J. Small Anim. Pract., 49, 531, 2008. 30. Perez, J. et al., Canine cutaneous protothecosis: An immunohistochemical analysis of the in¼ammatory cellular in�ltrate, J. Comp. Pathol., 117, 83, 1997. 31. Rakich, P.M. and Latimer, K.S., Altered immune function in a dog with disseminated protothecosis, J. Am. Vet. Med. Assoc., 185, 681, 1984. 32. Pore, R.S., Selective medium for the isolation of Prototheca, Appl. Microbiol., 26, 648, 1973. 33. Espinel-Ingroff, A. et al., Comparison of RapID yeast plus system with API 20C system for identi�cation of common, new, and emerging yeast pathogens, J. Clin. Microbiol., 36, 883, 1998. 34. Laeng, R.H. et al., Protothecosis in an HIV-positive patient, Am. J. Surg. Pathol., 18, 1261, 1994. 35. Rizzi, T.E. et al., More than meets the eye: Subretinal aspirate from an acutely blind dog, Vet. Clin. Pathol., 35, 111, 2006. 36. von Bergen, M. et al., Identi�cation of harmless and pathogenic algae of the genus Prototheca by MALDI-MS, Proteomics Clin. Appl., 3, 774, 2009. 98 Chapter 98 - Rhinosporidium
19. Lakshmanan, M. and Kameswaran, S., Development and histochemistry of Rhinosporidium seeberi, In Subramanian, C.V., Ed., Taxonomy of Fungi. Proceedings of the International Symposium on Taxonomy of Fungi, University of Madras, Madras.
20. Arseculeratne, S.N., Atapattu, D.N., and Wickramaratne, K., Nature and signi�cance of the electron-dense bodies of the endospores of Rhinosporidium seeberi; their reactions with MTT (3-[4,5-dimethyl-2-thiazolyl]-2,5-diphenyl tetrazolium bromide) and TMRE (tetramethyl-rhodamine ethyl ester), Med. Mycol., 43, 261, 2005.
21. Ashworth, J.H., On Rhinosporidium seeberi (Wernicke 1903) with special reference to its sporulation and af�nities, Trans. Roy. Soc., Edin., 53, 301, 1923.
22. Kennedy, F.A., Buggage, R.R., and Ajello, L., Rhinosporidiosis: A description of an unprecedented outbreak in captive swans (Cygnus spp.) and a proposal for revision of the ontogenic nomenclature of Rhinosporidium seeberi, J. Med. Vet. Mycol., 37, 157, 1995.
23. Arseculeratne, S.N. and Atapattu, D.N., The assessment of the viability of the endospores of Rhinosporidium seeberi with MTT (3-[4,5-dimethyl -2- thiazolyl]-2,5-diphenyl tetrazolium bromide), Mycol. Res., 108, 1423, 2004.
24. Teh, E.C. and Kutty, M.K., Rhinosporidium seeberi: Spherules and their signi�cance, Pathology, 7, 133, 1975.
25. Tirumurti, T.S., Rhinosporidium kinealyi, Practitioner, 93, 704, 1914.
26. Kutty, M.K. and Teh, E.C., Rhinosporidium seeberi. An ultrastructural study of its endosporulation phase and trophocyte phase, Archiv. Pathol., 99, 51, 1975.
27. Ahluwalia, K.B., New interpretations in rhinosporidiosis, enigmatic disease of the last nine decades, J. Submicrosc. Cytol. Pathol., 24, 109, 1992.
28. Rao, S.N., Rhinosporidium seeberi—A histochemical study, Indian J. Exp. Biol., 4, 10, 1966.
29. Jain, S.N., Aetiology and incidence of rhinosporidiosis. A preliminary report, Indian J. Otolaryngol., 19, 1, 1967.
30. Woodard, B.H. and Hudson, J., Rhinosporidiosis: Ultrastructural study of an infection in South Carolina, Southern Med. J., 77, 1587, 1984.
31. Arseculeratne, S.N., Panabokke, R.G., and Atapattu, D.N., Lymphadenitis, trans-epidermal elimination and unusual histopathology in human rhinosporidiosis, Mycopathologia, 153, 57, 2001.
32. Mendoza, L. et al., In vitro studies on the mechanisms of endospore release by Rhinosporidium seeberi, Mycopathologia, 148, 9, 1999.
33. Atapattu, D.N. et al., Puri�cation of the endospores and sporangia of Rhinosporidium seeberi on Percoll columns, Mycopathologia, 145, 113, 1999.
34. Levy, M.G., Meuten, D.J., and Breitschwerdt, E.B., Cultivation of Rhinosporidium seeberi in vitro: Interaction with epithelial cells, Science, 234, 474, 1986.
35. Arseculeratne, S.N. and Atapattu, D.N., Biological activities of the endospores of Rhinosporidium seeberi, Proceedings of the 25th Annual Sessions, Kandy Society of Medicine, Perademiya, Kandy, Sri Lanka Vol. 22, 2003.
36. Appuhamy, S. et al., Strain variation in Rhinosporidium seeberi. Proceedings of the Sri Lanka College of Microbiologists, OP7, Colombo, Sri Lanka, 2002.
37. Silva, V. et al., Molecular evidence for multiple host-speci�c strains in the genus Rhinosporidium, J. Clin. Microbiol., 43, 1865, 2005. 38. Arseculeratne, S.N. et al., The effects of biocides (antiseptics and disinfectants) on the endospores of Rhinosporidium seeberi, Indian J. Med. Microbiol., 24, 85, 2006. 39. Eriyagama, N.B. and Arseculeratne, S.N., Further observations on the effects of biocides (Antiseptics and Disinfectants) on the endospores of Rhinosporidium seeberi, as assayed by the MTT-reduction test, J. Infect. Dis. Antimicrob. Agents, 24, 125, 2007. 40. Arseculeratne, S.N. et al., In vitro susceptibility of the endospores of Rhinosporidium seeberi to seven antimicrobial agents, J. Infect. Dis. Antimicrob. Agents, 25, 135, 2008. 41. Mahakrishnan A., Rajasekaram V., and Pandian, P.J., Disseminated rhinosporidiosis treated with dapsone, Trop. Geogr. Med., 33, 189, 1981. 42. Job, A. et al., Medical therapy of rhinosporidiosis with dapsone, J. Laryngol. Otol., 107, 809, 1993. 43. Venkateswaran, S. et al., Light and electron microscopic �ndings in rhinosporidiosis after dapsone therapy, Trop. Med. Int. Health, 2, 1128, 1997. 44. Rex, J.H. et al., Antifungal susceptibility testing, Clin. Microbiol. Rev., 6, 367. 1993. 45. Cushion, M.T., Chen, F., and Kloepfer, N., A cytotoxicity assay for evaluation of candidate anti-Pneumocystis carinii, Antimicrob. Agents Chemother., 41, 379, 1997. 46. Kariuki, S. et al., Genotypic analysis of Multidrug-Resistant Salmonella enterica serovar typhi, Kenya, Emerg. Infect. Dis., 6, 649, 2000. 47. Bifani, P. et al., Molecular identi�cation of streptomycin monoresistant Mycobacterium tuberculosis related to multidrug-resistant W strain, Emerg. Infect. Dis., 7, 842, 2001. 48. Herr, R.A. et al., Immunolocalization of an endogenous antigenic material of Rhinosporidium seeberi expressed only during mature sporangial development, FEMS Immunol. Med. Microbiol., 23, 205, 1999. 49. Arseculeratne, S.N., Atapattu, D.N., and Eriyagama, N.B., Human anti-rhinosporidial antibody does not cause metabolic inactivation or morphological damage in endospores of Rhinosporidium seeberi, in vitro, Indian J. Med. Microbiol., 23, 14, 2005. 50. Arseculeratne, S.N. et al., The use of MTT (3-[4,5-dimethyl2-thiazolyl]-2,5-diphenyl tetrazolium bromide)-reduction as an indicator of the effects of strain-speci�c, polyclonal rabbit antisera on Candida albicans and C. krusei, Indian J. Med. Microbiol., 25, 267, 2007. 51. De Silva, N.R. et al., Cell mediated immune responses in human rhinosporidiosis, Mycopathologia, 152, 59, 2000. 52. Jayasekera, S. et al., Cell-mediated immune responses (CMIR) to Rhinosporidium seeberi in mice, Mycopathologia, 152, 69, 2001. 53. Atapattu, D.N. et al., Is human IgG bound by endospores and sporangia of Rhinosporidium seeberi? A possible mechanism of immune evasion. Proc. Kandy Soc. Med., 22, 34, 2000. 54. Arseculeratne, S.N., Mechanisms of immune evasion by Rhinosporidium seeberi, Bulletin of the Sri Lanka College of Microbiologists, Vol. 1, 2003. 55. Leeming, G. et al., Equine rhinosporidiosis in United Kingdom, Emerg. Infect. Dis., 13, 1377, 2007. 56. Dingle, K.E. et al., Molecular characterization of Campylobacter jejuni clones: A basis for epidemiologic investigation, Emerg. Infect. Dis., 8, 949, 2002. 57. Rota, P.A. et al., Molecular epidemiology of measles viruses in the United States, 1997–2001, Emerg. Infect. Dis., 8, 902, 2002.
58. Chowdhuri, N.R. et al., Molecular evidence of clonal Vibrio parahaemolyticus pandemic strains, Emerg. Infect. Dis., 6, 631, 2000.
59. Anh, D.D. et al., Mycobacterium tuberculosis Beijing genotype emerging in Vietnam, Emerg. Infect. Dis., 6, 302, 2000.
60. Colding, H. et al., Ribotyping for differentiating Flavobacterium meningosepticum isolates from clinical and environmental sources, J. Clin. Microbiol., 32, 501, 1994.
61. Skojen, V. et al., Molecular characterization of Corynebacterium diphtheriae isolates, Russia, 1957–1987. Emerg. Infect. Dis., 8, 516, 2002.
62. Kwon-Chung, K.J. and Bennett, J.E., Rhinosporidiosis. In Kwon-Chung, K.J., and Bennett, J.E., Eds., Medical Microbiology, p. 695, Lea & Febiger, Philadelphia, PA, 1992.
63. Sigler, L., Adiaspiromycosis and other infections caused by Emmonsia species. In Topley & Wilson’s Microbiology and Microbial Infections. Medical Mycology, pp. 809–824, William, G.M. and Roderick, J.H., Eds., 10th edn., Hodder Arnold, London, U.K., 2005.
64. McClatchie, S. and Bremner, A.D., Unusual subcutaneous swellings in African patients. East Afr. Med. J., 46, 625, 1969.
65. Hutt, M.S.R., Fernandez, B.J.J., and Templeton, A.C., Myospherulosis (subcutaneous Spherulocystic disease), Trans. Roy. Soc. Trop. Med. Hyg., 65, 182, 1971. 66. Chau, K.Y., Pretorius, J.M., and Stewart, A.W., Myospherulosis in renal carcinoma, Arch. Path. Lab. Med., 124, 1476, 2000. 67. Ali, A. and Flieder, D. et al., Rhinosporidiosis, an unusual af¼iction, Arch. Path. Lab. Med., 125, 1392, 2001. 68. Speers, D.J., Clinical applications of molecular biology for infectious diseases, Clin. Biochem. Rev., 27, 393, 2006. 69. Caliendo, A.M. et al., Real-time PCR improves detection of Trichomonas vaginalis infection compared with culture using self-collected vaginal swabs, Infect. Dis. Obstet. Gynecol., 13, 145, 2005. 70. Dhaulakhandi, D.B. et al., Detection of 16S rRNA gene in round bodies isolated from polyps of rhinosporidiosis. Infect. Genet. Evol., 6, 331, 2006. 71. Arseculeratne, S.N. et al., Anti-rhinosporidial antibody levels in patients with rhinosporidiosis and in asymptomatic persons in Sri Lanka, Mycopathologia, 158, 157, 2004. 72. Senaratne, T. et al., Ocular rhinosporidiosis with Staphyloma formation in Sri Lanka. The �rst report, J. Infect. Dis. Antimicrob. Agents, 24, 133, 2007. 73. Gargas, A. and De Priest, P.T., A nomenclature for fungal PCR primers with examples from intron-containing SSU rDNA. Mycologia, 88, 745–748, 1996. 74. Pfaller, M.A., Molecular approaches to diagnosing and managing infectious diseases: Practicality and costs, Emerg. Infect. Dis., 7, 312, 2001.
Part VI
Panfungal and Drug Resistance Detection 99 Chapter 99 - Nucleic Acid-Based Panfungal Detection
19. Cornely, O.A., Aspergillus to Zygomycetes: Causes, risk factors, prevention, and treatment of invasive fungal infections, Infection, 36, 296, 2008.
20. Bodey, G. et al., Fungal infections in cancer patients: An international autopsy survey, Eur J Clin Microbiol Infect Dis, 11, 99, 1992.
21. Castagnola, E. et al., Invasive mycoses in children receiving hemopoietic SCT, Bone Marrow Transplant, 41(Suppl 2), S107, 2008.
22. Martino, R. et al., Invasive fungal infections after allogeneic peripheral blood stem cell transplantation: Incidence and risk factors in 395 patients, Br J Haematol, 116, 475, 2002.
23. Jantunen, E. et al., Incidence and risk factors for invasive fungal infections in allogeneic BMT recipients, Bone Marrow Transplant, 19, 801, 1997.
24. Pagano, L. et al., Fungal infections in recipients of hematopoietic stem cell transplants: Results of the SEIFEM B-2004 study—Sorveglianza Epidemiologica Infezioni Fungine Nelle Emopatie Maligne, Clin Infect Dis, 45, 1161, 2007.
25. Richardson, M. and Lass-Florl, C., Changing epidemiology of systemic fungal infections, Clin Microbiol Infect, 14(Suppl 4), 5, 2008.
26. Tamura, K. and Drew, R., Antifungal prophylaxis in adult hematopoietic stem cell transplant recipients, Drugs Today (Barc), 44, 515, 2008.
27. Denning, D.W., Invasive aspergillosis, Clin Infect Dis, 26, 781, 1998.
28. Cordonnier, C. et al., Empirical versus preemptive antifungal therapy for high-risk, febrile, neutropenic patients: A randomized, controlled trial, Clin Infect Dis, 48, 1042, 2009.
29. Murali, S. and Langston, A., Advances in antifungal prophylaxis and empiric therapy in patients with hematologic malignancies, Transpl Infect Dis, 11, 480, 2009. 30. Lion, T. et al., Molecular monitoring of adenovirus in peripheral blood after allogeneic bone marrow transplantation permits early diagnosis of disseminated disease, Blood, 102, 1114, 2003.
31. Watzinger, F. et al., Real-time quantitative PCR assays for detection and monitoring of pathogenic human viruses in immunosuppressed pediatric patients, J Clin Microbiol, 42, 5189, 2004.
32. Ellepola, A.N. and Morrison, C.J., Laboratory diagnosis of invasive candidiasis, J Microbiol, 43 Spec No, 65, 2005.
33. Pasqualotto, A.C. and Denning, D.W., Diagnosis of invasive fungal infections—Current limitations of classical and new diagnostic methods, Eur Oncol Rev, 2005.
34. Ascioglu, S. et al., De�ning opportunistic invasive fungal infections in immunocompromised patients with cancer and hematopoietic stem cell transplants: An international consensus, Clin Infect Dis, 34, 7, 2002.
35. Simoneau, E. et al., What is the clinical signi�cance of positive blood cultures with Aspergillus sp in hematopoietic stem cell transplant recipients? A 23 year experience, Bone Marrow Transplant, 35, 303, 2005.
36. Hope, W.W., Walsh, T.J. and Denning, D.W., Laboratory diagnosis of invasive aspergillosis, Lancet Infect Dis, 5, 609, 2005.
37. Wheat, L.J. and Walsh, T.J., Diagnosis of invasive aspergillosis by galactomannan antigenemia detection using an enzyme immunoassay, Eur J Clin Microbiol Infect Dis, 27, 245, 2008.
38. Pfeiffer, C.D., Fine, J.P. and Safdar, N., Diagnosis of invasive aspergillosis using a galactomannan assay: A meta-analysis, Clin Infect Dis, 42, 1417, 2006.
39. Barnes, R.A., Early diagnosis of fungal infection in immunocompromised patients, J Antimicrob Chemother, 61(Suppl 1), i3, 2008. 40. Lee¼ang, M.M. et al., Galactomannan detection for invasive aspergillosis in immunocompromized patients, Cochrane Database Syst Rev, CD007394, 2008. 41. De Pauw, B. et al., Revised de�nitions of invasive fungal disease from the European Organization for Research and Treatment of Cancer/Invasive Fungal Infections Cooperative Group and the National Institute of Allergy and Infectious Diseases Mycoses Study Group (EORTC/MSG) Consensus Group, Clin Infect Dis, 46, 1813, 2008. 42. Maertens, J.A. et al., Optimization of the cutoff value for the Aspergillus double-sandwich enzyme immunoassay, Clin Infect Dis, 44, 1329, 2007. 43. Adam, O. et al., Treatment with piperacillin–tazobactam and false-positive Aspergillus galactomannan antigen test results for patients with hematological malignancies, Clin Infect Dis, 38, 917, 2004. 44. Zandijk, E. et al., False-positive results by the platelia Aspergillus galactomannan antigen test for patients treated with amoxicillin–clavulanate, Clin Vaccine Immunol, 15, 1132, 2008. 45. Racil, Z. et al., Intravenous PLASMA-LYTE as a major cause of false-positive results of platelia Aspergillus test for galactomannan detection in serum, J Clin Microbiol, 45, 3141, 2007. 46. Steinbach, W.J. et al., Prospective Aspergillus galactomannan antigen testing in pediatric hematopoietic stem cell transplant recipients, Pediatr Infect Dis J, 26, 558, 2007. 47. Girmenia, C., Ballaro, D. and Martino, P., Contamination by cardboard particles as a cause of false-positive results for Aspergillus galactomannan enzyme immunoassays, Clin Vaccine Immunol, 14, 929, 2007. 48. Murashige, N. et al., False-positive results of Aspergillus enzyme-linked immunosorbent assays for a patient with gastrointestinal graft-versus-host disease taking a nutrient containing soybean protein, Clin Infect Dis, 40, 333, 2005. 49. Kawazu, M. et al., Prospective comparison of the diagnostic potential of real-time PCR, double-sandwich enzyme-linked immunosorbent assay for galactomannan, and a (1 → 3)-betad-glucan test in weekly screening for invasive aspergillosis in patients with hematological disorders, J Clin Microbiol, 42, 2733, 2004. 50. Odabasi, Z. et al., Beta-d-glucan as a diagnostic adjunct for invasive fungal infections: Validation, cutoff development, and performance in patients with acute myelogenous leukemia and myelodysplastic syndrome, Clin Infect Dis, 39, 199, 2004. 51. Pazos, C., Ponton, J. and Del Palacio, A., Contribution of (1 → 3)-beta-d-glucan chromogenic assay to diagnosis and therapeutic monitoring of invasive aspergillosis in neutropenic adult patients: A comparison with serial screening for circulating galactomannan, J Clin Microbiol, 43, 299, 2005. 52. Ostrosky-Zeichner, L. et al., International, open-label, noncomparative, clinical trial of micafungin alone and in combination for treatment of newly diagnosed and refractory candidemia, Eur J Clin Microbiol Infect Dis, 24, 654, 2005. 53. Persat, F. et al., Contribution of the (1 → 3)-beta-d-glucan assay for diagnosis of invasive fungal infections, J Clin Microbiol, 46, 1009, 2008. 54. Akamatsu, N. et al., Preemptive treatment of fungal infection based on plasma (1 → 3) beta-d-glucan levels after liver transplantation, Infection, 35, 346, 2007. 55. Digby, J. et al., Serum glucan levels are not speci�c for presence of fungal infections in intensive care unit patients, Clin Diagn Lab Immunol, 10, 882, 2003.
56. Marty, F.M. and Koo, S., Role of (1 → 3)-beta-d-glucan in the diagnosis of invasive aspergillosis, Med Mycol, 47(Suppl 1), S233, 2009.
57. Pickering, J.W. et al., Evaluation of a (1 → 3)-beta-d-glucan assay for diagnosis of invasive fungal infections, J Clin Microbiol, 43, 5957, 2005.
58. Raad, I. et al., Polymerase chain reaction on blood for the diagnosis of invasive pulmonary aspergillosis in cancer patients, Cancer, 94, 1032, 2002.
59. El-Mahallawy, H.A. et al., Evaluation of pan-fungal PCR assay and Aspergillus antigen detection in the diagnosis of invasive fungal infections in high risk paediatric cancer patients, Med Mycol, 44, 733, 2006.
60. Lau, A. et al., Development and clinical application of a panfungal PCR assay to detect and identify fungal DNA in tissue specimens, J Clin Microbiol, 45, 380, 2007.
61. Lof¼er, J. et al., Detection of PCR-ampli�ed fungal DNA by using a PCR–ELISA system, Med Mycol, 36, 275, 1998.
62. Lass-Florl, C. et al., Diagnosing invasive aspergillosis during antifungal therapy by PCR analysis of blood samples, J Clin Microbiol, 42, 4154, 2004.
63. Florent, M. et al., Prospective evaluation of a polymerase chain reaction–ELISA targeted to Aspergillus fumigatus and Aspergillus °avus for the early diagnosis of invasive aspergillosis in patients with hematological malignancies, J Infect Dis, 193, 741, 2006.
64. Skladny, H. et al., Speci�c detection of Aspergillus species in blood and bronchoalveolar lavage samples of immunocompromised patients by two-step PCR, J Clin Microbiol, 37, 3865, 1999.
65. Williamson, E.C. et al., Diagnosis of invasive aspergillosis in bone marrow transplant recipients by polymerase chain reaction, Br J Haematol, 108, 132, 2000. 66. Halliday, C. et al., Role of prospective screening of blood for invasive aspergillosis by polymerase chain reaction in febrile neutropenic recipients of haematopoietic stem cell transplants and patients with acute leukaemia, Br J Haematol, 132, 478, 2006.
67. Loef¼er, J. et al., Quanti�cation of fungal DNA by using ¼uorescence resonance energy transfer and the light cycler system, J Clin Microbiol, 38, 586, 2000.
68. Baskova, L. et al., The Pan-AC assay: A single-reaction realtime PCR test for quantitative detection of a broad range of Aspergillus and Candida species, J Med Microbiol, 56, 1167, 2007.
69. Klingspor, L. and Jalal, S., Molecular detection and identi�cation of Candida and Aspergillus spp. from clinical samples using real-time PCR, Clin Microbiol Infect, 12, 745, 2006.
70. Vollmer, T. et al., Evaluation of novel broad-range real-time PCR assay for rapid detection of human pathogenic fungi in various clinical specimens, J Clin Microbiol, 46, 1919, 2008.
71. Landlinger, C. et al., Rapid Detection of Invasive Fungal Infections in Hemato-Oncological Patients, Blood (ASH Annual Meeting Abstracts), 112, 1468, 2008.
72. Leinberger, D.M. et al., Development of a DNA microarray for detection and identi�cation of fungal pathogens involved in invasive mycoses, J Clin Microbiol, 43, 4943, 2005.
73. Spiess, B. et al., DNA microarray-based detection and identi�cation of fungal pathogens in clinical samples from neutropenic patients, J Clin Microbiol, 45, 3743, 2007.
74. Loef¼er, J. et al., Development and evaluation of the nuclisens basic kit NASBA for the detection of RNA from Candida species frequently resistant to antifungal drugs, Diagn Microbiol Infect Dis, 45, 217, 2003. 75. Landlinger, C. et al., Identi�cation of fungal species by fragment length analysis of the internally transcribed spacer 2 region, Eur J Clin Microbiol Infect Dis, 28, 613, 2009. 76. Leaw, S.N. et al., Identi�cation of medically important yeast species by sequence analysis of the internal transcribed spacer regions, J Clin Microbiol, 44, 693, 2006. 77. Diaz, M.R. and Fell, J.W., High-throughput detection of pathogenic yeasts of the genus Trichosporon, J Clin Microbiol, 42, 3696, 2004. 78. Das, S. et al., DNA probes for the rapid identi�cation of medically important Candida species using a multianalyte pro�ling system, FEMS Immunol Med Microbiol, 46, 244, 2006. 79. Landlinger, C. et al., Species-speci�c identi�cation of a wide range of clinically relevant fungal pathogens by the Luminex xMAP™ technology, J Clin Microbiol, 47, 1063, 2009. 80. Gharizadeh, B. et al., Identi�cation of medically important fungi by the Pyrosequencing technology, Mycoses, 47, 29, 2004. 81. Montero, C.I. et al., Evaluation of pyrosequencing technology for the identi�cation of clinically relevant non-dematiaceous yeasts and related species, Eur J Clin Microbiol Infect Dis, 27, 821, 2008. 82. Caston-Osorio, J.J., Rivero, A. and Torre-Cisneros, J., Epidemiology of invasive fungal infection, Int J Antimicrob Agents, 32(Suppl 2), S103, 2008. 83. Lass-Florl, C., The changing face of epidemiology of invasive fungal disease in Europe, Mycoses, 52, 197, 2009. 84. Costa, C. et al., Development of two real-time quantitative TaqMan PCR assays to detect circulating Aspergillus fumigatus DNA in serum, J Microbiol Methods, 44, 263, 2001. 85. Ferns, R.B. et al., The prospective evaluation of a nested polymerase chain reaction assay for the early detection of Aspergillus infection in patients with leukaemia or undergoing allograft treatment, Br J Haematol, 119, 720, 2002. 86. Einsele, H. et al., Detection and identi�cation of fungal pathogens in blood by using molecular probes, J Clin Microbiol, 35, 1353, 1997. 87. Jaeger, E.E. et al., Rapid detection and identi�cation of Candida, Aspergillus, and Fusarium species in ocular samples using nested PCR, J Clin Microbiol, 38, 2902, 2000. 88. White, P.L. et al., The evolution and evaluation of a whole blood polymerase chain reaction assay for the detection of invasive aspergillosis in hematology patients in a routine clinical setting, Clin Infect Dis, 42, 479, 2006. 89. Schabereiter-Gurtner, C. et al., Development of novel realtime PCR assays for detection and differentiation of eleven medically important Aspergillus and Candida species in clinical specimens, J Clin Microbiol, 45, 906, 2007. 90. Dayan, L. et al., Aspergillus vertebral osteomyelitis in chronic leukocyte leukemia patient diagnosed by a novel panfungal polymerase chain reaction method, Spine J, 7, 615, 2007. 91. Badiee, P. et al., Prospective screening in liver transplant recipients by panfungal PCR–ELISA for early diagnosis of invasive fungal infections, Liver Transpl, 13, 1011, 2007. 92. Malani, A.N. and Kauffman, C.A., Changing epidemiology of rare mould infections: Implications for therapy, Drugs, 67, 1803, 2007. 93. Sandhu, G.S. et al., Molecular probes for diagnosis of fungal infections, J Clin Microbiol, 33, 2913, 1995. 94. Cuenca-Estrella, M. et al., Value of serial quanti�cation of fungal DNA by a real-time PCR-based technique for early diagnosis of invasive Aspergillosis in patients with febrile neutropenia, J Clin Microbiol, 47, 379, 2009.
95. White, P.L. et al., A consensus on fungal polymerase chain reaction diagnosis?: A United Kingdom–Ireland evaluation of polymerase chain reaction methods for detection of systemic fungal infections, J Mol Diagn, 8, 376, 2006.
96. Kutyavin, I.V. et al., 3′-Minor groove binder-DNA probes increase sequence speci�city at PCR extension temperatures, Nucleic Acids Res, 28, 655, 2000.
97. Simeonov, A. and Nikiforov, T.T., Single nucleotide polymorphism genotyping using short, ¼uorescently labeled locked nucleic acid (LNA) probes and ¼uorescence polarization detection, Nucleic Acids Res, 30, e91, 2002.
98. Preuner, S. and Lion, T., Towards molecular diagnostics of invasive fungal infections, Expert Rev Mol Diagn, 9, 397, 2009.
99. Silveira, F. and Nucci, M., Emergence of black moulds in fungal disease: Epidemiology and therapy, Curr Opin Infect Dis, 14, 679, 2001.
100. Lyratzopoulos, G. et al., Invasive infection due to Penicillium species other than P. marneffei, J Infect, 45, 184, 2002.
101. Mengoli, C. et al., Use of PCR for diagnosis of invasive aspergillosis: Systematic review and meta-analysis, Lancet Infect Dis, 9, 89, 2009.
102. Karim, M. et al., Chronic invasive aspergillosis in apparently immunocompetent hosts, Clin Infect Dis, 24, 723, 1997.
103. Raja, N.S. and Singh, N.N., Disseminated invasive aspergillosis in an apparently immunocompetent host, J Microbiol Immunol Infect, 39, 73, 2006.
104. Al-Khuwaitir, T.S. et al., Disseminated Candida albicans infection in an immunocompetent host, Saudi Med J, 26, 1003, 2005.
105. Capoor, M.R. et al., Disseminated cryptococcosis with necrotizing fasciitis in an apparently immunocompetent host: A case report, Med Mycol, 46, 269, 2008.
106. Izumikawa, K. et al., A case of pulmonary cryptococcosis followed by pleuritis in an apparently immunocompetent patient during ¼uconazole treatment, Med Mycol, 46, 595, 2008. 107. Vaideeswar, P. and Pandit, S.P., Primary zygomycosis of the pericardium in an immunocompetent host, Mycoses, 50, 232, 2007. 108. Gorman, S.R. et al., Fusarium oxysporum pneumonia in an immunocompetent host, South Med J, 99, 613, 2006. 109. Purnak, T. et al., A novel fungal pathogen under the spotlight—Acremonium spp. associated fungaemia in an immunocompetent host, Mycoses, 54, 78, 2011. 110. Abgrall, S. et al., Scedosporium apiospermum lung infection with fatal subsequent postoperative outcome in an immunocompetent host, Clin Infect Dis, 45, 524, 2007. 111. Borkar, S.A. et al., Brain abscess caused by Cladophialophora bantiana in an immunocompetent host: Need for a novel costeffective antifungal agent, Indian J Med Microbiol, 26, 271, 2008. 112. Sipsas, N.V. and Kontoyiannis, D.P., Occupation, lifestyle, diet, and invasive fungal infections, Infection, 36, 515, 2008. 113. d’Enfert, C., Hidden killers: Persistence of opportunistic fungal pathogens in the human host, Curr Opin Microbiol, 12, 358, 2009. 114. Khot, P.D. and Fredricks, D.N., PCR-based diagnosis of human fungal infections, Expert Rev Anti Infect Ther, 7, 1201, 2009. 115. Lau, A. et al., Current status and future perspectives on molecular and serological methods in diagnostic mycology, Future Microbiol, 4, 1185, 2009. 116. Loef¼er, J. et al., Contaminations occurring in fungal PCR assays, J Clin Microbiol, 37, 1200, 1999. 117. Van Burik, J.A. et al., Panfungal PCR assay for detection of fungal infection in human blood specimens, J Clin Microbiol, 36, 1169, 1998. 100 Chapter 100 - Molecular Characterization of Fungal Drug Resistance
1. Nucci, M. and Marr, K.A., Emerging fungal diseases, Clin. Infect. Dis., 41, 521, 2005.
2. Segal, B.H. et al., Prevention and early treatment of invasive fungal infection in patients with cancer and neutropenia and in stem cell transplant recipients in the era of newer broadspectrum antifungal agents and diagnostic adjuncts, Clin. Infect. Dis., 44, 402, 2007. 3. Schelenz, S., Management of candidiasis in the intensive care unit, J. Antimicrob. Chemother., 61, i31, 2008. 4. Pfaller, M.A. and Diekema, D.J., Epidemiology of invasive candidiasis: A persistent public health problem, Clin. Microbiol. Rev., 20, 133, 2007. 5. Hachem, R. et al., The changing epidemiology of invasive candidiasis: Candida glabrata and Candida krusei as the leading causes of candidemia in hematologic malignancy, Cancer, 112, 2493, 2008. 6. Pagano, L. et al., The epidemiology of fungal infections in patients with hematologic malignancies: The SEIFEM-2004 study, Haematologica, 91, 1068, 2006. 7. Pfaller, M.A. et al., Antifungal activities of posaconazole, ravuconazole, and voriconazole compared to those of itraconazole and amphotericin B against 239 clinical isolates of Aspergillus spp. and other �lamentous fungi: Report from SENTRY Antimicrobial Surveillance Program, 2000, Antimicrob. Agents Chemother., 46, 1032, 2002. 8. Diekema, D.J. et al., Activities of caspofungin, itraconazole, posaconazole, ravuconazole, voriconazole, and amphotericin B against 448 recent clinical isolates of �lamentous fungi, J. Clin. Microbiol., 41, 3623, 2003. 9. Chamilos, G. and Kontoyiannis, D.P., Update on antifungal drug resistance mechanisms of Aspergillus fumigatus, Drug. Resist. Updat., 8, 344, 2005. 10. Panackal, A.A. et al., Aspergillus ustus infections among transplant recipients, Emerg. Infect. Dis., 12, 403, 2006. 11. Baddley, J.W. et al., Patterns of susceptibility of Aspergillus isolates recovered from patients enrolled in the TransplantAssociated Infection Surveillance Network, J. Clin. Microbiol., 47, 3271, 2009. 12. Balajee, S.A. et al., Molecular identi�cation of Aspergillus species collected for the Transplant-Associated Infection Surveillance Network, J. Clin. Microbiol., 47, 3138, 2009. 13. Garcia-Effron, G. et al., Rapid detection of triazole antifungal resistance in Aspergillus fumigatus, J. Clin. Microbiol., 46, 1200, 2008. 14. Lass-Flörl, C., The changing face of epidemiology of invasive fungal disease in Europe, Mycoses, 52, 197, 2009. 15. Mitchell, T.G. and Perfect J.R., Cryptococcosis in the era of AIDS-100 years after the discovery of Cryptococcus neoformans, Clin. Microbiol. Rev., 8, 515, 1995. 16. Pukkila-Worley, R. and Mylonakis, E., Epidemiology and management of cryptococcal meningitis: Developments and challenges, Expert Opin. Pharmacother., 9, 551, 2008. 17. Johnson, E.M., Szekely, A., and Warnock, D.W., In-vitro activity of voriconazole, itraconazole and amphotericin B against �lamentous fungi, J. Antimicrob. Chemother., 42, 741, 1998. 18. Girmenia, C. et al., In vitro susceptibility testing of Geotrichum capitatum: Comparison of the E-test, disk diffusion, and Sensititre colorimetric methods with the NCCLS M27-A2 broth microdilution reference method, Antimicrob. Agents Chemother., 47, 3985, 2003. 19. Pfaller, M.A. and Diekema, D.J., Rare and emerging opportunistic fungal pathogens: Concern for resistance beyond Candida albicans and Aspergillus fumigatus, J. Clin. Microbiol., 42, 4419, 2004. 20. Espinel-Ingroff, A. et al., Activities of voriconazole, itraconazole and amphotericin B in vitro against 590 moulds from 323 patients in the voriconazole Phase III clinical studies, J. Antimicrob. Chemother., 61, 616, 2008. 21. CLSI. Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts; Approved Standard, 3rd edn. CLSI, Wayne, PA, 2008.
22. CLSI. Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi; Approved Standard, 2nd edn. CLSI, Wayne, PA, 2008.
23. Anderson, J.B., Evolution of antifungal-drug resistance: Mechanisms and pathogen �tness, Nat. Rev. Microbiol., 3, 547, 2005.
24. Sanglard, D. et al., Mechanisms of resistance to azole antifungal agents in Candida albicans isolates from AIDS patients involve speci�c multidrug transporters, Antimicrob. Agents Chemother., 39, 2378, 1995.
25. Perea, S. et al., Prevalence of molecular mechanisms of resistance to azole antifungal agents in Candida albicans strains displaying high-level ¼uconazole resistance isolated from human immunode�ciency virus-infected patients, Antimicrob. Agents Chemother., 45, 2676, 2001.
26. Tumbarello, M. et al., Fungaemia caused by Candida glabrata with reduced susceptibility to ¼uconazole due to altered gene expression: Risk factors, antifungal treatment and outcome, J. Antimicrob. Chemother., 62, 1379, 2008. 27. Sanglard, D. and Odds, F.C., Resistance of Candida species to antifungal agents: Molecular mechanisms and clinical consequences, Lancet Infect. Dis., 2, 73, 2002.
28. Chen, S.C. and Sorrell, T.C., Antifungal agents, Med. J., 187, 404, 2007.
29. Pasqualotto, A.C. and Denning, D.W., New and emerging treatments for fungal infections, J. Antimicrob. Chemother., 61, i19, 2008.
30. Odds, F.C., Brown, A.J., and Gow, N.A., Antifungal agents: Mechanisms of action, Trends Microbiol., 11, 272, 2003.
31. Sanglard, D. and Bille, J., Current understanding of the modes of action and resistance mechanisms to conventional and emerging antifungal agents for treatment of Candida infections, in Candida and Candidiasis, Calderone, R.A., Ed., ASM Press, Washington, DC, 2002, pp. 349–383.
32. St. Georgiev, V., Membrane transporters and antifungal drug resistance, Curr. Drug Targets, 1, 261, 2000.
33. Sokol-Anderson, M.L., Brajtburg, J., and Medoff, G., Amphotericin B-induced oxidative damage and killing of Candida albicans, J. Infect. Dis., 154, 76, 1986.
34. White, T.C., Marr, K.A., and Bowden, R.A., Clinical, cellular, and molecular factors that contribute to antifungal drug resistance, Clin. Microbiol. Rev., 11, 382, 1998.
35. Saag, M.S. et al., Practice guidelines for the management of cryptococcal disease. Infectious Diseases Society of America, Clin. Infect. Dis., 30, 710, 2000.
36. Pasqualotto, A.C. et al., Flucytosine therapeutic monitoring: 15 years experience from the UK, J. Antimicrob. Chemother., 59, 791, 2007.
37. Lupetti, A. et al., Molecular basis of resistance to azole antifungals, Trends Mol. Med., 8, 76, 2002.
38. Sanglard, D., Resistance of human fungal pathogens to antifungal drugs, Curr. Opin. Microbiol., 5, 379, 2002.
39. Donnelly, J.P. and De Pauw, B.E., Voriconazole-a new therapeutic agent with an extended spectrum of antifungal activity, Clin. Microbiol. Infect., 10, S107, 2004.
40. Schiller, D.S. and Fung, H.B., Posaconazole: An extendedspectrum triazole antifungal agent, Clin. Ther., 29, 1862, 2007.
41. Xiao, L. et al., Three-dimensional models of wild-type and mutated forms of cytochrome P450 14alpha-sterol demethylases from Aspergillus fumigatus and Candida albicans provide insights into posaconazole binding, Antimicrob. Agents Chemother., 48, 568, 2004.
42. Denning, D.W., Echinocandin antifungal drugs, Lancet, 362, 1142, 2003. 43. Bowman, J.C. et al., The antifungal echinocandin caspofungin acetate kills growing cells of Aspergillus fumigatus in vitro, Antimicrob. Agents Chemother., 46, 3001, 2002. 44. Dannaoui, E. et al., Amphotericin B resistance of Aspergillus terreus in a murine model of disseminated aspergillosis, J. Med. Microbiol., 49, 601, 1999. 45. Krogh-Madsen, M. et al., Amphotericin B and caspofungin resistance in Candida glabrata isolates recovered from a critically ill patient, Clin. Infect. Dis., 42, 938, 2006. 46. Soll, D.R. and Pujol, C., Candida albicans clades, FEMS Immunol. Med. Microbiol., 39, 1, 2003. 47. Blignaut, E. et al., Clade-related amphotericin B resistance among South African Candida albicans isolates, Diagn. Microbiol. Infect. Dis., 53, 29, 2005. 48. Nolte, F.S. et al., Isolation and characterization of ¼uconazoleand amphotericin B-resistant Candida albicans from blood of two patients with leukemia, Antimicrob. Agents Chemother., 41, 196, 1997. 49. Vandeputte, P. et al., Reduced susceptibility to polyenes associated with a missense mutation in the ERG6 gene in a clinical isolate of Candida glabrata with pseudohyphal growth, Antimicrob. Agents Chemother., 51, 982, 2007. 50. Qiao, J., Liu, W., and Li, R., Antifungal resistance mechanisms of Aspergillus, Jpn. J. Med. Mycol., 49, 157, 2008. 51. Loef¼er, J. and Stevens, D.A., Antifungal drug resistance, Clin. Infect. Dis., 36, S31, 2003. 52. Blum, G. et al., Potential basis for amphotericin B resistance in Aspergillus terreus, Antimicrob. Agents Chemother., 52, 1553, 2008. 53. Joseph-Horne, T. et al., Cross-resistance to polyene and azole drugs in Cryptococcus neoformans, Antimicrob. Agents Chemother., 39, 1526, 1995. 54. Kelly, S.L. et al., Resistance to amphotericin B associated with defective sterol delta 8→7 isomerase in a Cryptococcus neoformans strain from an AIDS patient, FEMS Microbiol. Lett., 122, 39, 1994. 55. Cannon, R.D. et al., Ef¼ux-mediated antifungal drug resistance, Clin. Microbiol. Rev., 22, 291, 2009. 56. Barchiesi, F. et al., Primary resistance to ¼ucytosine among clinical isolates of Candida spp., J. Antimicrob. Chemother., 45, 408, 2000. 57. Pfaller, M.A. et al., In vitro activities of 5-¼uorocytosine against 8,803 clinical isolates of Candida spp.: Global assessment of primary resistance using National Committee for Clinical Laboratory Standards susceptibility testing methods, Antimicrob. Agents Chemother., 46, 3518, 2002. 58. Perea, S. and Patterson, T.F., Antifungal resistance in pathogenic fungi, Clin. Infect. Dis., 35, 1073, 2002. 59. Pujol, C., Pfaller, M.A., and Soll, D.R., Flucytosine resistance is restricted to a single genetic clade of Candida albicans, Antimicrob. Agents Chemother., 48, 262, 2004. 60. Dodgson, A.R. et al., Clade-speci�c ¼ucytosine resistance is due to a single nucleotide change in the FUR1 gene of Candida albicans, Antimicrob. Agents Chemother., 48, 2223, 2004. 61. Hope, W.W. et al., Molecular mechanisms of primary resistance to ¼ucytosine in Candida albicans, Antimicrob. Agents Chemother., 48, 4377, 2004. 62. Odds, F.C., In Candida albicans, resistance to ¼ucytosine and terbina�ne is linked to MAT locus homozygosity and multilocus sequence typing clade 1, FEMS Yeast Res., 9, 1091, 2009. 63. Rustad, T.R. et al., Homozygosity at the Candida albicans MTL locus associated with azole resistance, Microbiology, 148, 1061, 2002.
64. Papon, N. et al., Molecular mechanism of ¼ucytosine resistance in Candida lusitaniae: Contribution of the FCY2, FCY1, and FUR1 genes to 5-¼uorouracil and ¼uconazole cross-resistance, Antimicrob. Agents Chemother., 51, 369, 2007.
65. Kanafani, Z.A. and Perfect, J.R., Antimicrobial resistance: Resistance to antifungal agents: Mechanisms and clinical impact, Clin. Infect. Dis., 46, 120, 2008.
66. Hospenthal, D.R. and Bennett, J.E., Flucytosine monotherapy for cryptococcosis, Clin. Infect. Dis., 27, 260, 1998.
67. White, T.C., Increased mRNA levels of ERG16, CDR, and MDR1 correlate with increases in azole resistance in Candida albicans isolates from a patient infected with human immunode�ciency virus. Antimicrob. Agents Chemother., 41, 1482, 1997.
68. Marichal, P. et al., Molecular biological characterization of an azole-resistant Candida glabrata isolate, Antimicrob. Agents Chemother., 41, 2229, 1997. 69. White, T.C. et al., Resistance mechanisms in clinical isolates of Candida albicans, Antimicrob. Agents Chemother., 46, 1704, 2002.
70. Orozco, A.S. et al., Mechanism of ¼uconazole resistance in Candida krusei, Antimicrob. Agents Chemother., 42, 2645, 1998.
71. Sanglard, D. et al., Amino acid substitutions in the cytochrome P-450 lanosterol 14alpha-demethylase (CYP51A1) from azole-resistant Candida albicans clinical isolates contribute to resistance to azole antifungal agents, Antimicrob. Agents Chemother., 42, 241, 1998.
72. Marichal, P. et al., Contribution of mutations in the cytochrome P450 14alpha-demethylase (Erg11p, Cyp51p) to azole resistance in Candida albicans, Microbiology, 145, 2701, 1999.
73. Braun, B.R. et al., A human-curated annotation of the Candida albicans genome, PLoS Genet., 1, 36, 2005.
74. Gaur, M., Choudhury, D., and Prasad, R., Complete inventory of ABC proteins in human pathogenic yeast, Candida albicans, J. Mol. Microbiol. Biotechnol., 9, 3, 2005.
75. Prasad, R. et al., Molecular cloning and characterization of a novel gene of Candida albicans, CDR1, conferring multiple resistance to drugs and antifungals, Curr. Genet., 27, 320, 1995.
76. Sanglard, D. et al., Cloning of Candida albicans genes conferring resistance to azole antifungal agents: Characterization of CDR2, a new multidrug ABC transporter gene, Microbiology, 143, 405, 1997.
77. Lamping, E. et al., Characterization of three classes of membrane proteins involved in fungal azole resistance by functional hyperexpression in Saccharomyces cerevisiae, Eukaryot. Cell, 6, 1150, 2007.
78. Holmes, A.R. et al., ABC transporter Cdr1p contributes more than Cdr2p does to ¼uconazole ef¼ux in ¼uconazole-resistant Candida albicans clinical isolates, Antimicrob. Agents Chemother., 52, 3851, 2008.
79. Sanguinetti, M. et al., Mechanisms of azole resistance in clinical isolates of Candida glabrata collected during a hospital survey of antifungal resistance, Antimicrob. Agents Chemother., 49, 668, 2005.
80. Posteraro, B. et al., Azole resistance of Candida glabrata in a case of recurrent fungemia, J. Clin. Microbiol., 44, 3046, 2006.
81. Magill, S.S. et al., Triazole cross-resistance among Candida spp.: Case report, occurrence among bloodstream isolates, and implications for antifungal therapy, J. Clin. Microbiol., 44, 529, 2006. 82. Shin, J.H. et al., Changes in karyotype and azole susceptibility of sequential bloodstream isolates from patients with Candida glabrata candidemia, J. Clin. Microbiol., 45, 2385, 2007. 83. Miyazaki, H. et al., Fluconazole resistance associated with drug ef¼ux and increased transcription of a drug transporter gene, PDH1, in Candida glabrata, Antimicrob. Agents Chemother., 42, 1695, 1998. 84. Sanglard, D. et al., The ATP binding cassette transporter gene CgCDR1 from Candida glabrata is involved in the resistance of clinical isolates to azole antifungal agents, J. Antimicrob. Agents Chemother., 43, 2753, 1999. 85. Sanglard, D., Ischer, F., and Bille, J., Role of ATP-bindingcassette transporter genes in high-frequency acquisition of resistance to azole antifungals in Candida glabrata, Antimicrob. Agents Chemother., 45, 1174, 2001. 86. Redding, S.W. et al., Multiple patterns of resistance to ¼uconazole in Candida glabrata isolates from a patient with oropharyngeal candidiasis receiving head and neck radiation, J. Clin. Microbiol., 41, 619, 2003. 87. Bennett, J.E., Izumikawa, K., and Marr, K.A., Mechanism of increased ¼uconazole resistance in Candida glabrata during prophylaxis, Antimicrob. Agents Chemother., 48, 1773, 2004. 88. Vermitsky, J.P. and Edlind, T.D., Azole resistance in Candida glabrata: Coordinate upregulation of multidrug transporters and evidence for a Pdr1-like transcription factor, Antimicrob. Agents Chemother., 48, 3773, 2004. 89. Brun, S. et al., Relationships between respiration and susceptibility to azole antifungals in Candida glabrata, Antimicrob. Agents Chemother., 47, 847, 2003. 90. Brun, S. et al., Mechanisms of azole resistance in petite mutants of Candida glabrata, Antimicrob. Agents Chemother., 48, 1788, 2004. 91. Torelli, R. et al., The ATP-binding cassette transporter-encoding gene CgSNQ2 is contributing to the CgPDR1-dependent azole resistance of Candida glabrata, Mol. Microbiol., 68, 186, 2008. 92. Pfaller, M.A. et al., Use of ¼uconazole as a surrogate marker to predict susceptibility and resistance to voriconazole among 13,338 clinical isolates of Candida spp. tested by clinical and laboratory standards institute-recommended broth microdilution methods, J. Clin. Microbiol., 45, 70, 2007. 93. Panackal, A.A. et al., Clinical signi�cance of azole antifungal drug cross-resistance in Candida glabrata, J. Clin. Microbiol., 44, 1740, 2006. 94. Lamping, E. et al., Abc1p is a multidrug ef¼ux transporter that tips the balance in favor of innate azole resistance in Candida krusei, Antimicrob. Agents Chemother., 53, 354, 2009. 95. Mellado, E. et al., Targeted gene disruption of the 14-alpha sterol demethylase (cyp51A) in Aspergillus fumigatus and its role in azole drug susceptibility, Antimicrob. Agents Chemother., 49, 2536, 2005. 96. Mann, P.A. et al., Mutations in Aspergillus fumigatus resulting in reduced susceptibility to posaconazole appear to be restricted to a single amino acid in the cytochrome P450 14alpha-demethylase, Antimicrob. Agents Chemother., 47, 577, 2003. 97. Chen, J. et al., Mutations in the cyp51A gene and susceptibility to itraconazole in Aspergillus fumigatus serially isolated from a patient with lung aspergilloma, J. Antimicrob. Chemother., 55, 31, 2005. 98. Howard, S.J. et al., Multi-azole resistance in Aspergillus fumigatus, Int. J. Antimicrob. Agents, 28, 450, 2006. 99. Verweij, P.E., Mellado, E., and Melchers, W.J., Multipletriazole-resistant aspergillosis, N. Engl. J. Med., 356, 1481, 2007.
100. Howard, S.J. et al., Frequency and evolution of azole resistance in Aspergillus fumigatus associated with treatment failure, Emerg. Infect. Dis., 15, 1068, 2009.
101. Moore, C.B. et al., Antifungal drug resistance in Aspergillus, J. Infect., 41, 203, 2000.
102. Balajee, S.A. et al., Aspergillus lentulus sp. nov., a new sibling species of A. fumigatus, Eukaryot. Cell, 4, 625, 2005.
103. Pavie, J. et al., Breakthrough disseminated Aspergillus ustus infection in allogeneic hematopoietic stem cell transplant recipients receiving voriconazole or caspofungin prophylaxis, J. Clin. Microbiol., 43, 4902, 2005.
104. Varga, J. et al., Aspergillus calidoustus sp. nov., causative agent of human infections previously assigned to Aspergillus ustus, Eukaryot. Cell, 7, 630, 2008.
105. Slaven, J.W. et al., Increased expression of a novel Aspergillus fumigatus ABC transporter gene, atrF, in the presence of itraconazole in an itraconazole resistant clinical isolate, Fungal Genet. Biol., 36, 199, 2002.
106. Nascimento, A.M. et al., Multiple resistance mechanisms among Aspergillus fumigatus mutants with high-level resistance to itraconazole, Antimicrob. Agents Chemother., 47, 1719, 2003.
107. Gulshan, K. and Moye-Rowley, W.S., Multidrug resistance in fungi, Eukaryot. Cell, 6, 1933, 2007.
108. Piddock, L.J., Multidrug-resistance ef¼ux pumps—Not just for resistance, Nat. Rev. Microbiol., 4, 629, 2006.
109. Mellado, E. et al., Identi�cation of two different 14-alpha sterol demethylase-related genes (cyp51A and cyp51B) in Aspergillus fumigatus and other Aspergillus species, J. Clin. Microbiol., 39, 2431, 2001.
110. Mellado, E. et al., Substitutions at methionine 220 in the 14alpha-sterol demethylase (Cyp51A) of Aspergillus fumigatus are responsible for resistance in vitro to azole antifungal drugs, Antimicrob. Agents Chemother., 48, 2747, 2004.
111. Mellado, E. et al., A new Aspergillus fumigatus resistance mechanism conferring in vitro cross-resistance to azole antifungals involves a combination of cyp51A alterations, Antimicrob. Agents Chemother., 51, 1897, 2007.
112. Snelders, E. et al., Emergence of azole resistance in Aspergillus fumigatus and spread of a single resistance mechanism, PLoS Med., 5, e219, 2008.
113. Bellete, B. et al., Acquired resistance to voriconazole and itraconazole in a patient with pulmonary aspergilloma, Med. Mycol., 48, 197, 2010.
114. Mosquera, J. and Denning, D.W., Azole cross-resistance in Aspergillus fumigatus, Antimicrob. Agents Chemother., 46, 556, 2002.
115. Meneau, I. and Sanglard, D., Azole and fungicide resistance in clinical and environmental Aspergillus fumigatus isolates, Med. Mycol., 43, S307, 2005.
116. Snelders, E. et al., Possible environmental origin of resistance of Aspergillus fumigatus to medical triazoles, Appl. Environ. Microbiol., 75, 4053, 2009.
117. Peetermans, W. et al., Fluconazole-resistant Cryptococcus neoformans var. gattii in an AIDS patient, Acta Clin. Belg., 48, 405, 1993.
118. Birley, H.D. et al., Azole drug resistance as a cause of clinical relapse in AIDS patients with cryptococcal meningitis, Int. J. STD AIDS, 6, 353, 1995.
119. Viard, J.P. et al., Fulminant cryptococcal infections in HIVinfected patients on oral ¼uconazole, Lancet, 346, 118, 1995.
120. Armengou, A. et al., Possible development of resistance to ¼uconazole during suppressive therapy for AIDS-associated cryptococcal meningitis, Clin. Infect. Dis., 23, 1337, 1996. 121. Aller, A.I. et al., Correlation of ¼uconazole MICs with clinical outcome in cryptococcal infection, Antimicrob. Agents Chemother., 44, 1544, 2000. 122. Saag, M.S. et al., Practice guidelines for the management of cryptococcal disease, Infectious Diseases Society of America, Clin. Infect Dis., 30, 710, 2000. 123. Sar, B. et al., Increasing in vitro resistance to ¼uconazole in Cryptococcus neoformans Cambodian isolates: April 2000 to March 2002, J. Antimicrob. Chemother., 54, 563, 2004. 124. Paugam, A. et al., Increased ¼uconazole resistance of Cryptococcus neoformans isolated from a patient with AIDS and recurrent meningitis, Clin. Infect. Dis., 19, 975, 1994. 125. Davey, K.G. et al., In-vitro susceptibility of Cryptococcus neoformans isolates to ¼uconazole and itraconazole, J. Antimicrob. Chemother., 42, 217, 1998. 126. Friese, G. et al., Development of azole resistance during ¼uconazole maintenance therapy for AIDS-associated cryptococcal disease, AIDS, 15, 2344, 2001. 127. Lamb, D.C. et al., Resistant P45051A1 activity in azole antifungal tolerant Cryptococcus neoformans from AIDS patients, FEBS Lett., 368, 326, 1995. 128. Rodero, L. et al., G484S amino acid substitution in lanosterol 14-alpha demethylase (ERG11) is related to ¼uconazole resistance in a recurrent Cryptococcus neoformans clinical isolate, Antimicrob. Agents Chemother., 47, 3653, 2003. 129. Venkateswarlu, K. et al., Fluconazole tolerance in clinical isolates of Cryptococcus neoformans, Antimicrob. Agents Chemother., 41, 748, 1997. 130. Joseph-Horne, T. et al., Amphotericin B resistant isolates of Cryptococcus neoformans without alteration in sterol biosynthesis, J. Med. Vet. Mycol., 34, 223, 1996. 131. Posteraro, B. et al., Identi�cation and characterization of a Cryptococcus neoformans ATP binding cassette (ABC) transporter-encoding gene, CnAFR1, involved in the resistance to ¼uconazole, Mol. Microbiol., 47, 357, 2003. 132. Sanguinetti, M. et al., Role of AFR1, an ABC transporterencoding gene, in the in vivo response to ¼uconazole and virulence of Cryptococcus neoformans, Infect. Immun., 74, 1352, 2006. 133. Orsi, C.F. et al., The ABC transporter-encoding gene AFR1 affects the resistance of Cryptococcus neoformans to microglia-mediated antifungal activity by delaying phagosomal maturation, FEMS Yeast Res., 9, 301, 2009. 134. Sionov, E. et al., Heteroresistance to ¼uconazole in Cryptococcus neoformans is intrinsic and associated with virulence, Antimicrob. Agents Chemother., 53, 2804, 2009. 135. Thornewell, S.J., Peery, R.B., and Skatrud, P.L., Cloning and characterization of CneMDR1: A Cryptococcus neoformans gene encoding a protein related to multidrug resistance proteins, Gene, 201, 21, 1997. 136. Douglas, C.M. et al., Identi�cation of the FKS1 gene of Candida albicans as the essential target of 1,3-beta-d-glucan synthase inhibitors, Antimicrob. Agents Chemother., 41, 2471, 1997. 137. Perlin, D.S., Resistance to echinocandin-class antifungal drugs, Drug. Resist. Updat., 10, 121, 2007. 138. Kurtz, M.B. et al., Characterization of echinocandin-resistant mutants of Candida albicans: Genetic, biochemical, and virulence studies, Infect. Immun., 64, 3244, 1996. 139. Balashov, S.V., Park, S., and Perlin, D.S., Assessing resistance to the echinocandin antifungal drug caspofungin in Candida albicans by pro�ling mutations in FKS1, Antimicrob. Agents Chemother., 50, 2058, 2006.
140. Garcia-Effron, G., Park, S., and Perlin, D.S., Correlating echinocandin MIC and kinetic inhibition of fks1 mutant glucan synthases for Candida albicans: Implications for interpretive breakpoints, Antimicrob. Agents Chemother., 53, 112, 2009.
141. Park, S. et al., Speci�c substitutions in the echinocandin target Fks1p account for reduced susceptibility of rare laboratory and clinical Candida sp. isolates, Antimicrob. Agents Chemother., 49, 3264, 2005.
142. Desnos-Ollivier, M. et al., European Committee on Antibiotic Susceptibility Testing. Mutations in the fks1 gene in Candida albicans, C. tropicalis, and C. krusei correlate with elevated caspofungin MICs uncovered in AM3 medium using the method of the European Committee on Antibiotic Susceptibility Testing, Antimicrob. Agents Chemother., 52, 3092, 2008.
143. Katiyar, S., Pfaller, M., and Edlind, T., Candida albicans and Candida glabrata clinical isolates exhibiting reduced echinocandin susceptibility, Antimicrob. Agents Chemother., 50, 2892, 2006.
144. Garcia-Effron, G. et al., A naturally occurring proline-toalanine amino acid change in Fks1p in Candida parapsilosis, Candida orthopsilosis, and Candida metapsilosis accounts for reduced echinocandin susceptibility, Antimicrob. Agents Chemother., 52, 2305, 2008.
145. Kartsonis, N. et al., Caspofungin susceptibility testing of isolates from patients with esophageal candidiasis or invasive candidiasis: Relationship of MIC to treatment outcome, Antimicrob. Agents Chemother., 49, 3616, 2005; Mol. Microbiol., 63, 1399, 2007.
146. Munro, C.A. et al., The PKC, HOG and Ca2+ signalling pathways co-ordinately regulate chitin synthesis in Candida albicans, Mol. Microbiol., 63, 1399, 2007.
147. Walker, L.A. et al., Stimulation of chitin synthesis rescues Candida albicans from echinocandins, PLoS Pathog., 4, e1000040, 2008.
148. Stevens, D.A., Espiritu, M., and Parmar, R., Paradoxical effect of caspofungin: Reduced activity against Candida albicans at high drug concentrations, Antimicrob. Agents Chemother., 48, 3407, 2004.
149. Stevens, D.A. et al., Escape of Candida from caspofungin inhibition at concentrations above the MIC (paradoxical effect) accomplished by increased cell wall chitin; evidence for beta-1,6-glucan synthesis inhibition by caspofungin, Antimicrob. Agents Chemother., 50, 3160, 2006.
150. Madureira, A. et al., Breakthrough invasive aspergillosis in allogeneic haematopoietic stem cell transplant recipients treated with caspofungin, Int. J. Antimicrob. Agents, 30, 551, 2007.
151. Gardiner, R.E. et al., Characterization of Aspergillus fumigatus mutants with reduced susceptibility to caspofungin, Med. Mycol., 43, S299, 2005.
152. Rocha, E.M. et al., A Ser678Pro substitution in Fks1p confers resistance to echinocandin drugs in Aspergillus fumigates, Antimicrob. Agents Chemother., 51, 4174, 2007.
153. Romano, J. et al., Disruption of the Aspergillus fumigatus ECM33 homologue results in rapid conidial germination, antifungal resistance and hypervirulence, Microbiology, 152, 1919, 2006.
154. Arendrup, M.C. et al., Establishing in vitro-in vivo correlations for Aspergillus fumigatus: The challenge of azoles versus echinocandins, Antimicrob. Agents Chemother., 52, 3504, 2008. 155. Maligie, M.A. and Selitrennikoff, C.P., Cryptococcus neoformans resistance to echinocandins: (1,3)beta-glucan synthase activity is sensitive to echinocandins, Antimicrob. Agents Chemother., 49, 2851, 2005. 156. Niimi, K. et al., Overexpression of Candida albicans CDR1, CDR2, or MDR1 does not produce signi�cant changes in echinocandin susceptibility, Antimicrob. Agents Chemother., 50, 1148, 2006. 157. Coleman, J.J. and Mylonakis, E., Ef¼ux in fungi: La pièce de résistance, PLoS Pathog., 5, e1000486, 2009. 158. MacPherson, S., Larochelle, M., and Turcotte, B., A fungal family of transcriptional regulators: The zinc cluster proteins, Microbiol. Mol. Biol. Rev., 70, 583, 2006. 159. Thakur, J.K. et al., A nuclear receptor-like pathway regulating multidrug resistance in fungi, Nature, 452, 604, 2008. 160. Carvajal, E. et al., Molecular and phenotypic characterization of yeast PDR1 mutants that show hyperactive transcription of various ABC multidrug transporter genes, Mol. Gen. Genet., 256, 406, 1997. 161. Nourani, A. et al., Clustered amino acid substitutions in the yeast transcription regulator Pdr3p increase pleiotropic drug resistance and identify a new central regulatory domain, Mol. Gen. Genet., 256, 397, 1997. 162. Delahodde, A., Delaveau, T., and Jacq, C., Positive autoregulation of the yeast transcription factor Pdr3p, which is involved in control of drug resistance, Mol. Cell Biol., 15, 4043, 1995. 163. Hallstrom, T.C. and Moye-Rowley, W.S., Multiple signals from dysfunctional mitochondria activate the pleiotropic drug resistance pathway in Saccharomyces cerevisiae, J. Biol. Chem., 275, 37347, 2000. 164. Tsai, H.F. et al., Candida glabrata PDR1, a transcriptional regulator of a pleiotropic drug resistance network, mediates azole resistance in clinical isolates and petite mutants, Antimicrob. Agents Chemother., 50, 1384, 2006. 165. Vermitsky, J.P. et al., Pdr1 regulates multidrug resistance in Candida glabrata: Gene disruption and genome-wide expression studies, Mol. Microbiol., 61, 704, 2006. 166. Ferrari, S. et al., Gain of function mutations in CgPDR1 of Candida glabrata not only mediate antifungal resistance but also enhance virulence, PLoS Pathog., 5, e1000268, 2009. 167. DeRisi, J., Genome microarray analysis of transcriptional activation in multidrug resistance yeast mutants, FEBS Lett., 470, 156, 2000. 168. Lucau-Danila, A. et al., Early expression of yeast genes affected by chemical stress, Mol. Cell Biol., 25, 1860, 2005. 169. Goffeau, A., Drug resistance: The �ght against fungi, Nature, 452, 541, 2008. 170. Chen, K.H. et al., The bZip transcription factor Cgap1p is involved in multidrug resistance and required for activation of multidrug transporter gene CgFLR1 in Candida glabrata, Gene, 386, 63, 2007. 171. Traven, A. et al., Interorganellar communication. Altered nuclear gene expression pro�les in a yeast mitochondrial DNA mutant, J. Biol. Chem., 276, 4020, 2001. 172. Shahi, P., Gulshan, K., and Moye-Rowley, W.S., Negative transcriptional regulation of multidrug resistance gene expression by an Hsp70 protein, J. Biol. Chem., 282, 26822, 2007. 173. Florio, A., unpublished data, 2007. 174. Coste, A.T. et al., TAC1, transcriptional activator of CDR genes, is a new transcription factor involved in the regulation of Candida albicans ABC transporters CDR1 and CDR2, Eukaryot. Cell, 3, 1639, 2004.
175. Selmecki, A., Forche, A., and Berman, J., Aneuploidy and isochromosome formation in drug-resistant Candida albicans, Science, 313, 367, 2006.
176. Coste, A. et al., A mutation in Tac1p, a transcription factor regulating CDR1 and CDR2, is coupled with loss of heterozygosity at chromosome 5 to mediate antifungal resistance in Candida albicans, Genetics, 172, 2139, 2006.
177. Selmecki, A. et al., An isochromosome confers drug resistance in vivo by ampli�cation of two genes, ERG11 and TAC1, Mol. Microbiol., 68, 624, 2008.
178. Dunkel, N. et al., Mutations in the multi-drug resistance regulator MRR1, followed by loss of heterozygosity, are the main cause of MDR1 overexpression in ¼uconazole-resistant Candida albicans strains, Mol. Microbiol., 69, 827, 2008.
179. Cowen, L.E. and Steinbach, W.J., Stress, drugs, and evolution: The role of cellular signaling in fungal drug resistance, Eukaryot. Cell, 7, 747, 2008.
180. Cowen, L.E. et al., Genetic architecture of Hsp90-dependent drug resistance, Eukaryot. Cell, 5, 2184, 2006.
181. Singh, S.D. et al., Hsp90 governs echinocandin resistance in the pathogenic yeast Candida albicans via calcineurin, PLoS Pathog., 5, e1000532, 2009.
182. Cowen, L.E. et al., Harnessing Hsp90 function as a powerful, broadly effective therapeutic strategy for fungal infectious disease, Proc. Natl. Acad. Sci. USA, 106, 2818, 2009.
183. Cowen, L.E. and Lindquist, S., Hsp90 potentiates the rapid evolution of new traits: Drug resistance in diverse fungi, Science, 309, 2185, 2005.
184. Weile, J. and Knabbe, C., Current applications and future trends of molecular diagnostics in clinical bacteriology, Anal. Bioanal. Chem., 394, 731, 2009. 185. Espy, M.J. et al., Real-time PCR in clinical microbiology: Applications for routine laboratory testing, Clin. Microbiol. Rev., 19, 165, 2006. 186. Morrell, M., Fraser, V.J., and Kollef, M.H., Delaying the empiric treatment of Candida bloodstream infection until positive blood culture results are obtained: A potential risk factor for hospital mortality, Antimicrob. Agents Chemother., 49, 3640, 2005. 187. Edlind, T.D., Molecular detection of antifungal resistance, in Molecular Microbiology: Diagnostic Principles and Practice, Chap. 43, Persing, D.H., Tenover, F.C., Versalovic, J., Tang, Y.W., Unger, E.R., Relman, D.A., White, T.J., Eds., ASM Press, Washington, DC, 2004. 188. Perlin, D.S., Antifungal drug resistance: Do molecular methods provide a way forward? Curr. Opin. Infect. Dis., 22, 568, 2009. 189. Balashov, S.V. et al., Rapid, high-throughput, multiplex, realtime PCR for identi�cation of mutations in the cyp51A gene of Aspergillus fumigatus that confer resistance to itraconazole, J. Clin. Microbiol., 43, 214, 2005. 190. Marinach, C. et al., MALDI-TOF MS-based drug susceptibility testing of pathogens: The example of Candida albicans and ¼uconazole. Proteomics, 9, 4627, 2009. 191. Odds, F.C., Discovery and development of antifungal drugs: A reality check, presented at 4th Trends in Medical Mycology, Athens, October 18–21, 2009, http://www.TIMM2009.org 192. Pukkila-Worley, R. et al., Antifungal drug discovery through the study of invertebrate model hosts, Curr. Med. Chem., 16, 1588, 2009.