Functional Analysis of the Stem-Loop Structures at the 5 End of the Aichi

View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector Available online at www.sciencedirect.com

Virology 313 (2003) 56Ð65 www.elsevier.com/locate/yviro

Functional analysis of the stem-loop structures at the 5Ј end of the Aichi virus genome

Shigeo Nagashima, Jun Sasaki,* and Koki Taniguchi

Department of Virology and Parasitology, Fujita Health University School of Medicine, Toyoake, Aichi 470-1192, Japan Received 16 December 2002; returned to author for revision 10 February 2003; accepted 15 April 2003

Abstract Aichi virus is a member of the family Picornaviridae. Computer-assisted secondary structure prediction suggested the formation of three stem-loop structures (SL-A, SL-B, and SL-C from the 5Ј end) within the 5Ј-end 120 nucleotides of the genome. We have already shown that the most 5Ј-end stem-loop, SL-A, is critical for viral RNA replication. Here, using an infectious cDNA clone and a replicon harboring a luciferase gene, we revealed that formation of SL-B and SL-C on the positive strand is essential for viral RNA replication. In addition, the speciﬁc nucleotide sequence of the loop segment of SL-B was also shown to be critical for viral RNA replication. Mutations of the upper and lower stems of SL-C that do not disrupt the base-pairings hardly affected RNA replication, but decreased the yields of viable viruses signiﬁcantly compared with for the wild-type. This suggests that SL-C plays a role at some step besides RNA replication during virus infection. © 2003 Elsevier Science (USA). All rights reserved.

Introduction caniello, 2001). The 5Ј UTR contains the following two functional elements (Rohll et al., 1994): one is involved in Picornaviruses are small (approximately 30 nm in diam- RNA replication and the other regulates translation. The eter), nonenveloped icosahedral viruses (Racaniello, 2001), element that directs translation initiation is termed the in- and the following nine genera have been deﬁned so far: ternal ribosome entry site (IRES) (Jang et al., 1988; Pelletier Enterovirus, Rhinovirus, Cardiovirus, Aphthovirus, Hepa- and Sonenberg, 1988). IRES is approximately 450 nucleo- tovirus, Parechovirus, Erbovirus, Kobuvirus, and Teschovi- tides long and is located immediately or ϳ160 nucleotides rus (Pringle, 1999). The genome of picornaviruses com- upstream of the coding region. IRES recruits ribosomes, and prises a single-stranded positive-sense RNA of 7200Ð8500 translation of picornavirus RNAs is initiated on the entry of nucleotides and is covalently linked at its 5Ј end to a small ribosomes into IRES in a 5Ј-end independent manner viral protein, VPg, which is 20Ð24 amino acids in length (Hellen and Sarnow, 2001; Jackson and Kaminski, 1995). (Flanegan et al., 1977; Lee et al., 1977). The genome con- The 5Ј-terminal region of the picornavirus genome is sists of the four following regions: a 5Ј-untranslated region involved in RNA replication. The 5Ј-end 90 nucleotides of (UTR), a single coding region, a 3Ј-UTR, and a poly(A) tail. the poliovirus genome fold into a cloverleaf-like structure The coding region spans approximately 90% of the genome and interact with a viral precursor polypeptide, 3CD, and a and encodes a long polyprotein that is cleaved into func- cellular protein, poly(rC)-binding protein (PCBP) (Andino tional proteins by virus-encoded proteinases (Summers and et al., 1990, 1993; Gamarnik and Andino, 1997; Parsley et Maizel, 1968). al., 1997). Mutations that disrupt the cloverleaf structure The 5Ј-UTR of the picornavirus genome is very long inhibit the interaction with the proteins and reduce or com- (620Ð1200 nucleotides in length) and highly structured (Ra- pletely prevent viral RNA replication (Andino et al., 1990, 1993; Percy et al., 1992). Thus, the formation of a ribonu- cleoprotein (RNP) complex at the 5Ј end of the poliovirus * Corresponding author. Fax: ϩ81-562-93-4008. genome is essential for efﬁcient RNA replication. Initially, E-mail address: [email protected] (J. Sasaki). interaction of the 5Ј cloverleaf with 3CD and PCBP was

stem-loop, SL-A, in virus replication, showing that correct folding of SL-A on the positive-strand RNA and the speciﬁc nucleotide sequence of the lower part of the stem are crucial for viral RNA replication (Sasaki et al., 2001). In this study, we investigated the functions of SL-B and SL-C in virus replication using various site-directed mutants derived from an infectious cDNA clone. The results showed that these two stem-loops are structures required for viral RNA replication. Proper folding of SL-B and SL-C on the positive-strand RNA, and the nucleotide sequences of the stem and loop segments of SL-B, were found to be important for RNA replication. In addition, it was suggested that SL-C plays a role at some step besides RNA replication during virus infection.

Results

Construction of an Aichi virus replicon in which the P1 region is replaced with a luciferase gene

Fig. 1. The predicted secondary structure of the 5Ј-end 120 nucleotides of To monitor viral RNA replication, we constructed an the Aichi virus genome. The three stem-loop structures are termed SL-A, Aichi virus replicon, AV-FL-Luc (Fig. 2A). In AV-FL-Luc, SL-B, and SL-C. almost the entire P1 region was replaced by a firefly luciferase gene, which was flanked by the nucleotide sequences encoding the N- and C-terminal seven amino acids of VP0 reported to be required for synthesis of positive-strand RNA and VP1, respectively, to release luciferase from the (Andino et al., 1990). Recently, it was found that this 5Ј-end polyprotein by cleavage with viral 3C protease. The size of RNP complex interacts with the 3Ј end of the genome the AV-FL-Luc RNA was 90% of that of the wild-type through binding of 3CD and PCBP to a cellular protein, genome. As a negative control, we constructed pAV-⌬5Ј- poly(A) binding protein, bound to the 3Ј poly(A) tail, and Luc with deletion of the 5Ј-terminal 32 nucleotides of the the formation of this circular RNP complex is required for genome. The previous study showed that the RNA with this initiation of negative-strand RNA synthesis (Barton et al., deletion (AV-⌬5Ј, termed AV-1 in the previous study) can- 2001; Herold and Andino, 2001; Lyons et al., 2001). It has not replicate in transfected cells (Sasaki et al., 2001). On in also been described that the poliovirus cloverleaf structure vitro transcription/translation analysis with a rabbit reticu- is involved in the processes of switching from viral trans- locyte lysate, pAV-FL-Luc and pAV-⌬5Ј-Luc produced a lation to replication (Gamarnik and Andino, 1998) and VPg protein whose molecular mass was almost the same as that uridylylation (Lyons et al., 2001). A cloverleaf structure of luciferase (61 kDa) (Fig. 2B). Although pAV-FL and similar to that of poliovirus is formed at the 5Ј end of the pAV-⌬5Ј also produced a protein that comigrates with the genomes of the viruses belonging to the genera Enterovirus luciferase, the 61-kDa protein produced by pAV-FL-Luc and Rhinovirus (Rivera et al., 1988; Zell et al., 1999). On and pAV-⌬5Ј-Luc was obviously more abundant than that the other hand, the 5Ј end of the genomes of cardio-, produced by pAV-FL and pAV-⌬5Ј. This result indicates aphtho-, hepato-, and parechoviruses folds into a stem-loop that luciferase was expressed from pAV-FL-Luc and pAV- structure (Brown et al., 1991; Duke et al., 1992; Ghazi et al., ⌬5Ј-Luc and released from the polyprotein. 1998; Le et al., 1993). No direct evidence that the stem-loop To determine whether the AV-FL-Luc RNA replicates in structure of these viruses is involved in RNA replication has Vero cells, cells were electroporated with the RNAs, and been provided so far. then accumulation of positive-strand RNAs in the cells was Aichi virus, which is associated with acute gastroenteritis analyzed by dot blot hybridization. The results showed that in humans (Yamashita et al., 1991), is a virus recently the AV-FL-Luc RNA replicates somewhat more efficiently assigned to the family Picornaviridae and is the only mem- than the AV-FL RNA (Fig. 2C; compare at 6 and 7 h after ber of the genus Kobuvirus at present (Pringle, 1999; Ya- transfection). The increased replication efficiency of the mashita et al., 1998). Computer-assisted prediction of the replicon is probably due to its reduced size compared to that RNA secondary structure suggested the formation of three of the wild-type genome, as reported for poliovirus repli- stem-loop structures (SL-A, SL-B, and SL-C) within the cons (Barclay et al., 1998; Kaplan and Racaniello, 1988). 120 nucleotides of the 5Ј end of the genome (Fig. 1). We Replication of the AV-⌬5Ј and AV-⌬5Ј-Luc RNAs was not have already investigated the function of the most 5Ј-end detected (Fig. 2C). Finally, the AV-FL-Luc and AV-⌬5Ј- 58 S. Nagashima et al. / Virology 313 (2003) 56–65

Fig. 2. (A) Organization of the Aichi virus infectious cDNA clone, pAV-FL, and the replicon, pAV-FL-Luc. Thick lines and open boxes show the untranslated regions and coding regions, respectively. The thin lines indicate the vector sequences. The Aichi virus sequence was cloned just downstream of the T7 promoter sequence. The restriction enzyme sites used in this study and their nucleotide positions are indicated below the diagram of pAV-FL. Below the diagram of pAV-FL-Luc, the deduced amino acid sequences ﬂanking the luciferase sequence are shown. We considered the cleavage site between VP1 and 2A the glutamine/glycine pair at amino acid positions 1016Ð1017 based on the amino acid sequence alignment of the picornavirus 2A proteins performed by Hughes and Stanway (2000). (B) In vitro translation of pAV-FL, pAV-⌬5Ј, pAV-FL-Luc, and pAV-⌬5Ј-Luc. pAV-⌬5Ј and pAV-⌬5Ј-Luc had the same sequences as pAV-FL and pAV-FL-Luc, respectively, except that the former two plasmids lack the 5Ј-end 32 nucleotides of the genome. The plasmids were subjected to in vitro transcription/translation reaction in a rabbit reticulocyte lysate containing biotinylated lysyl-tRNA, and proteins were electrophoresed on an SDSÐpolyacrylamide gel and blotted onto a PVDF membrane. The biotin-labeled translation products were detected as chemiluminescence. To investigate the electrophoretic mobility of luciferase, Luc control DNA, which only expresses luciferase, was analyzed. (C) RNA replication of AV-FL, AV-⌬5Ј, AV-FL-Luc, and AV-⌬5Ј-Luc in transfected cells. Vero cells were electroporated with the RNAs, and at the indicated time points after electroporation, total RNA was extracted. Using these total RNA samples, dot blot hybridization was performed to detect the viral positive-sense RNA. (D) Luciferase activity in the transfected cells with AV-FL-Luc and AV-⌬5Ј-Luc. Vero cells were electroporated with the RNAs, and at the indicated time points after electroporation, cell lysates were prepared and analyzed for luciferase activity.

Luc RNAs were electroporated into Vero cells, and lucif- concluded that the increase of luciferase activity in the cells erase activity in the cells was examined (Fig. 2D). By 2 h transfected with the replicons reflects RNA replication and after transfection, a similar level of luciferase activity was that by using this assay system we can indirectly monitor detected in cells transfected with the AV-FL-Luc and AV- the efficiency of viral RNA replication. ⌬5Ј-Luc RNAs, and those values were approximately 50- fold higher than that in mock-transfected cells. This sug- Site-directed mutagenesis of SL-B and SL-C gests that the AV-FL-Luc and AV-⌬5Ј-Luc RNAs were translated at the similar efficiency in cells. At 3 h after We investigated the importance of SL-B and SL-C in transfection, luciferase activity in the AV-FL-Luc RNA- virus replication by site-directed mutational analysis. Vari- transfected cells began to increase, and the value at7hwas ous mutations, as shown in Fig. 3, were introduced into approximately 2000-fold higher than that at 2 h. In contrast, SL-B and SL-C of pAV-FL and pAV-FL-Luc. pAV-FL and no increase of luciferase activity was observed in the AV- pAV-FL-Luc, and their mutants, were analyzed by in vitro ⌬5Ј-Luc RNA-transfected cells. Based on these results, we transcription/translation assay using a rabbit reticulocyte S. Nagashima et al. / Virology 313 (2003) 56–65 59

Fig. 3. Site-directed mutations introduced into SL-B and SL-C. The stem-loop structures formed by the sequence complementary to SL-B and SL-C at the 3Ј end of the negative strand are termed SL-B(Ϫ) and SL-C(Ϫ).

Table 1 lysate, and we found that these plasmids produce a similar Ability of mutant RNAs to produce viruses level of proteins (data not shown). RNA Stem-loop mutated Virus titera Plaque sizeb In vitro transcripts synthesized from the mutants con- (PFU/ml) (mm) structed based on pAV-FL were transfected into Vero cells AV-FL 2 ϫ 105 2.5 Ϯ 0.3 by lipofection, and the virus titers in the transfected cells at mutB-1 SL-B stem 0 72 h after transfection were examined by plaque assay mutB-2 SL-B stem 0 ϫ 3 Ϯ (Table 1). In parallel, replicon RNAs harboring a luciferase mutB-3 SL-B stem 2 10 1.1 0.1 mutC-1 SL-C stem 0 gene were transfected into Vero cells by electroporation, mutC-2 SL-C stem 0 and luciferase activity in the transfected cells was deter- mutC-3 SL-C stem 1 ϫ 103 1.6 Ϯ 0.2 mined at 2, 3, 4, 5, 6, and 7 h after electroporation to mutC-4 SL-C stem 0 investigate the efﬁciency of RNA replication (Figs. 4, 5, and mutC-5 SL-C stem 0 ϫ 6 Ϯ 6). At 2 h after electroporation, luciferase activity in cells mutC-6 SL-C stem 2 10 2.4 0.3 mutC-7 SL-C stem 0 transfected with all the mutant RNAs were signiﬁcantly mutC-8 SL-C stem 0 higher than that in mock-transfected cells (Figs. 4, 5, and 6), mutC-9 SL-C Stem 1 ϫ 103 1.3 Ϯ 0.2 indicating that the mutants have no primary defect in their mutB-4 SL-B top loop 0 translation ability. mutC-10 SL-C top loop 1 ϫ 105 2.1 Ϯ 0.2 mutC-11 SL-C internal-loop 2 ϫ 106 2.5 Ϯ 0.3 mutB-5 SL-B(Ϫ)/SL-C(Ϫ)2ϫ 105 2.2 Ϯ 0.2 Stem of SL-B a Titers (PFU/ml) of infectious viruses in the cells collected at 72 h after By introducing single or double mutations to disrupt or transfection. restore the base-pairings of the stem of SL-B, we con- b Values are the average diameters of 20 plaques Ϯ standard deviation. structed mutB-1, mutB-2, and mutB-3 (Fig. 3). The single The size was determined at 72 h after transfection. 60 S. Nagashima et al. / Virology 313 (2003) 56–65

Fig. 4. Luciferase activity in cells transfected with AV-FL-Luc and the mutants of SL-B and SL-B(Ϫ)/SL-C(Ϫ). Vero cells were electroporated Fig. 6. Luciferase activity in cells transfected with AV-FL-Luc and the with the RNAs, and at the indicated time points after electroporation, cell mutants of loop segments. Vero cells were electroporated with the RNAs, lysates were prepared and analyzed for luciferase activity. All samples and at the indicated time points after electroporation, cell lysates were were prepared and analyzed in parallel. prepared and analyzed for luciferase activity. All samples were prepared and analyzed in parallel. mutants, mutB-1 and mutB-2, formed no plaques in the plaque assay (Table 1). mutB-3, a double mutant, generated viable viruses, although this mutant exhibited a small mutC-2, and mutC-3), the middle stem (mutC-4, mutC-5, plaque phenotype and its titer was 100-fold lower than that and mutC-6), and the lower stem (mutC-7, mutC-8, and of AV-FL (Table 1). In the luciferase assay, no increase of mutC-9) of SL-C (Fig. 3). All single mutants (mutC-1, luciferase activity was observed in the cells transfected with mutC-2, mutC-4, mutC-5, mutC-7, and mutC-8) lacked mutB-1-Luc RNA or mutB-2-Luc RNA. Luciferase activity plaque-forming ability (Table 1). The luciferase assay in the mutB-3-Luc-transfected cells was reduced to 24Ð showed that replicons with a single mutation did not repli- 40% of that in the cells transfected with the AV-FL-Luc cate. The double mutants, mutC-3-Luc, mutC-6-Luc, and RNA (Fig. 4). These results indicate that formation of the mutC-9-Luc, replicated with similar efficiency to AV-FL- base-pairings of the stem of SL-B is critical for viral RNA Luc (Fig. 5). The plaque assay showed that mutC-3, mutC-6, replication. In addition, the specific nucleotide sequence of and mutC-9 produced viable viruses (Table 1). mutC-6 the stem of SL-B was suggested to be important for efficient generated viruses efficiently and its yield was even higher RNA replication. than that of AV-FL. In contrast, the virus yields of mutC-3 and mutC-9 were 200- and 2000-fold lower than those of Stem segments of SL-C AV-FL and mutC-6, respectively, and these two mutants We introduced single or double mutations to disrupt or formed small plaques (Table 1). These results indicate that restore the base-pairings of the upper stem (mutC-1, formation of the base-pairings of the three stem segments of

Fig. 5. Luciferase activity in cells transfected with AV-FL-Luc and the mutants of SL-C. Vero cells were electroporated with the RNAs, and at the indicated time points after electroporation, cell lysates were prepared and analyzed for luciferase activity. All samples were prepared and analyzed in parallel. S. Nagashima et al. / Virology 313 (2003) 56–65 61

SL-C is essential for viral RNA replication. In addition, the (Fig. 1). In this study, we investigated the functions of SL-B results for the double mutants showed that mutations of the and SL-C in virus replication using various site-directed nucleotide sequences of the upper and lower stems affect mutants and showed that these two stem-loops are second- some step other than RNA replication in the virus infection ary structures required for viral RNA replication. It was cycle. found that folding of SL-B and SL-C on the positive strand and the specific nucleotide sequence of the loop segment of Top loops of SL-B and SL-C and internal loop of SL-C SL-B are primarily critical for RNA replication (Figs. 4, 5, The four nucleotides of the top loops of SL-B and SL-C and 6, and Table 1). The nucleotide sequence of the stem were changed to AAAA, yielding mutB-4 and mutC-10, segment of SL-B was also important for efficient RNA respectively (Fig. 3). mutC-11 was constructed by changing replication (Fig. 4); however, a double mutation introduced the nucleotide sequence of the downstream segment of the into the stem segment of SL-B had a more modest effect on internal loop of SL-C to one complementary to the upstream RNA replication than disruption of the secondary structures segment to form base-pairings (Fig. 3). There was little or the nucleotide change of the loop segment of SL-B. effect of the mutation of the top loop sequence of SL-C We have already shown that SL-A, the most 5Ј-end (mutC-10 and mutC-10-Luc) in levels of the virus produc- stem-loop, is a structural element critical for viral RNA tion (Table 1) and RNA replication (Fig. 6). The mutants in replication (Sasaki et al., 2001), concluding that all three which the internal loop of SL-C was changed to a stem stem-loop structures at the 5Ј end of the Aichi virus genome (mutC-11 and mutC-11-Luc) exhibited efficient RNA rep- are crucial for RNA replication. It is known that the 5Ј end lication and virus production (Fig. 6 and Table 1). In con- of the poliovirus genome folds into a cloverleaf structure trast, nucleotide changes of the loop segment of SL-B pre- and that this structure is a cis-acting element required for vented the generation of viable viruses and RNA replication RNA replication (Andino et al., 1990). The following sev- (mutB-4 and mutB-4-Luc) (Table 1 and Fig. 6). These eral similarities exist between the three stem-loop structures results indicate that the specific nucleotide sequence of the of Aichi virus and the poliovirus cloverleaf structure: (i) loop segment of SL-B is critical for virus RNA replication, correct folding of the secondary structure on the positive while that of the top loop of SL-C is not. In addition, it was strand; (ii) the nucleotide sequences of certain loop seg- shown that the structure of the unpaired internal loop segments (SL-B for Aichi virus and stem-loops b and d for ment of SL-C is unnecessary for efficient RNA replication. poliovirus); and (iii) the nucleotide sequences of certain stems (SL-B and the lower part of SL-A for Aichi virus, and Stem-loops of the 3Ј end of the negative strand stem a for poliovirus) are important for RNA replication The formation of three stem-loops was predicted not (Andino et al., 1990, 1993; Sasaki et al., 2001). Such sim- only at the 5Ј end of the positive strand but also at the 3Ј end ilarities suggest that the 5Ј-terminal region of the Aichi of the negative strand of Aichi virus RNA (Fig. 3). We virus genome containing the three stem-loop structures acts previously showed that formation of the most 3Ј-end stem- as an RNA replication signal and is a functional counterpart loop of the negative strand is not required for RNA repli- of the poliovirus cloverleaf structure. cation (Sasaki et al., 2001). Here, we investigated the im- Mutational analysis of the loop segments of SL-B and portance of the second and third stem-loops from the 3Ј end SL-C indicated that the specific nucleotide sequence of the of the negative strand (termed SL-B(Ϫ) and SL-C(Ϫ), re- top-loop segment of SL-B is functionally critical (Fig. 6). In spectively) in virus replication. We constructed mutB-5 and contrast, nucleotide changes of the loop segment of SL-C mutB-5-Luc by changing the U-A pairs of SL-B (nt 52/63 hardly affected virus replication (Fig. 6, Table 1). In addi- and 49/66) to U-G pairs (Fig. 3). Prediction of the secondary tion, it was not necessary to keep the internal loop of SL-C structure using the MFOLD program (Mathews et al., 1999) unpaired for efficient replication. We previously showed suggested that in mutB-5, SL-B of the positive strand is that a nucleotide change of the loop segment of SL-A does formed properly, but the secondary structures formed at the not affect the RNA replication efficiency so severely 3Ј-end of the negative strand are different from SL-B(Ϫ) (Sasaki et al., 2001). It has been reported for poliovirus that and SL-C(Ϫ) of the wild type. The plaque and luciferase the formation of an RNP complex consisting of the 5Ј assays showed that mutation of SL-B(Ϫ) and SL-C(Ϫ) did cloverleaf, PCBP, and 3CD is critical for RNA replication not affect the generation of viable viruses or RNA replica- (Andino et al., 1990; Barton et al., 2001; Herold and An- tion (Table 1 and Fig. 4). This indicates that correct folding dino, 2001). Mutations of the loop segments of stem-loops of the stem-loops at the 3Ј end of the negative strand is not b and d of the cloverleaf inhibit formation of the RNP important for virus replication. complex, and thereby, reduce or completely abolish RNA replication (Andino et al., 1990, 1993). The 5Ј-end sequence of the HAV genome folds into three stem-loop structures Discussion (Brown et al., 1991; Le et al., 1993). It has not been confirmed whether the formation of these stem-loop struc- The 5Ј-end 120 nucleotides of the Aichi virus genome tures is required for viral RNA replication. However, it has fold into three stem-loop structures, SL-A, SL-B, and SL-C been reported that the 3ABC precursor polypeptide of HAV 62 S. Nagashima et al. / Virology 313 (2003) 56–65 can bind to the second stem-loop and that this binding yields mation of mature virions and empty capsids in mutant a more stable RNP complex with three stem-loop structures RNAs-transfected cells, the transfected cells were labeled (Kusov et al., 1997). In Aichi virus, it would be possible that with [35S]methionine, and a sedimentation analysis of the efficient RNA replication requires the formation of an RNP radiolabeled virus particles was performed using a 10Ð30% complex consisting of the region containing the three stem- sucrose gradient as described elsewhere (Sasaki and Ta- loop structures and viral and/or cellular proteins and that the niguchi, 2003). However, we could observe neither a sig- loop segment of SL-B plays an important role in the inter- nificant defect of mutC-3 or mutC-9 in virion formation nor action with a protein. facilitation of virion formation in mutC-6 or mutC-11 com- cis-acting RNA replication elements of picornaviruses pared to the wild-type (data not shown). Even if there were had been thought to be located in the 5Ј- and 3Ј-terminal differences of the encapsidation efficiency between the regions of the genome. However, it has been reported over wild-type and these mutants, the differences may be too the last several years that some picornavirus genomes con- slight to be detected by the sedimentation analysis. Plaque tain a cis-acting replication element within an internal re- assay may have enabled us to find this slight difference of gion of the genome including the coding region. The loca- the encapsidation efficiency due to the repeated replication tion of such an internal cis-acting replication element (cre) cycles for 72 h. Alternatively, another step during virus on the genome varies among viruses: the elements have infection may be affected in these mutants. Further experi- been mapped in the VP1-coding region of human rhinovirus ments are needed to determine whether or not SL-C is type 14 (HRV-14) (McKnight and Lemon, 1996, 1998), the involved in RNA encapsidation. VP2-coding region of Theiler’s virus and Mengo virus (Lobert et al., 1999), the 2C-coding region of poliovirus (Goodfellow et al., 2000), the 2A-coding region of HRV-2 Materials and methods (Gerber et al., 2001), and the region adjacent to the IRES of foot-and-mouth disease virus (Mason et al., 2002). The cres Construction of an Aichi virus replicon containing a of these viruses are similar to each other in that they fold luciferase gene into a stem-loop structure with an AAACA motif in the loop segment and function at the RNA, not protein, level. Re- An Aichi virus replicon, pAV-FL-Luc, was constructed cently, it was shown that the cres of poliovirus, HRV-2 and by replacing almost the entire capsid-coding region (P1 HRV-14, act as a template for the uridylylation of VPg region) with a firefly luciferase gene (Fig. 2A). An EcoRI- (Gerber et al., 2001; Paul et al., 2000; Rieder et al., 2000; StuI fragment (nt 387Ð4644) of pAV-FL, an infectious Yang et al., 2002). The Aichi virus replicon, AV-FL-Luc, cDNA clone of Aichi virus (Sasaki et al., 2001), was sub- lacks the capsid-coding region except for the 21 nucleotides cloned into the EcoRI-SmaI sites of pUC118. Deletion of of the 5Ј- and 3Ј-terminal sequences of the VP0- and VP1- the P1 region (nt 1276Ð3771) was introduced into this coding regions, respectively (Fig. 2A). AV-FL-Luc repli- subclone by inverse PCR. The sequences of the primers cated efficiently (Figs. 2C and D), indicating that the se- used were as follows: Sac-3772 P, 5Ј-AAGAGCTCA- quence from nt 1276 to 3771 within the capsid-coding CAGTGGCCGTGATCAAGCA-3Ј; SacI site (underlined) region does not contain a cre. In Aichi virus, it would be and plus-strand sequence (nt 3772Ð3791), and Xba-1275 M, located in another region. 5Ј-TTCTAGAGATGTTGGTGACCGAGTTGCCT-3Ј; The mutC-3-Luc, mutC-6-Luc, mutC-9-Luc, and mutC- XbaI site (underlined) and minus-strand sequence (nt 1254Ð 11-Luc RNAs replicated with similar efficiency to the wild- 1275). The PCR product was self-ligated, and the nucleotide type (Figs. 5 and 6). However, mutC-3, mutC-6, mutC-9, sequence between the KpnI (nt 663) and BglII (nt 3914) and mutC-11 varied in the ability to produce viable viruses. sites of the derived clone was confirmed. The KpnI-BglII mutC-6 and mutC-11 produced viruses 10-fold more than fragment of pAV-FL was replaced with the KpnI-BglII the wild-type, while mutC-3 and mutC-9 did 200-fold less fragment with nt 1276Ð3771 deleted, generating pAV-FL (Table 1). This suggests role(s) of SL-C in some step(s) ⌬P1. This KpnI-BglII fragment with the deletion was li- besides RNA replication during virus infection. The pheno- gated into the KpnI-BglII sites of pAV-⌬5Ј (termed AV-1 in type of mutC-3 and mutC-9 seems to be similar to that of a the previous study) (Sasaki et al., 2001), which lacks the mutant, mut6, obtained in our previous study (Sasaki et al., 5Ј-end 32 nucleotides of the genome, pAV-⌬5Ј⌬P1 being 2001). In mut6, the seven-nucleotide stretches of the middle generated. part of SL-A were exchanged with each other to maintain A luciferase gene was amplified by PCR with the Xba- the base pairings of the stem. mut6 exhibited efficient RNA Luc P primer (5Ј-TCTAGAATGGAAGACGCCAAAAA- replication and translation, but formed no plaques (Sasaki et CATAAAG-3Ј; XbaI site is underlined) and SacI-Luc M al., 2001). We recently found that mut6 has a severe defect primer (5Ј-AGAGCTCCACGGCGATCTTTCCGCCCT- in RNA encapsidation (Sasaki and Taniguchi, 2003). It may TCT-3Ј; SacI site is underlined) using the pGL3-Control be possible that the mutations introduced into SL-C affected vector (Promega) as a template. The PCR product was the encapsidation efficiency and that, as a result, the mutants digested with XbaI and SacI and then ligated into the XbaI- showed various plaque-forming abilities. To investigate for- SacI sites of the pGEM-3Z vector (Promega), and the nu- S. Nagashima et al. / Virology 313 (2003) 56–65 63 cleotide sequence of the luciferase gene of the derived clone (SDS)Ð10% polyacrylamide gel electrophoresis. The pro- was confirmed. The luciferase gene was then cut out by teins were blotted onto a polyvinylidene difluoride (PVDF) digestion with XbaI and SacI from the clone and ligated into membrane, and biotin-labeled translation products were de- the XbaI-SacI sites of pAV-FL⌬P1 and pAV-⌬5Ј⌬P1, gen- tected using a BM chemiluminescence blotting kit (Biotin/ erating pAV-FL-Luc and pAV-⌬5Ј-Luc, respectively. Streptavidin) (Roche Molecular Biochemicals).

Site-directed mutagenesis In vitro transcription

An EcoRI fragment of pAV-FL, which contains the T7 pAV-FL and mutants were linearized by digestion with promoter sequence and the 5Ј-end 387 nucleotides of the HindIII and then transcribed with T7 RNA polymerase genome, was subcloned into pUC118, and various site- using a MEGAscript kit (Ambion). The integrity of the directed mutations were introduced into the subclone. PCR- synthesized RNAs was confirmed by agarose gel electro- based site-directed mutagenesis was carried out as described phoresis. The transcripts have two nonviral nucleotides previously (Sasaki et al., 2001). The primer pairs used for (GG) at the 5Ј end and a poly(A) tail of 40 bases, followed the construction of mutants and their sequences were as by three nucleotides, GCU at the 3Ј end (Sasaki et al., follows: mutB-1: primers A (5Ј CCCGGACCACCGT- 2001). TACTCCAT; plus sense) and B (5Ј ACCAGtggtggG- GAAAAGAGGGTGAGGGGGCCG; minus sense), mutB-2: Dot blot hybridization C(5Ј CCCGGtggtggGTTACTCCATTCAGCTTCTTCG; plus sense) and D (5Ј ACCAGACCACCGGAAAAGAGG; Dot blot hybridization was performed to investigate the minus sense), mutB-3: C and B, mutB-4: E (5Ј aaCGGAC- replication of replicon RNAs in Vero cells, as described CACCGTTACTCCATTCA; plus sense) and F (5Ј ttCA- previously (Sasaki et al., 2001). GACCACCGGAAAAGAGGGTG; minus sense), mutB-5: Titration of viable viruses generated from transcripts G(5Ј CCCGGgCCgCCGTTACTCCATTCAGCTTCT; plus sense) and D, mutC-1: H (5Ј CGGAACCTGTTCGGAG- Vero cells in a 35-mm dish were transfected with 1 ␮gof GAATT; plus sense) and I (5Ј AActtGCTGAATGGAGTA- in vitro transcripts using Lipofectamine plus reagent (Life ACGGTGGTC; minus sense), mutC-2: J (5Ј CGcttCCTGT- Technologies) according to the manufacturer’s recommen- TCGGAGGAATTAAACGG; plus sense) and K (5Ј dation. After incubation at 37¡C for 3 h, 1.5 ml of Eagle’s AAGAAGCTGAATGGAGTAACG; minus sense), mutC-3: J minimum essential medium containing 5% fetal calf serum and I, mutC-4: H and L (5Ј AAGAAGgacAATGGAGTA- was added to each dish, and then the cells were incubated ACGGTGGTCCGG; minus sense), mutC-5: M (5Ј CG- for 72 h. The cells were lysed by three consecutive freezeÐ GAACgacTTCGGAGGAATTAAACGGGCA; plus sense) thaw cycles, and the lysates were used for the plaque assay. and K, mutC-6: M and L, mutC-7: H and N (5Ј AA- The numbers and sizes of plaques were determined at 72 h GAAGCTGAATcctGTAACGGTGGTCCGGGACCAG; after infection. minus sense), mutC-8: O (5Ј CGGAACCTGTTCcctG- GAATTAAACGGGCACCCATA; plus sense) and K, Luciferase assay mutC-9: O and N, mutC-10: P (5Ј aaGAACCTGTTCG- Ј GAGGAATTAAA; plus sense) and Q (5 ttGAAGCT- Vero cells were transfected with 20 ␮g of replicon RNAs GAATGGAGTAACGGTG; minus sense), and mutC-11: R containing a luciferase gene by electroporation as described Ј (5 CGGAACCTGaatGGAGGAATTAAACGGGCACCC; previously (Sasaki et al., 2001) and cultured in six 35-mm plus sense) and K. In these sequences, mutated nucleotides dishes. At various times after electroporation, the cells in are indicated by lowercase letters. The nucleotide sequences each dish were lysed by the addition of 200 ␮l of cell- of the subclones into which mutations had been introduced culture lysis reagent (Promega). After cell debris had been were confirmed, and then the EcoRI fragments of these removed by centrifugation, 3 ␮l aliquots of the lysates were subclones were ligated into pAV-FL and pAV-FL-Luc from mixed with 100 ␮l of Luciferase assay reagent (Promega), which the EcoRI fragment had been removed, yielding and then luciferase activity was measured with a lumines- various mutant full-length cDNA clones and replicons. cence reader BLR-301 (Aloka Co., Ltd.) for 10 s after a 4-s delay. The assay was conducted within a linear range. Sim- In vitro translation ilar values of RLUs were obtained for each replicon in repeated experiments. In vitro translation of pAV-FL and mutants was carried out using a TNT quick-coupled transcription/translation system (Promega). Each plasmid (500 ng) was incubated in Acknowledgments a10␮l of reaction mixture containing biotinylated lysyl- tRNA (Promega) at 30¡C for 90 min. One microliter of the This work was supported in part by a grant from the reaction mixture was subjected to sodium dodecyl sulfate Human Science Research Foundation of Japan and a Grant- 64 S. Nagashima et al. / Virology 313 (2003) 56–65 in-Aid for Scientific Research from the Ministry of Educa- rus, aphthovirus and hepatitis A virus RNAs. Nucleic Acids Res. 21, tion, Science, and Culture, Tokyo, Japan. 2445Ð2451. Lee, Y.F., Nomoto, A., Detjen, B.M., Wimmer, E., 1977. A protein covalently linked to poliovirus genome RNA. Proc. Natl. Acad. Sci. USA 74, 59Ð63. References Lobert, P.-E., Escriou, N., Ruelle, J., Michiels, T., 1999. A coding RNA sequence acts as a replication signal in cardiovirus. Proc. Natl. Acad. Sci. USA 96, 11560Ð11565. Andino, R., Rieckhof, G.E., Achacoso, P.L., Baltimore, D., 1993. Polio- Lyons, T., Murray, K.E., Roberts, A.W., Barton, D.J., 2001. Poliovirus virus RNA synthesis utilizes an RNP complex formed around the 5Ј-terminal cloverleaf RNA is required in cis for VPg uridylylation and 5Ј-end of viral RNA. EMBO J. 12, 3587Ð3598. the initiation of negative-strand RNA synthesis. J. Virol. 75, 10696Ð Andino, R., Rieckhof, G.E., Baltimore, D., 1990. A functional ribonu- 10708. cleoprotein complex forms around the 5Ј end of poliovirus RNA. Cell Mason, P.W., Bezborodova, S.V., Henry, T.M., 2002. Identification and 63, 369Ð380. characterization of a cis-acting replication element (cre) adjacent to the Barclay, W., Li, Q., Hutchinson, G., Moon, D., Richardson, A., Percy, N., internal ribosome entry site of foot-and-mouth disease virus. J. Virol. Almond, J.W., Evans, D.J., 1998. Encapsidation studies of poliovirus 76, 9686Ð9694. subgenomic replicons. J. Gen. Virol. 79, 1725Ð1734. Mathews, D.H., Sabina, J., Zuker, M., Turner, D.H., 1999. Expanded Barton, D.J., O’Donnell, B.J., Flanegan, J.B., 2001. 5Ј cloverleaf in polio- sequence dependence of thermodynamic parameters improves predic- virus RNA is a cis-acting replication element required for negative- tion of RNA secondary structure. J. Mol. Biol. 288, 911Ð940. strand synthesis. EMBO J. 20, 1439Ð1448. McKnight, K.L., Lemon, S.M., 1996. Capsid coding sequence is required Brown, E.A., Day, S.P., Jansen, R.W., Lemon, S.M., 1991. The 5Ј non- for efficient replication of human rhinovirus 14 RNA. J. Virol. 70, translated region of hepatitis A virus RNA: secondary structure and 1941Ð1952. elements required for translation in vitro. J. Virol. 65, 5828Ð5838. McKnight, K.L., Lemon, S.M., 1998. The rhinovirus type 14 genome Duke, G.M., Hoffman, M.A., Palmenberg, A.C., 1992. Sequence and contains an internally located RNA structure that is required for viral structural elements that contribute to efficient encephalomyocarditis replication. RNA 4, 1569Ð1584. virus RNA translation. J. Virol. 66, 1602Ð1609. Parsley, T.B., Towner, J.S., Blyn, L.B., Ehrenfeld, E., Semler, B.L., 1997. Flanegan, J.B., Pettersson, R.F., Ambros, V., Hewlett, M.J., Baltimore, D., Poly (rC) binding protein 2 forms a ternary complex with the 5Ј- 1977. Covalent linkage of a protein to a defined nucleotide sequence at terminal sequences of poliovirus RNA and the viral 3CD proteinase. the 5Ј-terminus of virion and replicative intermediate RNAs of poliovirus. Proc. Natl. Acad. Sci. USA 74, 961Ð965. RNA 3, 1124Ð1134. Gamarnik, A.V., Andino, R., 1997. Two functional complexes formed by Paul, A.V., Rieder, E., Kim, D.W., van Boon, J.H., Wimmer, E., 2000. KH domain containing proteins with the 5Ј noncoding region of po- Identification of an RNA hairpin in poliovirus RNA that serves as the liovirus RNA. RNA 3, 882Ð892. primary template in the in vitro uridylylation of VPg. J. Virol. 74, Gamarnik, A.V., Andino, R., 1998. Switch from translation to RNA rep- 10359Ð10370. lication in a positive-stranded RNA virus. Genes Dev. 12, 2293Ð2304. Pelletier, J., Sonenberg, N., 1988. Internal initiation of translation of Gerber, K., Wimmer, E., Paul, A.V., 2001. Biochemical and genetic studies eukaryotic mRNA directed by a sequence derived from poliovirus of the initiation of human rhinovirus 2 RNA replication: identification RNA. Nature 334, 320Ð325. of a cis-replicating element in the coding sequence of 2Apro. J. Virol. Percy, N., Barclay, W.S., Sullivan, M., Almond, J.W., 1992. A poliovirus 75, 10979Ð10990. replicon containing the chloramphenicol acetyltransferase gene can be Ghazi, F., Hughes, P.J., Hyypia¬, T., Stanway, G., 1998. Molecular analysis used to study the replication and encapsidation of poliovirus RNA. of human parechovirus type 2 (formerly echovirus 23). J. Gen. Virol. J. Virol. 66, 5040Ð5046. 79, 2641Ð2650. Pringle, C.R., 1999. Virus taxonomy at the XIth international congress of Goodfellow, I., Chaudhry, Y., Richardson, A., Meredith, J., Almond, J.W., virology, Sydney, Australia, 1999. Arch. Virol. 144, 2065Ð2070. Barclay, W., Evans, D.J., 2000. Identification of a cis-acting replication Racaniello, V.R., 2001. Picornaviridae, in: Knipe, D.M., Howley, P.M., et element within the poliovirus coding region. J. Virol. 74, 4590Ð4600. al. (Eds.), Fields Virology, fourth ed. Lippincott Williams & Wilkins, Hellen, C.U.T., Sarnow, P., 2001. Internal ribosome entry sites in eukary- Philadelphia, pp. 685Ð722. otic mRNA molecules. Genes Dev. 15, 1593Ð1612. Rieder, E., Paul, A.V., Kim, D.W., van Boom, J.H., Wimmer, E., 2000. Herold, J., Andino, R., 2001. Poliovirus RNA replication requires genome Genetic and biochemical studies of poliovirus cis-acting replication circularization through a protein-protein bridge. Mol. Cell 7, 581Ð591. element cre in relation to VPg uridylylation. J. Virol. 74, 10371Ð10380. Hughes, P.J., Stanway, G., 2000. The 2A proteins of three diverse picor- Rivera, V.M., Welsh, J.D., Maizel Jr., J.V., 1988. Comparative sequence naviruses are related to each other and to the H-rev 107 family of analysis of the 5Ј noncoding region of the enteroviruses and rhinovi- proteins involved in the control of cell proliferation. J. Gen. Virol. 81, ruses. Virology 165, 42Ð50. 201Ð207. Rohll, J.B., Percy, N., Ley, R., Evans, D.J., Almond, J.W., Barclay, W.S., Jackson, R.J., Kaminski, A., 1995. Internal initiation of translation in 1994. The 5Ј-untranslated regions of picornavirus RNAs contain inde- eukaryotes: the picornavirus paradigm and beyond. RNA 1, 985Ð1000. pendent functional domains essential for RNA replication and transla- Jang, S.K., Kra¬usslich, H.-G., Nicklin, M.J.H., Duke, G.M., Palmenberg, tion. J. Virol. 68, 4384Ð4391. A.C., Wimmer, E., 1988. A segment of the 5Ј nontranslated region of Sasaki, J., Kusuhara, Y., Maeno, Y., Kobayashi, N., Yamashita, T., Sakae, encephalomyocarditis virus RNA directs internal entry of ribosomes K., Takeda, N., Taniguchi, K., 2001. Construction of an infectious during in vitro translation. J. Virol. 62, 2636Ð2643. cDNA clone of Aichi virus (a new member of the family Picornaviri- Kaplan, G., Racaniello, V.R., 1988. Construction and characterization of dae) and mutational analysis of a stem-loop structure at the 5Ј end of poliovirus subgenomic replicons. J. Virol. 62, 1687Ð1696. the genome. J. Virol. 75, 8021Ð8030. Kusov, Y.Y., Morace, G., Probst, C., Gauss-Mu¬ller, V., 1997. Interaction Sasaki, J., Taniguchi, K., 2003. The 5Ј-end sequence of the genome of of hepatitis A virus (HAV) precursor proteins 3AB and 3ABC with the Aichi virus, a picornavirus, contains an element critical for viral RNA 5Ј and 3Ј termini of the HAV RNA. Virus Res. 51, 151Ð157. encapsidation. J. Virol. 77, 3542Ð3548. Le, S.-Y., Chen, J.-H., Sonenberg, N., Maizel Jr., J.V., 1993. Conserved Skinner, M.A., Racaniello, V.R., Dunn, G., Cooper, J., Minor, P.D., Al- tertiary structural elements in the 5Ј nontranslated region of cardiovi- mond, J.W., 1989. New model for the secondary structure of the 5Ј S. Nagashima et al. / Virology 313 (2003) 56–65 65

non-coding RNA of poliovirus is supported by biochemical and genetic and genetic organization of Aichi virus, a distinct member of the data that also show that RNA secondary structure is important in Picornaviridae associated with acute gastroenteritis in humans. J. Vi- neurovirulence. J. Mol. Biol. 207, 379Ð392. rol. 72, 8408Ð8412. Summers, D.F., Maizel Jr., J.V., 1968. Evidence for large precursor pro- Yang, Y., Rijnbrand, R., McKnight, K.L., Wimmer, E., Paul, A., Martin, teins in poliovirus synthesis. Proc. Natl. Acad. Sci. USA 59, 966Ð971. A., Lemon, S.M., 2002. Sequence requirements for viral RNA repli- Yamashita, T., Kobayashi, S., Sakae, K., Nakata, S., Chiba, S., Ishihara, cation and VPg uridylylation directed by the internal cis-acting repli- Y., Isomura, S., 1991. Isolation of cytopathic small round viruses with cation element (cre) of human rhinovirus type 14. J. Virol. 76, 7485Ð BS-C-1 cells from patients with gastroenteritis. J. Infect. Dis. 164, 7494. 954Ð957. Zell, R., Sidigi, K., Henke, A., Schmidt-Brauns, J., Hoey, E., Martin, S., Yamashita, T., Sakae, K., Tsuzuki, H., Suzuki, Y., Ishikawa, N., Takeda, Stelzner, A., 1999. Functional features of the bovine enterovirus 5Ј- N., Miyamura, T., Yamazaki, S., 1998. Complete nucleotide sequence non-translated region. J. Gen. Virol. 80, 2299Ð2309.