MOLECULAR ANALYSIS OF PCP2/L7 3’UTR
AND ITS PUTATIVE BINDING PROTEINS: UNR AND VPS36
DISSERTATION
Presented in Partial Fulfillment of the Requirements for
the Degree Doctor of Philosophy in the Graduate
School of The Ohio State University
By
Rui Zhang, Bachelor of Medicine
* * * * *
The Ohio State University
2008
Dissertation Committee:
Dr. John Oberdick, Advisor Approved by
Dr. Anthony P. Young
Dr. Michael Xi Zhu
Dr. Mariano S. Viapiano Advisor Ohio State Biochemistry Program
ABSTRACT
Purkinje cell protein 2 (Pcp2 or L7) is highly expressed in cerebellar
Purkinje cells and functions as a modulator for G protein-mediated cell
signaling. Its mRNA is abundantly localized in the dendrites as well as in the
cell bodies. Although the dendritic localization of L7 mRNA has been found to
be developmentally regulated, the molecular mechanisms and biological
functions of the localization are still unknown. Here we present data to show the cis-acting sequences important for its localization in dendrites, and the proteins that recognize these sequences. First, we show that the L7 3’UTR is critical in the process of L7 mRNA localization in Purkinje cell dendrites.
Second, we have partially purified two 3’UTR-binding proteins from cerebellar extracts using FPLC and identified them by MALDI-MS. They are upstream of
N-ras (Unr) and vacuolar protein sorting 36 (Vps36). Unr is a cold-shock domain RNA-binding protein with multiple reported functions related to translational control and RNA stabilization. Vps36 is the mammalian homologue of yeast Vps36, a mediator of apical growth and endosome trafficking of receptors in yeast. An RNA binding function for this protein has
ii been reported in Drosophila. Using various RNA-protein binding assays, we
confirmed that Unr binds specifically to L7 3’UTR, while Vps36 binding to L7
3’UTR is inconclusive. As direct study in Purkinje cells is difficult due to the
lack of suitable cell culture models, we employed an inducible conditional
knockout strategy to study the functions of Unr and Vps36 in cerebellar
Purkinje cells. We have successfully obtained homologous recombination at
the ES cells level for Vps36. We have also generated an inducible cerebellar
Purkinje cell-specific CreERT2 transgenic mice. In vivo studies on molecular
mechanism of the Purkinje cell-specific expression of L7 has revealed that the 0.9 kb proximal L7 promoter and the structural gene both contribute to this process. Using a minimal promoter test, we found that multiple copies of
0.9 kb fragment can behave as a classical enhancer without the cooperation of the structural gene. However, the full function appears to be dependent on appropriate signals in the L7 structural gene.
iii
Dedicated to my parents, my grandma and my husband
iv ACKNOWLEDGMENTS
I would like to thank my advisor, Dr. John Oberdick, for his advice, patience and encouragement throughout the course of my graduate career. I cannot imagine how much he had to put up with me all these years. I really appreciate him for giving me the opportunity to be his student.
I would also like to thank my committee members Dr. Anthony Young,
Dr Mariano S. Viapiano and Dr. Mike Zhu for all their time and advice during my candidacy exam and my thesis preparation. I thank Dr. C. Glenn Lin who helped me during my candidacy exam.
I would like to acknowledge to Dr. Donald Dean and Dr. Ross Dalbey for giving me the opportunity to pursue my Ph.D. in The Ohio State
Biochemistry Program.
I thank The Ohio State Biochemistry Program, Department of
Neuroscience and Center for Molecular Neurobiology for the financial support during my graduate education.
I am very grateful to Dr. Mary Cheng, who has provided BAC clones and various constructs for knockout generation and showed me how to do
v Southern blot. It was because of her help that made the knockout project
possible.
I would like to express my thanks to the Transgenic Animal Facility,
Imaging Core and administrative staff in Rightmire Hall. Dr. Xin-an Pu has
contributed a lot to my transgenic studies. Paula Monsma has trained me
using the Confocal microscope and was always there for troubleshooting.
I thank past members of the Oberdick lab, Yelda Serinagaoglu, Peijun
Wu, Jamie Depelteau, and Nichole Gebhart for their assistance and great
discussion over the years.
I must thank members of Dr. Mike Zhu’s lab, Dr. Tony Brown’s lab, Dr.
Mariano Viapiano’s lab, Dr. Tsonwin Hai’s lab, Dr. Anthony Young’s lab and
Dr. Chen Gu’s lab for technical support, encouragement and friendship. I
would especially like to offer my sincere thanks to Dr. Niraj Trivedi for his
selfless help, grounded scientific knowledge and generous friendship.
Most of all I would like to thank my parents for their encouragement and endless love throughout my entire education. Mother, you were with me when I was happy or sad, you supported me in times good or bad. I can not thank you enough for what you have done. Finally, I would like to thank my
vi loving husband, who has always believed in me and been there for me. It was through his love and support that have made this all possible.
vii VITA
2002………………………...……….....Bachelor of Medicine
Shandong University, China
2002 - present...... ………….Graduate Research Associate,
The Ohio State University
PUBLICATIONS
1. Serinagaoglu, Y., Zhang, R., Zhang, Y., Zhang, L., Hartt, G., Young, A.P., Oberdick, J.(2007) A promoter element with enhancer properties, and the orphan nuclear receptor RORalpha, are required for Purkinje cell-specific expression of a G(i/o) modulator. Mol Cell Neurosci. 34, 324-42.
2. Zhang, R., Zhang, X., Bian., F. and Oberdick., J. (2008) 3’UTR-dependnet localization of a Purkinje cell mRNA in dendrites. The Cerebellum. In press.
3. Zhang, R., Zhang, X., Gebhart, N., Bian, F. and Oberdick, J. (2008) Vps36 and Csde1 (Unr): candidate 3'UTR binding proteins for dendritic localization and/or translation of a Purkinje cell mRNA. Submitted.
viii 4. Zhang, R and Oberdick, J (2008) Expression of novel mRNA binding proteins, Vps36 and Unr, in the brain and in primary neuronal cultures. In preparation.
5. Iscru, E. Serinagaoglu, Y., Schilling, K., Tian, J., Bowers-Kidder, S., Zhang, R., Morgan, J., DeVries, C., Nelson, R., Zhu, M., and Oberdick, J. (2008) Sensorimotor enhancement in mouse mutants lacking the Purkinje cell-specific Gi/o modulator, Pcp2(L7). Submitted.
FIELDS OF STUDY
Major Field: Ohio State Biochemistry Program
ix TABLE OF CONTENTS
Page
ABSTRACT...... ii
ACKNOWLEDGMENTS...... v
VITA...... viii
LIST OF TABLES...... xv
LIST OF FIGURES...... xvi
ABBREVIATIONS...... xix
CHAPTER 1
INTRODUCTION...... 1 1.1 CEREBELLUM...... 1 1.1.1 Structure of the cerebellum...... 2 1.1.2 Microcircuitry of the cerebellum...... 3 1.2 L7/Pcp-2 IS SPECIFICALLY EXPRESSED IN CEREBELLAR PURKINJE CELLS…………………………………………………………..…4 1.2.1 Discovery of L7 gene...... 4 1.2.2 There are two alternative L7 transcripts in the cerebellum...... 5 1.2.3 L7 mRNA dendritic localization is developmentally regulated…...... 6 1.2.4 Molecular mechanism of Purkinje cell specific L7 expression…...... 8 1.3 FUNCTION OF L7 PROTEIN……………..……..…………...………………9 1.3.1 Phenotype of L7 knockout (KO) mice…………………..…….....…….9 1.3.2 L7 protein interacts with Gαi and Gαo subunit of Heterotrimeric G protein and modulates voltage-dependent Ca2+ channels in a dose-dependent manner……….………………………...………….. 11 1.3.3 L7 in synaptic plasticity.………………………..…………..……….…15 1.4 mRNA DENDRITIC LOCALIZATION IN NEURONS...... 16 1.4.1 Presence of mRNAs in dendrites…………....……………………….19 1.4.2 Local protein synthesis machinery in dendrites…...….…………….21 x 1.4.3 Local protein synthesis in dendrites……..…………..……………….22 1.4.4. Targeting signals necessary for dendritic mRNA transport..……...21 1.5 PUTATIVE L7 3’UTR BINDING PROTEINS...... 25 1.5.1 Unr (upstream of N-ras)………………...…………………...………..25 1.5.2 Vps36 (vesicular protein sorting 36)………….………………...……27 1.6 CONDITIONAL KNOCKOUT………..………………………..…………….30 1.6.1 The Cre-loxP system……………….…………………..……………..30 1.6.2 Ligand-inducible Cre Recombinase: Cre-ERT and Cre-ERT2….…..32 1.7 OVERVIEW OF THESIS WORK………………………..……….……...... 33 CHAPTER 2
TRANSGENIC ANALYSIS OF CIS-ACTING ELEMENTS FOR L7
DENDRITIC LOCALIZATION…………...... 40 2.1 INTRODUCTION...... 40 2.2 MATERIALS AND METHODS...... 42 2.2.1 Mouse strains...... 42 2.2.2 Generation of transgenic mice…...... 42 2.2.3 Tail DNA preparation for analysis of transgenic mice...... 45 2.2.4 Genotyping...... 46 2.2.5 In situ hybridization……….…….…………………………………...... 46 2.3 RESULTS...... 50 2.3.1 The L7 3’UTR is necessary for dendritic localization…………..…..50 2.3.2 Species conservation of primary sequence and structure of the 3’UTR…………………………………………………………….…...... 56 2.4 DISCUSSION...... 58 CHAPTER 3
BIOCHEMICAL ANALYSIS OF L7 3’UTR AND ITS PUTATIVE BINDING
PROTEINS: UNR AND VPS36…………………………………………………71 3.1 INTRODUCTION...... 71 3.1.1 The sequence around poly(A) addition site in 3’ UTR acts as a cis-acting element which interacts with cerebellar proteins…..…...71 3.1.2 Several proteins are involved in RNA-protein complex……………73 xi 3.1.3 FPLC was used to partially purify the proteins that interact with oligo3……………………………………………………….………..….74 3.1.4 Two putative L7 3’-UTR binding proteins: Unr and Vps36…...…..75 3.1.5 Summary………………………………………….…..……….….76 3.2 MATERIALS AND METHODS...... 76 3.2.1 DNA Constructs...... 76 3.2.2 Expression of recombinant proteins in Escherichia Coli...... 76 3.2.3 Purification of His-tag recombinant proteins in Escherichia Coli....77 3.2.4 Hitrap Chelating column purification...... 79 3.2.5 Protein refolding…………………….……………………...... 79 3.2.6 Purification of IgG from polyclonal serum…………………...... 80 3.2.7 Antibody Affinity purification …………………...... 80 3.2.8 Preparation of cytoplasmic protein extracts from mammalian cell..81 3.2.9 Preparation of cytoplasmic extracts from mouse cerebellum …….82 3.2.10 Electrophoresis mobility shift assay (EMSA)……….…...………..83 3.2.11 UV crosslinking proteins to RNA……………………………..……84 3.2.12 Immunofluorescent labeling of floating tissue sections…………85 3.2.13 Coomassie Blue staining………………..………………………….85 3.2.14 Western Blotting……………………..………………………………86 3.2.15 Cell culture…………………………...……………………………….87 3.3 RESULTS...... 91 3.3.1 Confirmation of Unr and mVps36 binding specifically to L7 3’UTR……………………………………………………………………91 3.3.2 Expression of Vps36 and Unr in the adult mouse brain……..…....94 3.4 DISCUSSION…………………..…………………………………………….97 CHAPTER 4
GENERATION OF MICE WITH CONDITIONAL INACTIVATION OF UNR
AND VPS36 GENES…………………………………………………………...119 4.1 INTRODUCTION...... 119 4.2 MATERIALS AND METHODS...... 122 4.2.1 DNA constructs…………………………………………………...….122 4.2.2 Transgenic mice production………………………………………..125 4.2.3 TA cloning…………………………………………………………....126 4.2.4 Addition of 3´ A-overhangs post-amplification…………………126 xii 4.2.5 Site-directed mutagenesis………………………..………….…..…126 4.2.6 Genotyping………………………………..…………………….…....127 4.2.7 ES cell DNA extraction: tube method………………………………127 4.2.8 ES cell screening by PCR……………………………………..……128 4.2.9 ES cell culture and transfection………………………………...…..129 4.2.10 Southern blotting…………………………………………..……….130 4.2.11 Total RNA extraction……………………………………………....134 4.2.12 DNase treatment…………………………………………...………134 4.2.13 Reverse transcription…………………………………………..…..135 4.2.14 Real-Time PCR……………………………………………………..135 4.2.15 Tamoxifen treatment…………………….……………………...….136 4.2.16 Perfusion……………………………………………………..……..136 4.2.17 X-Gal staining…………………………………………………...….137 4.2.18 siRNA transfection in HEK 293 cells……………………………..138 4.3 RESULTS……………………………………………………………………139 4.3.1 Unr and Vps 36 targeting vector construction and homologous recombination…………………………………..……………………139 4.3.2 Generation and recombinase activity of L7P1-CreERT2 transgenic mice………...……………………………………………141 4.3.3 Generation and recombinase activity of L7P4-CreERT2 transgenic mice………………………………………..…………….143 4.3.4 Reduction of Unr and Vps36 expression by RNA Interference…145 4.4 DISCUSSION………………………..……………………………………..146 CHAPTER 5
ROLES OF L7 PROMOTER/ENHANCER AND 3’-END RNA PROSSING
SIGNAL IN CONTROL OF GENE EXPRESSION………………………..160 5.1 INTRODUCTION...... 160 5.2 MATERIALS AND METHODS...... 162 5.2.1 Mouse strains……………………………………..………..……162 5.2.2 Generation of transgenic mice………………………….…..…162 5.2.3 Perfusion………………………………..….....………………….164 5.2.4 X-Gal staining………………………………………..….……….165 5.3 RESULTS……………………………….………….……….………………166
xiii 5.4 DISCUSSION…………………...…………………….……………….…...167 BIBLIOGRAPHY...... 176
xiv LIST OF TABLES
Table Page
2.1 Morphological measures of transgenic cerebella…………………..…....61 2.2 Grain density over the Purkinje cell soma of highest expressing transgenic founders………………………..…………………..…...... 62 5.1 LacZ-reporter expression from 3XL7enhancer-minimal promoter construct……………..…………………………………….…………….…..172
xv LIST OF FIGURES
Figure Page
1.1 Schematic illustration of the neurons and circuits of the cerebellum…...33 1.2 Schematic illustration of L7 gene structure in rodents and human……...34 1.3 Diversity of G-protein-coupled receptor signaling……………………...…35 1.4 A proposed model for mRNA localization and translation in neuronal dendrites…………….....…………...... ………………..………..36 1.5 Sorting of endocytic cargo at early endosomes by Hrs-STAM and ESCRT complexes…………...….……………………………..…..……….37 1.6 Cre-LoxP system..…………………………………..……………………….38 2.1 Comparison of L7 and Calbindin mRNA distributions in P12 cerebellum……………………………………………………………………63 2.2 Schematic diagram shows the constructs and mRNAs that were used in the experiment.….……………………………………….…………………...64 2.3 Expression of the SV40-3’UTRswap transgene using in situ hybridization ……………………………………………….………………………………...65 2.4 Expression of L7-SV40 and hybrid 3’UTR constructs in P12 mouse cerebellum………..………………………………………………….………..66 2.5 Schematic diagram showing mRNAs produced by L7-PKC-I and L7-PKCI-SV40 constructs……………………………………………………67 2.6 Expression of L7-PKC-I and L7-PKCI-SV40 constructs in P12 mouse cerebellum…………………………………………………………………… 68 2.7 M-fold analysis of L7-3’UTR structure……………………..………………69 3.1 Binding to the L7-3’UTR is specific.………………………………………100
xvi 3.2 The poly(A) addition signal and flanking sequences are critical for binding………………………………………………………………………101 3.3 A multi-protein complex binds to the L7 3’UTR…………………….....…102 3.4 Flow-chart showing the scheme used to purify the 95kDa and 50kDa proteins…………………………..………………..…………..……………103 3.5 His-tag Vps36 expressed in E coli………..…………………….…………104 3.6 His-tag Unr expressed in E coli…………………………………………....105 3.7 RNA-protein binding analysis of Unr and Vps36 expressed in E coli….106 3.8 Confirmation of Unr participation in complex A in HEK 293 cell extract……………………..………………………………………………….107 3.9 Vps36 is not involved in RNA-protein complexes in HEK 293 cell extract…………..………………………………………………………….…108 3.10 Confirmation of Unr and Vps36 participation in RNA-protein binding complexes in cerebellar extract……………………………….…..…….109 3.11 In situ hybridization of Unr and Vps36 in mouse brain…….……….….111 3.12 In situ hybridization of Unr and Vps36 in rat cerebellum………………112 3.13 Expression of Vps36 and Unr proteins in cerebellar Purkinje cells…..113 3.14 Expression of Vps36 and Unr proteins in the mouse brain…..…….....115 3.15 Expression of Unr and Vps36 in cortical cultures………………………116 3.16 Unr is expressed in glial cells………………………………………….…117 3.17 Vps36 is expressed in glial cells………………………………..………..118 4.1 Cloning sites on the backbone vector pSPUC_LFneo(+)………………150 4.2 Genenration of targeted ES cells for Unr KO…………….…….………..151 4.3 Genenration of targeted ES cells for Vps36 KO…………………………152 4.4 Cre recombinase activity in the ES cells………………………………….153 xvii 4.5 Diagram of the tamoxifen-inducible expression system………………..154 4.6 Schematic representation of the L7P1-CreERT2 transgenic construct.155 4.7 Constitutive L7 Cre mediated gene recombination in the ROSA26 reporter mice…………...…..………………………………………..…….156 4.8 Actin-normalized relative expression levels of L&-CreERT2 mRNA determined by Real-Time PCR………………..…………………………..157 4.9 L7P4-CreERT2 (line 3) mediated gene recombination in the ROSA26 reporter mice…………………………………………………..…………….158 4.10 Characterization of siRNA directed against Unr and Vps36 in HEK 293 cells…………….………………………………………………………….....159 5.1 Schematic representation of LacZ construts which showed L7 3’-end processing signals are required for strong Purkinje cell expression.….173 5.2 Minimal promoter constructs for enhancer test in transgenic mice……174 5.3 Analysis of an enhancer construct………………………………………..175
xviii ABRREVIATIONS aa amino acid AMPA α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid APS ammonium persulphate ATP adenosine triphosphate Bgeo B-galactosidase-neomycine BGH bovine growth hormone bp base pair CaBP calbindin CaMKII Ca2+/calmodulin-dependent protein kinase II cDNA complementary deoxyribonucleic acid CF climbing fiber COUP-TF chicken ovalbumin upstream promoter-transcription factor CPE cytoplasmic polyadenylation element CPSF cleavage/polyadenylation specificity factor Cre cyclization recombination CS complex spike CSD cold shock domain DAG diacylglycerol ddH2O double distilled H2O DEPC diethylpyrocarbonate DMEM Dulbecco's Modified Eagle's Medium DNA deoxyribonucleic acid DNase deoxyribonuclease dsDNA double-stranded DNA DTA diphtheria toxin DTE dendritic targeting element DTT dithiothreitol EAP ELL associating protein EDTA ethylenediaminetetra-acetic acid eEF eukaryotic elongation factor EGFP enhanced green fluorescent protein EGTA ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′ tetraacetic acid EMSA electrophoresis mobility shift assay ER estrogen receptor
xix ES embryonic stem ESCRT endosomal sorting complex required for transport FBS fetal bovine serum Flox LoxP flanked FPLC fast protein liquid chromatography frt flp recognition target GABA γ-aminobutyric acid GDI guanine-nucleotide dissociation inhibitor GDP guanosine diphosphate GEF guanine nucleotide exchange factor GLUE GRAM-like ubiquitin-binding in Eap45 GoLoco Gαi/o-Loco GSH reduced glutathione GSSG oxidized glutathione GTP guanosine triphosphate HEK human embryonic kidney HEPES 4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid Hsp heat-shock promoter ip intraperitoneally IP3 inositol trisphosphate IPTG isopropyl β-D-thiogalactopyranoside IRES internal ribosome entry segment ISH in situ hybridization kb kilo bases KO knockout LB Luria-Bertani broth LBD ligand-binding domain Lc Lurche LacZ β-galactosidase LoxP locus of X-ing over LTD long-term depression MAP2 microtubule-associated protein 2 mGluR metabotropic glutamate receptor MVB multivesicular body NB neurobasal neo neomycin nt nucleotide OHT 4-hydroxytamoxifen
xx ORF open reading frame P postnatal PABA poly(A)-binding protein PBS phosphate buffered saline PBST phosphate buffered saline with Tween 20 PC Purkinje cell pcd Purkinje cell degeneration Pcp2 Purkinje cell protein 2 PCR polymerase chain reaction pcv packed cell volume PF parallel fiber PIP2 phosphatidylinositol bisphosphate PMSF phenylmethylsulphonyl fluoride Poly(A) polyadenosine PTB polypyrimidine tract-binding protein REM rough endoplasmic reticulum RNA ribonucleic acid RORα retinoic acid receptor-related orphan nuclear receptor-α ROSA reverse orientation splice acceptor RT reverse transcription/reverse transcriptase SDS sodium dodecyl sulphate SDS-PAGE sodium dodecyl sulphate polyacrylamide gel eletrophoresis SSC saline-sodium citrate SV 40 simian virus 40 TBE Tris/Borate/EDTA TCA trichloric acid TEA triethanolamine TEMED N,N,N',N'- tetramethylethylenediamine Tris tris(hydroxymethyl)aminomethane tRNA Transfer RNA Tween 20 polyxyethylenesorbitan Ub ubiquitin Unr upstream of N-ras UPS ubiquitin proteasome system UTR untranslated region UVX UV cross-linking VDCC voltage-dependent Ca2+ channels VP vasopressin
xxi Vps36 vacuolar protein sorting 36 v/v volume per volume w/v weight per volume wt wild type X-gal 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside
xxii
CHAPTER 1
INTRODUCTION
1.1 CEREBELLUM
The cerebellum, Latin for "little brain", is a portion of the hindbrain located below the cerebral hemispheres and behind the brain stem. It constitutes 10% of the size of the brain but contains half of all its neurons
(Kandel, 2000). Two key components of the cerebellum are established during cerebellar development: a highly uniform laminar arrangement of cells in the cerebellar cortex; and an equally uniform microcircuitry. These features make the cerebellum an ideal system in which to study mechanisms that are critical for the development of complex neuronal systems. The elaborate structural organization of the cerebellum has fascinated investigators for centuries. The first book devoted solely to the cerebellum was published in 1776 by M.V.G. Malacarne, and the principal cell type was named by Jan Purkyne in 1837. Our current knowledge suggests that the
1 cerebellum controls fine movement, equilibrium, posture, and motor learning
(DeZeeuw et al, 1998; Ivry et al., 2002; Konarski et al., 2005). More recent discoveries, however, also implicate the cerebellum's participation in nonmotor functions, such as cognition and higher-order executive and
visuospatial functions (Kim et al., 1997; Molinari and Leggio, 2007; Raymond
and Lisberger, 2000).
1.1.1 Structure of the cerebellum
The cerebellum is cytoarchitecturally uniform, like many other parts of
the brain. It contains outer cortex and white matter divisions. There are three
layers to the cerebellar cortex; from outer to inner layer, these are the
molecular, Purkinje, and granular layers (Figure 1.1A). The molecular layer
contains dendrites of Purkinje cells, axons of granule cells, basket cells and
stellate cells. Both stellate cells and basket cells are inhibitory interneurons
and form GABAergic synapses with Purkinje cell dendrites. Beneath this
layer is the Purkinje cell layer, which is formed by a single layer of Purkinje
cell bodies. Purkinje cells are the primary integrative neurons of the
cerebellar cortex. Their dendritic trees extend into the molecular layer. Their
axons run into the white matter providing the sole output of the cerebellar
cortex. The innermost granule cell layer contains the numerous and tiny
granule cells, and the larger Golgi cells. The granule cells are by far the
most numerous neurons in the brain. The granule cells send their T-shaped
axon, known as parallel fibers, up into the superficial molecular layer, where
2 they form hundreds of thousands of synapses with Purkinje cell dendrites.
Golgi cells provide inhibitory feedback to granule cells, forming a synapse with them and projecting an axon into the molecular layer. Embedded within the white matter are four deep cerebellar nuclei. These nuclei receive inhibitory inputs from Purkinje cells in the cerebellar cortex and excitatory inputs from mossy fiber pathways.
1.1.2 Microcircuitry of the cerebellum
The activity of the Purkinje neurons is affected by two excitatory afferent inputs coming from outside the cerebellum and by the cerebellar inhibitory interneurons (Figure 1.1B). The two excitatory inputs come from the climbing fibers arising from the inferior olive, and from mossy fibers, coming from nuclei in the brainstem and from neurons in the spinal cord.
Climbing fibers are fewer and most directly related to Purkinje cells. After sending excitatory collaterals to deep nuclei, the climbing fibers travel to the cortex, where they synapse on the dendrites of the Purkinje cells, which immediately fire their inhibitory messages to the deep nuclei. A single
Purkinje cell receives input from only one climbing fiber, but an individual climbing fiber can make synaptic contacts with 1-10 Purkinje cells. This important afferent system is known for the direct excitability of the Purkinje cells. Mossy fibers, like climbing fibers, branch to supply excitatory input to both the deep nuclei and the cortex. In the cortex, the information is relayed to the cortical layer by granule cells whose excitatory axons enter the outer
3 cortical layer and split, sending long axons (parallel fibers) in opposite directions. The parallel fiber excites a large strip of Purkinje cell dendrites.
Therefore each Purkinje cell receives input from thousands of parallel fibers.
The cerebellar cortex also has an elaborate series of inhibitory feedback circuits consisting of small cells, such as basket cells, Golgi cells, and spindle cells. These regulate the general excitability of the cortex and prevent it from a general cerebellar seizure state.
1.2 L7/Pcp-2 IS SPECIFICALLY EXPRESSED IN CEREBELLAR
PURKINJE CELLS
1.2.1 Discovery of L7 gene
The cerebellum serves as an ideal model for investigation of the nervous system because of its simple yet highly ordered structure (Altman et al., 1997). In an effort to discover cell-type specific genes which are important in regulating the development of cerebellum, one Purkinje cell specific gene, L7/Pcp2 (Purkinje cell protein-2), was identified by two labs
(Oberdick et al., 1988; Nordquist et al., 1988). By differential hybridization using wild type and Lurcher (Lc) cDNA probes, Oberdick et al. identified a
Purkinje cell specific clone L7. Nordquist and colleagues discovered a PCD5 clone by subtractive hybridization between wild type and Purkinje cell
degeneration (pcd) mice, and mapped this gene to mouse chromosome 8.
L7 gene has been shown to be expressed exclusively in cerebellar
Purkinje cells and retinal bipolar neurons (Oberdick et al., 1990; Vandaele et
4 al., 1991; Berrebi et al., 1991). L7 mRNA including the polyA tail was shown to be about 550-600 bp long by Northern blot and primer extension. The predicted open reading frame encodes a 99 amino acids protein with a molecular weight of 10.7 kDa. In the brain, cerebellar Purkinje cells are the only type of cell that has L7 expression. The exclusive expression of L7 mRNA in the cerebellum was confirmed by Northern blot. In situ hybridization showed that L7 mRNA is present in both cell body and dendrites of cerebellar Purkinje cells (Bian et al., 1996). The existence of L7 protein in Purkinje cells was confirmed by both immunohistochemistry and western blot. In fact, L7 protein is a major component in Purkinje cells due to the abundant expression level close to that of actin and tubulin (Oberdick et al., 1988).
1.2.2 There are two alternative L7 transcripts in the cerebellum
When the L7 gene was first discovered, it has been reported to
include four exons and three introns which is around 2 kb long (Nordquist et
al., 1988; Oberdick et al., 1988). These studies also suggested the
possibility of different forms of L7 mRNA at the 5’ end due to alternative
splicing. This hypothesis was confirmed by further studies using 5’ rapid
amplification of cDNA ends (5’ RACE). Two alternative forms of L7 mRNA,
L7A and L7B, were discovered in the mouse, rat and human cerebellum
(Zhang et al., 2002). The most remarkable difference of L7 gene structures
5 between rodents and human was found to be in the genomic configuration of
the first exon, while the rest of the structural genes were very similar.
As shown in Figure 1.2, in rodent sequences, exon 1A has no ATG
and initiates translation in exon 2. Exon 1B was found within the first intron
of the previously described L7A mRNA, and has its own start codon at the
very 3’ end. These two forms of L7 mRNA are translated into two isoforms of
L7 protein, L7A and L7B, with L7B carrying extra 21 amino acids at the N- terminus. L7A and L7B protein differ with respect to GoLoco domain which will be discussed in details in Chapter 1.3.2.
Human L7 also has two forms of L7 mRNA. Human L7A only has three exons. Exon 1A is composed of mouse exon 2 homologous region and a continuous upstream region of 119 bp. This region is highly homologous to the downstream part of mouse intron 1B. Human exon 1B is highly homologous to mouse exon 1B. In spite of the differences in the precise configuration of the first exons, the resulting L7A and L7B proteins are very similar in human and mouse.
1.2.3 L7 mRNA dendritic localization is developmentally regulated
One unique feature of L7 gene is that it mRNA is abundantly localized in Purkinje cell dendrites. L7 mRNA was first found to be localized in the cerebellar Purkinje cell dendrites by in situ hybridization in 1996 by Bian et al.
Later on when the two forms of L7 transcripts were discovered, subcellular localization of both forms was extensively studied (Zhang et al., 2002). Both
6 L7A and L7B mRNA were found in the cell body and dendrites of Purkinje
neurons. However the peak time of dendritic localization of these two forms
differs. At postnatal day 7 (P7), L7B is the predominant form while L7A is
hardly detectable. At P14, both forms are expressed at similar levels in the
Purkinje cell dendrites. By P21, L7A becomes more abundant than L7B. In adult mice, L7A and L7B are still present in the dendrites at an equivalent
level but much reduced than in postnatal stage. The distribution of L7 mRNA
in human cerebellum is also under developmental regulation, with the
highest levels in Purkinje cell dendrites right after birth and slowly switching in favor of the cell body after four years old (Zhang et al., 2002).
The hypothesis of dendritic RNA transport and local postsynaptic protein synthesis has been supported by increasing evidence in recent years.
This will be discussed in details in Chapter 1.4. In this section, it is worth mentioning that L7 mRNA dendritic localization is affected by its protein synthesis. Bian and colleagues showed that the dendritically localized L7 mRNA is sensitive to translational inhibition. Furthermore, in cultured
Purkinje neurons, it was revealed that L7 protein translation increases under depolarizing conditions where L7 mRNA dendritic translocation increases
(Wanner et al., 2000). In addition, this dendritic localization was later shown to be developmentally regulated following a time course that correlates with synaptogenesis (Zhang et al., 2002). The above evidence indicates that the activity-dependent local synthesis of L7 proteins may play a significant role in Purkinje cell synaptic plasticity.
7
1.2.4 Molecular mechanism of Purkinje cell specific L7 expression
Extensive studies on cis-acting elements and trans-acting factors
have been carried out to investigate the underlying molecular determinants
of Purkinje cell specific L7 expression in cerebellum. An 8 kb genomic clone
of L7 gene was identified from mouse (Oberdick et al., 1990). It is composed
of ~2 kb of L7 structural gene, 4 kb upstream of the transcription start site
and 2 kb downstream of the polyadenylation signal. It has been shown that
this 8 kb fragment can drive the Purkinje cell specific expression of a
reporter gene (Oberdick et al., 1990). In vivo studies trying to identify
minimal cis-acting sequences for L7 Purkinje cell specific expression have been focused on the L7 promoter region. Promoter truncation analysis in
transgenic mice indicated that a promoter fragment as short as 0.25 kb could
still drive Purkinje cell expression (Oberdick et al., 1993). However, promoter
fragments shorter than 1 kb drove non-uniform expression in adult
cerebellum. 1 kb and 4 kb promoter fragments could show an even
expression in adult cerebellum, which suggested that cis-acting sequences
required for a uniform expression of L7 gene in the cerebellum exist in the
distal part of the L7 promoter. Another study using transgenic mice approach
showed that the L7 0.9 kb proximal promoter enhancer in conjunction with a
2 kb structural gene fragments behave like a classic position-independent
enhancer that is specific for cerebellar Purkinje cells (Serinagaoglu et al.,
2007). In addition this enhancer activity can re-program or silence other
8 strong neuronal promoters in favor of Purkinje cell-specific expression and the distal half of the structural gene is necessary for the enhancement.
However, L7 structural gene carries repressive signals that inhibit the expression in the other part of the brain.
In vitro reporter gene assays have identified a few potential cis-acting elements that exist in L7 gene, including cAMP response element, AP-1 binding sites, Oct protein biding sites, E-box motif, chicken ovalbumin upstream promoter-transcription factor (COUP-TF), thyroid hormone response elements and retinoic acid receptor-related orphan nuclear receptor-α (RORα) (Vandaele et al., 1991; Oberdick et al., 1993; Zou et al.,
1994; Schrader et al., 1996; Anderson et al., 1997; Anderson et al., 1998).
Several transcription factors have also been suggested to regulate L7 gene
expression, including homeodomian proteins and POU domain transcription
factors and RORα (Sanlioglu et al., 1998; Serinagaoglu et al., 2007).
1.3 FUNCTION OF L7 PROTEIN
1.3.1 Phenotype of L7 knockout (KO) mice
L7 has a spatiotemporal expression pattern that coincides with the
development of Purkinje cells. This suggests a role for L7 in Purkinje cell
maturation or normal cell physiology. In order to elucidate the function of L7
in the cerebellar Purkinje cells in vivo, two separate groups have generated
constitutive L7 KO mice (Mohn et al., 1997; Vassileva et al., 1997).
9 Surprisingly, L7 KO mice did not show any significant difference when compared to their wild type littermates. L7 KO mice appeared normal at birth and developed through adulthood with similar body weight, brain weight and cerebellum weight to that of the wild type mice. L7 KO cerebellum has normal Purkinje cell numbers, morphology, and ultrastructure. Behavioral analysis reveals normal abilities for balance and coordination. For example,
L7 KO mice had no signs of ataxia and loss of balance that would indicate a cerebellar deficiency. The rotarod test was employed to determine whether
loss of L7 had resulted in some type of behavioral deficit too subtle to detect
by direct observation. However, no significant differences were found
between L7 KO and wild type mice. There are several possible explanations
for the observed phenotype of the L7 KO mice. One possibility is that L7
plays little role in the normal physiology of the mouse, and its function can
be compensated by other unknown factors. It is also possible that loss of L7
does result in behavioral deficits, but that these deficits are too subtle to
detect with the methods that have been utilized to date. These possibilities
have been clarified by extensive research on L7 KO mice in our lab
(unpublished observation, Iscru et al, submitted).
Significant anatomical, behavioral and electrophysiological changes
have been discovered in our lab using L7 KO mice (Iscru et al., submitted).
Anatomically, subtle cerebellar hypoplasia has been observed. The
molecular layer was thinner compared to the wild type and Purkinje cell body
size was reduced. Behaviorally, L7 KO mice have improved rate of gross
10 motor learning, increased maximal gross motor performance after training,
and increased rate of acquisition in tone-conditioned fear. In addition, L7 KO
mice also present sexually dimorphic sensorimotor changes, ranging from
increased acoustic to cutaneous sensory responsiveness. These changes
are due to cerebellar loss of L7 protein and not to sensory organ defects.
The above observations suggest a non-traditional role of cerebellum in
sensory responsiveness. Electrophysiologically, L7 KO Purkinje cells showed reduced number of spikelets in the complex spike indicating the
alterations in voltage-gated Ca2+ channel activities. The result is consistent
with our hypothesis that L7 is a modulator of P-type channels through which
it contributes to the firing properties and synaptic transmission of Purkinje
cells. The physiological function of L7 will be discussed in details in Chapter
1.3.2.
1.3.2 L7 protein interacts with Gαi and Gαo subunit of heterotrimeric G
proteins and modulates voltage-dependent Ca2+ channels in a dose-
dependent manner
1.3.2.1 Heterotrimeric G proteins
G proteins, short for guanine nucleotide-binding proteins, are a family
of proteins which mediate signal transduction through G-protein coupled
receptors and involved in second messenger cascades. Heterotrimeric G
proteins are large proteins made up of alpha (Gα), beta (Gβ), and gamma
(Gγ) subunits (Figure 1.3). In the inactive state, Gα-GDP forms a trimeric
11 protein with membrane bound Gβγ. When a ligand activates the GPCR, it induces a conformation change in the receptor that allows the receptor to
function as a guanine nucleotide exchange factor (GEF) that exchanges
GTP in place of GDP on the Gα subunit. This exchange triggers the dissociation of the Gα subunit, bound to GTP, from the Gβγ dimer and the receptor. Both Gα-GTP and Gβγ, can then activate different second messenger pathways and effector proteins, while the receptor is able to activate the next G protein. Eventually, the Gα subunit hydrolyzes the
attached GTP to GDP by its inherent enzymatic activity, allowing it to re-
associate with Gβγ dimer to form the inactive heterotrimeric G protein and
starting a new cycle. There are different types of Gα subunits, for example,
Gαs, Gαi, Gαq/11, and Gα12/13. These groups have a common mechanism of activation but differ primarily in second messenger recognition. As shown in
Figure 1.3 (Dorsam and Gutkind, 2007 review), while Gαs stimulates
adenylyl cyclase via increasing cAMP production, Gαi1-3 and Gαo inhibit adenylyl cyclase. Gαq/11 stimulates membrane-bound phospholipase C beta,
which then cleaves phosphatidylinositol bisphosphate (PIP2) into two
second messengers, inositol trisphosphate (IP3) and diacylglycerol (DAG).
Gα12/13 are involved in Rho family GTPase signaling and control cell
cytoskeleton remodeling, thus regulating cell migration. Gβγ sometimes also
have active functions, such as coupling to L-type calcium channels.
12 1.3.2.2 L7 protein modulates voltage-dependent Ca2+ channels via
interaction with Gαi and Gαo subunit
Ever since the first discovery of L7 gene, its function remained
unknown for many years. The first clue for the function of L7 protein came
from the discovery in 1999 by Luo and Denker that L7 interacts with αo and
αi2 subunits of heterotrimeric G protein by the yeast two-hybrid interaction screening. Studies later on showed that there are two isoforms of L7 protein which are produced by the usage of different transcriptional start positions
(Natochin et al., 2001; Zhang et al., 2002). L7 A (99 aa-long) and L7B (120 aa-long) proteins are GoLoco (or Gαi/o-Loco) domain-containing proteins
(Siderovski et al., 1999). L7A and L7B contain one and two GoLoco domains, respectively (Zhang et al., 2002). GoLoco domain was discovered by comparing mammalian RGS proteins to Drosophila Loco protein
(Granderath et al., 1999). It is a 19 amino acid-long motif with a consensus sequence of EELLEMLxxxQSxRMEEQR. It is through GoLoco domains that
L7 protein interacts with Gαi and Gαo subunits of heterotrimeric G proteins
(Kimple et al., 2002; Luo and Denker, 1999; Natochin et al., 2001). The
GoLoco domains act as guanine-nucleotide dissociation inhibitors (GDIs).
They interact with GDP bound Gαi/o, subunits and exclude Gβγ subunits
reassociation that restores the heterotrimeric state (Kimple et al., 2002). This
can also be interpreted that the association of GDP bound Gαi/o with Gβγ
prevent GoLoco motif binding. However, there has been some controversy
as whether GoLoco domain proteins or peptides can break apart a pre-
13 formed heterotrimeric G protein. Ghosh and colleagues recently showed that
a 20,000-fold molar excess of GoLoco peptide over hetertrimer can
accelerate spontaneous Gαi/o dissociation from Gβγ (Ghosh et al., 2003). In contrast, Webb et al (2005) reported that an excess of GoLoco motif peptide is unable to render spontaneous G-protein subunit dissociation in vivo.
Functional analysis of L7 on Gαi/o subunit revealed that L7 A played the role
of GDI by inhibiting GDP/GTP exchange of Gαi1 and Gαo (Kimple et al., 2002;
Natochin et al., 2001). Recently, L7B was identified to act as a GDI and only interact with Gαi1, but not any other Gα subunits (Willard et al., 2006). The
above discoveries give the clue that L7 protein may be involved in cell
signaling in cerebellar Purkinje cells.
Recently, an investigation of L7 protein physiological function in
Xenopus oocytes revealed that L7 can modulate G-protein-coupled receptor-
mediated inhibition of P/Q-type Ca2+ channels in a dose-dependent manner
(Kinoshita-Kawada et al., 2004). Voltage-dependent Ca2+ channels (VDCCs) are a group of voltage-gated ion channels found in excitable cells (e.g., muscle, glial cells, neurons, etc). In neurons, activation of particular VDCCs allows Ca2+ entry into the cell resulting in excitation of neurons and
subsequent up-regulation of gene expression, release of hormones or
neurotransmitters. In the cerebellar Purkinje cells, which is the sole site of L7
gene expression in the brain, P/Q-type Ca2+ channels account for more than
95% of the voltage-dependent Ca2+ channel activity (Llinas et al., 1989). The
VDCCs in Purkinje cells control the spontaneous firing properties of these
14 cells (Womack and Khodakhah, 2004). They are regulated by
neurotransmitters through G-protein-coupled receptors (Herlitze et al., 1996;
Kaneko et al., 1999). Both Gαi/o and Gβγ subunits contribute to this effect
2+ through direct binding to the pore forming Cav2.1(α1A) subunit of the Ca channel (Furukawa et al., 1998a; Furukawa et al., 1998b; Kinoshita et al.,
2001). As L7 interacts with Gαi/o, it is possible that L7 modulates P/Q-type
Ca2+ channels by which in turn regulate the physiological activity of the
Purkinje cells. The effect of L7A and L7B on the inhibition of P/Q-type Ca2+ channels via a Gi/o-coupled к-opiod receptor was examined in Xenopus oocytes. It was shown that at low concentrations of L7A and L7B, the receptor-mediated Cav2.1 channel inhibition was enhanced via the release
of the Gβγ subunit from the trimeric Gi/o. In contrast, the Gαi/o-mediated inhibition of Cav2.1 channel was antagonized by high concentrations of L7
proteins. However, how Purkinje cell function is affected by L7 through the
modulation of P/Q-type Ca2+ channels is a mystery. Currently it is still
unknown to what extent L7A and L7B differ in function. The study of L7 and
P/Q-type Ca2+ channels indicate that L7B is more effective at preventing but less effective at enhancing the Ca2+ channels inhibition than L7A. This could
be explained by the additional GoLoco domain in L7B it could provide a
stronger binding to Gαi/o, in terms of a higher affinity and/or more binding sites.
15 1.3.3 L7 in synaptic plasticity
The indication of its role in synaptic plasticity came from four
observations: L7 mRNA dendritic localization, the activity-dependent
synthesis of L7 proteins, dose-dependent modulation of the receptor-
mediated Cav2.1 channel and a sensorimotor damping function of L7 protein
(Bian et al., 1996; Wanner, et al., 2000; Kinoshita-Kawada et al., 2004). First,
studies have shown that the translocation of L7 mRNAs into distal dendrites
is developmentally regulated, and it is conserved in both mouse and human
(Wanner 1997; Zhang et al., 2002). Moreover, the dendritic distribution of L7
mRNA peaked during the early postnatal synaptogenic period (Zhang et al.,
2002). As L7B mRNA is localized in dendrites at an earlier time point than
L7A mRNA, it indicates that L7B protein might be required at an earlier
dendritogenesis stage while L7A is required later. Second, local synthesis of
L7 proteins was increased by membrane depolarization independent of
transcription (Wanner et al. 2000). The activity-dependent local translation of
L7 suggests that L7 may be critical for Purkinje cell development and
functional plasticity by either directly affecting local signal processing in a
long-lasting manner or indirectly assisting other key proteins synthesized in
the cell body to be transported to the stimulated sites.
One form of synaptic plasticity, long-term depression (LTD), has been
reported in many parts of the brain including the cerebellum. LTD is an
activity-dependent weakening of synaptic strength. Studies performed in a culture preparation of cerebellar Purkinje neurons have revealed an input-
16 specific late phase, requiring metabotropic glutamate receptor (mGluR) and
α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor
activation for induction, that is blocked by translation inhibitors, transcription
inhibitors, or somaticynuclear removal (Linen, 1996). In addition, local
postsynaptic mRNA translation has been found to be required for the
induction of mGluR-dependent LTD in the hippocampus (Huber et al., 2000).
Local protein synthesis-dependent LTD may suggest that a neuron can
selectively change the synaptic input to any one of its hundreds of dendrites
without changing others. The dendritic localization of L7 mRNA and the
activity-dependent synthesis of L7 proteins suggests that L7 may be critical
for cerebullar functional plasticity by directly affecting local signal processing
in a long-lasting manner. This possibility was supported by
electrophysiological studies on functions of L7 protein in our lab (Kinoshita-
Kawada et al., 2004; Iscru et al., submitted).
Extracellular recording of L7 KO Purkinje cell complex spikes (CS)
evoked by climbing fiber (CF) simulation showed reduced number of small
spikelets, which is indicative of voltage-gated Ca2+ channel activity (Iscru et al., submitted). What does the decreased CS spikelet number mean in terms of L7 function in Purkinje cell synaptic plasticity? One form of synaptic plasticity, LTD, has been reported at the climbing fiber-Purkinje cell (CF-PC)
synapses (Weber et al., 2003). It appears as a reduction in both slow
components of the CS waveform and CF-evoked dendritic Ca2+ transients
(Weber et al., 2003). Although it is not clear what channel is responsible for
17 the CS, a possible type is the P/Q-type Ca2+ channel. The decreased spikelet number is also consistent with the increased inhibition of the P/Q- type Ca2+ channel that would be predicted in the absence of the G protein coupled receptor uncoupling function of L7 protein (Kinoshita-Kawada et al.,
2004). Therefore, it is possible that L7 protein is involved in the expression of synaptic plasticity, which in turn alters the extent of receptor-mediated inhibition of P-type Ca2+ channel and hence the intrinsic electrophysiology of
Purkinje cells.
Another evidence for L7 involvement in synaptic plasticity came from the affected motor learning in L7 KO mice. The most surprising behavioral changes observed in L7 KO mice are enhancements, including improved gross motor learning and an increased initial rate of association between a conditioned stimulus and an unconditioned stimulus (Iscru et al., submitted).
As L7 plays a role in motor learning, it will be important to examine LTD of synaptic transmission at parallel fiber-Purkinje cell (PF-PC) synapses, which is thought to be a cellular substrate of motor learning in the cerebellum
(Crepel et al., 1996). However, the key question is why would nature have designed a protein whose function was to slow down learning and decrease sensory responsiveness? Further tests will need to be conducted in order to resolve these issues.
18 1.4 mRNA DENDRITIC LOCALIZATION IN NEURONS
Targeting of mRNAs to distinct subcellular regions occurs in all
polarized cells. In particular, neurons are polarized cells in which dendrites
receive signals from presynaptic neurons. Upon stimulation, the dendrite
processes the information such that an immediate dendritic response is
generated as well as a longer-term somatic response. The integrated cellular response results in a signal that can be propagated through the axon to the next post-synaptic neuron. Extensive studies have shown that mRNAs can be localized in dendrites and that local protein synthesis in dendrites can occur.
1.4.1 Presence of mRNAs in dendrites
The first indication that mRNAs are present in dendrites came from
electron microscopic studies in which ribosomes were found in CNS
dendrites (Peters et al., 1970). In dentate granule cells of the hippocampus, polyribosomes were found to be preferentially located at the base of dendritic spines (Steward et al., 1982). Later, poly(A)+ mRNAs were
detected in the dendrites of cultured neurons by in situ hybridization
(Bruckenstein et al., 1990; Kleiman et al., 1993) and a more detailed
untrastructural study showed poly(A)+ mRNAs at the base of dendritic
spines and near synaptic sites (Martone et al., 1996). We now know that an
estimated number of at least 400 different mRNA species are presumably
sorted to dendrites in their own specific manners (Eberwine et al., 2002).
19 These have been determined using a variety of approaches including in situ
hybridization, microarray analysis, RT-PCR, synaptoneurosome enriched mRNA isolation and mRNA translation.
Apart from BC1 RNA, a non-coding RNA polymerase III transcript
(Tiedge et al., 1991), most of the RNA present in dendrites of neurons are mRNAs (Eberwine et al., 2002). BC1 RNA is present in different types of neurons both in the rat central nervous system and in primary cultured neurons. The mRNA encoding the microtubule-associated protein 2 (MAP-2) and the α-subunit of calcium/calmodulin-dependent kinase II (CaMKIIα), for example, were first found to be localized in dendrites of tissue sections, which were subsequently confirmed in cultured neurons (Bruckenstein et al.,
1990; Steward, 1995). Now we know that different classes of mRNAs can be targeted to dendrites. These dendritically localized mRNAs encode proteins that fall into various functional classes. Among the mRNAs that are targeted to dendrites are those that encode proteins involved in dendritic outgrowth and remodeling (actin [Kleiman et al., 1994], Tubulin [Kleiman et al., 1994],
Map-2 [Garner et al., 1988], nestin [Crino and Eberwine, 1996]); integral membrane proteins (e.g. glutamate receptors [Miyashiro et al., 1994] and
GABA receptors [Sperk et al., 1998; Job and Eberwine, 2001]); peptide hormones (vasopression and oxytocin [Mohr and Richter, 1995]) and transcription factors (CREB [Crino et al., 1998]). The presence of these mRNAs in dendrites suggests that multiple signaling pathways are modulated through selective dendritic protein synthesis.
20
1.4.2 Local protein synthesis machinery in dendrites
The presence and targeting of mRNAs into the dendrite suggests that
these RNAs serve a functional role at this subcellular site. The most obvious
hypothesis is that these mRNAs are translated in dendrites in response to
various stimulations. It has been suggested in original work of Bodian that
ribosomes exist in dendrites and it was he who first proposed that dendritic
protein synthesis could occur (Bodian, 1965). In addition, several years
before mRNAs have been identified to be present in dendrites, the capacity
of dendrites for local protein synthesis has been suggested by the detection of protein translation machinery using ultrastructural analysis (Steward and
Levy, 1982; Steward and Reeves, 1988). The existence of ribosomes in dendrites has been followed by more extensive studies aiming at characterizing various components of the translational machinery in
dendrites of neurons. A detailed immunohistrochemical study with antibodies directed against a ribosomal protein confirmed the presence of ribosomes in dendrites (Tiedge and Brosius, 1996). Moreover, arginyl-tRNA synthetase, eukaryotic initiation factor (eIF) 2 and eukaryotic elongation factor (eEF) 2 have also been observed in dendrites by specific antisera. Several studies have also shown the presence of rough endoplasmic reticulum (REM) and
Golgi apparatus (Steward and Falk, 1985; Tiedge and Brosius, 1996; Torre and Steward, 1996) within dendrites.
21 1.4.3 Local protein synthesis in dendrites
Using single cell and single dendrite mRNA transfection assays, dendrites have proven to be capable of translating exogenous mRNAs into proteins (Crino and Eberwine, 1996; Job and Eberwine, 2001). This assay has furthermore, shown that both cytoplasmic and membrane bound proteins can be translated in this subcellular compartment and also that new dendritically synthesized receptors can be directly inserted into membranes in isolated dendrites (Kacharmina et al., 2000). Local protein synthesis in dendrites has been reported by a transgenic mouse approach using a reporter gene attached to the CaMKIIα promoter (Mayford et al., 1996). The local synthesis of proteins in dendritic sites has been hypothesized to be involved in various physiological phenomena including synaptic plasticity, development and learning and memory. It has been suggested that dendritic protein synthesis is important for regulation of local dendritic functioning, signaling between dendrites and the cognate cell soma and perhaps in regulating intercellular communication. There is much work remaining to establish the multiple roles that local protein synthesis likely plays in regulating CNS physiology.
1.4.4. Targeting signals necessary for dendritic mRNA transport
A model for mRNA transport and localization in neurons is shown in
Figure 1.4 (Bramham and Wells, 2007). Upon synaptic activation, targeting sequences on a specific mRNA in the nucleus is recognized by certain RNA-
22 binding proteins, which are capable of silencing translation. The inhibited
mRNA is packaged into transport granules that are transported into
dendrites by motor protein along microtubules. In the dendrites, the mRNAs
can be locally translated for neuronal function.
1.4.4.1 cis-acting elements
The majority of localization signals have been found within 3’UTRs.
For example, a recent study introducing CaMKIIα constructs into transgenic mice has discovered the involvement of the 3’UTR in dendritic mRNA transport. Transgenic lines lacking these sequences fail to sort the reporter mRNA to dendrites (Mayford et al., 1996). In 1999, Blichenberg et al showed that the 3’UTR of MAP2 mRNA could relocalize enhanced green fluorescent protein (EGFP) to dendrites of cultured superior cervical ganglion neurons.
Many localization signals on other mRNA 3’UTRs have also been identified, including those in bicoid mRNA in Drosophila embryos (Macdonald and
Struhl, 1988), Vg1 mRNA in Xenopus oocytes (Mowry and Melton, 1992) and β-actin mRNA in fibroblasts (Kislauskis et al., 1994). The general idea that dendritic localization elements reside in the 3’UTRs, however has been challenged. There are examples in Drosophila and yeast of mRNAs with
localization signal in the 5’UTR, or even in the coding region (Jansen, 2001
review). The targeting signal of the vasopressin (VP) mRNA is composed of
sequences within the coding region in addition to the 3’UTR (Prakash et al.,
1997). There are also evidences showing the secondary and tertiary
structures of mRNA involvement of localization (Jansen, 2001 review).
23 1.4.4.2 trans-acting factors
RNA-protein interactions specify the correct subcellular mRNA
distribution patterns in neurons. Trans-acting factors are proteins that can interact directly or indirectly with those localization sequences within the
mRNAs to be transported. These trans-acting proteins are hypothesized to
transport the RNAs, anchor them and control their expression and stability
(Kindler and Monshausen, 2002).
A growing number of RNA-binding proteins have been identified
which contain distinct RNA-binding and protein-protein interaction domains.
RNA-binding proteins not only mediate mRNA translocation, but also are
involved in translation and mRNA stability regulation. Trans-acting factors
can bind RNA in a sequence-independent manner, such as Staufen. It is a
double-stranded RNA-binding protein that was found to be required for
Drosophila bicoid and oskar mRNA localization (Kindler and Monshausen,
2002). In rat hippocampal neurons, Staufen has been colocalized with mRNA targeting complexes that move along microtubules in dendrites
(Köhrmann et al., 1999). Some other RNA-binding proteins interact specifically with a cis-acting factor of one dendritic mRNA. For example, by
UV-crosslinking analysis, poly(A)-binding protein (PABP) was shown to specifically interact with the dendritic localizer sequences of VP mRNA
(Prakash, et al., 1997). Two MAP2-RNA trans-acting proteins, MARTA1 and
MARTA2, specifically bind to the dendritic targeting element (DTE) within
24 MAP2 3’UTR (Rehbein et al., 2001). Although there is a growing group of
RNA-binding proteins that are involved in extrasomatic mRNA localization,
the current studies suggest that they regulate targeting and translation of
particular transcripts by different pathways.
1.5 PUTATIVE L7 3’UTR BINDING PROTEINS
A previous study in our lab has identified two candidate L7 3’UTR-
binding proteins from cerebellar extracts using FPLC and identified them by
MALDI-MS (Xulun Zhang, 2001). They are Unr and Vps36.
1.5.1 Unr (upstream of N-ras)
One of the RNA-binding proteins we identified that specifically interact with the L7 3’-UTR is Unr. The Unr gene was identified as a transcription unit located immediately upstream of N-ras in the genome of several mammalian species: guinea pig (Doniger and DiPaolo, 1988), rat (Jeffers et al., 1990), mouse and human (Nicolaiew et al., 1991). The homozygous Unr knockout is embryonic lethal in mice, but only at around 10 days (Boussadia et al.,
1997). It suggests that the Unr gene is not essential for general cell viability and cell division, but must be essential for certain stages in differentiation.
Unr gene has three different forms of transcripts created through the
differential use of polyadenylation sites located in the 3’ UTR. It has been
shown to be ubiquitously expressed in various tissues in mouse and human
25 and high level Unr transcripts were detected in the brain (Jeffers et al., 1990;
Nicolaiew et al., 1991). Research in our lab (Zhang et al., submitted) has shown that Unr mRNA is ubiquitously expressed in mouse brain and especially enriched in the adult hippocampus and cerebellum. In the cerebellum, it was detected in Purkinje cells and granule cells and immunohistochemistry studies found that Unr protein is expressed at high levels in cerebellar granule cells and Purkinje cells. In the latter cells, it was found primarily in the cell body, proximal dendrites, and axons, but only weakly detectable in the distal dendrites (see chapter 3).
Unr protein contains five cold shock domain (CSD), which is a single- stranded nucleic acid binding domain (Jacquemin-Sablon et al., 1994). By an in vitro selection approach (SELEX), it has been found to be a single strand RNA-binding protein which binds preferentially to purine-rich RNA sequences (Triqueneaux et al., 1999). Two 11-14 nt long consensus sequences were characterized by a conserved core motif AAGUA/G or
AACG downstream of a purine stretch. Unr is an essential protein important for translational control and mRNA decay. Unr has been found to be required for internal ribosome entry segment (IRES)-dependent translation in both viral and cellular RNAs (Martinez-Salas et al., 2001). Internal initiation of translation seems to facilitate the translation under conditions that are less efficient for cap-dependent mechanism, for example conditions of amino acid starvation, cell death, hypoxia and heat shock (Cornelis et al., 2005). It has been shown that Unr, together with the other proteins in a RNA binding
26 complex, is involved in determining mRNA stability (Chang et al., 2004;
Dinur et al., 2005). In mammalian neuronal-derived cells, Unr protein
functions as a RNA chaperone to permit translation initiation (Mitchell et al.,
2003). Interestingly a recent study has shown that in Drosophila, dUNR is
involved in modulating translation of msl-2 mRNA by binding to its 3’-UTR
sequences. In conclusion, Unr is an essential protein important for
translational control and mRNA decay.
1.5.2 Vps36 (vesicular protein sorting 36)
1.5.2.1 Endosomal sorting complexes required for transport (ESCRT)
complexes
The other potential L7 3’-UTR binding protein is the mammalian
homologue of yeast Vps36. The yeast Vps36 associates with Vps22 and
Vps25 to form a protein complex called endosomal sorting complexes
required for transport II (ESCRT-II). The human and rat homologues of
ESCRT-II were originally identified as the ELL Associating Protein (EAP)
complex associated with the RNA polymerase II elongation factor ELL in the nucleus (Schmidt et al., 1999; Kamura et al., 2001).The class E Vps protein complexes are sequencially recruited to endosomal membranes, where they help sorting of ubiquitinated proteins into the multivesicular body (MVB)
pathway (Katzmann et al., 2001). Ubiquitinated proteins are first recognized
27 by Vps27, and are then transferred to ESCRT-I (Vps2, Vps28 and Vps37)
(Katzmann et al., 2003). ESCRT-I is then thought to activate functions of
ESCRT-II (Vps22, Vps25 and Vps36) in the recruitment and assembly of small coiled-coil proteins (Vps2, Vps20, Vps24 and Vps32) to form ESCRT-
III, which ultimately results in the sorting of the cargo molecules to form MVB
(Babst et al., 2002).
1.5.2.2 Function of Vps36 protein
Mammalian Vps36 homolog, Eap45, was discovered to bind ubiquitin via a phosphoinositide-interacting GLUE (GRAM-like ubiquitin-binding in
Eap45) domain (Slagsvold et al., 2005). Mutations of Vps36 in yeast results in aberrations in bud growth during the apical growth phase. In another study
Vps36 was found to mediate pheromone signaling via a G-protein-coupled pathway (Burchett et al., 2002). Therefore, it is possible that the role of
Vps36 in endosome trafficking is related to cellular polarization. Recent studies in two diverse systems (Drosophila oogenesis and retrovirus infected cells) have pointed to a role for recycling endosomal vesicles in RNA transport and/or anchoring (Cohen, 2005). Vps36 was first reported to be an
RNA-binding protein by Irion and Johnston. By UV-crosslinking study in vitro, they have discovered that Drosophila Vps36 binds specifically and directly to the bicoid 3’-UTR via its amino-terminal GLUE domain. In vivo, mutants in all subunits of the ESCRT-II complex (Vps22, Vps25 and Vps36) abolished the final Staufen-dependent bicoid mRNA localization to the anterior of the
28 oocyte. This is the first study of the ESCRT-II complex as an RNA-binding complex. However, whether mVps36 and ESCRT-II complex play any role in
mRNA trafficking in neurons remains unknown.
1.5.2.3 Monoubiquitination and the endocytic pathway
Ubiquitin proteasome system (UPS) has been identified to play a key
role in neuronal biology (Yi and Ehlers, 2007). The UPS is involved in
neuronal growth and development, synaptic formation and plasticity (Patrick,
2006). Many neurodegenerative diseases have been revealed to be related
to UPS as well, including Alzheimer’s disease and Parkinson’s disease
(Lowe et al., 1988a). These observations have stimulated interest in understanding the molecular mechanism of UPS in neuronal function. A
complex network of endosomes inside cells coordinates vesicular transport
between membranous structures such as plasma membrane and lysosomes.
Many UPS genes are involved in endosomal sorting primarily in the
endocytosis of transmembrance proteins and sorting of internalized cargo,
including ion channels, G protein-coupled receptors and tyrosine kinases.
Many recent studies have shown that ubiquitination of receptors triggers
endocytosis and can be used to sort out receptors for degradation or
recycling (Figure 1.5). In this figure, internalized receptors that are
ubiquitinated are sorted in the early endosome, where their ubiquitin (Ub)
signal is recognized by Hrs-STAM or ESCRT complexes. Receptors found in
these domains are sorted for the late endosome/lysosome pathway, where
29 they are degraded. As ESCRT I, II and III are complexes interacting with
ubiquitin and associating with endosomal sorting, it is feasible that ESCRT
complexes play an important role in neuronal function.
1.6 CONDITIONAL KNOCKOUT
As described in detail in Chapter 3, Unr and Vps36 are two candidate
L7 3’UTR-binding proteins. However, functions of these two proteins in
neurons are still a mystery. In order to investigate whether these two
proteins are involved in L7 mRNA dendritic localization and Purkinje cell
development, we decided to knock down the Unr and Vps36 gene expression in vivo. As direct study in Purkinje cells is difficult due to the lack of suitable cell culture models, we employed an inducible conditional knockout strategy to avoid any developmental defects that might be caused by deletion of Unr and Vps36. The generation of Unr and Vps36 conditional knockout constructs will be discussed in Chapter 4. In this section, I give a brief overview of Cre-LoxP system and ligand-Inducible Cre Recombinase.
1.6.1 The Cre-LoxP system
The Cre-LoxP system is a genetic technology which gives the possibility for conditional mutagenesis of a gene of interest (Nagy, 2000).
This means, that the gene of interest gets inactivated not only under certain circumstances but also in defined tissues of the mouse. It facilitates studies of gene function and the generation of animal models for human disease.
30 The Cre-LoxP-system was first described in bacteriophages and consists of two components (Gu et al., 1994): a sequence-specific Cre
(cyclization recombination) recombinase and a DNA sequence flanked by
LoxP (locus of X-ing over) sites. A LoxP site consists of two 13 bp inverted repeats separated by an 8 bp asymmetric spacer region (Figure 1.6A). The
Cre recombinase, a 38 kDa recombinase protein from bacteriophage P1, mediates site specific recombination between LoxP sites. If both LoxP-sites have the same orientation, the LoxP-flanked DNA will be excised and thereby eliminated. There are no metabolic compounds or cofactors necessary to catalyze this reaction. This system also works in E.coli, yeast, plants and more complex organisms. In mice, spatially or temporally controlled somatic mutations can be obtained by placing the Cre gene under the control of either a cell-specific or an inducible promoter, respectively.
In addition to being used to inactivate gene expression in a tissue- specific fashion, recombinases can also be used to activate gene expression.
In this case, a reporter gene or stop codons are flanked by recombinase recognition sites and inserted between a promoter and the coding region of the gene to be activated. The gene to be activated can be endogenous or a transgene expressed under the control of a ubiquitous promoter. Expression of the recombinase excises the stop codons of the reporter gene and allows transcription of the gene of interest (Soriano P, 1999).
31 1.6.2 Ligand-Inducible Cre Recombinase: Cre-ERT and Cre-ERT2
To obtain a spatio-temporal control of floxed DNA excision, Cre
recombinase activity has been regulated in a ligand-dependent manner in
the adult animals. In this approach, a tamoxifen-dependent Cre recombinase
was generated by the fusion of Cre to the mutated ligand-binding domain
(LBD) of the human estrogen receptor (Cre-ERT) (Feil et al., 1996). The
mutated LBD (Gly521Arg) of the human ER binds only the synthetic ligands
tamoxifen and 4-hydroxytamoxifen (OHT) achieving tight control of Cre
recombinase activity in the presence of endogenous estradiol. The mutated
LBD retains the fusion protein Cre-ERT in the cytoplasm and upon binding of
tamoxifen it translocates into the nucleus, where it mediates the excision of
the LoxP-flanked DNA sequence.
Although short-term tamoxifen treatments cause no severe
abnormalities in mice (Furr et al., 1984), possible undesired tamoxifen-
induced side effects can still be avoided by introducing a triple mutation in
the human ER LBD (Feil et al., 1997). The Cre-ERT2 mutant containing the
G400V/M543A/L540A triple mutation was about 4-fold more sensitive in F9
cells to OHT than that of Cre-ERT. It has been shown in vitro and in vivo that the CreERT2 is the most potent Cre fusion protein with low leakiness and
highly efficient induction (Feil et al., 1997; Indra et al., 1999). The CreERT2
fusion protein has been successfully expressed in peripheral tissues (Kim et
al., 2004; Yajima at al., 2006) and in the nervous system in astrocytes
32 (Hirrlinger et al., 2006), oligodendrocytes and Schwann cells (Leoneo et al.,
2003) and neural stem cells (Imayoshi et al., 2006).
1.7 OVERVIEW OF THESIS WORK
In the next five chapters, research focused on three major areas will be present: 1) Transgenic analysis of role for L7 3’UTR in L7 mRNA dendritic localization in Purkinje neurons. 2) Characterization of two putative
L7 3’UTR binding proteins, Unr and Vps36 and progress on generating KO mice. 3) Analysis of L7 gene specific expression in Purkinje cells.
33
Figure 1.1 Schematic illustration of the neurons and circuits of the cerebellum. (Adapted from “Neuroscience “, edited by Dale Purves et al. 2nd edition). (A) Neuronal types in the cerebellar cortex. B) Diagram showing convergent inputs onto the Purkinje cell from parallel fibers and local circuit neurons.
34
Figure 1.2 Schematic illustration of L7 gene structure in rodents and human. (adapted from Serinagaoglu, 2007).
35
Figure 1.3 Diversity of G-protein-coupled receptor signaling. (Adapted from Dorsam and Gutkind., 2007)
36
Figure 1.4 A proposed model for mRNA localization and translation in neuronal dendrites. (Adapted from Bramham and Wells, 2007).
37
Figure 1.5 Sorting of endocytic cargo at early endosomes by Hrs-STAM and ESCRT complexes. (Adapted from Yi and Ehlers, 2007). Internalized receptors that are ubiquitinated (in red) are sorted in the early endosome, where their ubiquitin (Ub) signal is recognized by Hrs-STAM or ESCRT complexes. Receptors found in these domains are sorted for the late endosome/lysosome pathway, where they are degraded. In contrast, receptors that do not contain a ubiquitin signal (blue) are sorted to recycling endosomes, from where they are reinserted back into the plasma membrane.
38
Figure 1.6 Cre-LoxP system. A) LoxP site sequence. B) (Adapted from Metzger and Chambon, 2001) Schematic representation of ligand-activated LoxP-specific Cre recombination.
39
CHAPTER 2
TRANSGENIC ANALYSIS OF CIS-ACTING ELEMENTS
FOR L7 DENDRITIC LOCALIZATION1
2.1 INTRODUCTION
Protein synthesis in neuronal dendrites is a likely mechanism for synaptogenesis and neural plasticity expression (Kang and Schuman, 1996;
Steward et al., 1998; Scheetz et al., 2000; Tiruchinapalli et al., 2003; for reviews see Steward and Schuman, 2001 or Wells et al., 2000). A selective set of RNAs is now known to be localized in dendrites, and the proteins encoded by dendritic mRNAs generally fall into two main categories, synaptic structural proteins or signaling proteins. One protein in the latter
category that is encoded by a dendritic mRNA is the L7 protein. The L7
protein is in the family of GoLoco domain modulators of large heterotrimeric
1 Dr. Feng Bian, Dr. Xulun Zhang and I contributed to this chapter. The L7-SV40 construct was made and analyzed by Dr. Feng Bian, L7/SV40 hybrid-3’UTR construct was made and analyed by Dr. Xulun Zhang, SV40/L7 hybrid-3’UTR construct was made and analyzed by me. L7-PKC-I construct was reported in De Zeeuw et al., 1998. 40 G-protein subunits Gαi and/or Gαo (Siderovski et al., 1999; Zhang et al.,
2002). Inactivation of this gene in mice resulted in no detectable phenotype
(Vassileva et al., 1997; Mohn et al., 1997). However, using Pcp2(L7) gene
mutant mice in a homogeneous strain background and a different
assortment of assays, we have recently observed behavioral and
electrophysiological changes that indicate a sensorimotor damping function
for L7 and Purkinje cells (unpublished observations). In addition, we have
previously shown in vitro that L7 has modulatory effects on the P/Q-type
Ca2+ channel, the predominant Ca2+ channel subtype of cerebellar Purkinje
cells, and these effects are L7 concentration-dependent (Kinoshita-Kawada
et al., 2004). Therefore, local synthesis of the protein might be expected to
result in direct and reversible effects on P-type Ca2+ channel currents. As a
first step towards understanding how this local synthesis would be controlled we have begun an analysis of L7 mRNA cis-acting sequences.
There are several factors that make the L7 mRNA and the cerebellar
system ideal for Unraveling not only the functional relevance of L7 mRNA
localization, but also the molecular mechanisms of this process. First, the
small size of the L7 mRNA (~500 bases) should make identification of cis-
acting trafficking elements tractable. Second, the L7 mRNA is very
specifically expressed in cerebellar Purkinje cells. The laminar arrangement
of these cells and their dendrites makes this system ideal for in situ
localization studies of modified mRNAs. Lastly, there are a host of
physiological and behavioral paradigms that are thought to reflect the
41 plasticity of various neuronal contacts with post-synaptic Purkinje cells (Kim and Thompson, 1997; De Zeeuw et al., 1998; Raymond and Lisberger, 2000;
Hansel et al., 2001). Thus, the means are available to ultimately test the functional significance of local protein synthesis in the context of synaptic plasticity.
To this end we have begun an analysis of mRNA sequences involved in dendritic localization of the L7 mRNA. As for other dendritic RNAs, we find that the L7-3’UTR plays a major role in dendritic trafficking.
2.2 MATERIALS AND METHODS
2.2.1 Mouse strains
All the transgenic mice were kept in the FVB/N strain using the standard procedures in the Transgenic Mouse Facility of The Ohio State
University.
2.2.2 Generation of transgenic mice
2.2.2.1 DNA contructs for transgenic mice
L7-SV40 construct: The SV40-3’UTR and downstream 3’ end processing sequences were amplified by PCR using pGL3 vector (Promega) as template and primers as follows: SV40a: 5’-GGACTAGTCAGACATGATA
AGATACATTGATGA-3’ and SV40b: 5’-CACATGCATGCAATGAATGCAATT
GTGTTGTTAAC-3’. The former primer generates a SpeI site and the latter an SphI site (underlined) at the ends of the 190 bp. SV40-3’UTR fragment.
42 The SV40-3’UTR fragment was cloned into a modified version of the
Purkinje cell vector, L7ΔAUG (Smeyne et al., 1995), in which SphI and SpeI sites were introduced at the 5’ and 3’ ends, respectively, of the L7-3’UTR.
This was performed using the strand-jumping method we used previously to generate mutations by PCR (Smeyne et al., 1995). Briefly, the BamHI to
EcoRI fragment at the 3’end of L7ΔAUG was replaced with one that was modified using the following PCR strategy. Amplicon A was produced by
PCR using L7 primer JDO23, 5’-GATGGAATGCAGAAACG-3’ and Feng9,
5’-AGGATGGCTAGCATGCTCAAGGAGC-3’ and L7ΔAUG as template.
Amplicon B was produced by using the same template, this time with primers Feng8, 5’-GCTCCTTGAGCATGCTAGCCATCCT-3’ and Feng10, 5’-
TTGGCACTAGCACTAGTGAGTTGAG-3’. Amplicon C was produced using the same template, this time with Feng11, 5’-CTCAACTCACTAGTGCTAGT
GCCAA-3’ and the T7 Universal Primer. Feng8 and Feng9 are complementary and generate an SphI site, and Feng10 and Feng11 are also complementary and generate an SpeI site (underlined). The three amplicons were agarose gel purified and 10 ng. of each was mixed as template for a
PCR reaction using JDO23 and T7 primers. The resulting amplicon ABC was digested with BamHI and EcoRI and inserted in place of the excised
BamHI-EcoRI fragment of L7ΔAUG to produce pL7ΔAUG/Sph-3’UTR-Spe .
The BamHI and EcoRI sites near the ends of amplicon ABC were present in the original L7ΔAUG template and were thus regenerated by this PCR scheme. When inserted in place of the 3’UTR between the SphI and SpeI
43 sites of pL7ΔAUG/Sph-3’UTR-Spe to make pL7-SV40, the SV40-3’UTR fragment was in the SV40 early orientation with respect to L7 transcription
(i.e., large T antigen poly(A)). The vector pL7-SV40 lacks the L7-3’UTR, but retains the L7 gene 3’end processing signals downstream of those of SV40 large T. The SV40-3’UTR fragment was also cloned between the SpeI and
SmaI sites of pGEM3Z to make pSV40-GEM3Z. This vector was used to make 35S-riboprobe for in situ hybridizations of the transgenic mice carrying the L7-SV40-3’UTR construct.
Note: At the time these experiments were performed we were unaware of a second form of the L7 mRNA, called L7B, that is generated by alternative first exon choice (Zhang et al., 2002). As a result, the base promoter vector, L7ΔAUG (Smeyne et al., 1995), which was used to make the constructs reported here, retains the ability to make an aberrant form of
L7 protein. While L7A mRNA indeed does not encode any protein due to the mutagenesis of all possible ATG codons, Form B retains a start codon which, if used, would produce an aberrant L7 protein with multiple methionine substitutions. This aberrant transcript has no effect on the fidelity of reporter gene expression (Smeyne et al., 1995; Zhang et al., 2001). An alternate version of the L7ΔAUG vector minus the ATG in exon1B is currently available upon request (L7ΔAUG/1B).
L7/SV40 hybrid-3’UTR construct: The L7-3’UTR with a mutated
(UÆG) poly(A) addition sequence was added back upstream of the SV40-
3’UTR in pL7-SV40 described above. Briefly, primer 3’UTR-U/G:
44 ACTGACATGCATGCGCTAGTGCCAAGTGTTTTCTTGTTTT and primer
Feng8 (see above) were used in a PCR reaction with L7ΔAUG vector as template. The amplified and mutated L7-3’UTR fragment was digested with
SphI and inserted into the SphI site of pL7-SV40.
SV40/L7 hybrid-3’UTR construct: A 75bp SphI PCR fragment of
SV40 3’UTR was cloned into the SphI site right upstream of L7-3’UTR of pL7ΔAUG/Sph-3’UTR-Spe (see above). The polyA addition site U to G mutation was introduced in the SV40-R1 primer as shown below. The sequence of the two PCR primers are: SV40-F1 5’-GCATGCAATGAATGCA
ATTG-3’ and SV40-R1 5’-GCATGCTTGTGATGCTTTCTTTG.
L7-PKC-I construct: The L7-SV40 construct was used as a base vector for the insertion of the PKC-I mini-coding fragment into the BamH1 site as previously described (De Zeeuw et al., 1998).
2.2.2.2 Preparation of DNA for pronuclear injection
The L7-SV40, L7/SV40 hybrid-3’UTR, and SV40/L7 hybrid-3’UTR constructs were digested with HindIII and EcoRI, gel purified, and injected into fertilized mouse oocytes using standard procedures (Oberdick et al.,
1993).
2.2.3 Tail DNA preparation for analysis of transgenic mice
A piece of 1-2 cm mouse tail was digested at 55°C overnight on a rocking platform in 300 µl of lysis buffer (50 mM Tris pH 8, 100 mM EDTA,
0.5% SDS and 1mg/ml proteinase K[add fresh each time, Invitrogen]). After
45 digestion, 300 µl buffer-saturated phenol (Invitrogen) was added to the
sample. The mixture was vigorously vortexed for 3 min and then centrifuged
for 3 min at 13,200 rpm to allow phase separation. The upper, aqueous layer
was carefully removed to a new tube, and then subjected to be extracted
with an equal volume of 1:1 buffer-saturated phenol: chloroform. The mixture
was vortexed, centrifuged and the aqueous layer was removed to a clean
tube as above. The sample was extracted the third time with an equal
volume of phenol: chloroform: isoamyl alcohol (25:24:1). After this extraction,
the DNA was precipitated by mixing with 300 µl 100% ethanol and 30 μl of
3M sodium acetate (pH 6) and incubated at room temperature for 5 min. The
DNA pellet was washed by 1 ml 70% ethanol, dried and dissolved in 100 µl
TE (10 mM Tris pH 8, 1 mM EDTA).
2.2.4 Genotyping
The offsprings were screened for the presence of the transgene in tail
DNA by polymerase chain reaction (PCR) analysis. The primer sequences are as follows: SV40-5 end 5’-GGGGAATGCAATTGTTGTTGTTAACTTG-3’
and SV40-R1 5’-GTGATGCTATTGCTTTCTTTGTAACC-3’.
2.2.5 In situ hybridization
2.5.5.1 35S-labeled probes for in situ hybridization
L7-3’UTR antisense probe: DNA plasmid pGEM3Z-L7-3’UTR which
contains the complete L7-3’UTR was linearized with EcoRI, the digestion
46 mixture was then phenol/chloroform extracted to remove the enzyme, DNA was precipitated with ethanol and dissolved in TE (10mM Tris, 1mM EDTA pH8.0). To make antisense L7 probe, 1ug of linearized DNA was used as template and alpha-35S UTP was incorporated into transcript by SP6 RNA
polymerase. After the in vitro transcription reaction, the mixture was
phenol/chloroform extracted followed by chloroform extraction. The labeled
probe was ethanol precipitated in the presence of 20ug of yeast tRNA and
2.5M ammonium acetate. Pellet was washed with 75% ethanol and dissolved in DEPC-treated water. The probe was precipitated again with ethanol in the presence of ammonium acetate to remove most of the unincorporated alpha-35S UTP. The probe was then washed with 75%
ethanol and dissolved in 30ul of DEPC-treated water.
SV40 3'UTR antisense probe: DNA plasmid pSV40-GEM3Z which
contains SV40 3'UTR was linearized with HindIII and probe prepared as above, this time using T7 RNA polymerase.
To quantify the radioactivity of α-35S UTP-labeled probe, 1μl of 1:200
probe dilution was precipitated by adding 500 μl, 2% BSA, and 1 ml 15%
TCA on ice for 10 min. The precipitate was filtered with glass-fiber filter paper (Fisher) using a vacuum pump. The filter was washed twice with 5%
TCA, and dried in a vacuum oven for 1 min. The radioactivity of the filtered paper was measured using a scintillation counter.
47 2.5.5.2 Frozen tissue and section preparation
After sacrificing the mouse, the brain was quickly removed and left on
dry ice for fast freezing. The frozen tissue was either sectioned immediately or stored for later use at -80°C. For sectioning, the brain was sectioned onto microscope slide at a thickness of 12 μm using a cryostat. Slides were kept at 80°C for storage.
2.5.5.3 Pretreatment of the slides
Immediately before the experiment, slides were taken out of the freezer, and kept at room temperature for 15 min. The slides were first fixed in 4% paraformaldehyde in 1X PBS (pH 7.2) for 10 min followed by rinsing twice in 1X PBS. They were then incubated with 0.25% acetic anhydride in
0.1 M triethanolamine (TEA, pH 8.0) for 10 min. After TEA treatment, the
slides were subjected to a series of ethanol and chloroform washing as follows: 70% ethanol for 1 min, 80% ethanol for 1 min, 95% ethanol for 2 min,
100% ethanol for 2 min, 100% chloroform for 5 min, 100% room ethanol for
1 min, and 95% ethanol for 1 min. The slides were air-dried at temperature
and subjected to the following hybridization.
2.5.5.4 Hybridization
The 35S- labeled probe was diluted in hybridization buffer (Amresco)
to a desired concentration. The mixture was denatured at 95°C for 2 min to
unfold any secondary structures and placed immediately on ice. Right before
use, 5 M DTT was added to the probe mixture to a final concentration of 0.1
M. 50 μl hybridization mixture was added on each slide and covered with
48 coverslips sealed with Gurr (VWR Int). The slides were kept in a sealed
container and left at 55°C for overnight hybridization.
2.5.5.5 Post-hybridization
The next morning, the Gurr sealing was peeled off, and the slides were placed in 2X PBS to facilitate removing of the coverslips. Then the
slides were washed twice in 2X PBS, 5mM DTT at 45°C for 15 mintues each.
To remove the unbound probe, they were then washed in RNase A buffer with 20 μg/μl RNase at 37°C for 30 min. After this, the sections were washed
five times in 2X SSC at 37°C for 15 min each, twice in 0.5X SSC at 37°C for
15 min each, and four times in 0.1X SSC at 75°C for 15 min each. These series of SSC washing with decreasing concentrations at increasing temperatures were to further remove unbound probes, and to obtain high stringency. After the final wash, the sections were dehydrated with a sequential treatment of ethanol, in 70% ethanol with 0.3 M ammonium acetate (pH 7.4) for 1 min, 80% ethanol with 0.3 M ammonium acetate (pH
7.4) for 1 min, 95% ethanol for 1 minute and 100% ethanol for 5 minutes.
The slides were air-dried and exposed to Classic Blue Autoradiography Film
B-Plus (Midsci) overnight at room temperature. Slides with good signals were used for dipping.
2.5.5.6 Detection steps
The slides were dipped in a vertical glass container filled with LM-1 emulsion for light microscopy (Amersham). Dipped slides were put in a closed box wrapped with aluminum foil, and stored at 4ºC for the time
49 needed, depending on the strength of the signal. The slides were then
developed in the dark room with developer D-19 and fixed with fixer.
Developed slides were counter-stained with cresyl-violet and mounted using
permount. The slides were visualized by the Zeiss microscope using both
dark field and bright field and images were taken using and MetaVue
Imaging Software.
Autoradiographic emulsion-dipped slides were developed after one day for grain counting or one to ten weeks for dendritic detection exposures.
For grain counting purposes, bright-field images were collected using a 63X
oil immersion objective on a Zeiss Axiophot microscope. 10 fields around the
vermal primary fissure were collected from each of two sections from the
highest expressor. Each field typically included 2-3 Purkinje cell bodies. The
images were printed at 8X10 format, an acetate was placed over the image,
a box with dimensions equivalent to 20 m X 20 m of tissue area was placed
over the cell body, and grains were marked on the acetate with a red pen
and counted. Counts were performed by an uninformed (“blind”) observer.
Measurements of morphological characteristics were made in MetaView. P
values were calculated in Excel using a two-tailed t-test.
2.3 RESULTS
2.3.1 The L7 3’UTR is necessary for dendritic localization
We have previously demonstrated that the L7 mRNA is highly
abundant in both soma and dendrites of Purkinje cells, and that the dendritic
50 localization is developmentally regulated and is observed in both rodents and humans (Zhang et al., 2002). In Figure 2.1 we show a comparison of L7 mRNA distribution in early postnatal cerebellum with that of Calb1 (calbindin, or CaBP) using a dark field exposure of autoradiographic grains revealed using 35S-labeled probes. L7 mRNA is found in the Purkinje cell layer and molecular layer while Calb1 mRNA is restricted to the Purkinje cell soma.
The L7 signal in the molecular layer is not cellular since the grains are not localized to the relatively sparse cell bodies of basket and stellate cells, the only cell types residing in this layer (Figure 2.1). Rather, grains are concentrated in the space between these cells that is occupied primarily by
Purkinje cell dendrites (see also Figure 2.4B). Also, the dendritic localization of L7 has been confirmed in multiple studies using either colorimetric or fluorescent detection methods (Bian et al., 1996; Wanner at al., 2000).
Nevertheless, the autoradiographic technique provides both better sensitivity and ease of quantification, and coupled with the laminar arrangements of cerebellar constituent neurons, provides a simple assay for the measurement of RNA localization in dendrites (Figure 2.1).
The majority of dendritic mRNA localization studies have shown that cis-acting targeting sequences are almost always in the 3’UTR. For example, the 3’UTR of microtubule-associated protein 2 (MAP2) were found to be both sufficient and essential for dendritic targeting of chimeric mRNAs in hippocampal and sympathetic neurons (Blichenberg et al., 1999). Two cis- acting factors in the 3’UTR of the Ca2+/calmodulin-dependent protein kinase
51 II (α-CaMKII) have also been reported for the dendritic localization of its
mRNA (Mori et al., 2000). To begin to explore the cis-acting sequences important for L7 localization in dendrites, we tested the effect of replacement of the L7 3’UTR with that of SV40 T-antigen. The SV40 3’UTR was selected as it has previously been shown not to interfere with dendritic localization sequences and imparts no dendritic targeting function of its own
(Blichenberg et al., 1999; Bockers et al, 2004). Purkinje cells, the sole cellular site of expression of the L7 mRNA in the brain, are not amenable to simple transfection procedures that are commonly applied to other primary neuronal cultures. In addition, while cell culture methods can provide strong support for specific hypotheses concerning RNA localization, and while RNA localization is typically considered to be an intrinsic property of neurons,
cultured cells are developmentally abnormal, typically lack normal
innervation, and frequently have disrupted polarity. Therefore, we used a
transgenic mouse approach to introduce modified L7 mRNAs into Purkinje
cells in vivo. We used the L7 promoter construct we have previously
described as the base vector for making these constructs (Smeyne et al.,
1995). This vector, called L7ΔAUG, includes the promoter and complete structural gene of L7, and drives the expression of the full-length L7 mRNA,
but with mutated ATG codons. cDNAs encoding proteins of interest can be
inserted in exon 4, and when the transgene is transcribed not only is the
protein of interest expressed, but tagged L7 mRNAs are also delivered into
52 Purkinje cell dendrites(De Zeeuw et al., 1998; Zhang et al., 2001),
presumably by L7 mRNA targeting sequences.
To test whether the 65 bp L7 3’UTR is important for dendritic targeting,
it was replaced with a 172 bp. fragment that includes the SV40-large T-
3’UTR and all SV40 downstream 3’-end processing signals (Figure 2.2;
construct #2). Then the construct was injected into fertilized mouse eggs.
Four founder transgenic mice were obtained as detected by tail biopsy and
PCR. All had normal growth and suckling behavior up to the time they were
euthanized at P11, at which time their brains were used for in situ
hybridization. 35S-labeled SV40-3’UTR probe was used to detect transgene
expression in sagittal sections of whole brain. First, sections from all four
brains were exposed to x-ray film for 2 days, and two founders were found to express high levels of the L7-SV40 fusion mRNA that was restricted to the cerebellum, consistent with the numerous reports using this promoter construct. Using emulsion dipped slides cerebellum-specific expression was confirmed, and expression was found to be restricted within the cerebellum to Purkinje cells (Figure 2.3). The cerebellum had normal morphology and size, normal width of the molecular layer (a measure of Purkinje cell dendrite length), and normal Purkinje cell density (Table 2.1). The one with highest expression expressed at a level about 50% higher than the endogenous L7 mRNA as measured by the density of autoradiographic grains over the cell body using a short (2 day) exposure time (endogenous L7 mRNA detected with L7-3’UTR anti-sense probe) (Table 2.2 and Figure 2.4B). Under these
53 conditions the grain density over the cell bodies is not saturated and can be
easily quantified, and relative levels of expression determined. As shown in
Figure 2.4A, using a long exposure time, no dendritic signal was detected for
the transgene mRNA while it is clearly detected for endogenous L7 mRNA
(Figure 2.4A, panel #2, exposure time = 3 wks., compared to 1 wk. for panel
#1). The specific conditions and relative exposure times were selected such
that, while the density of grains over the cell bodies is saturated, the relative transgene mRNA signal in the cell body should exceed by more than three- fold that of the endogenous L7 mRNA. No transgene mRNA was detectable in dendrites even after autoradiographic exposure times of several months
(not shown). 20 sections distributed throughout the vermis and hemispheres, each containing hundreds of Purkinje cells, were examined in this manner.
The loss of dendritic localization due to replacement of the L7 3’UTR was absolute, since no detectable dendritic signal was observed in any Purkinje cell of the thousands that were examined. In contrast, the endogenous L7
mRNA was present in dendrites at high levels in these same two founder
animals showing that the transport system itself is unperturbed and the
dendrites are intact (Figure 2.4A, panel #1; Figure 2.4B, panel #1; Figure
2.3B, panel #1).
In order to determine whether L7 3’UTR loss per sé or an anchoring
function of the SV40-3’UTR might explain this result, we added back the L7
3’UTR either upstream or downstream of the SV40 3’UTR (Figure 2.2;
constructs 3 & 4, respectively). Five founder transgenics were obtained for
54 construct 3 and eight for construct 4. Of these, multiple founders for each construct were identified that had high-level Purkinje cell-specific expression that was detectable by exposure to x-ray film for two days. For all transgenics the cerebellum had normal size, molecular layer width, and
Purkinje cell density (Table 2.1). Once again the relative grain density over the cell bodies was determined using short exposure times (2 days) of emulsion-dipped slides (Table 2.2). These data, as before, were used to normalize the signal over the cell body. As shown in Figure 2.4A, using a relative exposure time such that the transgene signal in the cell body was comparable to that of construct 2, dendritic signal was observed (Figure
2.4A; panels 3 & 4; 10 wk. exposure in panel 3, 3 wk. exposure in panel 4).
This signal, however, was considerably weaker than typically observed for the endogenous L7 mRNA, and so dendritic localization was only partially recovered. From the combined result of replacement of the L7 3’UTR and its add-back, we conclude that this 65 base region is necessary for dendritic localization, but we cannot exclude that the SV40-3’UTR either disrupts the
RNA structure required for optimal dendritic targeting, or binds to a protein that interferes with it.
One possible confound of the experiment described above is that the base promoter vector (L7ΔAUG) used to make the L7-SV40 construct has a modified coding sequence such that normal L7 protein cannot be made, and therefore the transgene mRNA is likely in a different translational state than the endogenous L7 mRNA to which its dendritic localization pattern was
55 compared (see Methods). Therefore, we replaced the 3’UTR of a previously reported L7 transgene with that of SV40 (Figure 2.5). This transgene had a
small mini-gene insertion encoding a PKC pseudo-substrate inhibitor, and,
most importantly for the current studies, the transgene mRNA was detected
strongly in Purkinje cell dendrites (De Zeeuw et al., 1998). The L7-PKCI and
L7-PKCI-SV40 constructs were injected in fertilized mouse embryos, and
multiple founders analyzed for expression. While the L7-PKCI transgene
mRNA with an intact L7-3’UTR is abundantly localized in soma and
dendrites of Purkinje cells, the L7-PKCI-SV40 mRNA is retained in the soma
(Figure 2.6). These data further support that the 3’UTR is critical for dendritic
localization of L7 mRNA.
2.3.2 Species conservation of primary sequence and structure of the
3’UTR
We have previously reported that there are two different forms of the
L7 mRNA expressed in cerebellum based on alternative first exon usage
(L7A and L7B), and in humans both forms are localized in Purkinje cell
dendrites as in mouse (Zhang et al., 2002). The two forms within each
species share identical mRNA sequences for the most part, including the
3’UTR, but differ in their 5’UTRs and the N-terminal portion of their coding
sequences. It would be expected that any 3’UTR sequences that contribute
to dendritic targeting should be conserved between human and mouse,
since the dendritic localization is conserved. Alignment of the mouse and
56 human 3’UTR sequences is shown in Figure 2.7A. The gray boxes indicate
the residues that are perfectly matched, which is 43/66, or 65% with 7 gaps.
We also included an alignment with the sequence of the oldest mammal for
which data are available, opossum (obtained from Ensembl; L7 is mammal-
specific, as no non-mammalian vertebrates have an identifiable Pcp2(L7)
gene; unpublished observations). There are clearly two regions of homology
between all three species: one is at the 5’ end of the 3’UTR, the other is
surrounding the polyA addition sequence. As primary sequence is of limited
value, we also compared the predicted structures of the three 3’UTR sequences using Mfold (Zuker, 2003). These results are shown in Figure
2.7B. While the structures vary considerably, three features of note are highlighted: first, the C residue at position 30 (31 in opossum) indicates a single stranded loop found in all structures (arrowhead), second, the U residue from the polyA addition sequence indicates another single strand loop in all structures, and third, the GCC residues that are conserved in all
species (at positions 33-35 in mice) always occupy a stem structure that
separates the two loops described above. These same features are evident
in the predicted structures of full-length L7 (in both L7A and L7B of both
human and mouse). This is shown for mouse L7B in Figure 2.7C, where the predicted structure has the unique property that the 3’UTR portion of the structure folds entirely upon itself (see expanded view inset). The same C residue in the first loop, the U residue of the polyA addition sequence, and the highly conserved GCC triplet are highlighted as described above.
57
2.4 DISCUSSION
Previous studies from our laboratory have shown that insertion of coding sequences within the full-length L7 mRNA expressed in transgenic mice results in expression of the encoded protein in Purkinje cells, as well as dendritic targeting of the transgene mRNA (PKC-I, DeZeeuw et al., 1998;
GFP, Zhang et al., 2001). Here we have used two constructs to show that the L7-3’UTR is necessary for dendritic localization of the mRNA. In the first, the base L7 promoter vector without any translatable insertion was modified by swapping the 3’UTR with that of SV40. The mRNA produced from the base vector cannot be distinguished from the endogenous L7 mRNA, therefore, for this 3’UTR swap construct we compared localization of its transcript to the endogenous mRNA. In order to exclude that the loss of dendritic localization might be due to the aberrant translational state of the transcript or some other property of the transgene Unrelated to the 3’UTR, we modified the previously reported transgene construct called L7-PKC-I, again by swapping-in the SV40-3’UTR. While the L7-PKC-I transcript was abundantly localized in Purkinje cell dendrites, the L7-PKCI-SV40 transcript was not. We conclude that the short L7-3’UTR, only 65 bases in length, is necessary for dendritic localization.
While our data do not bear directly on the issue, they also suggest that the 3’UTR is not sufficient for dendritic localization as add-back of the
L7-3’UTR in combination with the SV40-3’UTR did not recover full dendritic
58 transport function as revealed by the qualitatively lower level of dendritic localization. This suggests that aspects of the overall structure of the 3’UTR or of the full-length L7 mRNA may play a role in determining its dendritic localization. This is consistent with the observation that not all cDNA insertions into the L7 base vector result in transcripts that are localized in dendrites, even though the insertions are always in the same position within exon 4, and, within the transcript, would be flanked by the complete L7 mRNA sequences (unpublished observations)
Our data add to the growing list of cis-acting sequences known to be involved in targeting RNAs to subcellular domains. In most cases a relatively long RNA element has been identified that is both necessary and sufficient for dendritic targeting. For example, a 640 base targeting element (DTE) was identified in the 3’UTR of the MAP2 mRNA using deletion mapping of constructs transfected or injected in primary neuronal cultures (Blichenberg et al, 1999). Dendritic targeting elements have also been identified in the
CaMKII mRNA 3’UTR, which is more than 3 kb in length. One of these elements, again identified by transfection and expression of truncated constructs in neuronal cell culture, lies at the 5’end of the 3’UTR, is only 30 bases in length, and is homologous to a targeting element in neurogranin mRNA (Mori et al., 2000). However, this short element may not be functional in vivo, as another study used homologous recombination targeting in ES cells to construct a mouse in which the CaMKII 3’UTR was truncated after only 97 bases; in spite of inclusion of the 30 base targeting element
59 identified by Mori et al this mRNA was not localized in hippocampal
dendrites in vivo (Miller et al., 2002). In a different study, again in cell culture,
a 1200 base element was identified, mostly in the distal half of the CaMKII
3’UTR that was sufficient for dendritic targeting (Blichenberg et al, 2001).
Thus, several known dendritic targeting elements are nearly as long or longer than the entire L7 mRNA. In addition to not carrying any regions of homology to these mapped dendritic targeting sequences, the L7 mRNA has no known cytoplasmic polyadenylation element (or CPE), which has been shown to facilitate mRNA transport (Huang et al., 2003).
Further studies will need to be performed to determine the molecular mechanisms and function of L7 mRNA localization in dendrites.
60
Molecular PC number/500 μm Transgenic X-sectional Area Layer Width (μm) type (mm2)
Non-transgenic 7.59 + 0.23 112 + 10.0 14.2 + 0.50 (control) SV40-3’UTR 7.66 + 0.22 120 + 11.5 13.4 + 0.47 L7-SV40-3’UTR 7.22 + 0.39 104 + 9.8 13.2 + 0.57 SV40-L7-3’UTR 7.16 + 0.41 120 + 13.6 13.9 + 0.48
Table 2.1 Morphological measures of transgenic cerebella. Animals were all P12. Two non-transgenic F0 mice and two expressing transgenic F0 mice for each construct (FVB/N strain) were used for this analysis. All measurements were taken from the vermis. Area was measured in MetaView from 6 sections per mouse (12 sections/transgenic type). ML width (from top of Purkinje cell layer to bottom of EGL) and PC number were averaged over 2 sections from each of 2 mice. ML width was determined in lobules IV/V & VI, spanning the primary fissure, using bright-field view with cresyl violet counterstain. PC density was measured in the same lobules using dark-field (L7 probe for non-Tg, and SV40 probe for the
Tg’s). + SEM is indicated for each measure.
61
Number of grains 2 Probe Transgenic Type /400 m + SEM P-value
(construct # & name)
L7-3’UTR #2: SV40-3’UTR swap 117.0 + 9.8 SV40-3’UTR #2: SV40-3’UTR swap 146.8 + 8.6 P < 0.05 SV40-3’UTR #3: L7-SV40-3’UTR 65.6 + 9.9 P < 0.01 SV40-3’UTR #4: SV40-L7-3’UTR *107.3+8.1 P=0.456
Table 2.2 Grain density over the Purkinje cell soma of highest expressing transgenic founders. In situ hybridization was performed and slides were exposed to autoradiographic emulsion for 24 hrs. Images were collected at 630X (see Figure 2.4B) and printed in 8-1/2 x 11 format. Grains were counted 2 manually within a box equivalent to 400 µm (20 µm x 20 µm) of cell space, moved from Purkinje cell body to cell body (see Methods). Numbers were averaged for 25 cells of each highest expressor transgenic (same founders depicted in Figure 2.4A). All cells that were counted resided within the primary fissure within the vermis. Two-tailed T-Test was performed to determine if the average grain densities were significantly different from those observed with L7- 3’UTR probe (same exposure time and probe specific activity). Images shown in Figures 3 and 4A of main text are from the same hybridization experiment, but with longer exposures. Background grain density (3.9 + 0.47/400 µm2) was determined using the same box to count grains in the external granule cell layer (EGL) and granule cell layer (GL) (construct #2 mouse using SV40 probe; see Figure 2.4B).
62
Figure 2.1 Comparison of L7 and Calbindin mRNA distributions in P12 cerebellum. In situ hybridization was performed using antisense probes for Pcp2(L7) and Calb1. Images are dark-field with a small amount of bright-field illumination in order to reveal the cell layers, which are darkly counter-stained by cresyl violet. White autoradiographic grains indicate the distributions of the indicated mRNAs. A) L7 expression is found in the Purkinje cell layer (soma) and molecular layer (dendrites). B) Calb1 expression is in the Purkinje cell layer only. EGL: external germinal (granule cell) layer; ML: molecular layer; PC: Purkinje cell layer; GCL: internal granule cell layer. Scale bar = 30 µm
63
Figure 2.2 Schematic diagram shows the constructs and mRNAs that were used in the experiment. The structures of the endogenous L7 mRNA (1), and the L7-SV40 (2), L7/SV40 hybrid- 3’UTR (3), and SV40/L7 hybrid-3’UTR (4) transgene mRNAs are shown. The “X” through the ATG indicates that the start codon for L7A was mutated in the base vector, L7ΔAUG.
64
Figure 2.3 Expression of the SV40-3’UTRswap transgene using in situ hybridization. L7-3’UTR probe (A,B) or SV40 probe (C,D) were used to detect endogenous L7 or SV40-3’UTRswap transgene mRNA expression, respectively, in P12 transgenic brains. Dark-field images are presented. Numbers to the right indicate the mRNA that is being detected based on Figure 2. The transgene is only expressed in the cerebellum (C), and is clearly restricted to the Purkinje cell monolayer that includes the soma (D). Expression of the endogenous L7 mRNA is in the cell bodies as well as in the molecular layer (ML) where the Purkinje cell dendrites are located (see also Figure 4). Scale bar in A,C is 1 mm, and in B,D 100 µm. Exposure time for all panels is 4 days.
65
Figure 2.4 Expression of L7-SV40 and hybrid 3’UTR constructs in P12 mouse cerebellum. A) In situ hybridization with 35S-labelled cRNA probes applied to sections of cerebellum from L7-SV40 transgenic mice. (Panels 1 & 2) Replacement of L7-3’UTR with the 3’UTR of SV40 large T-antigen results in loss of dendritic localization. Both panels show sections from an L7-SV40 transgenic (construct 2). Panel 1: L7-3’UTR probe shows hybridization to the endogenous L7 mRNA in the cell bodies (P) and dendrites (M). Panel 2: SV40-3’UTR probe shows hybridization to the cell bodies only. (Panel 3) Add- back of the L7-3’UTR upstream of the SV40-3’UTR results in dendritic localization of the hybrid mRNA. (Panel 4) Add-back of the L7-3’UTR downstream of the SV40-3’UTR also results in localization of the hybrid mRNA. Exposure times for the four panels are as indicated in the text. P = Purkinje cell layer; M = molecular layer; G = granule cell layer. B) Examples of images used for Purkinje cell body grain counts to normalize relative expression levels of transgenes using in situ hybridization. L7-3’UTR (1) and SV40 (2) probes were used to detect endogenous L7 and SV40-3’UTRswap transgene mRNAs, respectively, in transgenic cerebellum. Bright field images are presented (630X). The hybridized sections were exposed to autoradiographic emulsion for 48 hrs. Longer exposures result in saturated grain densities over the cell body. Scale bar is 10 µm.
66
Figure 2.5 Schematic diagram showing mRNAs produced by L7-PKC-I and L7-PKCI-SV40 constructs.
67
Figure 2.6 Expression of L7-PKC-I and L7-PKCI-SV40 constructs in P12 mouse cerebellum. In situ hybridization was performed on sagittal sections of cerebellum from A) an L7-PKC-I transgenic founder and B) an L7-PKCI-SV40 founder. 35S-labeled antisense PKC-I oligonucleotide probe was used in both cases. The L7-PKCI transgene transcript is detected in the Purkinje cell soma and dendrites (A) just like the endogenous L7 mRNA, whereas the L7-PKCI- SV40 transcript is restricted to the soma only (B). Numbers in the upper right corner of each panel indicate the RNA that is being detected using the numbering from the schematic in Figure 5. Scale bar = 30 µm.
68
(Continued)
Figure 2.7 M-fold analysis of L7-3’UTR structure.
69 (Figure 2.7 continued)
Figure 2.7 M-fold analysis of L7-3’UTR structure. A) The primary sequences of human, mouse, and opossum 3’UTRs were manually aligned and regions of identity and similarity are indicated. Gray boxes indicate the regions of identity between mouse and human. The dashes between the opossum and mouse sequences indicate residues that are conserved in all three species (bold dashes) and residues that are found in opossum and one or the other of human or mouse (gray dashes). B) The M-fold program (Zuker, 2003; [31]) was used to predict the most stable 3’UTR structure for each species. The arrowhead indicates the same C residue in each species found in a single-stranded loop. The arrow indicates the same U residue of the polyA addition sequence, which resides in a single-stranded loop in all structures. The asterisk indicates the same GCC residues in a stem that separates the two loops in all species. C) The structure of the full-length L7B mRNA was predicted by M-fold, and the inset indicates the 3’UTR region, which folds independently of any non-3’UTR residues. The folded structure has the same relative positions of the three conserved features indicated in B. Numerals indicated in units of kcal indicate the Gibbs free energy of each folded structure.
70
CHAPTER 3
BIOCHEMICAL ANALYSIS OF L7 3’UTR AND
ITS PUTATIVE BINDING PROTEINS: UNR AND VPS362
3.1 INTRODUCTION
In this section, we examined RNA-protein interactions with the 3’UTR
due to the targeting analysis in addition to structural considerations
described in chapter 2.
3.1.1 The sequence around poly(A) addition site in 3’ UTR acts as a cis-
acting element which interacts with cerebellar proteins.
To define regions of the 3’UTR that interact with RNA binding proteins we performed EMSA starting with the L7-3’UTR as probe. To this end a sense riboprobe labeled with 32P was prepared corresponding to the
2 Both Dr. Xulun Zhang and I contributed to work presented in this chapter. Dr. Xulun Zhang’s work is presented in the introduction. Figure 3.1 to 3.4, and Figure 3.12 were adapted from Xulun Zhang’s thesis.
71 full-length 3’UTR. The probe was mixed with cytoplasmic extract from adult
mouse cerebellum. As shown in Figure 3.1 the shifted complex reveals two major species and several minor ones suggesting multiple binding proteins.
This complex was specifically competed only by 3’UTR cRNA and not by unlabeled cRNAs corresponding to the coding or 5’UTR regions. To determine which part of the 3’UTR formed a complex with cerebellar protein we prepared RNA oligonucleotides covering the entire sequence (Figure
3.2A). As shown in Figure 3.2B oligo 3 was the best competitor, followed by oligo 1 and oligo 5. Oligos 2 and 4 showed no competition. Thus the optimum binding sequence centers around the poly(A) addition sequence.
We conclude that all or most of the detectable binding to the 3’UTR is centered around the poly(A) addition sequence.
CPSF (cleavage/polyadenylation specificity factor) is the predominant poly(A) addition site binding complex, and a key residue for binding is the U in the AAUAAA consensus site (Wickens, 1990; Murthy and Manley, 1992).
To test whether CPSF was required for complex formation we tested a mutated 3’UTR that had a G residue in place of the U in the poly(A) site
(polyAm: see Figure 3.2A). As shown in Figure 3.2C this mutated probe formed very similar complexes as wt 3’UTR probe. These data suggest that
CPSF’s are not required for binding of the proteins in our EMSA complexes.
To test the role of residues flanking the poly(A) site three different mutant molecules were prepared (Figure 3.2A). All of these mutated versions
72 showed much reduced competition with wt 3’UTR probe, showing that the flanking sequences are important for binding (Figure 3.2D).
3.1.2 Several proteins are involved in RNA-protein complex.
EMSA analysis is very powerful but cannot provide much information about the sizes and numbers of proteins that participate in each EMSA band.
To approach this problem we performed UV-crosslinking analysis using the
3’UTR cRNA probe. Five bands were observed ranging in size from 95 kDa to 20 kDa. The two most prominent bands were ~95 kDa and ~50 kDa
(Figure 3.3A). Both of these bands were competed off by wt 3’UTR cRNA and oligo3. Oligos1 and 5, which showed moderate to weak competition in
EMSA’s, mainly competed for binding to the 50 kDa band. Oligos 2 and 4 were not effective competitors mirroring the result by EMSA. We conclude that the 95 kDa and 50 kDa proteins are the major binding proteins that interact with the sequence around the poly(A) site; the 50 kDa protein prefers a sequence in the 5’ half of oligo 3 while the 95 kDa protein requires the same plus some more downstream.
To determine the relationship between the major EMSA bands and the 95 kDa and 50 kDa proteins, we eluted the RNA-protein complex from the EMSA gel after UV treatment and examined this material by SDS-PAGE
(Figure 3.3B). Crosslinked protein eluted from the larger EMSA complex
(Complex A) included both a 95 kDa and 50 kDa band. Thus, Complex A
73 consists of multiple proteins. The crosslinked protein eluted from the lower
EMSA band (Complex B) included only a 50 kDa band.
3.1.3 FPLC was used to partially purify the proteins that interact with oligo 3.
The basic strategy of partial purification is diagrammed in Figure 3.4.
Rat cerebellar protein extract was used as preliminary studies indicated no differences in complex formation between rat and mouse. The starting material was a total cytoplasmic protein extract prepared from 140 rat cerebella. Both EMSA and UVX were used to detect the presence of the 95 kDa and 50 kDa proteins in column fractions.
The purification procedure is briefly described as follows. First, the total extract was passed over a weak anion exchanger, DEAE column. Both the the 95 kDa and 50 kDa proteins co-eluted and pooled fractions were then loaded onto a heparin sepharose column, which is used for purifying nucleic acid binding proteins. Once again the 95 kDa and 50 kDa proteins were eluted together. These two proteins were then separated by running over a phenyl-sepharose column based on their hydrophobicity difference.
The 95 kDa protein-containing peak was loaded onto a high-resolution
MonoQ column and the fractions with binding activity were identified. The second peak containing the 50 kDa protein was loaded onto a SP-
Sepharose FPLC column. The peak fraction was then run over a MonoQ column. Peak fractions for both proteins were examined by SDS-PAGE, and
74 the corresponding 95 kDa and 50 kDa bands were excised and used for
MALDI-MS analysis.
3.1.4 Two putative L7 3’-UTR binding proteins: Unr and Vps36
By MALDI-MS analysis, we found that the 95 kDa protein is Unr and the 50 kDa protein is called Vps36.
Unr is a single strand RNA-binding protein which binds preferentially to purine-rich RNA sequences (Triqueneaux et al., 1999). It is a well studied protein involved in IRES-dependent translation in both viral and cellular
RNAs (Martinez-Salas et al., 2001). Unr also plays an important role in controlling mRNA stability and decay (Chang et al., 2004; Dinur et al., 2005).
However, little is known about its role in neuronal system. In situ hybridization has shown that Unr mRNA is ubiquitously expressed in mouse brain and especially enriched in the adult hippocampus and cerebellum
(Zhang et al., submitted). In the cerebellum, it was detected in Purkinje cells and granule cells (Figure 3.13)
Vps36 is the ubiquitin-binding subunit of ESCRT-II complex involving in sorting of ubiquitinated transmembrane receptors into the MVB pathway
(Katzmann et al., 2001). Ubiquitination has been identified to play a key role in neuronal biology (Yi and Ehlers, 2007), such as neuronal growth and development, synaptic formation and plasticity (Patrick, 2007). Therefore,
Vps36 may be an essential protein for neuronal development. In situ hybridization has shown that Vps36 mRNA is also ubiquitously expressed in
75 mouse brain and especially enriched in the adult hippocampus and cerebellum (Zhang et al., submitted). In the cerebellum, it was detected both in Purkinje cells layer and granule cell layer (Figure 3.13).
3.1.5 Summary
In this chapter, we have done extensive RNA-protein binding analysis both in vitro and in vivo to confirm binding of Unr and Vps36 to L7 3’UTR.
We have generated rabbit polyclonal antisera against bacterially expressed proteins. We also made affinity purified antibodies to show the expression of
Unr and Vps36 in the brain.
3.2 MATERIALS AND METHODS
3.2.1 DNA constructs
The pcDNA-Unr construct was constructed as follows: Unr cDNA was digested by XhoI from pET16b-Unr (Zhang et al., 2008) and subcloned into pcDNA-HisMaxC (Invitrogen). The pcDNA-Vps36 was made by inserting the
XhoI fragment of Vps36 cDNA digested from pET16b-Vps36 (Zhang et al.,
2008) into the XhoI site of pcDNA-HisMaxC (Invitrogen).
3.2.2 Expression of recombinant proteins in Escherichia Coli.
Chemically competent BL21-CodonPlus E. coli cells (Stratagene) were transformed using 1-50 ng of plasmid DNA following the protocol provided by the manufacturer. Transformants were plated on LB agar plate
76 with appropriate antibiotics and incubated overnight at 37°C. A single colony
was inoculated into 25 ml of LB medium and grown in a 37°C shaker at 250
rpm overnight. The next morning, the overnight culture was diluted 1:40 into
fresh LB medium with the antibiotics. Cells were grown several hours at
37°C to an optical density of 0.5-1. Then the culture was induced to express
the protein by the addition of 0.4 mM isopropyl β-D-thiogalactopyranoside
(IPTG, Sigma). Cultures were incubated for another 2 hours with shaking. 1 ml of cells was saved for analyzing the induced proteins by SDS-PAGE. The cells were then harvested by centrifugation at 5000g in a Sorvall SA-600 rotor for 15 minutes at 4°C. The cell pellet was stored at -20°C before purification.
3.2.3 Purification of His-tag recombinant proteins in Escherichia Coli.
3.2.3.1 Prepapration of soluble protein - Unr
The cell pellet was resuspended in binding buffer A (20 mM sodium phosphate, 500 mM NaCl, 10 mM imidazole, pH 7.4) with 100 µg/ml lysozyme and incubated at 37°C for 15 min. The bacterial lysate was then sonicated in ice bucket 9 x 20s pulse with 30 sec rest in between until cells were completely disrupted. Protease inhibitor cocktail (Sigma) was added immediately to the cell lysate and then the cell lyaste was centrifuged at
15,000g in a Sorvall SA-600 rotor at 4°C to pellet the cellular debris. The
supernatant was then subjected to be cleared by ultracentrifugation in a
77 Beckman Type 50 rotor at 40,000 rpm for 1 hour before it was loaded onto
Hitrap Chelating column (Invitrogen).
3.2.3.2 Prepapration of insoluble proteins – Vps36
The cell pellet was resuspended in resuspension buffer (20 mM Tris-
HCl, pH 8.0) with 100 µg/ml lysozyme and incubated at 37°C for 15 min. The bacterial lysate was then sonicated in ice bucket 9 x 20s pulse with 30 sec rest in between until cells were completely disrupted. Protease inhibitor cocktail (Sigma) was added 1:200 (v/v) immediately to the cell lysate and then the cell lyaste was centrifuged at 15,000g in a Sorvall SA-600 rotor at
4°C. The inclusion body pellet was resuspended in prechilled isolation buffer
(2 M urea, 20 mM Tris-HCl, 500 mM NaCl, 2% Triton X-100 (v/v), pH 8.0) and sonicated on ice to break the inclusion bodies. Then the lysate was centrifuged at 15,000 rpm for 10 min at 4°C. The pellet was resuspended in binding buffer B (6 M guanidine hydrochloride, 20 mM Tris-HCl, 500 mM
NaCl, 5 mM imidazole, 1 mM β-mercaptoethanol, pH 8.0) and stirred at room temperature for 1 hour to solubilize the protein. Following centrifugation at
15,000 rpm for 15 min, the supernanted was was then subjected to be cleared by ultracentrifugation in a Beckman Type 50 rotor at 40,000 rpm for
1 hour before it was loaded onto Hitrap Chelating column (Amersham).
78 3.2.4 Hitrap Chelating column purification
3.2.4.1 Column preparation
A Hitrap 1 ml column was washed with 5 ml distilled water to wash
away the 20% ethanol storage buffer. To charge the column, 0.5 ml of 0.1 M
NiSO4 was loaded onto the column followed by washing with 5 ml distilled
water.
3.2.4.2 Protein purification
For soluble Unr protein purification, the precleared supernatant was
loaded onto Hitrap column followed by washing with 10 columm volumes of
binding buffer A. His-tag Unr was eluted with 5 column volumes of elution
buffer A (20 mM sodium phosphate, 500 mM NaCl, 500 mM imidazole, pH
7.4) (Figure 3.4). For insoluble Vps36 protein purification, the precleared
supernatant was loaded onto Hitrap column followed by washing with 10
columm volumes of binding buffer B. His-tag Unr was eluted with 5 column
volumes of elution buffer B (6 M guanidine hydrochloride, 20 mM Tris-HCl,
500 mM NaCl, 500 mM imidazole, 1 mM β-mercaptoethanol, pH 8.0) (Figure
3.3).
3.2.5 Protein refolding
Protein refolding was carried out using the Pro-Matrix Protein
Refolding Kit (Pierce). Briefly, 20 μg (~10 μl) of denatured Vps36 protein was mixed with 950 μl of Base Refolding Buffer 3 (880 mM L-arginine HCl, 55 mM Tris, 21 mM NaCl, 0.88 mM KCl, 1mM Reduced Glutathione [GSH],
79 1mM Oxidized Glutathione [GSSG] pH 8.2) on ice. The above step was
repeated 5 times until 100 μg of denatured Vps36 protein was added to the refolding buffer. The final Vps36 protein concentration was 100ng/μl).
Refolding reaction was left at 4°C for about 24 hours. Refolded protein was desalted using Desalting Columbus (Pierce) and checked by SDS-PAGE.
3.2.6 Purification of IgG from polyclonal serum
Polyclonal sera were loaded onto HiTrap protein A HP column
(Amersham) follower by washing with 5-10 column volumes of binding buffer
(20 mM sodium phosphate, pH 7.0). The purified IgG was eluted with 2-5
volumes of elution buffer (0.1 M citric acid, pH 6.0). 60-200 µl of 1M Tris-HCl
(pH 9.0) was added to the elution fractions to preserve the activity of acid
labile IgG.
3.2.7 Antibody Affinity purification
The affinity purifed antibodies were prepared by attaching his-tag Unr
or Vps36 protein expressed in bacteria to the AminoLink Plus column using
the AminoLink Plus Immobilization Kit (Pierce). Briefly, the AminoLink Plus
column was equilibrated with 5 ml of pH 10 coupling buffer. Then 2-4 ml of
his-tag Unr or Vps36 protein solution was applied to the column followed by
end-to-end rocking for 4 hours at room temperature. The column was then
washed and incubated with 2 ml of pH 10 coupling buffer and 40 µl of
sodium cyanoborohydride solution with gentle rocking overnight at 4°C.The
80 next day, the column was washed and incubate with 2 ml of quenching
buffer and 40 µl of sodium cyanoborohydride solution with gentle rocking for
30 minutes. The column was then extensively washed with 15 ml of wash
solution and equilibrated with 2 ml of storage buffer. The column was used
for affinity purification and stored upright at 4°C for later use. For affinity
purification, 2 ml of rabbit polyclonal anti-Unr (03885) or anti-Vps36 (03583)
was loaded onto the column, washed and eluted with 8 ml of elution buffer
by collecting separate 1 ml fractions neutralized with 50µl of neutralization
buffer. Elution fractions containing purified antibodies were determined by checking the absorbance at 280 nm. The highest fractions were pooled and dialyzed into storage buffer.
3.2.8 Preparation of cytoplasmic extracts from mammalian cells
Confluent monolayer cultures were washed once with PBS and collected into fresh PBS. The cells were collected by centrifuging 10 min in a benchtop microcentrifuge at 3,000 rpm. The cell pellets were resuspended in a volume of hypotonice buffer (10 mM HEPES, [pH 7.9], 1.5 mM MgCl2, 10
mM KCl, 0.2 mM PMSF, 0.5 mM DTT) ~3 times the packed cell volume (pcv)
and allowed to swell 10 min on ice. Then the cells were transferred to a
glass Dounce homogenizer and homogenized with ten up-and-down strokes
using a type B pestle. After homogenization, the sample was centrifuged 15
min at 4,000 rpm. The supernatant was transferred to an ultracentrifuge tube
(Beckman) followed by adding 0.11 volume of 10X cytoplasmic extract buffer
81 (300 mM HEPES, [pH 7.9], 1.4 M KCl, 30 mM MgCl2). The
ultracentrifugation was performed at 40,000 rpm for 1 hr by using a
Beckman Type 50 rotor at 4°C. After ultracentrifugation, the supernatant was
transferred to a dialysis cassette (MWCO 3,500, Pierce) and dialysized
against the dialysis buffer buffer (20 mM HEPES, [pH 7.9], 100 mM KCl, 0.2
mM EDTA, 20% glycerol, 0.5 mM DTT, 0.5 mM PMSF) in the cold room for 6
hr. The cytoplasmic extract was aliquoted and stored at -80°C.
3.2.9 Preparation of cytoplasmic extracts from mouse cerebellum
One cerebellum was homogenized in 500 µl ice cold homogenization
buffer (10 mM HEPES, [pH 7.9], 1.5 mM MgCl2, 10 mM KCl, 0.5 mM PMSF,
0.5 mM DTT, 2 mg/ml aprotinin, 1 µg/ml leupeptin, 0.2 mg/ml pefabloc and 1
µg/ml pepstatin). The sample was centrifuged at 2,000 rpm for 15 min to
remove the nuclei. The supernatant was transferred to an ultracentrifuge
tube (Beckman) followed by adding 0.11 volume of 10X cytoplasmic extract
buffer (300 mM HEPES, [pH 7.9], 1.4 M KCl, 30 mM MgCl2). The
ultracentrifugation was performed at 40,000 rpm for 1 hr by using a
Beckman Type 50 rotor at 4°C. The supernatant was transferred to a dialysis
cassette (MWCO 3,500, Pierce) and dialysized against the dialysis buffer
buffer (20 mM HEPES, [pH 7.9], 100 mM KCl, 0.2 mM EDTA, 20% glycerol,
0.5 mM DTT, 0.5 mM PMSF) in the cold room for 6 hr.
82 3.2.10 Electrophoresis mobility shift assay (EMSA)
3.2.10.1 Preparation of P32-labeled RNA oligo probe
RNA oligo 3, 29 bp, CUGAAAACAAUAAAACACUUGGCACUAGC was synthesized by Damocon. 1 pmol of Oligo 3 was end-labeled with 50
µCi gamma-32P ATP by T4 kinase (Invitrogen) at 37°C for 30 min. Then the reaction was subject to electrophoresis and gel purification.
3.2.10.2 Gel purification of RNA probe
Following the end-labeling reaction, the reaction mixture was loaded onto an 8% denaturing polyacrylamide gel. 1.5 mm thick gels were cast in
Bio-Rad mini-PROTEAN II gel casting system. The compositions of the gel are described below in the recipe section. The gel was run at 100 volts until the Bromphenol Blue dye reached two-thirds down the gel. The gel was disassembled and left on one plate. Then gel was wrapped in plastic wrap and exposed to film for 10 sec. The film was used as a template to excise the RNA probe band. The gel piece was eluted in 500 µl elution buffer (2M ammonium acetate, 1% SDS, 25 µg/ml tRNA) and shaked at least 5 hr at
55°C. The elute was removed to a fresh microcentrifuge tube followed by
ethanol precipitation overnight at -80°C. The RNA pellet was redissolved in
100 µl DEPC water. 1 µl was counted in a liquid scintillation counter.
3.2.10.3 EMSA
10 µg of cytoplasmic protein extract or various amount of purified his-
tag protein was incubated with 1.0 x 105 cpm of 32P-labeled Oligo 3 probe for
15 minutes at room temperature in binding buffer (10 mM HEPES pH 8.0, 3
83 mM MgCl2, 40 mM KCl, 5% glycerol, and 1 mM DTT) supplemented with
200 ng yeast tRNA and 10 µg heparin. Antibody was added to the reaction
for supershift (if needed) and incubated for additional 15 minutes at room
temperature. For competition assays, unlabeled Oligo 3 probe was mixed
with the reaction and incubated for additional 15 mintues. While binding
reaction was incubating, pre-run EMSA gel at 200V for 30 minutes using
0.5xTBE as running buffer. Reactions were loaded onto EMSA gel followed
by running at 200V for 3 to 4 hours until the blue dye reached the bottom of the gel. The gel was transferred to Whatman 3MM filter paper (Fisher), covered with plastic wrap and dried in a vacuum dryer for 2 hours. The dried gel was placed in cassette with intensifying screen and visualized by autoradiography at -80oC.
3.2.11 UV crosslinking proteins to RNA
1X105 cpm 32P-labeled oligo 3 probe was incubated with protein
samples in 1X RNA-protein binding buffer in the presence of 10 µg heparin
and 200 ng of yeast tRNA. Following 15 min incubation at room temperature,
the RNA-protein mix was irradiated by UV light for 150 sec using a UV
transilluminator (Fisher, 120,000µJ/cm2). Then the RNA-protein mix was
resolved on a 10% SDS-PAGE gel. The gel was dried on Whatman 3MM
filter paper and visualized by autoradiography at -80°C.
84 3.2.12 Immunofluorescent labeling of floating tissue sections
The floating sections were incubated 30 min at room temperature in
blocking buffer (10% sheep serum, PBS, 0.3% Triton X-100). Rabbit
antibody UNR, mVps36 (1:100) or mCaBP Ab (1:20,000) diluted in PBST
was added to the floating section and incubated 2 hr at room temperature.
Following 3 washes with PBS, 5 minutes per wash, the sections were
incubated with Alexa 488 or Alex 555 labeled secondary antibody in PBST
for 1 hr at room temperature. The sections were washed three times with
PBS and one time with ddH2O, 5 minutes each time. If it is a double-labeling
experiment, the procedure was the same as the basic protocol except that
the primary and secondary antibody steps were replaced by mixtures of two primary and two secondary antibodies. After labeling, each floating section
was transferred to a Superfrost plus slide (Fisher) and allowed to be air-dried.
The sections were then mounted with vectashield (Vector) mounting medium.
3.2.13 Coomassie Blue staining
The SDS-PAGE gel was transferred into the Coomassie Blue gel
staining solution (45% Methanol [v/v], 10% glacial acetic acid [v/v], and
0.25% Coomassie Brilliant Blue R-250 [w/v, Biorad] in ddH2O). The gel was
agitated slowly on a shaking platform for 30 min at room temperature. The staining solution was replaced with the destaining solution (20% Methanol
[v/v], 9% glacial acetic acid [v/v] in ddH2O). The gel was kept in the
destaining solution until blue bands and a clear background were obtained.
85 The gel was dried on Whatman 3MM filter paper to maintain a permanent gel record.
3.2.14 Western Blotting
Proteins separated on a SDS polyacryamide gel were transftered to a nitrocellulose membrane (Amersham) by electrophoresis using a Mini Tank
Transfer Unit (TE 22, Amersham). Then the proteins were electrophoretically transferred from the gel to the nitrocellulose at 60 V constant voltage for an hour at 4°C. The nitrocellulose membrane was then stained with Ponceau S solution for 5 min to ensure that transfer had occurred successfully.
After extensive destaining in PBST, the nonspecific antibody sites on the blots were then blocked by incubating the blots in blocking buffer for an hour at room temperature on a shaking platform.
Blots were then placed in a heat-sealable plastic bag with primary antibody diluted in fresh blocking buffer and incubated overnight at 4oC on a
shaking platform. Blots were then washed by agitating with PBST for 5
minutes, five times. The blots were then incubated with horseradish
peroxidase-conjugated secondary antibody diluted in fresh blocking buffer
for 1 hour at room temperature. Blots were then washed again five times in
TBST, for 5 min each wash.
The proteins bands were visualized using West Pico
Chemiluminescence Kit (Pierce) by the instruction provided by the
86 manufacturer. Blots were exposed to Kodak X-ray film in a dark room, and
developed by an automatic X-ray film processor (Fisher).
Solutions for Western blotting
5X Tris-glycine running buffer – 0.125 M Tris, 192 mM glycine, 0.5%
SDS (w/v). Stored at room temperature.
5X SDS gel loading buffer – 0.625 M Tris (pH 6.8), 10% SDS (w/v),
0.5% of bromophenol blue, 50% glycerol (v/v). The solution was titrated to
pH 6.8 using 1 M HCl. The sample buffer was stored at -20oC and 10% (v/v)
β-mercaptoethanol (Sigma) was added just before the buffer was used.
Transfer buffer – 25 mM Tris, 192 mM glycine, 20% methanol in
ddH2O stored at room temperature.
Ponceau-S stain – 0.1% (w/v) Ponceau-S (Sigma) in 5% (v/v) acetic
stored at room temperature.
1X Phosphate-Buffered Saline (PBS) Tween-20 (PBST) – 138 mM
NaCl, 2.7 mM KCl, 10 mM Phosphate, pH 7.4 To produce PBST, 0.1% (v/v)
Tween-20 (Fisher) was added.
Blocking buffer – 5% (w/v) non-fat dry milk dissolved in PBST, made up fresh before use.
3.2.15 Cell culture
3.2.15.1 HEK 293 cell culture
HEK 293 cells were cultured in Dulbecco's Modified Eagle's Medium
(DMEM, Gibco BRL) supplemented with 10% heat-inactivated fetal bovine
87 serum (Gibco BRL), 50 units/ml penicillin, and 50µg/ml streptomycin. The cells were maintained in 100 mm Falcon culture dish at 37°C in a humidified
CO2 incubator. The Cells were sub-cultured when they reached 80-90% confluency. Before sub-culturing, cells were washed with 3 ml of Hank’s
Balanced Salt Solution (HBSS, Gibco BRL) pre-warmed to 37°C. They were then treated with 1 ml of Trypsin-EDTA solution (0.05% trypsin/EDTA, Gibco
BRL) for 3 minutes at 37oC. During trypsinization, the dish was gently tapped on the sides to detach the cells from from the plastic surface. Then 3 ml of pre-warmed DMEM was added to inactivate the trypsination. The cells were transferred to a 15 ml Falcon centrifugation tube and pelleted by centrifugation at 100gmax for 5 minutes. The cell pellet was resuspended in 4 ml of fresh complete medium. After cells/cm2 was determined, the correct amount of cells was seeded to a fresh 100 mm dish with 8 ml of fresh supplemented medium.
3.2.15.2 Transfection of HEK 293 cells in 35 mm dishes
The day before transfection, a 100 mm dish with 90% confluency were washed and trypsinized as described above. Following resuspension of the cells in medium, the cellular density was estimated using a haemocytometer. Cells were plated onto 35 mm Falcon petri dishes at a density of 1 x 105 cells per dish, and incubated for 24 hours in supplemented
DMEM at 37oC. Transfection of cells was carried out by lipofection using
Lipofectamine Transfection Reagent (Invitrogen). 2 µg of total plasmid DNA
88 was used for the transfections. For example, 2 µg of plasmid DNA was used
per dish for single transfections, or 1 µg of each plasmid DNA per dish was used for double transfections. The DNA was incubated with 5 µl plus reagent
(Invitrogen) and 100 µl OPTI-MEM (GIBCO BRL) at room temperature for 15 min. Then a mix of 10 µl Lipofectamine and 100 µl OPTI-MEM was added to the reaction and allowed to incubate 15 more minutes. Control cultures were treated with the transfection mixture but without the presence of any plasmid
DNA. The transfection mix was then added drop by drop to the cultures and incubated at 37°C for 24 hr.
3.2.15.3 Primary cortical neuronal cultures
3.2.15. 3.1 Preparation of acid washed glass coverslips.
Fisherbrand glass coverslips were dropped one by one into 250 ml concentrated nitric acid in a glass beaker at room temperature overnight with constant rocking. The coverslips were rinsed with dH2O three times, two
hours each time. In the end the coverslips were washed with ddH2O for two
hours followed by 100% ethanol wash for one hour. The coverslips were
dried by flaming briefly in laminar flow hood. Store dry in a sterile tissue
culture dish for several months.
3.2.15. 3.2 Preparation of poly-D-lysine-coated coverslips
The acid-washed coverslips were placed on culture dish and sterilized
for 45 minutes with 70% ethanol. 250 µl of 1mg/ml poly-D-lysine (Sigma)
dilution in borate buffer (0.1M boric acid, 0.1M sodium tetraborate) was
applied to each air-dried coverslip. Three hours later, the poly-D-lysine was
89 aspirated from the coverslips and wells were rinsed with three changes of ddH2O. The culture dish with some ddH2O in it was left in 37ºC incubator
before use. The dishes can be stored for 7 days.
3.2.15.3.3 Cortical cell culture
Brain cortex was dissected from P1 mouse pups and placed in a petri dish containing HBSS+ (HBS medium supplemented with 10 mM MgCl2, 7 mM HEPES, 2 mM L-glutamine). After all the samples were collected, cortexes were chopped into 300-600 µm chunks and placed to a 15 ml cell culture tube. HBSS+ was added to the tube to a volume of 4.5 ml, with 0.5 ml trypsin (2.5%). Cells were incubated for 15 min in a 37 ºC water bath. The supernatant was removed and washed three times with HBSS+. Cells were dissociated by pipetting up and down using a Pasteur pipette, and cell number and viability were determined by trypan blue exclusion. Cells were plated on 22-mm polyl-D-lysine-coated coverslips at a density of approximately 1x106 cells/coverslip and placed in 35-mm dishes in
neurobasal (NB) medium (Invitrogen) containing 10% FBS, 0.02% B-27, 2
mM glutamine, 0.27% glucose, 37.5 mM NaCl, and 0.1% gentamicine. Cells
were allowed to adhere for 1-3 hours in a 37ºC, 5% CO2 incubator. Then the
medium was changed to fresh NB medium same as described above. The
medium was changed every 3 days. Cultures were maintained for up to 3
weeks in a 37ºC, 5% CO2 incubator.
90 3.2.15.3.4 Immunocytochemistry
All incubations were at 37ºC or as indicated. Cells on coverslips were fixed in 4% paraformaldehyde in PBS supplemented with 1% sucrose for 15
minutes, permeabilized with 0.25% Triton X-100 in PBS for 15 minutes, and blocked with 4% seru from host species for secondary antibody in PBS for
15 minutes. Primary antibody (1:100) was diluted in (PBS, 0.3% Triton X-100)
and incubated with cells for 1 hour. Cells were washed with PBS three times,
five minutes each followed by incubation with secondary antibody (1:250)
diluted in 4% goat serum in PBST for 1 hour. The secondary antibodies used
were Alex Fluro 488 goat anti-rabbit and Alex Fluro 555 goat anti-mouse
(Molecular Probes). The coverslips were mounted in Vectashield mounting medium with DAPI (Vector) and analyzed with a Zeiss fluorescence microscope and Metaphore software. Merged images were generated using
the Photoshop software (Adobe Systems).
3.3 RESULTS
3.3.1 Confirmation of Unr and mVps36 binding specifically to L7 3’UTR
3.3.1.1 Bacterially expressed Unr protein binds to L7 3’UTR
To test whether Vps36 and Unr identified by the MS analysis actually
participate in the complex detected by EMSA, we first performed in vitro
RNA-protein binding assays using the bacterially expressed recombinant
proteins. His-Vps36 and His-Unr proteins were purified using a Ni column
(Figure 3.5 & Figure 3.6) and renatured in the refolding buffer. These two
91 recombinant proteins were then tested for binding to the L7 3’UTR using
EMSA and UV-crosslinking. Binding was observed for renatured His-Unr by both methods (Figure 3.7) and it had the same selectivity for oligo3 as described above for cerebellum extract protein. Supershift analysis using anti-HisG antibody (Invitrogen) resulted in successful supershifts of His-Unr suggesting the binding is specific to Unr. However, using the same assays,
His-Vps36 protein could not be demonstrated to bind to RNA (Figure 3.7).
The problem existed in a minor contaminating bacterial protein species of estimated molecular weight of ~55 kDa and with robust RNA binding activity was observed in both protein preparations (Figure 3.7A). In addition, a protein of identical size and binding activity was observed after Ni column purification using extracts prepared from the same E. coli strain transformed with empty pET16b vector.
3.3.1.2 Unr protein, but not Vps36, expressed in HEK 293 cells binds to
L7 3’UTR
It is possible that Vps36 binding may require cellular co-factors, which are not present in the bacterial extracts. To demonstrate this issue and avoid the problems described above for bacterially expressed proteins, we cloned the Unr and Vps36 coding sequences into the mammalian expression vector pcDNA4/HisMax C (Invitrogen). These plasmids were transfected into HEK
293 cells and cytoplasmic extracts were prepared for RNA-protein binding assays. Expression of both proteins could be easily detected on Western blots using anti-HisG (Figure 3.8A & Figure 3.9A) or antiXpress Tag
92 (Invitrogen) antibodies (not shown). Using both EMSA and UV-crosslinking,
His-Unr was shown to bind to oligo3 probe (Figure 3.8B & C). The binding in
EMSA could be supershifted using anti-HisG antibody (Figure 3.8C). In
contrast, no binding to probe of Vps36 could be detected, and no protein
was supershifted with the anti-His (Figure 3.9B).
3.3.1.3 Confirmation of Unr and Vps36 binding to L7 3’UTR in vivo
To perform the supershift analysis using cerebellar exatract, we used
either rabbit polyclonal antisera that we generated against bacterially
expressed proteins or affinity purifed antibodies. These antibodies were
tested by Western blot, and both detected the His-tagged antigen and a
single protein species of correct size in cerebellar cytoplasmic extracts
(Figure 3.10A&C). Anti-Unr and anti-Vps36 both resulted in successful
supershifts using either purified total IgG or affinity purified antibodies(Figure
3.10B&D). In fact, the supershift results are consistent with the observations
described in Figure 3.3. Both Unr and Vps36 are found in Complex A, but
only Vps36 is found in Complex B (Figures 3.10D). When the EMSA gels are
run for longer time intervals Complex A can be resolved into Complexes A1
and A2 (Figure 3.10D), and Complex A2 can be further resolved into
Complexes A2a and A2b (Figure 3.10D). Unr is primarily in A2a (Figure
3.10B), while Vps36 is mainly in A1 and B (Figure 3.10D). The major
problem with Vps36 is that the supershits could only be detected using
purified IgG, but not by affinity purified antibody. During the course of these experiments we also tested whether antibodies to poly(A) binding protein
93 (PABP) (Santa Cruz), staufen (Chemicon), and FMR1 (Santa Cruz) could cause supershifting of any EMSA complexes. We also tested two high- stringency affinity purified antibodies, one to staufen1 and the other to staufen2 (Goetze et al., 2006) (unpublished high affinity reagent kindly provided by Dr. Michael Kiebler, Medical University of Vienna, Austria).
None of these antibodies resulted in any detectable disruptions or supershifts of any EMSA bands (not shown). Thus the effects observed with antibodies to Unr and Vps36 are highly selective.
To summarize the above data, we conclude that both proteins participate in L7 3’UTR binding complexes. Both proteins contact the mRNA.
However, as opposed to Unr, which can bind the RNA without interactions with other partners, Vps36 binding likely requires other factors that may be tissue- or cell type-specific.
3.3.2 Expression of Vps36 and Unr in the adult mouse brain
As Vps36 and Unr were purified and sequenced from cerebellar cytoplasmic extracts, and not from a pure Purkinje cell population, it was important to determine that these molecules are actually expressed in
Purkinje cells since these cells are the sole site of L7 mRNA expression in the brain-proper. RNA in situ hybridization analyses revealed that both Unr and Vps36 are highly and ubiquitously expressed in mouse brain (Figure
3.11, allen brain atlas). Unr mRNA in adult brain is detectable throughout, but is highly enriched in olfactory bulb, hippocampus, cerebellum and pons
94 (Figure 3.11A). In the latter tissue, Vps36 is clearly enriched in the
hippocampus and cerebellum (Figure 3.11B). In the cerebellum, both Vps36
and Unr are expressed in the granule cells and Purkinje cells (Figure 3.12).
3.3.2.1 Expression of Vps36 and Unr in cerebellum
Using the affinity purified antibodies against Vps36 and Unr described
above we performed immunohistochemistry. In confirmation of the in situ
hybridization studies, both proteins are found at moderate to high levels in
cerebellar Purkinje cells as well as in granule cells (Figure 3.13). Using laser
scanning confocal microscopy Unr protein was found primarily in the cell body, proximal dendrites, and axons of Purkinje cells, and is weakly detectable in the distal dendrites (Figure 3.13A,C). It was also detected in basket and stellate cells of the molecular layer (Figure 3.13A). Vps36 was also detected in the Purkinje cell perikaryon, but in contrast to Unr it was
found at high levels in the complete dendritic arbor from proximal to distal
(Figure 3.13B,D). Vps36 was not detected in the axon. Both Unr and Vps36
had punctate staining within the cytoplasm and dendrites, suggesting they
may participate in RNA:protein granules.
3.3.2.2 Unr and Vps36 are expressed in neuronal and non-neuronal
cells in the brain.
It has previously shown that Unr and Vps36 mRNA are both
expressed throughout the mouse brain, with highest expression levels in the
cerebral cortex, hippocampus, cerebellum and olfactory bulb. To determine
the expression and subcellular localization of the Unr and Vps36 proteins,
95 immunohistochemical staining of adult mouse brain using the affinity purified
antibodies.
These experiments revealed that both Unr and Vps36 are widely
distributed in the mouse brain. Both proteins are highly expressed in
cerebral cortex, hippocampus, dentate nucleus and pons (Figure 3.14). In
order to test whether Unr and Vps36 are neuronal-specific proteins and the subcellular localization, we performed immunohistochemistry on cultured
cortical neurons. As shown in Figure 3.15A, a somatodendritical localization
of Vps36 was revealed. In the cortical cell body, Vps36 is mainly
homogenously distributed in the cytoplasm. Within the dendrites Vps36 is
detected in a punctate pattern, which is consistent with what has been
shown in the cerebellar Purkinje cell dendrites. In terms of Unr, it is only
localized in the cell body with low level of expression in the processes
(Figure 3.15C). To test whether Unr and Vps36 are expressed in non-
neuronal cells, we used primary cortical cells cultured in NB medium without
the supplement of AraC to keep the glail cells alive. We performed
immunohistochemistry using a glial cell-specific marker anti-GFAP (Glial
fibrillary acidic protein) to stain the cortical cultures. As shown in Figure 3.16,
Unr is strongly detectable in the cell bodies of both neurons and glial cells.
One interesting observation is that Unr appeared to be localized in the
nucleus. Vps36 is also abundantly expressed in glial cells. It is mainly
distributed in the cell body without any expression in the glial cell process
(Figure 3.17).
96
3.4 DISSCUSSION
In this chapter, we presented data characterizing two putative L7
3’UTR binding proteins, Unr and Vps36. We have previously partially purified two 3’UTR-binding proteins from cerebellar extracts using FPLC and identified them by MALDI-MS. We carried out EMSA and UV-crosslinking experiments both in vitro and in vivo to test whether Vps36 and Unr actually participate in the complex detected by EMSA. Unr has been confirmed that it binds to L7 3’UTR specifically. In terms of Vps36, we could not confirm its binding activity by in vitro assays. Supershift analysis using purified anti-
Vps36 IgG showed that Vps36 is involved in RNA-protein complex in cerebellar extract. However, due to the excessive amount of IgG we have used, the supershifted bands could just be nonspecific binding. We concluded that Vps36 binding might require other factors that are tissue- or cell type-specific. Using the affinity purified antibodies against Unr and
Vps36, we have also done extensive immunohistochemical studies on expression of Unr and Vps36 in the mouse brain. We have presented here that both protein are expressed abundantly in both neurons and glial cells.
While Unr is mainly localized in the cell body and proximal dendrite, Vps36 is expressed both in the cell body and the entire dendrites.
Here we showed that Unr is an L7 mRNA binding protein. However, whether Unr plays any roles in terms of L7 mRNA stability, metabolism and trafficking remains unknown. One important function of Unr protein is that it
97 had been shown to be involved in the stimulation of IRES-dependent
translation (Martinez-Salas et al., 2001). In neurons, Unr and polypyrimidine
tract-binding protein (PTB), act in a concerted fashion as chaperones that change the IRES structure and permit translation initiation of Apaf-1 (Mitchell
et al., 2003). One interesting phenomenon has been observed in some
dendritic localized mRNAs. Pinkstaff and colleagues showed that IRESes
were present in five dendritically localized mRNAs, ARC, CaMKIIα, dendrin,
MAP2 and neurogranin (RC3) (Pinkstaff et al., 2001). For these five mRNAs, both cap-dependent and IRES-dependent (cap-independent) translations are used in neurons with a greater contribution of IRES-dependent translation in dendrites. It is worth noting that an IRES structure is predicted within the L7A 5’UTR by UTRscan (http://www.ba.itb.cnr.it/UTR/). It is possible that an IRES-dependent translation exists in L7 mRNA and Unr is involved in this process. Further studies need to be done to test this
hypothesis.
Vps36 is the ubiquitin-binding subunit of ESCRT-II complex involving
in sorting of ubiquitinated transmembrane receptors into the MVB pathway
(Katzmann et al., 2001). It is not clear what role endosomes might play in
RNA trafficking in neurons. However, evidence supporting a role for Vps36
or endosomal mechanisms in mRNA trafficking does exist in other system. It
has recently been shown that the Drosophila homologue of the vertebrate gene, Rab11, is involved in oskar mRNA localization at the posterior pole of the oocyte (Dollar et al., 2002). Rab11 is known to control endosome and
98 apical membrane trafficking in vertebrates (Prekeris et al., 2000; Rodman and Wandinger-Ness, 2000). Therefore, attachment of mRNAs to vesicles that are in turn moved about by a microtubule-dependent mechanism may be a common mode of trafficking mRNA molecules to distinct membrane compartments. In Drosophila, Vps36 has recently been shown to bind directly to the bicoid 3'UTR, and is required for bicoid mRNA localization to the anterior of the oocyte during late oogenesis (Irion and Johnston, 2007).
Thus, while there is no functional evidence as of yet supporting a role for
Vps36 and endosomal mechanisms in mRNA trafficking in neurons, such evidence does exist in other systems. Our binding data point to a functional role for Vps36 in neuronal mRNA trafficking as well. Further studies are underway to identify the RNA binding domain of mouse Vps36, and to uncover the functional relevance of mVps36 in Purkinje cells.
99
Figure 3.1 Binding to the L7-3’UTR is specific. (Zhang, 2001) EMSA was performed using cerebellum cytoplasmic protein extract and 32P-labeled sense L7-3’UTR cRNA as probe. Cold cRNA competitors were used corresponding to the L7-3’UTR, the L7 coding sequence, and the 5’UTR + coding sequence. Cold competitor concentrations were 10X (lanes 3, 6, 9), 100X (lanes 4, 7, 10), and 500X (lanes 5, 8, 11) that of the radiolabeled probe. Lane 1 = probe alone, no protein; Lane 2 = probe + protein, no competitior. The two main RNA:protein complexes are indicated with arrows.
100
Figure 3.2 The poly(A) addition signal and flanking sequences are critical for binding. (Zhang, 2001) A) The L7-3’UTR sequence is shown at the top. Immediately below are the sequences of five RNA oligonucleotides used for RNA-EMSA-competition analyses. Immediately below that are targeted mutations that were made in the 3’UTR sequence for further competition studies. Substituted residues are underlined. Deletions are shown as a dashed line. Two consensus core sites for UNR binding (see text) are over-lined. B) RNA-EMSA competition analysis. Each of the RNA oligonucleotides was used as a cold competitor in an EMSA experiment. Each competitor was at a concentration 10X, 100X, and 500X that of the probe (increasing left to right). The best competitor was oligo3, followed by oligo1, then oligo5. Oligos2 and 4 showed no appreciable competition. C) Mutation of a critical U residue required for CPSF binding to the poly(A) addition signal (mutation PolyAm) shows very little effect on binding in RNA-EMSA. However, one large complex that may be CPSF is absent from the mutated probe lane (arrow). D) Deletion of residues that lie upstream and downstream of the poly(A) addition signal (see F and I in panel A), and substitution of certain residues upstream and downstream of the same site (see J in panel A), results in loss of competition in RNA-EMSA in comparison to the wild-type 3’UTR (wt 3’UTR) competitor.
101
Figure 3.3 A multi-protein complex binds to the L7 3’UTR. (Zhang, 2001) (A & B) UV-cross-linking analysis of RNA:protein complexes. A) 32 Similar conditions as for RNA-EMSA were used to allow the P-labelled wt-3’UTR probe and cerebellar cytoplasmic proteins to interact. The proteins were cross-linked by UV treatment and analyzed by SDS-
PAGE. No bands were detected in the absence of UV treatment; however, multiple bands were detectable after UV treatment. The most prominent were ~95kDa and ~50kDa. wt 3’UTR cRNA and oligo3 competed most effectively for binding of these proteins to probe. oligos1 and 5 competed mostly for binding to the 50kDa protein. Oligo3 competed for binding to both proteins. B) The left panel is a typical RNA- EMSA showing the two major complexes, A and B. The EMSA material was treated with UV light and the RNA:protein complexes were eluted from the gel and run on SDS-PAGE. A standard UV cross-linking reaction, with and without UV treatment, were run for comparison. Complex A was found to include bands of ~95kDa and 50kDa along with a variable third band. Complex B was found to contain mostly a band of about 50kDa. wt-3’UTR probe was used in this experiment.
102
Figure 3.4 Flow-chart showing the scheme used to purify the 95kDa and 50kDa proteins. (Zhang, 2001).
103
Figure 3.5 His-tag Vps36 expressed in E coli. A) Vps36 is insoluble and present in the cell pellet. B) His-tag Vps36 protein eluted from Ni column. -, uninduced; +, induced; S, supernatant; P, pellet.
104
Figure 3.6 His-tag Unr expressed in E coli. A) Unr is soluble and present in the cell supernatant. B) His-tag Unr protein eluted from Ni column. -, uninduced; +, induced; S, supernatant; P, pellet.
105
Figure 3.7 RNA-protein binding analysis of Unr and Vps36 expressed in E coli. A) To test binding of Unr and mVps36 by another method, the bacterially expressed His-mVps36 and His-Unr proteins were purified using a Ni column and tested for binding to the L7 3’UTR using UV-crosslinking. Binding was only observed for renatured His-Unr, and it had the same selectivity for oligo3 as described above for cerebellum extract protein, The His-Vps36 protein could not be demonstrated to bind to RNA. However, a minor contaminating bacterial protein species of estimated molecular weight of ~55 kDs and with robust RNA binding activity was observed in both protein preparations. B) EMSA analysis was performed using the bacterially expressed His-Unr protein. Anti-HisG was used in increasing amounts to supershift the Unr-containing complex (arrowhead). 0.2, 0.5, 1 and 2 ug of Anti-HisG were used. A supershifted band was observed (arrow). The minor contaminating bacterial protein was present in each lane. C) EMSA analysis was performed using the bacterially expressed His-Vps36 protein. No supershifted band was detected with the addition of anti- HisG (lane 5 & 6).
106
Figure 3.8 Confirmation of Unr participation in complex A in HEK 293 cell extract. A) Western blot analysis using anti-HisG. The His-Unr is detected in HEK 293 cytoplasmic extract. B) UV-crosslinking was performed on His-Unr- transfected 293 cells. An intense labeled band appears at 90 kDa in the transfected cells (“Unr”) that is not present in the untransfected cells (arrow). This band runs slightly higher than the largest cross-linked protein in cerebellum extracts (“CBM”) C) His-Unr was expressed in HEK-293 cells. EMSA was performed using cytoplasmic extracts prepared from these cells. A novel binding complex appears in Unr transfected cells (lane 5, “UNR”; arrow) that is completely supershifted using anti-HisG antibodies (lanes 6 & 7; arrowhead). This band is not present in untransfected 293 cells (lane 3, “Un- Tx”). In addition it migrates at a position equivalent to that of Complex A2a of cerebellum extract (asterisk).
107
Figure 3.9 Vps36 is not involved in RNA-protein complexes in HEK 293 cell extract. A) Western blot analysis using anti-HisG. The His-Vps36 is detected in HEK 293 cytoplasmic extract. B) His-Vps36 was expressed in HEK-293 cells. EMSA was performed using cytoplasmic extracts prepared from these cells. No binding complex appears in Vps36 transfected cells (lane 3, “Vps36”) that is supershifted using anti-HisG antibodies (lanes 6).
108
(Continued)
Figure 3.10 Confirmation of Unr and Vps36 participation in RNA-protein binding complexes in cerebellar extract.
109
(Figure 3.10 continued)
E
kDa
Figure 3.10 Confirmation of Unr and Vps36 participation in RNA-protein binding complexes in cerebellar extract. A) Western blot analysis using affinity purified anti-Unr. The His-Unr expressed and purified from E. coli is detected, and a single major band of MW 90 kDa is detected in cerebellar cytoplasmic extract. B) EMSA analysis was performed using cerebellum cytoplasmic extract and oligo3 probe. Longer gel runs reveal that Complex A2 is actually made up of two closely spaced components (1st lane). The upper of these two bands (A2a) is removed by increasing amounts of anti-UNR (0.5, 1, and 2 ug., lanes 2-4, respectively). Supershifted bands are observed above and intermingled with Complex A1 (arrowheads). C) Western blot analysis using anti-mVps36. Increasing amounts of cerebellum extract show a single reactive species migrating at 48 kDa. The His- mVps36 expressed and purified from E. coli migrates at a position slightly higher. D) EMSA analysis was performed using cerebellum cytoplasmic extracts. Longer gel runs were performed here than in previous experiments, resolving two distinct components of Complex A, called A1 & A2. Purified IgG from either pre-immune serum or immune serum from rabbit 03583 (anti-mVps36) was used in increasing amounts to supershift the mVps36-containing complexes. The first lane in each panel is no IgG. Then 5, 10, 20, 50, and 100 ug. of pre-immune and 5, 10, 20, 50, 100, and 200 ug. of immune IgG were used for supershifting. Complexes A1 and B are supershifted (arrows & arrowhead). Complex A2 shows a complementary effect, increasing with increasing antibody. E) Western blot blocking experiment using purified anti-Vps36 IgG. For each panel, 10, 20 and 30µg of cerebellar cytoplasmic extract were used. When anti-Vps36 ab was pre-incubated with Bac-Vps36 protein (middle panel), the Vps36 band disappeared on the gel showing the specificity of the antibody, while pre-incubation with nonspecific protein cytochrome C (right panel) did not block the immunoreactivity of the antibody.
110
Figure 3.11 In situ hybridization of Unr and Vps36 in mouse brain. (Adapted from Allen Institue for Brain Science/Allen Brain Atlas). A) Unr mRNA is enriched in cerebellum, hippocampus, olfactory bulb and pons. B) Vps36 mRNA is enriched in hippocampus and cerebellum.
111
Figure 3.12 In situ hybridization of Unr and Vps36 in rat cerebellum. (Zhang, 2001). A) Lower magnification (1X) showing Unr mRNA is present in Purkinje cell layer and granule cell layer. B) Higher magnification (40X) showing Unr mRNA in Purkinje cell bodies. C) Lower magnification (1X) showing Vps36 mRNA is present in Purkinje cell layer and granule cell layer. D) Higher magnification (40X) showing Vps36 mRNA in Purkinje cell bodies. P, Purkinje cell layer; G, granule cell layer; M, molecular cell layer; PC, Purkinje cells.
112
(Continued)
Figure 3.13 Expression of Vps36 and Unr proteins in cerebellar Purkinje cells.
113 (Figure 3.13 continued)
Figure 3.13 Expression of Vps36 and Unr proteins in cerebellar Purkinje cells. Immunohistochemistry was performed on sagittal sections of cerebellum. A) Unr is strongly detectable in the cell bodies and proximal dendrites. It is also weakly detectable in the distal dendrites. It is also detected in the cell bodies of basket/stellate cells. B) A higher magnification view showing the enriched expression of Unr in the perikaryon and proximal dendrites. The expression is primarily cytoplasmic and granular in appearance. C &G) CaBP staining showing cell bodies and dendrites of Purkinje cells. D) Merged images of A & C. E) Vps36 is highly expressed in cell bodies and in the complete dendritic arbor of Purkinje cells. F) Higher magnification showing that like Unr, cytoplasmic staining is primarily granular, which extends into the dendrites (arrow). H)Merged images of E & G. Scale bar in A,C,D,E,G & H is 25 µm. Scale bar in B & F is 6 µm. ML, molecular layer; PC, Purkinje cell layer; GL, granule cell layer.
114
Figure 3.14 Expression of Vps36 and Unr proteins in the mouse brain. Both Vps36 and Unr are abundantly expressed in the brain. Scale bar, 25 µm.
115
Figure 3.15 Expression of Unr and Vps36 in cortical cultures. Immunohistochemistry was performed on cultured cortical neurons on coverslips. Double labeling was performed with tubulin and Vps36 or Unr. A) Vps36 is highly expressed in cell bodies and in the complete dendritic arbor of cortical neurons. The expression is primarily cytoplasmic.Staining in the cell body is homogenous while in the dendrite punctate staining is observed. B & D) Tubulin staining of cortical neurons. C) Unr is strongly detectable in the cell bodies and proximal dendrites. Scale bar is 25 µm.
116
Figure 3.16 Unr is expressed in glial cells. Immunohistochemistry was performed on cultured cortical neurons on coverslips. Double labeling was performed with GFAP and Unr antibodies. Coverslips were mounted using vectorshield containing DAPI. A) Unr is strongly detectable in the cell bodies of both neurons and non-neurons. B) GFAP staining indicating the glial cells in the cortical cultures. C) DAPI staining showing the nuclei on the coverslips. D) Merged images showing that Unr is expressed in glial cell. Scale bar is 25 µm.
117
Figure 3.17 Vps36 is expressed in glial cells. Immunohistochemistry was performed on cultured cortical neurons on coverslips. Double labeling was performed with glial cell-specific marker GFAP and Vps36 antibodies. Coverslips were mounted using vectorshield containing DAPI. A) Vps36 is strongly detectable in both neurons and non-neurons. Vps36 is also detected in the neuronal processes. B) GFAP staining indicating the glial cells in the cortical cultures. C) DAPI staining showing the nuclei on the coverslips. D) Merged images showing that Vps36 is expressed in glial cells and the staining is mainly cytoplasmic. Scale bar is 25 µm.
118
CHAPTER 4
GENERATION OF MICE WITH
CONDITIONAL INACTIVATION OF UNR AND VPS36 GENES
4.1 INTRODUCTION
As described in Chapter 3, Unr and Vps36 are putative L7 3’UTR binding proteins. In order to investigate whether those two proteins are involved in L7 mRNA dendritic localization and Purkinje cell development, we decided to knock down the Unr and Vps36 gene expression in vivo. As direct study in Purkinje cells is difficult due to the lack of suitable cell culture models, we employed an inducible conditional knockout strategy to study the functions of Unr and Vps36 in cerebellar Purkinje cells.
Although both Unr and Vps36 are well known proteins, the knowledge of both proteins in the brain are very limited. Unr is a single strand RNA- binding protein which binds preferentially to purine-rich RNA sequences
119 (Triqueneaux et al., 1999). It is a well studied protein involved in IRES-
dependent translation in both viral and cellular RNAs (Martinez-Salas et al.,
2001). Unr also plays an important role in controlling mRNA stability and decay (Chang et al., 2004; Dinur et al., 2006). However, little is known about its role in neuronal system. Vps36 is the ubiquitin-binding subunit of ESCRT-
II complex involving in sorting of ubiquitinated transmembrane receptors into the MVB pathway (Katzmann et al., 2001). Ubiquitination has been identified to play a key role in neuronal biology (Yi and Ehlers, 2007), such as neuronal growth and development, synaptic formation and plasticity (Patrick,
2006). Therefore, Vps36 may be an essential protein for neuronal development. As described previously, immunohistochemical studies on mouse cerebelluar slices revealed that both Unr and Vps36 were expressed at moderate to high levels in Purkinje cells as well as in granule cells. The distribution patterns of both proteins, however, are quite different. Higher magnification images showed that Unr protein was found primarily in the cell body, proximal dendrites, and axons of Purkinje cells, and is weakly detectable in the distal dendrites. Vps36 was also detected in the Purkinje cell perikaryon, but in contrast to Unr it was found at high levels in the complete dendritic arbor from proximal to distal. However, Vps36 was not detectable in the axon. Both Unr and mVps36 had punctate staining within the cytoplasm and dendrites, suggesting they may participate in RNA:protein granules. Given the fact that both proteins are abundantly expressed in cerebellar Purkinje cells, generating Unr-deficient and Vps36-deficient
120 mutant mouse models may shed light on the neuronal functions of both
proteins in the cerebellum.
The generation of transgenic mouse containing targeted inactivation
of desired genes using homologous recombination in embryonic stem (ES)
cells is a powerful tool to analyze their role in complex brain functions such
as synaptic plasticity, neurogenesis and neuronal cell death (Chen and
Tonegawa, 1997). However, inactivation of genes in the germline often
results in a lethal phenotype that prevents further analysis of the targeted
gene in the adult brain. For example, homozygous Unr knockout is
embryonic lethal in mice, but only at around 10 days (Boussadia et al., 1997).
It suggests that the Unr gene is not essential for general cell viability and cell
division, but must be essential for certain stages in differentiation. siRNA
analysis in the Caenorhabditis elegans system revealed that depletion of the
Vps36 homologue was larval-lethal (Roudier et al., 2005). To avoid early
lethality and to analyze functions of a gene particularly in the adult cerebellum, the tamoxifen-inducible Cre/LoxP-recombination system was
generated to conditionally delete Unr and Vps36 gene in Purkinje cells.
In this chapter, I will discuss two parts of the conditional knockout
project. 1) Generation of targeting alleles of Unr and Vps36 and homologous
recombination in ES cells. 2) Generation of inducible CRE-ERT2 in cerebellar
Purkinje cells.
121 4.2 MATERIALS AND METHODS
4.2.1 DNA constructs
4.2.1.1Targeting vector construction and homologous recombination
4.2.1.1.1 Unr-LoxP targeting construct
To make the Unr-LoxP targeting vector, three arms of homology, including long arm, middle arm and short arm with diphtheria toxin gene
(DTA), were cloned into the backbone vector pSPUC_LFneo(+) (Figure 4.1).
Three arms of homology were obtained by PCR using Bacterial Artificial
Clone (BAC) 272H6. The primer sequences used for each arm were shown as follows:
For Unr long arm (6783 bp):
UNR/LA-F 5’-GACTAGCTACAATTGTGACTCTAAGGCCAGAG-3’
UNR/LA-R 5’-CTCGGCAATTGATTAAATTCATAAAGTTAGC-AG-3’
For Unr middle arm (1771 bp):
UNR/MA-5’ 5’-CAGCGCTAGCCTGCATGACTTACCAAATAG-3’
UNR/MA-3’ 5’-CAGCGCTAGCCCCAAACTGAGTCTTGAC-3’
For Unr short arm (600 bp):
UNR/SA-5’ 5’-GAGCCCGCTCGAGTTTTACATATAACCCTGAG-3’
UNR/SA-3’5’-GGATCGCTCGAGACTGGAGTTAGTGCTTAAAAG-3’
The short arm PCR fragment containing exon 4 was first cloned into the XhoI site on pBSSK(+)_DTA. Then the short arm with DTA was digested with SalI and cloned into pSPUC_LFneo(+). To the resulting construct we added the following PCR fragments: the 6.8 kb large arm digested with MfeI
122 into EcoRI site and the 1.8 kb middle arm containing exon 2 and exon 3 into
NheI site. The final targeting vector Unr-LoxP was linearized by NotI and eletroporated into embryonic stem (ES) cells in the Transgenic and
Embryonic Stem Cell Core, Nationwide Children’s Hospital. The BAC clone, pBSSK(+)_DTA and pSPUC_LFneo(+) were kindly provided by Dr. Mary
Cheng.
4.2.1.1.2 Vps36 targeting construct
To make the Vps36-LoxP targeting vector, three arms of homology, including long arm, middle arm and short arm with diphtheria toxin gene
(DTA), were cloned into the backbone vector pSPUC_LFneo(+) (Figure 4.1).
Three arms of homology were obtained by pcr using BAC clone 99L16. The primer sequences used for each arm were shown as follows:
For Vps36 long arm (6059 bp):
VLA-5’ 5’-ATTCCCGGGCAACAGAAGAGTGCTAACTG-3’
VLA-3’ 5’-AATTCCCGGGCCACATGTGAGTGGAACTGAAG-3’
For Vps36 middle arm (1993 bp):
VMA-5’ 5’-ATGCTAGCGGAGAGAGCTCCACTCTATG-3’
VMA-3’ 5’-AGCTAGCTTCAATCCCATCTTCCTGTC-3’
For Vps36 short arm (730 bp):
VSA-5’ 5’-TCAAGCTTGACCAGAAAGATGAATAGGTGTTGG-3’
VSA-3’ 5’-ATCTCGAGACCGGGTTCTTATCAGCAAG-3’
VSA/DTA-5’ 5’-GACTGGTCGACAAGCTTGACCAGAAAGATG-3’
VSA/DTA-3’ 5’-GATATGTCGACCTCGACTCTAGTGGATC-3’
123 The short arm PCR fragment was first cloned into the Hind III and
XhoI site on pBSSK(+)_DTA. Then the short arm with DTA fragment was
amplified by PCR and then cloned into the SalI site on pSPUC_LFneo(+). To
the resulting construct we added the following PCR fragments: the 6.1 kb
large arm containing exon 1 and exon 2 into SmalI site and the 2.0 kb middle
arm containing exon 3 and exon 4 into NheI site. The final targeting vector
Vps36-LoxP was linearized by NotI and eletroporated into embryonic stem
(ES) cells in the Transgenic and Embryonic Stem Cell Core, Nationwide
Children’s Hospital.
4.2.1.2 L7P1-CreERT2
Two mutations were introduced into the base vector called L7ΔAUG,
in which the L7 cDNA with all the AUG sequences mutated were put
downstream of the 1 kb L7 promoter and inserted into pGEM3 vector in
between HindIII and EcoRI. One mutation was to introduce an MfeI site next
to the HindIII site by the QuickChange Site Directed Mutagenesis Kit
(Qiagen) for the final linearization of the construct. The other mutation was to mutate the unique BamHI in L7 exon 4 to KpnI for the insertion of Cre-ERT2 sequence. The CreERT2 sequence was synthesized by Turbo Pfu
polymerase (Strategene) using pMC-Cre as the template. The primers used
were shown as follows: CreERT2-F 5’-AAGGTACCCGCCACCATGTCCAAT
TTACTGACC-3’ and CreERT2-R 5’-AAGGTACCTCAGACCGTGGCAGGGA
AAC-3’.
124 The CreERT2 pcr fragment was then cloned into TOPO TA vector with
the aid of pCR8/GW/TOPO TA Cloning Kit (Invitrogen), digested by KpnI
and subcloned into L7ΔAUG. The final construct called L7P1-CreERT2 was
linearized by MfeI and injected into blastocysts for generation of transgenic
mice.
4.2.1.3 L7P4-CreERT2
This construct is obtained by inserting extra 3 kb L7 promoter
sequence upstream to L7P1-CreERT2. The 3 kb promoter sequence was
amplified by Pfu polymerase using EM-1 as the template. The primers used
for amplification are L7 Prom4kbF 5’-ATGCGTCGACTGCACAAAGCTCTGG
GTTCC-3’ and L7 Prom4kbR 5’-ACTGCTCGAGGACCATGCTCTGAGAGTC
TG-3’. The PCR fragment was treated with addition of 3’ A-overhangs
reaction, cloned into TOPO vector and subcloned into the SalI site of
L7PCreERT2 vector right upstream of the L7 1kb promoter. The final construct called L7P4-CreERT2 was linearized by MfeI and injected into
blastocysts for generation of transgenic mice.
4.2.2 Transgenic mice production
The transgenic founders were produced by pronuclear injection of
linearized DNA using standard procedures (Oberdick et al., 1993). The Cre
founders were back-crossed into the B6 background for production of
transgenic offspring. The Cre transgenic mice from lines T27, T3, T9 were
125 also crossed with the Cre recombination reporter mice the GtROSA26 (Mao et al., 1999) strain.
4.2.3 TA cloning
The TA cloning was done with the aid of pCR8/GW/TOPO TA Cloning
Kit from Invitrogen followed by manufacturer’s instruction. Breifly, fresh pcr fragment produced by Taq polymerase was mixed with salt solution and
TOPO vector provide by the kit. The reaction was kept at room temperature from 5 min to 1 hour followed by transformation into One Shot chemically competent E. coli cells (Invitrogen). Cells were then plated onto LB
Spectinomycin plates and incubated at 37oC overnight. Positive colonies were screened by PCR.
4.2.4 Addition of 3´ A-Overhangs Post-Amplification
After amplification with a proofreading polymerase, place vials on ice and add 0.7-1 unit of Taq polymerase per tube. Incubate at 72°C for 10 minutes.Place on ice and use immediately in the TOPO Cloning reaction
4.2.5 Site-directed mutagenesis
The mutations were generated by QuickChange Site Directed
Mutagenesis Kit (Qiagen). Briefly, the kit used a non-PCR based method to introduce the point mutation, switch amino acids, and delete or insert single or multiple amino acids into the supercoiled double-stranded DNA (dsDNA)
126 vector of interest. The primers, each complementary to opposite strands of
the vector, are extended during temperature cycling by PfuTurbo DNA
polymerase. Incorporation of the oligonucleotide primers generates a mutated plasmid containing staggered nicks. The original template was then digested by the methylated-DNA specific restriction enzyme Dpn I to digest the parental DNA template and to select for mutation-containing synthesized
DNA. The synthesized DNA was used to transform XL1-Blue
Supercompetent Cells. The transformation and control reactions were
followed as described in the kit protocol. Cells were then plated onto LB
Ampicillin plates and incubated at 37oC overnight.
4.2.6 Genotyping
The offsprings were screened for the presence of the transgene in tail
DNA by PCR analysis. The primer sequences are as follows:
Cre5’ 5’GCCGAAATTGCCAGGATC-3’
Cre 3’ 5’-AGCCACCAGCTTGCATGATC-3’.
4.2.7 ES cell DNA extraction: tube method
This protocol for extracting DNA from ES Cells, starting from the 96-
well plate but processing in an eppendorf tube, is to recover more of the
DNA. 250 µl lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM EDTA, 10 mM NaCl,
0.5% (w/v) Sarkosyl [N-Lauroylsarcosine,Sigma], 1mg/ml Proteinase K [add
fresh each time, Invitrogen]) was added to each well. The plate was wrapped
127 with wet paper towel in a sealed plastic bag and incubated at 55° overnight.
The next morning, the sample of each well was transferred into a separate
1.5ml microcentrifuge tube. The DNA in each tube was then precipitated by
mixing with 250 µl cold 100% ethanol and incubated at room temperature for
5 min. DNA pellets was obtained by centrifugation 3 min at 13,000 rpm,
washed with 1 ml 70% ethanol and dissolved in 30 µl 10mM Tris pH 8.5.
4.2.8 ES cell screening by PCR
To screen for the occurrence of a homologous recombination event, genomic DNA was isolated from individual ES cells clones and screened by
PCR. The screening strategies for recombination at the long arm and short arm were shown in Figure 4.2 & 4.3. The primer sequences for screening are as follows:
For homologous recombination at the Unr short arm:
Neo 3: 5’-CTTTCTAGAGAATAGGA ACTTCGG-3’
Neo P: 5’-ATGCTCCAGACTGCCTTGGGAAAAG-3’
SA-DS: 5’-CCA GAG ACT GTA GTT ACA TTT C-3’
For homologous recombination at the Unr long arm:
UNR/LA-F18: 5’-CTAAGGACTTGAGTGTGTGTTGTG-3’
UNR/MA-R2: 5’-CTATTTGGTAAGTCATGCAG-3’
For homologous recombination at the Vps36 short arm:
Neo 3: 5’-CTTTCTAGAGAATAGGA ACTTCGG-3’
Neo P: 5’-ATGCTCCAGACTGCCTTGGGAAAAG-3’
128 VSADS1: 5’-AGCTCACTAAGCTAACACTGAG-3’
For homologous recombination at the Vps36 long arm:
VMAR3: 5’-CTGGGAACTGGCACAGTCTC-3’
VLAF13: 5’-GCTTCTGTATCTGACTTGTC-3’
Positive clones that carry the targeted alleles were tested either by
Southern blot or transiently transfected with a Cre recombinase plasmid
(pMC-Cre) (kindly provided by Dr. Mary Cheng).
4.2.9 ES cell culture and transfection
Tissue culture dishes were incubated with autoclaved 0.1% Gelatin
(Sigma). After 15 mintues, the gelatin was removed and the dishes were
filled with DMEM before adding cells to prevent hypotonic lysis. The ES cell
stock vials were removed from nitrogen tank and thawed immediately in a
37oC water bath. The ES cells were then plated to gelatin-coated culture
dishes with DMEM supplemented with 10% FBS, 1mM glutamine and
0.1mM β-mercaptoethanol and maintained at 37°C in a humidified CO2
incubator. One day before transfection, ES cells were plated onto 24 well plate at a density of 2 x 104 cells per well, and incubated for 24 hours in 500
µl supplemented DMEM without antibiotics at 37oC. Transfection of cells was
carried out by lipofection using Lipofectamine 2000 Transfection Reagent
(Invitrogen). 100 mg of pMC-Cre plasmid DNA was used for each positive
ES cell clones per well. 100ng of pMC-Cre and 100 mg of mVps36-LoxP plasmid DNAs per dish were used for double transfection to wt ES cells and
129 used as positive controls for three possible Cre recombinations. 100 ng of
pMC-Cre or 100 ng mVps36-LoxP plasmid DNA alone was transfected to wt
ES cells as negative controls.100 or 200 ng plasmid DNA(s) was diluted in
50 µl OPTI-MEM reduced serum medium (Invitrogen). Then 1.5 µl
Lipofectamine 2000 was mixed with 50 µl OPTI-MEM and incubated for 5
minutes at room temperature. After the 5-minute incubation, combine the
diluted DNA with the diluted Lipofectamine 2000 and incubate for 20 minutes at room temperature. Then the DNA-Lipofectamine 2000 complexes were added drop by drop to each well and incubate the cells at 37°C in a CO2 incubator for 24 hours before DNA extraction.
4.2.10 Southern blotting
4.2.10.1 Solutions for Southern blotting
Depurination solution – 11 ml HCl, 989 ml ddH2O. Store at room
temperature for up to 1 month.
Denaturation buffer – 87.66 g NaCl, 20 g NaOH, make up to a final
volume of 1 L with ddH2O. Store at room temperature for up to 3 months.
Neutralization buffer – 87.66 g NaCl, 60.5 g Tris, adjust to pH 7.5 with
HCl, make up to a final volume of 1 L with ddH2O. Store at room temperature for up to 3 months.
Nucleic acid transfer buffer (20X SSC) - 88.23 g Tri-sodium citrate,
175.32 g NaCl, check the pH 7-8, make up to a final volume of 1 L with ddH2O. Store at room temperature for up to 3 months.
130 50x Denhardt’s solution – 1 g bovine serum albumin, 1 g ficoll 400, 1
g polyvinylpyrrolidone, make up to a final volume of 100 ml with ddH2O.
Store at -20°C for up to 3 months.
Hybridization solution – 5x Denhardt’s solution, 6x SSC, 0.5% SDS,
50 μg/ml denatured DNA.
4.2.10.2 Preparation of radiolabelled probe
The Unr probe was a PCR fragment amplified by the following
primers: UNR-SBF2 5’-GGAGTAAGGTTAGAGTTGTG-3’ and UNR-SBR2
5’- GCAACTATGGCTTGTCCTGAAC-3’. The probe was diluted to a
concentration of 25 ng in 45 μl of TE buffer (10 mM Tris HCl pH8.0, 1 mM
EDTA). The DNA probe was denatured by heating to 95–100°C for 5
minutes followed by immediate cooling on ice for 5 minutes. The probe was
incubated with the reaction tube and 5 μl of Redivue [32P] dCTP and mixed
by pipetting up and down about 12 times. The labeling reaction was
incubated at 37°C for 10 minutes. The reaction was stopped by adding 5 μl
of 0.2 M EDTA. For use in hybridization, the probe was denatured by heating to 95°C for 5 minutes, and placed on ice immediately. 14 μl of this labeled probe was used per 5 ml of hybridization buffer.
4.2.10.3 Restriction enzyme digestion of genomic DNA
Digest 10 μg of genomic DNA with one or more restriction enzymes in a total volume of 300 μl. Allow water, buffer and DNA to stand at 37°C for 10 to 15 min prior to adding enzymes. Leave the digestion reaction at 37°C overnight. After digestion is complete, the DNA is precipitated with 2
131 volumes of ethanol. The DNA pellet is resuspended in 18 μl water and 2 μl
gel loading dye. The DNA is separated by electrophoresis through a 0.7%
agarose gel with 1X TAE containing 0.5 μg/ml ethidium bromide. After electrophoresis is completed, photograph the gel with a transparent ruler alongside the gel so that the distance that any band of DNA has migrated can be read directly from the image.
4.2.10.4 Neutral transfer gel treatment protocol
Process the gel for blotting, between each step rinse the gel in distilled water.
Depurination - Fragment DNA by immersing the gel in 0.125 M HCl for 10 minutes or until the bromophenol blue dye turns yellow. Depurination is not required for DNA fragments <10 kb in size.
Denaturation – Denature DNA by soaking gel in sufficient denaturation buffer for 30 minutes with gentle agitation. During the time the bromophenol blue dye will return to its original color.
Neutralization – Neutralize the gel by placing the gel in sufficient neutralization buffer for 30 minutes with gentle agitation.
Membrane Preparation - Cut the nylon membrane (Hybond-N+,
Amersham) to exactly the same size as the gel. Pre-wet the membrane in distilled water until thoroughly wet. Then immerse the membrane in 2 x SSC prior to blotting.
132 4.2.10.5 Capillary transfer and immobilization
Half fill a tray of a suitable size with the transfer buffer. Make a
platform using a glass plate and cover with a wick made from three pieces of
filter paper (chromatography grade, Fisher) saturated in transfer buffer.
Place the gel on the wick platform. Avoid trapping any air bubbles between
the gel and the wick. Surround the gel with Parafilm to prevent the transfer
buffer being absorbed directly into the paper towels. Place the membrane
over the gel and avoid trapping any air bubbles. Place three sheets of filter
paper cut to size and saturated in transfer buffer. Place a stack of paper
towels on top of the filter paper at least 5 cm high. Finally place a glass plate
and a weight on top of the paper towels. The weight should not exceed 750g
for a 20x20 cm gel. Allow the transfer to go overnight. After blotting, carefully
dismantle the transfer apparatus. Before separating the gel and membrane,
mark the membrane to allow identification of the tracks with a pencil. Fix the
DNA to the membrane by using an optimized UV crosslinking procedure with a UV crosslinker (FB-UVXL-1000, Fisher). Blots may be used immediately or thoroughly dried if storage is needed.
4.2.10.6 Hybridization
The hybridization was performed by placing the blot in a plastic bag.
The blot was pre-wet in 5x SSC hybridization buffer for 30 minutes at 60°C with constant agitation. Denatured DNA probe was added to the
hybridization buffer in the bag and incubated in a 60°C water bath with gentle agitation overnight. The hybridization buffer volume used was 125
133 μl/cm2 of membrane. The next day after overnight hybridization, the blot was
washed in 2x SSC and 0.1% SDS twice, 5 minutes each at room
temperature, followed by 0.1x SSC, 0.1% SDS for 2x 10 minutes at the
hybridization temperature. The wash solution was used in excess at 5ml/cm2.
After the last wash, the blot was wrapped and exposed to X-ray film.
4.2.11 Total RNA extraction
Total RNA was isolated from mouse tissues using TRIzol reagent
(Invitrogen) following manufacturer’s instructions. Briefly, tissue was
homogenized using a glass Teflon homogenizer in 1 ml TRIzol reagent.
Proteins and lipids were separated from the mixture by addition of 0.2 ml chloroform. RNA was precipitated by addition of 0.5 ml isopropanol.
Precipitated RNA was air dried and dissolved in RNase-free water. Total
amount of RNA was quantitated after measuring optical density of the
sample. Samples were stored at -80°C.
4.2.12 DNase treatment
DNA-Free kit (Ambion) was used to eliminate DNA contamination in
RNA extracts following manufacturer’s instruction . For a 50μL reaction, 10
μg of RNA extract was incubated with 2 units of DNase at 37°C for 30 min.
Then 5μL DNase inactivation reagent was added, and the sample was
incubated at room temperature for 2 minutes, mixing occasionally.
Inactivation reagent was precipitated by centrifugation at 10,000g for 1.5
134 minutes. The supernatant with pure RNA in it was transferred to a fresh tube.
Samples were stored at -80°C.
4.2.13 Reverse transcription
Reverse transcription reactions were performed using RETROscript
kit (Ambion) to produce cDNA from RNA extractions. Briefly, 1 μg of DNA- free RNA was mixed with Oligo(dT) primers and incubated at 80°C for 3 minutes to heat-denature the RNA. The reactions were kept on ice immediately, and RT buffer, dNTP mix, RNase inhibitor and MMLV-RT were added. The mixture was incubated at 42°C for one hour followed by 92°C for
10 min to inactivate the RT. The cDNA product from RT reaction was stored at -20°C.
4.2.14 Real-Time PCR
All Real-Time PCR reactions were performed in a 20 μl mixture containing 1μl of cDNA product from RT, 1X iQ™ SYBR® Green Supermix
(Biorad), 0.3 μM of each primers. Real-Time PCR was performed using the
BIO-RAD iCycler iQ system (BioRad). The fluorescence threshold value was calculated using the iCycle iQ system software.
The Primer sequences were as follows:
Cre: PCR produces a 421 bp fragment.
Cre 5’ 5’-GCCGAAATTGCCAGGATC-3’
Cre 3’ 5’-AGCCACCAGCTTGCATGATC-3’.
135 β-actin: PCR produces a 346 bp fragment.
β-actin-2a-F 5’- GCATGTGCAAAGCCGGCTTC-3’
β-actin-2a-R 5’-GGGGTGTTGAAGGTCTCAAA-3’.
L7: PCR produces a 115 bp fragment.
L7-exon3-F 5’-CTGCTCCAGAGAAGGACAATC
L7-exon3-R 5’-AAGGGGCCGATAGGTTGGAAG-3’.
4.2.15 Tamoxifen treatment
Tamoxifen stock solution was prepared by addition of 100% ethanol to 10 mg of tamoxifen (Sigma) to obtain a 100mg/ml tamoxifen suspension.
A 10 mg/ml tamoxifen solution was prepared by addition of autoclaved sunflower seed oil, followed by 30 min sonication with a.ultrasonicator, and stored at 4°C for a week or at -20°C for months. The tamoxifen solution was sonicated just before use. Four to Eight weeks old mice were injected intraperitoneally (ip) once a day with vehicle (oil) or with 1 mg tamoxifen for 5 consecutive days.
4.2.16 Perfusion
Transgenic mice were perfused with two different fixing solutions depending on the following experiment. If the brain tissue is to be used for immunohistochemistry, 4% paraformaldehyde in 1X PBS will be used. If the the brain tissue is be analyzed for wholemount LacZ staining, a fixing solution containing 2% Paraformaldehyde in 1X PBS and 1X Blue I (0.12 M
136 PIPES, 2 mM MgCl2 and 2 mM EGTA, pH=7.6) will be used. Brain and
cerebellum were dissected followed by further one hour fixation in the fixing solution. For immunohistochemistry, samples were kept in 22% sucrose with
1 mM EDTA at 4°C until used. For X-Gal staining procedure, samples were washed with PBS twice and immediately put into staining solution.
4.2.17 X-Gal staining
Dissected brain samples were incubated in freshly presterilized X-Gal
(5-bromo-4-chloro-3-indoly solution containing X-Gal (1 mg/ml, in DMSO)
and Blue II (4.8 mM potassium ferricyanide, 4.8 mM potassium ferrocyanide,
2 mM MgCl2, 0.02% NP40, 0.2 mM sodium deoxycholate and 1X PBS). For
one cerebellum, 5 ml of the staining solution was used. The samples were
incubated at 37°C for 4-5 hours or at room temperature overnight. Samples
were washed with 1X PBS twice and stored in 1X PBS with 50 mM EDTA at
4°C. Whole mount pictures were taken using camera attached to the
dissecting microscope.
For histochemical analysis, samples were sectioned using the
cryostat. Before sectioning, samples were kept in 22% sucrose with 1mM
EDTA overnight at 4°C. 40 μm-thick tissue sections were collected by the
cryostat and kept in 1X PBS. The sections were then stained in X-Gal
staining solution overnight at room temperature. Tissue sections were post-
fixed in 4% Paraformaldehyde, washed with 1X PBS twice and with water once, and mounted on slides. After air drying, sections on microscope slides
137 were counter-stained with Nuclear Fast Red, and subjected to a series of
ethanol wash to remove water (70, 80, 90, 95 and 100% ethanol). The sections were incubated in Histoclear (HS-200, National Diagnostics, Atlanta,
GA) for 10 min and coverslipped using Permount (SP15- 100, Fisher,
Pittsburgh, PA). They were analyzed under the Zeiss microscope, and images were taken using the MetaVue Imaging Software.
4.2.18 siRNA transfection in HEK 293 cells
To achieve the selective knockdown of Unr and Vps36, double- stranded 21-mer RNA duplexes argeted at regions of sequence that are unique to each protein were designed and ordered. Unr-specific siRNA , siRNA-u, sense sequence is GGACAGAAAUGGUAAAGAAUU (Dharmacon).
Three Vps36-specific siRNAs were designed and synthesized by Ambion.
The sequences were shown as follows: siRNA-v1 5’-
CGGCGAGGAGAAGAUAAATT-3’; siRNA-v2 5’-CCAUCAGGUUUAAGUCG
UATT-3’; siRNA-v3 5’-CGACACUGAGCUAAGAGAUTT-3’. Each siRNA duplex was delivered into target cells via the reagent LipofectAMINE 2000
(Invitrogen). Specifically, 5 μl LipofectAMINE 2000 (1 mg/ml) was diluted in
100 μl Opti-MEM, and, separately, 125 pmol of each siRNA sample and 1 μg pET16b-Unr or pET16b-Vps36 DNA were diluted in 100 μl Opti-MEM. 200 μl siRNA–DNA transfection complexes were added to each well, and the plates were incubated for 24 hr at 37°C (5% CO2).
138 4.3 RESULTS
4.3.1 Unr and Vps 36 targeting vector construction and homologous
recombination.
4.3.1.1 Unr targeting vector construction and homologous
recombination.
To construct a conditional Unr allele, a gene targeting vector Unr-
LoxP was constructed in which exons 3 and 4 are flanked by LoxP (flox)
sites in the adjacent introns (Figure 4.2). The targeting vector also includes
DTA for negative selection and a neomycin (neo) resistance gene, which is
flanked by a third LoxP sites and two flp recognition targets (frt), for positive
selection (Figure 4.2). The deletion of exon 3 and exon 4 will lead to a shift
in the open reading frame (ORF) and result in a null mutation. The Unr-LoxP
targeting construct has already been injected into embryonic stem cells.
Neomycin-resistant colonies were first screened for homologous recombinants using PCR covering the short arm of the targeting construct.
Two out of 288 neo-resistant clones, 1C5 and 1D2, were identified having the homologous recombination containing the UNRfloxneo allele. DNA from ES
cell clone 1C5 and 1D2 were digested with EcoRI and subjected to Southern
blot analysis to confirm the homologous recombination. The desired
recombinations are within the long arm and the short arm introducing a new
EcoRI site, therefore resulting in a new fragment shorter than the wt allele
(Figure 4.2A). However, the result was surprising. Instead of giving a 6.7 kb
DNA band of the correct homologous recombination, there was a 11.7 kb
139 fragment. The result could only be explained that the recombinations occurred within the middle arm and the short arm. Therefore, instead of introducing a new EcoRI site which makes the targeted allele shorter, the resultant targeted allele now has an extra 0.9 kb due to the insertion of the neo cassette (Figure 4.2B). In conclusion, the first attempt for ES cell homologous recombination failed.
4.3.1.2 Vps36 targeting vector construction and homologous recombination.
To construct a conditional Vps36 allele, a gene targeting vector
Vps36-LoxP was constructed in which exons 5 and 6 are flanked by LoxP in the adjacent introns (Fig. 4.3). The targeting vector also includes DTA for negative selection and a neomycin (neo) resistance gene, which is flanked by a third LoxP site and two flp recognition targets (frt), for positive selection.
The deletion of exon 5 and exon 6 will lead to a shift in the ORF and result in a null mutation. The Vps36-LoxP targeting construct has already been injected into ES cells. Neomycin-resistant colonies were first screened for homologous recombinants using PCR covering the short arm of the targeting construct. Four out of 384 neo-resistant clones, 1G2, 1H2, 2C4 and 5F9, were identified having the homologous recombination containing the
Vps36floxneo allele (Figure 4.3B). To test the presence of 3 LoxP sites on the targeting allele, four positive ES clone cultures were transfected with pMC-
Cre vector. In principle, the transient expression of Cre recombinase would
140 recognize all the available LoxP sites and 3 possible recombination would
occur as shown in Figure 4.4. The resultant recombinations were tested by
corresponding primers and clone 1G2, 2C4 and 5F9 were shown containing
all 3 LoxP sites. I am in the process of confirming the homologous
recombinations by Southern blotting. Once it is done, these 3 clones will be
injected into blastocysts to generate chimeric mice.
4.3.2 Generation and recombinase activity of L7P1-CreERT2 transgenic
mice
To express the CreERT2 recombinase in the cerebellar Purkinje cells, the 7kb MfeI fragment of L7P1-CreERT2 (Figure 4.6) was injected into fertilized eggs. The CreERT2 transgene was detected in mouse tail DNA by
PCR and four transgenic lines, 1,2,15,27 were identified. RealTime-PCR
was performed to estimate the level and expression specificity of CreERT2
mRNA in the brain. Two lines, 15 and 27 had detectable CreERT2 mRNA in
the cerebellum and therefore further studied (Figure 4.8). The CreERT2
expression pattern in the brain of line 15 and 27 was analyzed by
immunohistochemistry. Only line 27 was weakly detectable in Purkinje cells
(data not shown), which is consistent with the low mRNA level. As CreERT2 is located in the cytoplasm in the absence of ligand, its presence in Purkinje cells might not be easily detectable when expressed at low levels.
To estimate the CreERT2 protein activity, transgenic mice of line 15
and 27 were crossed with a Cre reporter mouse strain, Gt(ROSA)26Sor
141 tm1Sho (Jackson Laboratory). The strategy is illustrated in Figure. 4.5. The Cre
reporter strain was engineered by modifying the proviral B-galactosidase-
neomycine phosphotransferase fusion gene (Bgeo) –trapped reverse
orientation splice acceptor Bgeo line 26 (ROSA26) locus by insertion of a
floxed stopper fragment in ES cells. Bgeo is expressed only after Cre-
mediated excision of the stopper sequences. It has been reported to be an
improved reporter stain for monitoring Cre-mediated recombination (Mao et
al., 1999). Offspring of the double transgenic mice were identified by
genotyping using Cre specific primers. Four weeks old CreERT2/ROSA26
mice were therefore treated with either vehicle oil or with 1 mg tamoxifen by
i.p. injection for five consecutive days. Three days after the last injection,
mice were sacrificed and brain tissues were subjected for whole-mount X-gal
staining. However, no detectable LacZ staining was identified. There are
several possible explanations for non-Cre mediated recombination. First,
since the CreERT2 mRNA levels of both lines were not high compared to the
endogenous L7 mRNA, it is possible that the CreERT2 protein concentration in Purkinje cells is too low to induce DNA recombination. Second, tamoxifen dosage was not high enough for efficient CreERT2 translocalization into
nucleus because i.p. injection is not efficient for tamoxifen absorption. Third,
the ROSA26 reporter line does not work efficiently for cerebellar Purkinje
cells.
To rule out the potential problem of ROSA26 reporter strain, a
constitutive Cre line (Barski et al., 2000) was crossed with the reporter line
142 and the double transgenic L7Cre/ROSA26 mice were analyzed for β-
galactosidase by X-gal staining. As shown in Figure 4.7, the X-gal positive
cells were mainly detected in the cerebellum. Sagittal section of cerebellum
analyzed by X-gal staining showed that Purkinje cells are β-galactosidas
positive. The above result indicate that the ROSA26 reporter line t work
efficiently for cerebellar Purkinje cells.
It has been shown that the LD50 of tamoxifen in mice is 15-fold higher via the oral route than by i.p. injection (Furr and Jordan, 1984). Therefore, it
is possible that the dosage of 1mg tamoxifen per day via i.p. injection did not
induce an effective blood concentration in the cerebellum. To address this
issue, four weeks old CreERT2/ROSA26 mice were therefore treated with either vehicle oil or with 1.5 mg tamoxifen by oral gavage.for eight consecutive days. The β-galactosidase activity was analyzed either 10 days or 24 days after the last administration. We could only detected ~20 Purkinje
cells on the sagittal section of hemi-brains stained with whole-mount LacZ.
4.3.3 Generation and recombinase activity of L7P4-CreERT2 transgenic
mice
As the L7P1-CreERT2 did not show high expression level of Cre
transgene, we decided to add extra 3 kb promoter sequences upstream of
the 1 kb promoter. We expected the extra promoter fragment to increase the
Cre transgene expression. To express the CreERT2 recombinase in the
cerebellar Purkinje cells, the 10 kb MfeI fragment of L7P4-CreERT2 was
143 injected into fertilized eggs. The CreERT2 transgene was detected in mouse tail DNA by PCR and 6 transgenic lines 1, 2, 3, 9, 10 and 30, were identified from multiple blastocyst injections. Founders of line 1 and line 2 were sacrificed after a few failed attempts of breeding. RealTime-PCR was performed to estimate the level and expression specificity of CreERT2 mRNA
in the brain. It revealed that Line 9 and 10 had similar moderate levels of
CreERT2 mRNA in the cerebellum and detectable amount in the brain. Line 3
and 30 had weak and similar expression as the L7P1-CreERT2 lines (15 and
27) in the cerebellum, . Line 9 and 10 had expression that was 2.5~3 fold
higher in the cerebellum than line 3 and 30 (Figure 4.8). As Line 3 was the
first available transgenic line we got, we carried on analyzing its CreERT2 protein activity by crossing it to the ROSA reporter mouse strain. Offspring of the double transgenic mice were identified by genotyping using Cre specific primers. Four weeks old CreERT2/ROSA26 mice were either treated with 1.5
mg tamoxifen by i.p. injection or oral gavage for eight consecutive days. 10
days after the last injection, mice were sacrificed and brain tissues were
subjected for whole-mount X-gal staining. However, the staining in the
Purkinje cell layer was very weak and only a few LacZ positive Purkinje cells
were observed on the sagittal section of hemi-brains (Figure 4.9). This could
be explained that the Cre mRNA level of Line 3 was very low compared to
that of the endogenous Cre. Other transgenic lines are still breeding. Once
Cre positive pups are identified, Cre recombinase activity will be tested by
144 crossing with the LacZ reporter strain. Analysis of the higher expression
Line 9 corssed to the ROSA reporter mouse is in progress.
4.3.4 Reduction of Unr and Vps36 expression by RNA interference
As described above, the efficiency of homologous recombination in
ES cells is very low. Generation of conditional knockout mice is a time-
consuming and complicated project. As both Unr and Vps36 are expressed
abundantly in neurons in the brain, we decided to knock down the gene
expression using specific siRNAs in primary cortical and glial cultures. This
approach may allow us to explore the roles of these proteins in neurons and
glia by examination of the effects on dendrite and axon growth. In addition,
in the future we could also look at the effect of knock-down on dendritic
localization of neuronal mRNAs, such as MAP2 or CaMKIIα.
To reduce the expression of Unr, I designed one siRNA duplexes that targeted the segment 699-720 of the mouse Unr open reading frame. To reduce the expression of Vps36, we ordered three pre-designed siRNA duplexes (Ambion) that targeted the segments 84-104, 641-659 and 1106-
1126 of the mouse Vps36 open reading frame. To test the effectiveness of
these siRNAs, HEK 293 cells were transfected with the transfection reagent
alone, a non-specific siRNA (Ambion) or different siRNAs designed against
either Unr or Vps36 together with his-tag Unr or Vps36. First, to quantify the
level of Unr and Vps36 expression, cell lysates were prepared from control
and siRNA-transfected cells and analyzed by western blot using specific
145 anti-HisG antibody. As shown in Figure 4.10, addition of the non-specific
siRNA did not alter the levels of his-tag Unr or his-tag Vps36. However, transfection of siRNAs directed against Unr or Vps36 resulted in a marked inhibition of his-tag Unr or his-tag Vps36 expression, respectively. The three siRNAs specific to Vps36 were equally effective in inhibiting Vps36 expression. The endogenous beta actin protein expression was not affected in all the experiments. Future experiments will be transfecting these siRNAs into primary cortical cultures to reduce the endogenous Unr and Vps36 expression and analyzing any changes in the neurons.
4.4 DISCUSSION
In this chapter, I presented progress on generating conditional knockout of Unr and Vps36. This project includes two parts. One is generation of targeting allele of Unr and Vps36 in ES cells, respectively. The other one is to create an inducible cerebellar Purkinje cell-specific Cre transgenic line. To this end, successful homologous recombination has been achieved in ES cells for Vps36. Analysis of the cerebellar Purkinje cell- specific Cre transgenic line is still continuing.
Gene inactivation by homologous recombination has become an important approach to study the function of genes and proteins in mice. A major limitation of this approach is the low efficiency of homologous recombination events of the transfected DNA. Although the factors that are most critical for determining the gene targeting efficiency are not yet well
146 understood, we know there are a few factors should be taken into account
when designing a targeting allele.
First, procedures for positive/negative selections were developed to
partially increase selecting the correct targeting events. Rate of correct
homologous recombination is often in the range of ~1% in the absence of
selection. Negative selection markers (lost after correct recombination) can
yield an up to 10-fold enrichment of correct targeting events. In the targeting
vectors that we constructed, a positive selection marker neo and a negative
selection marker DTA was included in the targeting vector. As described on
the results section, the positive ES clones for Vps36 were only 3 out of 384,
which is less than 1%. For the Unr targeting vector, we did not identify a
single positive clone from 288 ES clones. The result indicated that the
frequency of homologous recombination for the two targeting vectors that we
made was almost as if there was not selection at all. This suggests that the
DTA selectable marker is non-functional.
Second, improved efficiency of homologous recombination was also
achieved by using constructs that take into account factors known to affect this process, such as the degree of sequence identity between the exogenous and endogenous DNA and the length of the homologous sequences (Bronson and Smithies, 1994; Moreadith and Radford, 1997).
However, even when these factors are considered, great variability in the
efficiency of homologous recombination between various constructs and
genes still exists, suggesting that additional parameters such as the intrinsic
147 properties of the DNA sequences themselves may also affect the process.
When the two targeting vectors were designed, we took all the possible factors that may affect the targeting frequency into account. We used isogenic BAC DNAs (from the same ES cell line) as templates to amplify the homologous arms. The length of each homologous arm is around the optimal range. One possible explanation for the different rate the gene targeting between Unr and Vps36 is that the intrinsic properties of the DNA sequences play an important role in the efficiency of homologous recombination.
To achieve the inducible conditional knock out, we had the tamoxifen- inducible CreERT2 recombinase expressed under the control of the L7 promoter to generate Purkinje cell-specific temporally controlled targeted mutations in transgenic mice. These mice will be useful to analyze the function of many genes that are involved in Purkinje cell and cerebellar functions. So far, we have only tested the Cre recombinase activity in line 27 and line 3, which only had weak expression of CreERT2 recombinase in the cerebellum. According to the ROSA26 reporter line, although the CreERT2 recombinase activity is present in cerebellar Purkinje cells, it is not high enough to be further used in generating conditional KO mice. One point worth to mention is that we got higher (or moderate) expression of CreERT2 in the cerebellum (line 9&10) using L7 4kb promoter as we predicted.
Another explanation for the low CreERT2 recombinase activity in the cerebellum could be that local concentration of tamoxifen in the cerebellum
148 is not high enough to drive the Cre-mediated gene recombination. Lack of
CreERT2 -mediated recombination in the brain has been reported by
Hameyer and colleagues. Another group has also showed that CreERT2 - mediated deletion was inefficient in the brain (Takeda et al., 2007). However, successful CreERT2-mediated gene recombinations have also been shown
in astrocytes (Hirrlinger et al., 2006), oligodendrocytes cells (Leoneo et al.,
2003) in the central nervous system. The blood brain barrier could be an
issue for the tamoxifen to reach a reasonable dose for the induction of
T2 CreER recombinase. It has been shown that the LD50 of tamoxifen in mice
is 15-fold higher via the oral route than by i.p. injection (Furr and Jordan,
1984). Once we identified a good CreERT2 line, we will compare the effect of
different administration routs on the level of recombinase activity.
We are still in the process of testing L7P4-CreERT2 line 9, which has
~3-fold higher Cre mRNA expression in the cerebellum than any other lines we have tested so far.
149
Figure 4.1 Cloning sites on the backbone vector pSPUC_LFneo(+).
150
Figure 4.2 Genenration of targeted ES cells for Unr KO. A) Scheme of the gene targeting strategy. B) The scheme of the gene targeting at the wrong region. C) Southern blot analysis of genomic DNA extracted from positive ES clones. Homologous recombination occurred between the middle arm and short arm instead.
151
Figure 4.3 Genenration of targeted ES cells for Vps36 KO. A)Scheme of the gene targeting strategy. B) PCR screening of homologous recombination in ES cells. Primer pair A tests the homologous recombination between long arm and middle arm, while primer pair B tests the recombination downstream between middle arm and short arm. These PCR experiments showed four positive ES clones, 1G2, 1H2, 2C4 and 5F9.
152
Figure 4.4 Cre recombinase activity in the ES cells. A) Expected three different recombination events when Cre recombinase if present. B) Transfected Cre recombinase is present in every positive ES clone. C) Three recombination events are present in ES clone 1G2, 2C4 and 5F9.
153
Figure 4.5 Diagram of the tamoxifen-inducible expression system. In the presence of tamoxifen, CreERT2 recombinase will be active and the stop sequence between two LoxP sites will be deleted for LacZ expression.
154
L7P1-CreERT2
Ex’s 1 Ex2 Ex3 Ex4
L7 1Kb promoter L7 structural gene L7 3’ end processing signal T2 Cre-ER L7 3’UTR
T2 Figure 4.6 Schematic representation of the L7P1-CreER transgenic construct.
155
Figure 4.7 Constitutive L7 Cre mediated gene recombination in the ROSA26 reporter mice. A) Whole-mount LacZ stains of hemi-brains viewed in sagittal lane. B) Same as A, close-up view of the cerebellum. C) Sagittal section showing LacZ staining restricted to Purkinje cells. Scale bars: A, 1 mm; B, 500 µm; C, 10µm.
156
6000 c (cbm) 5000 b (brain) 4000
3000
2000 Relative expression Relative 1000
0 c b c b c b c b c b c b c b wt Line 15 Line 27 Line 3 Line 9 Line 10 Line 30
T2 T2 L7P1-CreER L7P4-CreER
Figure 4.8 Actin-normalized relative expression levels of L7-CreERT2 mRNA determined by Real-Time PCR.
157
A B
Figure 4.9 L7P4-CreERT2 (line 3) mediated gene recombination in the ROSA26 reporter mice. A) Whole-mount LacZ stains of hemi-brains viewed in sagittal lane. B) Sagittal section showing LacZ staining in some Purkinje cells. Scale bars: A, 1 mm; B, 1mm. Arrow, postitive Purkinje cells.
158
Figure 4.10 Characterization of siRNA directed against Unr and Vps36 in HEK 293 cells. A) 40µg of cell lysates from controls and siRNA transfections was run on a polyacrylamide gel and analyzed by western blot. The controls are, respectively, from left to right: cells transfected only with the transfection reagent, and cells transfected with a non-specific siRNA. Cell lysates were transfected with either pET16b-Unr alone or cotransfeced with Unr-specific siRNA. His-tag Unr expression was reduced by Unr- specific siRNA using anti-HisG antibody. B) 40µg of cell lysates from controls and siRNA transfections was run on a polyacrylamide gel and analyzed by western blot. The controls are, respectively, from left to right: cells transfected only with the transfection reagent, and cells transfected with a non-specific siRNA. Cell lysates were transfected with either pET16b- Vps36 alone or cotransfeced with Vps36-specific siRNA, v1, v2 and v3. His- tag Vps36 expression was reduced by three Vps36-specific siRNA using anti-HisG antibody.
159
CHAPTER 5
ROLES OF L7 PROMOTER/ENHANCER AND 3’-END RNA PROCESSING
SIGNAL IN CONTROL OF GENE EXPRESSION
5.1 INTRODUCTION
In the brain proper, L7 gene expression is specifically found in cerebellar Purkinje cells. In an effort to investigate the molecular and genetic mechanisms of the specific expression, our lab has employed a transgenic approach to introduce mutations and deletions in the L7 structural gene and/or promoter sequences and observe the effect in vivo. We generated expression constructs carrying L7 promoter and/or L7 structural gene in combination with another promoter and a LacZ reporter, and expression of these hybrid genes was indicated by LacZ expression patterns. This work has been facilitated by the small size of the L7 structural gene. Based on recently reported studies, we have made the following conclusions
(Serinagaoglu et al., 2007): (i) L7 structural gene does not have the capacity
160 to drive cerebellar Purkinje cell-specific expression. (ii) Attachment of the 0.9 kb proximal-most fragment of the L7 gene promoter in an inverted orientation upstream of other promoters and LacZ reporter resulted in highly reproducible and robust cerebellar Purkinje cell expression. (iii) The enhancer activity of the 0.9 kb proximal L7 promoter requires the cooperation of a 2 kb structural gene fragment to act as a classic position- independent enhancer that is specific for cerebellar Purkinje cells
(Serinagaoglu et al., 2007). Furthermore, the structural gene can only act as a co-enhancer when configured as part of the primary transcript, but not outside of the transcript. However, neither fragment alone is sufficient to drive Purkinje cell-specific expression.
The observation that the 0.9 kb proximal L7 promoter and the structural gene both contribute to the enhancing activity lead us to hypothesize the 0.9 kb promoter fragment would not behave as a classic enhancer responsible for the cell-specific expression without the structural gene. In this chapter, LacZ reporter assays in vivo was used to determine the minimum size of promoter/enhancer and structural gene fragments that are required to drive Purkinje cell expression. Using a minimal promoter test, we proved that this hypothesis is not correct, and in fact the 0.9 kb fragment has some enhancer activity on its own when placed in multiple copies, without the structural gene.
161 5.2 MATERIALS AND METHODS
5.2.1 Mouse strains
All the mice were kept in the FVB/N strain using the standard
procedures in the Transgenic Mouse Facility of The Ohio State University.
5.2.2 Generation of transgenic mice
5.2.2.1 DNA constructs for transgenic mice
Three constructs were tested so far for the purpose of testing the minimal promoters required for specific Purkinje cell gene expression. They are OJ22 (3Xenh-hsp), OJ23 (1Xenh-hsp-3'UTR) and OJ27 (3Xenh/3kb-hsp)
(Figure 5.2 A, B & C, respectively).
A PCR fragment of Hsp minimal promoter-LacZ cassette-bovine growth hormone (BGH) poly(A) and 3’-end processing signals was amplified using pIND/LacZ as the template. It was made by the following primers:
PIND-fr-5’ 5’-AGCTCAGTAGTCGACAGTACCT-3’
PIND-fr-3’ 5’-TTAATGGTCGACTACCCCGGGCGTGGGGATA-3’
The PCR fragment was digested with SalI and inserted into the base vector
Psp72 to make the Psp72-LacZ construct.
0.9 kb L7 proximal promoter fragment was made by PCR using EM1 vector, which has 4 kb L7 promoter and 2 kb structural gene, as the template.
The primer sequences used were shown as follows: L7Prom850-5’: 5’-
TAACTCGAGTCCTGAAAGGTATCTTGGAGATAGG-3’ and L7Prom850-3’:
5’-ATACTCGAGTACGTCGACCCCCTGTGTGTTATAG-3.
162 L7 3’UTR and 3’-end processing signal fragment was amplified by
PCR using L7ΔAUG as the template. The primer sequences used were shown as follows:
L73’UTR-F-XhoI 5’-TCACCCCTCGAGATCCTGCTGCACTCA-3’
L73’UTR-R-XhoI 5’-TGTACTCCTCGAGCCTTCCCATCACAC-3’
An extra 3 kb promoter upstream of the 0.9 kb proximal promoter fragment was amplified by PCR using L7ΔAUG as the template. The primer sequences used were shown as follows:
L7Prom4kb-F 5’-GAGTCGAC TTCAATTCCATCCATGAC-3’
L7Prom4kb-R 5’-CAGTCGACGTCTGTTCCTATCTCC-3’
To make construct OJ22 (3Xenh-hsp) in Figure 5.1.B, one copy of 0.9 kb L7 proximal promoter PCR fragment was digested with XhoI and SalI and inserted into the SalI site on Psp72-LacZ. This step was repeated 3 times to obtain 3 copies of L7 promoter/enhancer upstream of the Hsp minimal promoter.
To make construct OJ23 (1Xenh-hsp-3'UTR) in Figure 5.1.E, one copy of 0.9 kb L7 proximal promoter PCR fragment was digested with XhoI and
SalI and inserted into the SalI site on Psp72-LacZ. The resultant construct was then digested with XhoI and ligated to the XhoI digested PCR product of
L7 3’UTR and 3’-end processing signal.
To make construct OJ27 (3Xenh/3kb-hsp) in Figure 5.1.F., 3 kb extra promoter PCR product was digested with SalI and cloned into OJ23 construct right upstream of the Hsp minimal promoter.
163 5.2.2.2 Preparation of DNA for pronuclear injection.
All the constructs were prepared using QiaFilter Plasmid Maxi kit
(Qiagen). 50 μg of DNA was digested with SmalI, gel purified and injected
into fertilized mouse oocytes using standard procedures (Oberdick et al.,
1993).
5.2.2.3 Genotyping
The offsprings were screened for the presence of the transgene in tail
DNA by PCR analysis. The primer sequences are as follows:
LacZ set 2: PCR produces a 225 bp fragment.
LacZ-F2 5’-CCATTGTCAGACATGTATACCCCGTACGTC-3’
LacZ-R2 5’- GCCACCAATCCCCATATGGAAACCGTCGAT-3
LacZ set 3: PCR produces a 210 bp fragment.
LacZ-F3 5’- ATTGACCCTAACGCCTGGGTCGAACGCTGG-3’
LacZ-R3 5’-AACATCAACGGTAATCGCGATTTGACCTCT-3’
.
5.2.3 Perfusion
Transgenic mice were perfused with a fixing solution containing 2% paraformaldehyde in 1X PBS and 1X Blue I (0.12 M PIPES, 2 mM MgCl2 and 2 mM EGTA, pH=7.6). Brain and cerebellum were dissected followed by further one hour fixation in the fixing solution. For X-Gal staining procedure, samples were washed with PBS twice and immediately put into staining solution.
164 5.2.4 X-Gal staining
Dissected brain samples were incubated in freshly presterilized X-Gal
(5-bromo-4-chloro-3-indoly solution containing X-Gal (1 mg/ml, in DMSO)
and Blue II (4.8 mM potassium ferricyanide, 4.8 mM potassium ferrocyanide,
2 mM MgCl2, 0.02% NP40, 0.2 mM sodium deoxycholate and 1X PBS). For
one cerebellum, 5 ml of the staining solution was used. The samples were
incubated at 37°C for 4-5 hours or at room temperature overnight. Samples
were washed with 1X PBS twice and stored in 1X PBS with 50 mM EDTA at
4°C. Whole mount pictures were taken using camera attached to the
dissecting microscope.
For histochemical analysis, samples were sectioned using the cryostat.
Before sectioning, samples were kept in 22% sucrose with 1mM EDTA
overnight at 4°C. 40 μm-thick tissue sections were collected by the cryostat
and kept in 1X PBS. The sections were then stained in X-Gal staining
solution overnight at room temperature. Tissue sections were post-fixed in
4% paraformaldehyde, washed with 1X PBS twice and with water once, and
mounted on slides. After air drying, sections on microscope slides were
counter-stained with Nuclear Fast Red, and subjected to a series of ethanol
wash to remove water (70, 80, 90, 95 and 100% ethanol). The sections were
incubated in Histoclear (National Diagnostics) for 10 min and coverslipped
using Permount (Fisher). They were analyzed under the Zeiss microscope,
and images were taken using the MetaVue Imaging Software.
165 5.3 RESULTS
A good approach for investigating enhancer function is to link a
putative enhancer fragment to a minimal promoter such as heat-shock
promoter (Hsp). Hsp minimal promoter has been previously and successfully
attached to four copies of a known enhancer fragment of the Math 1 gene
and tested in transgenic mice (Gliem et al., 2006). In our study, a single 0.9
kb L7 promoter/enhancer and its concatamers was attached to the Hsp
minimal promoter-LacZ cassette with either BGH 3’-end signals or L7 3’-end
signals downstream. We wanted to test the possibility whether the 0.9 kb L7 promoter/enhancer fragment can act as a Purkinje cell enhancer on its own without additional structural gene. We have designed and tested 3 different constructs so far.
In OJ22 (3Xenh-hsp) construct, we inserted three copies of inverted
0.9 kb L7 promoter/enhancer fragment upstream of the minimal Hsp promoter (Figure 5.2A). Seven LacZ positive founders were identified by genotyping and perfused for whole-mount LacZ staining. 2 founders out of 7 showed weak to moderate levels of Purkinje cell-specific LacZ staining
(Table 5.1, Figure 5.3). The expression in Purkinje cells was specific as no staining was detected in other types of neurons in cerebellum (Figure 5.3B).
Some very weak ectopic expression was observed (Figure 5.3A). However, comparing with a previous transgenic line where both the 0.9 kb L7
promoter/enhancer fragment and the 3’-end processing region were included
(Serinagaoglu et al., 2007), the expression level of LacZ in Purkinje cells
166 was much weaker. Following this result, we made another construct, OJ27
(3Xenh/3kb-hsp), where a 3 kb extra upstream promoter fragment was placed in the same orientation with the 0.9 kb enhancer and immediately upstream of the minimal Hsp promoter. The rationale was to test whether adding back extra sequences of L7 promoter would affect the enhancer activity of the 0.9 kb L7 promoter/enhancer fragment. Five LacZ positive founders were identified by genotyping and perfused for whole-mount LacZ staining. Only 1 positive founder showed very low levels of Purkinje cell
LacZ staining and there was no ectopic expression elsewhere in the brain
(Figure 5.2C).
To understand the cooperative actions of the 0.9 kb L7 promoter/enhancer and the 3’-end processing signal, we have generated construct OJ23 (1Xenh-hsp-3'UTR) (Figure 5.2 B). In this construct, one copy of the 0.9 kb L7 promoter/enhancer was placed in an inverted orientation upstream of Hsp promoter, while L7 3’-end processing signals were placed upstream of LacZ. Five LacZ positive founders were identified by genotyping and perfused for whole-mount LacZ staining. We expected to observe Purkinje cell-specific expression. However, none of the founder showed any expression in the whole brain.
5.4 DISCUSSION
In this chapter, we presented LacZ reporter analysis of minimal promoter constructions for enhancer activity in transgenic mice. To further
167 investigate the minimal sequences required for the Purkinje cell-specific
expression, we tested the placement of multiple copies of the L7 enhancer
upstream of a minimal promoter and showed that it can drive weak to
moderate levels of Purkinje cell-specific expression (Figure 5.2A & 5.3). As
this construct included a bovine growth hormone 3’UTR and 3’-end
processing signals, it revealed that other sequences can substitute, at least
partially, for those of L7. However, neither the 3’-end of the SV40 T-antigen
nor that of the Gabra6 gene worked with L7 promoter to drive Purkinje cell expression. Therefore, we conclude that the 0.9 kb L7 proximal promoter fragment can behave as a classical enhancer on its own when placed in multiple copies, without the structural gene. However, the it is not a strong enhancer indicating that it might require cooperation with part of structural gene for better activity.
We expected to observe Purkinje cell expression in OJ23 (1Xenh- hsp-3'UTR) transgenic mice. This is based on the observation that replacing
L7 3’-end processing signals with that of the SV40 T-antigen abolished
Purkinje cell expression. However, we could not detect any LacZ expression in the whole brain. One interpretation is that extra L7 structural gene is
needed to drive Purkinje cell expression. Based on this it is possible that a
co-enhancer exists within the L7 structural gene, which implicates that
transcription enhancement maybe be coupled to RNA processing. Coupling
between gene transcription and 3’-end RNA processing is a fascinating idea
that has been discussed by several reviews (Kornblihtt et al., 2004;
168 Proudfoot, 2004; Bentley, 2005). Transcription-coupled processing differs from uncoupled processing in that the RNA is a growing and progressively folding structure instead of a static linear pre-mRNA. In yeast, it is suggested that the initiation of transcription is coupled with mRNA 3’-end processing by interaction of transcriptional co-activators and polyadenylation machinery before or during the formation of transcription initiation complex (Calvo and
Manley, 2001; Hirose and Manley, 2000). Coupling of transcription with processing can allosterically activate or inhibit mRNA processing factors and influence local concentration of them in the vicinity of nascent transcript
(Bentley, 2005). It is now recognized that transcription-coupled processing is critical factor for many genes, without which expression is either reduced or negligible (Proudfoot, 2004; Bentley, 2005).
Several observations suggest that L7 promoter/enhancer function may be coupled to mRNA processing signals and responsible for the cell- specific expression. First, in spite of the fact that the original truncated construct reported by the Orr group (Figure 5.1C) was expressed in ectopic locations in the brain, it was highly expressed in Purkinje cells (Vandaele et al., 1991). To pursue this further, our lab produced a transgene with a similarly truncated structural gene, but instead of the L7 3’UTR and 3’-end processing signal we appended the SV40-3’UTR and processing signal
(Figure 5.1B). This construct was not expressed at detectable levels in
Purkinje cells (Serinagaoglu et al., 2007). We conclude from this and other results discussed above that i) the region including the L7-3’UTR and 3’-end
169 processing signal is required for strong Purkinje cell expression and ii) loss
of a portion of the structural gene spanning the region between exons 2 and
4 results in depression in the brain. We also know that L7-3’UTR is not involved in expression since when this region alone is replaced by the SV40-
3’UTR (Figure 5.1A) there is strong expression in Purkinje cells (unpublished observation; Zhang et al, submitted). The only difference is that the RNA no longer moves into the dendrites as we have reported for the natural L7 mRNA (Bian et al., 1996). This implicates that the 3’-end processing region acts as the primary co-enhancer. Thus, this region may influence transcription in a different way from classical enhancement.
In order to continue this study, we will add L7 structural gene back to construct OJ23 (1Xenh-hsp-3'UTR) (Figure 5.3D&E). We would expect to observe expression of the transgene in Purkinje cells. If this construct can drive Purkinje cell-specific expression, it means L7 3’-end processing signal and L7 exons/introns (or both) are required for optimal Purkinje cell-specific expression. We will use it for subsequent analyses, such as making mutations and truncations within those regions. We will also add these regions downstream of the BGH termination signal as previously it has shown that the structural gene can only act as a co-enhancer when configured as part of the primary transcript, but not outside of the transcript
(Serinagaoglu et al., 2007). If that is the case, it could indicate transcriptional coupling with RNA processing.
170 In summary, the 0.9 kb L7 proximal promoter fragment can behave as
a classical enhancer, but the full function appears to be dependent on
appropriate signals in the L7 structural gene. This could suggest that L7
promoter/enhancer coupling to the 3’-end RNA processing signals is responsible for the cell-specific expression.
171
Mouse construct/ID # GC PJ Pons Olf Bulb Cortex Coll/Thal Brainstem 3XL7enh-Inj1 6 ------9 ------22 - ++ + - - - - 26 ------5 ------13 ------17 - ++ + - - - - Key: GC, granule cells; PJ, Purkinje cells; Coll/Thal, colliculus or thalamus; ST, stria terminalis; +++ = soma and many dendrites filled; ++ = soma filled; + = 3-5 puncta/cell; +, 1 or 2 puncta/cell
Table 5.1 LacZ-reporter expression from 3XL7enhancer-minimal promoter construct.
172
Figure 5.1 Schematic representation of LacZ construts which showed L7 3’-end processing signals are required for strong Purkinje cell expression. A construct with a truncated structural gene like that of the Orr group (C) but with an SV40 3’UTR and 3’-end processing signal was not expressed in Purkinje cells (B). This is most likely not due to the loss of the L7 3’UTR, since when only that region was replaced, retaining an intact L7-3’end processing signal, there was strong Purkinje cell expression (A).
173
Figure 5.2 Minimal promoter constructs for enhancer test in transgenic mice. A) OJ22 (3Xenh-hsp). B)OJ23 (1Xenh-hsp-3'UTR). C) OJ27 (3Xenh/3kb- hsp).
174
Figure 5.3 Analysis of an enhancer construct. A) Whole-mount LacZ stains of hemi-brains viewed in sagittal lane. B) Sagittal section showing LacZ staining restricted to Purkinje cells. Scale bars: A, 1 mm; B, 10µm.
175
BIBLIOGRAPHY
Altman, J. and Bayer, S. A. (1997) Development of the cerebellar system, in relation to its evolution, structure, and functions. 26-43.
Anderson, G. W., Hagen, S. G., Larson, R. J., Strait, K. A., Schwartz, H. L., Mariash, C. N., and Oppenheimer, J. H. (1997) Purkinje cell protein-2 cis- elements mediate repression of T3-dependent transcriptional activation. Mol Cell Endocrino. 131, 79-87.
Anderson, G. W., Larson, R. J., Oas, D. R., Sandhofer, C. R., Schwartz, H. L., Mariash, C. N. and Oppenheimer, J. H. (1998) Chicken ovalbumin upstream promoter-transcription factor (COUP-TF) modulates expression of the Purkinje cell protein-2 gene. A potential role for COUP-TF in repressing premature thyroid hormone action in the developing brain. J Biol Chem. 273, 16391-9.
Babst, M., Katzmann, D. J., Snyder, W.B., Wendland, B. and Emr, S.D. (2002) Endosome-associated complex, ESCRT-II, recruits transport machinery for protein sorting at the multivesicular body. Dev Cell. 3, 283-9.
Barski, J. J., Dethleffsen, K. and Meyer, M. (2000) Cre recombinase expression in cerebellar Purkinje cells. Genesis. 28, 93-8.
Bentley, D. L. (2005) Rules of engagement: co-transcriptional recruitment of pre-mRNA processing factors. Curr Opin Cell Biol. 17, 251-6.
Berrebi, A. S., Oberdick, J., Sangameswaran, L., Christakos, S., Morgan, J. I. and Mugnaini, E. (1991) Cerebellar Purkinje cell markers are expressed in retinal bipolar neurons. J Comp Neurol. 308, 630-49.
Bian, F., Chu, T., Schilling, K. and Oberdick, J. (1996) Differential mRNA transport and the regulation of protein synthesis: selective sensitivity of Purkinje cell dendritic mRNAs to translational inhibition. Mol Cell Neurosci. 7, 116-33.
176 Blichenberg, A., Schwanke, B., Rehbein, M., Garner, C. C., Richter, D. and Kindler, S. (1999) Identification of a cis-acting dendritic targeting element in MAP2 mRNAs. J Neurosci. 19, 8818-29.
Blichenberg, A., Rehbein, M., Muller, R., Garner, C.C., Richter, D. and Kindler, S. (2001) Identification of a cis-acting dendritic targeting element in the mRNA encoding the subunit of Ca2+/calmodulin-dependent protein kinase II. Eur. J. Neurosci. 13, 1881-8.
Bockers, T. M., Segger-Junius, M., Iglauer, P., Bockmann, J., Gundelfinger, E. D. Kreutz, M. R., Richter, D., Kindler, S. and Kreienkamp, H. (2004) Differential expression and dendritic transcript localization of Shank family members: identification of a dendritic targeting element in the 3’ untranslated region of Shank1 mRNA. Mol. Cell. Neurosci. 26, 182-90.
Bodian, D. (1965) A suggestive relationship of nerve cell RNA with specific synaptic sites. Proc. Natl. Acad. Sci. USA. 53, 418– 25.
Boussadia, O., Amiot, F., Cases, S., Triqueneaux, G., Jacquemin-Sablon, H. and Dautry, F. (1997) Transcription of Unr (upstream of N-ras) down- modulates N-ras expression in vivo. FEBS Lett. 420, 20–4.
Bramham, C. R. and Wells, D. G. (2007) Dendritic mRNA: transport, translation and function. Nat Rev Neurosci. 8, 776-89.
Bronson, S. K. and O. Smithies. (1994) Altering mice by homologous recombination using embryonic stem cells. J Biol Chem. 269, 27155–8.
Bruckenstein, D. A., Lein, P. J., Higgins, D. and Fremeau, R. T. Jr. (1990) Distinct spatial localisation of specific mRNAs in cultured sympathetic neurons. Neuron. 5, 809–19.
Burchett, S. A., Flanary, P., Aston, C., Jiang, L., Young, K. H., Uetz, P., Fields, S. and Dohlman, H. G. (2002) Regulation of stress response signaling by the N-terminal dishevelled/EGL-10/pleckstrin domain of Sst2, a regulator of G protein signaling in Saccharomyces cerevisiae. J Biol Chem. 277, 22156-67.
Calvo, O. and Manley, J. L. (2001) Evolutionarily conserved interaction between CstF-64 and PC4 links transcription, polyadenylation, and termination. Mol Cell. 7, 1013-23.
Chang, T. C., Yamashita, A., Chen, C. Y., Yamashita, Y., Zhu, W., Durdan, S., Kahvejian, A., Sonenberg, N. and Shyu, A. B. (2004) UNR, a new partner of poly(A)-binding protein, plays a key role in translationally coupled mRNA
177 turnover mediated by the c-fos major coding-region determinant. Genes Dev. 18, 2010-23.
Chen, C. and Tonegawa, S. (1997) Molecular genetic analysis of synaptic plasticity, activity-dependent neural development, learning, and memory in the mammalian brain. Annu Rev Neurosci. 20, 157-84.
Cohen, R. S. (2005) The role of membranes and membrane trafficking in RNA localization. Biol Cell. 97, 5-18.
Cohen, R. S., Zhang, S. and Dollar, G. L. (2005) The positional, structural, and sequence requirements of the Drosophila TLS RNA localization element. RNA. 11, 1017-29.
Cornelis, S., Tinton, S. A., Schepens, B., Bruynooghe, Y. and Beyaert, R. (2005) UNR translation can be driven by an IRES element that is negatively regulated by polypyrimidine tract binding protein. Nucleic Acids Res. 33, 3095–108.
Crepel, F., Hemart, N., Jaillard, D. and Daniel, H. (1996) Cellular mechanisms of long-term depression in the cerebellum. Behav Brain Sci. 19, 347-53.
Crino, P. B. and Eberwine, J. (1996) Molecular characterization of the dendritic growth cone: regulated mRNA transport and local protein synthesis. Neuron. 17, 1173–87.
Crino, P., Khodakhah, K., Becker, K., Ginsberg, S., Hemby, S. and Eberwine, J. (1998) Presence and phosphorylation of transcription factors in dendrites. Proc. Natl. Acad. Sci. USA. 95, 2313–8.
DeZeeuw., C. I, Hansel, C., Bian, F., Koekkoek, S. K., van Alphen, A. M., Linden, D. J. and Oberdick, J. (1998) Expression of a protein kinase C inhibitor in Purkinje cells blocks cerebellar LTD and adaptation of the vestibulo-ocular reflex. Neuron. 20, 495-508. .
Dinur, M., Kilav, R, Sela-Brown, A., Jacquemin-Sablon, H. and Naveh-Many, T. (2006) In vitro evidence that upstream of N-ras participates in the regulation of parathyroid hormone messenger ribonucleic acid stability. Mol Endocrinol. 20, 1652–60.
Dollar, G., Struckhoff, E., Michaud, J. and Cohen, R.S. (2002) Rab11 polarization of the Drosophila oocyte: a novel link between membrane trafficking, microtubule organization, and oskar mRNA localization and translation. Development. 129, 517-26.
178 Doniger, J. and DiPaolo, J. A. (1988) Coordinate N-ras mRNA up-regulation with mutational activation in tumorigenic guinea pig cells. Nucleic Acids Res. 16, 969-80.
Dorsam, R. T. and Gutkind, J. S. (2007) G-protein-coupled receptors and cancer. Nature Rev. Cancer. 7, 79-94.
Eberwine, J., Belt, B., Kacharmina, J. E. and Miyashiro, K. (2002) Analysis of subcellularly localized mRNAs using in situ hybridization, mRNA amplification, and expression profiling. Neurochem Res. 27, 1065-77.
Feil, R., Brocard, J., Mascrez, B., LeMeur, M., Metzger, F. and Vhambon, P. (1996) Ligand-activated site-specific recombination in mice. Proc. Natl. Acad. Sci. USA. 93, 10887-90.
Feil, R., Wagner, J., Metzger, D. and Chambon, P. (1997) Regulation of Cre Recombinase Activity by Mutated Estrogen Receptor Ligand-Binding Domains. Biochem. Biophys. Res. Commun. 237, 752-7.
Feng Bian. (1998) Molecular analysis of subcellular mRNA localization in cerebellar Purkinje cells. OSU thesis.
Furr, B. J. A. and Jordan, V. C. (1984) The pharmacology and clinical uses of tamoxifen. Pharmaco. Ther. 25, 127–205.
Furukawa, T., Miura, R., Mori, Y., Strobeck, M., Suzuki, K., Ogihara, Y., Asano, T., Morishita, R., Hashii, M., Higashida, H., et al. (1998a) Differential interactions of the C terminus and the cytoplasmic I-II loop of neuronal Ca2+ channels with G-protein alpha and beta gamma subunits. II. Evidence for direct binding. J Biol Chem. 273, 17595-603.
Furukawa, T., Nukada, T., Mori, Y., Wakamori, M., Fujita, Y., Ishida, H., Fukuda, K., Kato, S. and Yoshii, M. (1998b) Differential interactions of the C terminus and the cytoplasmic I-II loop of neuronal Ca2+ channels with G- protein alpha and beta gamma subunits. I. Molecular determination. J Biol Chem. 273, 17585-94.
Garner, C. C., Tucker, R. P. and Matus, A. (1988) Selective localization of messenger RNA for cytoskeletal protein MAP2 in dendrites. Nature. 336, 674–7.
Ghosh M., Peterson Y. K., Lanier S. M. and Smrcka A. V. (2003) Receptor- and nucleotide exchange-independent mechanisms for promoting G protein subunit dissociation. J. Biol. Chem. 278, 34747–50.
179 Goetze, B., Tuebing, F., Xie, Y. Dorostkar, M. M., Thoams, S., Pehl, U., Boehm, S., Macchi, P. and Kiebler, M. A. (2006) The brain-specific double- stranded RNA-binding protein Staufen2 is required for dendritic spine morphogenesis. J. Cell Biol. 172, 221-31.
Gliem, M., Weisheit, G., Mertz, K. D., Endl, E., Oberdick, J. and Schilling, K. (2006) Expression of classical cadherins in the cerebellar anlage: quantitative and functional aspects. Mol Cell Neurosci. 33, 447-58.
Granderath, S., Stollewerk, A., Greig, S., Goodman, C. S., O'Kane, C. J. and Klämbt, C. (1999) loco encodes an RGS protein required for Drosophila glial differentiation. Development. 126, 1781-91.
Gu, H., Marth, J. D., Orban, P. C., Mossmann, H. and Rajewsky, K. (1994) Deletion of a DNA polymerase beta gene segment in T cells using cell type- specific gene targeting. Science. 265, 103-6.
Hansel, C. Linden, D. J. and D’Angelo, E. D. (2001) Beyond parallel fiber LTD: the diversity of synaptic and non-synaptic plasticity in the cerebellum. Nature Neurosci. 4, 467-75.
Herlitze, S., Garcia, D. E., Mackie, K., Hille, B., Scheuer, T. and Catterall, W. A. (1996) Modulation of Ca2+ channels by G-protein beta gamma subunits. Nature., 380, 258-62.
Hirose, Y. and Manley, J. L. (2000) RNA polymerase II and the integration of nuclear events. Genes Dev. 14, 1415-29.
Hirrlinger, P. G., Scheller, A., Braun, C., Hirrlinger, J. and Kirchhoff, F. (2006) Temporal control of gene recombination in astrocytes by transgenic expression of the tamoxifen-inducible DNA recombinase variant CreERT2. Glia. 54, 11-20.
Huang, Y. S., Carson, J. H., Barbarese, E. and Richter, J. D. (2003) Facilitation of dendritic mRNA transport by CPEB. Gene & Dev. 17, 638-53.
Huber, K. M., Kayser, M. S. & Bear, M. F. (2000) Role for Rapid Dendritic Protein Synthesis in Hippocampal mGluR-Dependent Long-Term Depression. Science. 288, 1254–6.
Imayoshi, I., Ohtsuka, T., Metzger, D., Chambon, P. and Kageyama, R. (2006) Temporal regulation of Cre recombinase activity in neural stem cells. Genesis, 44, 233-8.
Indra, A. K, Warot, X., Brocard, J., Bornert, J. M., Xiao, J. H, Chambon, P. and Metzger, D. (1999) Temporally-controlled site-specific mutagenesis in 180 the basal layer of the epidermis: comparison of the recombinase activity of the tamoxifen-inducible Cre-ER(T) and Cre-ER(T2) recombinases. Nucleic Acids Res. 27, 4324-7.
Irion, U. and Johnston, S. D. (2007) bicoid RNA localization requires specific binding of an endosomal sorting complex. Nature. 445, 554-8.
Iscru, E. Serinagaoglu, Y., Schilling, K., Tian, J., Bowers-Kidder, S., Zhang, R., Morgan, J., DeVries, C., Nelson, R., Zhu, M., and Oberdick, J. (2008) Sensorimotor enhancement in mouse mutants lacking the Purkinje cell- specific Gi/o modulator, Pcp2(L7). Submitted.
Ivry, R. B., Spencer, R. M., Zelaznik, H. N. and Diedrichsen, J. (2002). The cerebellum and event timing. Ann N Y Acad Sci. 978, 302-17.
Jacquemin-Sablon, H., Triqueneaux, G., Deschamps, S., le Maire, M., Doniger, J. and Dautry, F. (1994) Nucleic acid binding and intracellular localization of Unr, a protein with five cold shock domains. Nucleic Acids Res. 22, 2643-50.
Jansen, R.P. (2001) mRNA localization message on the move. Nature Review. 2, 247-56.
Jeffers, M., Paciucci, R. and Pellicer, A. (1990) Characterization of Unr; a gene closely linked to N-ras. Nucleic Acids Res. 18, 4891-9.
Job, C. and Eberwine, J. (2001) Identification of sites for exponential translation in living dendrites. Proc. Natl. Acad. Sci. USA. 98, 13037–42.
Kacharmina, J. E., Job, C., Crino, P. and Eberwine, J. (2000) Stimulation of glutamate receptor protein synthesis and membrane insertion within isolated neuronal dendrites. Proc. Natl. Acad. Sci. USA. 97, 11545–50.
Kamura, T., Burian, D., Khalili, H., Schmidt, S. L., Sato, S., Liu, W. J., Conrad, M. N., Conaway, R. C., Conaway, J. W. and Shilatifard, A. (2001) Cloning and characterization of ELL-associated proteins EAP45 and EAP20. a role for yeast EAP-like proteins in regulation of gene expression by glucose. J Biol Chem. 276, 16528–33.
Kandel, E. R., Schwartz, J. H. and Jessell, T. M. (2000) The Cerebellum in Principles of Neural Science, Fourth Edition, 626-46.
Kaneko, S., Akaike, A. and Satoh, M. (1999) Receptor-mediated modulation of voltage-dependent Ca2+ channels via heterotrimeric G-proteins in neurons. Jpn J Pharmacol. 81, 324-31.
181 Kang, H. and Schuman, E. M. (1996) A requirement for local protein synthesis in neurotrophin-induced hippocampal synaptic plasticity. Science. 273, 1402-6.
Katzmann, D. J., Babst, M. and Emr, S. D. (2001) Ubiquitin-dependent sorting into the multivesicular body pathway requires the function of a conserved endosomal protein sorting complex, ESCRT-I. Cell. 106, 145-55.
Katzmann, F. J., Stefan, C. J. Babst, M. and Rmr, S. D. (2003) Vps27 recruits ESCRT machinery to endosomes during MVB sorting. J. Cell Biol. 162, 413-23.
Kim, J. E., Nakashima, K. and de Crombrugghe, B. (2004) Transgenic mice expressing a ligand-inducible cre recombinase in osteoblasts and odontoblasts: a new tool to examine physiology and disease of postnatal bone and tooth. Am J Pathol. 165, 1875-82.
Kim, J. J. and Thompson, R. F. (1997) Cerebellar circuits and synaptic mechanisms involved in classical eyeblink conditioning. Trends Neurosci. 20, 177-81.
Kimple, R. J. De Vries, L. Tronchere, H. Behe, C. I. Morris, R. A. Gist Farquhar, M. and Siderovski, D. P. (2001) RGS12 and RGS14 GoLoco motifs are Gαi interaction sites with guanine nucleotide dissociation inhibitor Activity, J. Biol. Chem. 276, 29275– 81.
Kimple, R. J., Kimple, M. E., Betts, L., Sondek, J. and Siderovski, D. P. (2002) Structural determinants for GoLoco-induced inhibition of nucleotide release by Galpha subunits. Nature. 416, 878-81.
Kindler, S. and Monshausen, M. (2002) Candidate RNA-binding proteins regulating extrasomatic mRNA targeting and translation in mammalian neurons. Mol Neurobiol. 25, 149–65.
Kinoshita, M., Nukada, T., Asano, T., Mori, Y., Akaike, A., Satoh, M. and Kaneko, S. (2001) Binding of G alpha(o) N terminus is responsible for the voltage resistant inhibition of alpha(1A) (P/Q-type, Ca(v)2.1) Ca(2+) channels. J Biol Chem. 276, 28731-8.
Kinoshita-Kawada, M., Oberdick, J. and Xi Zhu, M. (2004) A Purkinje cell specific GoLoco domain protein, L7/Pcp-2, modulates receptor-mediated inhibition of Cav2.1 Ca2+ channels in a dose-dependent manner. Brain Res Mol Brain Res. 132, 73-86.
182 Kislauskis, E. H., Zhu, X. and Singer, R. H. (1994) Sequences responsible for intracellular for intracellular localization of beta-actin messenger RNA also affect cell phenotype. J Cell Biol. 127, 441-51.
Kleiman, R., Banker, G. and Steward, O. (1993) Subcellular distribution of rRNA and poly(A) RNA in hippocampal neurons in culture. Brain Res Mol Brain Res. 20, 305–12.
Kleiman, R., Banker, G. and Steward, O. (1994) Development of subcellular mRNA compartmentation in hippocampal neurons in culture. J. Neurosci. 14, 1130–40.
Köhrmann, M., Luo, M., Kaether, C., DesGroseillers, L., Dotti, C. G. and Kiebler M. A. (1999) Microtubule-dependent recruitment of staufen-green fluorescent protein into large RNA-containing granules and subsequent dendritic transport in living hippocampal neurons. Mol. Biol. Cell. 10, 2945- 53.
Konarski, J. Z., McIntyre, R. S., Grupp, L. A. and Kennedy, S. H. (2005) Is the cerebellum relevant in the circuitry of neuropsychiatric disorders? J Psychiatry Neurosci. 30, 178-86.
Kornblihtt, A. R., de la Mata, M., Fededa, J. P., Munoz, M. J. and Nogues, G. (2004) Multiple links between transcription and splicing. RNA. 10, 1489-98.
Leone, D. P., Genoud, S., Atanasoski, S., Grausenburger, R., Berger, P., Metzger, D., Macklin, W. B., Chambon, P. and Suter, U. (2003) Tamoxifen- inducible glia-specific Cre mice for somatic mutagenesis in oligodendrocytes and Schwann cells. Mol Cell Neurosci. 22, 430-40.
Linden, D. J. A protein synthesis-dependent late phase of cerebellar long- term depression (1996) Neuron. 17, 483-90.
Llinas, R., Sugimori, M., Lin, J. W. and Cherksey, B. (1989) Blocking and isolation of a calcium channel from neurons in mammals and cephalopod utilizing a toxin fraction (FTX) from funnel-web spider poison. Proc Natl Acad Sci USA. 86, 1689-93.
Lowe, J., Blanchard, A., Morrell, K., Lennox, G., Reynolds, L., Billett, M., Landon, M. and Mayer, R. J. (1988a) Ubiquitin is a common factor in intermediate filament inclusion bodies of diverse type in man, including those of Parkinson’s disease, Pick’s disease, and Alzheimer’s disease, as well as Rosenthal fibres in cerebellar astrocytomas, cytoplasmic bodies in muscle, and Mallory bodies in alcoholic liver disease. J Pathol. 155, 9–15.
183 Luo, Y. and Denker, B. M. (1999) Interaction of heterotrimeric G protein Galphao with Purkinje cell protein-2. Evidence for a novel nucleotide exchange factor. J Biol Chem. 274, 10685-8.
Macdonald, P. M. and Struhl, G. (1988) cis-acting sequences responsible for anterior localization of bicoid mRNA in Drosophila embryos. Nature. 336, 595-8.
Mao, X., Fujiwara, Y. and Orkin, S. H. (1999) Improved reporter strain for monitoring Cre recombinase-mediated DNA excisions in mice. Proc Natl Acad Sci USA. 96, 5037-42.
Martínez-Salas, E., Ramos, R., Lafuente, E. and López de Quinto, S. (2001) Functional interactions in internal translation initiation directed by viral and cellular IRES elements. J. Gen. Virol., 82, 973-84.
Martone, W. E., Pollock, J. A., Jones, Y. Z., and Ellisman, M. H. (1996) Ultrastructural localisation of dendritic messenger RNA in adult rat hippocampus. J Neurosci. 16, 7437–46.
Mayford, M., Baranes, D., Podsypanina, K. and Kandel, E. (1996) The 3′- untranslated region of CaMKIIα is a cis-acting signal for the localization and translation of mRNA in dendrites. Proc. Natl Acad. Sci. USA. 93, 13250–5.
Metzger, D. and Chambon, P. (2001) Site- and time-specific gene targeting in the mouse. Methods. 24, 71-80.
Miller, S., Yasuda, M., Coats, J. K., Jones, Y., Martone, M. E. and Mayford, M. (2002) Disruption of dendritic translation of CaMKIIa impairs stabilization of synaptic plasticity and memory consolidation. Neuro. 36, 507-19.
Mitchell, S. A., Spriggs, K. A., Coldwell, M. J., Jackson, R. J. and Willis, A. E. (2003) The Apaf-1 internal ribosome entry segment attains the correct structural conformation for function via interactions with PTB and Unr. Mol Cell. 11, 757-71.
Miyashiro, K., Dichter, M. and Eberwine, J. (1994) On the nature and differential distribution of mRNAs in hippocampal neurites: implications for neuronal functioning. Proc. Natl. Acad. Sci. USA. 91, 10800–4.
Mohn, A. R., Feddersen, R. M., Nguyen, M. S. and Koller, B. H. (1997) Phenotypic analysis of mice lacking the highly abundant Purkinje cell- and bipolar neuron-specific Pcp2 protein. Mol Cell Neurosci. 9, 63-76.
Mohr, E. and Richter, D. (1995) mRNAs in extrasomal domains of rat hypothalamic peptidergic neurons. Localized RNAs. Heidelberg 275–87. 184
Molinari, M. and Leggio, M. G. (2007) Cerebellar information processing and visuospatial functions. Cerebellum. 6, 214-20.
Moreadith R. W. and Radford, N. B. (1997) Gene targeting in embryonic stem cells: the new physiology and metabolism. J. Mol. Med. 75, 208-16.
Mowry, K.L. and Melton, D.A. (1992) Vegetal messenger RNA localization directed by a 340-nt RNA sequence element in Xenopus oocytes. Science. 255, 991-4.
Mori, Y., Imaizumi, K., Katayama, T., Yoneda, T. and Tohyama, M. (2000) Two cis-acting elements in the 3' untranslated region of alpha-CaMKII regulate its dendritic targeting. Nat Neurosci. 3, 1079-84.
Murthy, K. G. K. and Manley, J. L. (1992) Characterization of the multisubunit cleavage polyadenylation specificity factor from calf thymus. J. Biol. Chem. 267, 14804-11.
Nagy, A. (2000). Cre recombinase: the universal reagent for genome tailoring. Genesis. 26, 99-109.
Natochin, M., Gasimov, K. G. and Artemyev, N. O. (2001) Inhibition of GDP/GTP exchange on G alpha subunits by proteins containing G-protein regulatory motifs. Biochemistry. 40, 5322-8.
Nicolaiew, N., Triqueneaux, G. and Dautry, F. (1991) Organization of the human N-ras locus: characterization of a gene located immediately upstream of N-ras. Oncogene. 6, 721-30.
Nordquist, D. T., Kozak, C. A. and Orr, H. T. (1988) cDNA cloning and characterization of three genes uniquely expressed in cerebellum by Purkinje neurons. J Neurosci. 8, 4780-9.
Oberdick, J., Levinthal, F. and Levinthal, C. (1988) A Purkinje cell differentiation marker shows a partial DNA sequence homology to the cellular sis/PDGF2 gene. Neuron. 1, 367-76.
Oberdick, J., Smeyne, R. J., Mann, J. R., Zackson, S. and Morgan, J. I. Analysis of Mice Lacking PCP2 75 (1990). A promoter that drives transgene expression in cerebellar Purkinje and retinal bipolar neurons. Science. 248, 223–6.
Oberdick, J., Schilling, K., Smeyne, R., Corbin, J., Bocchiaro, C. and Morgan, J. (1993) Control of segment-like patterns of gene expression in the mouse cerebellum. Neuron. 10, 1007-18. 185
Patrick, G. N. (2007) Synapse formation and plasticity: recent insights from the perspective of the ubiquitin proteasome system. Curr Opin Neurobiol. 16, 90-4.
Peters, A., Palay, S. L., and Webster, H. deF. (1970) The fine Structure of the Nervous System: The Cells and Their Processes. New York: Harper &Row.
Pinkstaff, J. K., Chappell, S. A., Mauro, V. P., Edelman, G. M. and Krushel, L. A. (2001) Internal initiation of translation of five dendritically localized neuronal mRNAs. Proc. Natl Acad. Sci. USA. 98, 2770–5.
Prakash, N., Fehr, S., Mohr, E. and Richter, D. (1997) Dendritic Localization of Rat Vasopressin mRNA: Ultrastructural Analysis and Mapping of Targeting Elements. Eur. J. Neurosci. 9, 523–32.
Prekeris, R., Klumerman, J. and Scheller, R. H. (2000) A Rab11/Rip11 protein complex regulates apical membrane trafficking via recycling endosomes. Mol. Cell. 6, 1437-48.
Proudfoot, N. (2004) New perspectives on connecting messenger RNA 3’ end formation to transcription. Curr Opin Cell Biol. 16, 272-8.
Raymond, J. L. and Lisberger, S. G. (2000) Hypotheses about the neural trigger for plasticity in the circuit for the vestibulo-ocular reflex. Prog. Brain Res. 124, 235-46.
Rehbein, M., Kindler, S., Horke, S. and Richter, D. (2000) Two trans-acting rat-brain proteins, MARTA1 and MARTA2, interact specifically with the dendritic targeting element in MAP2 mRNAs. Brain Res Mol Brain Res. 79, 192-201.
Rodman, J.S. and Wandinger-Ness, A. (2000) Rab GTPases coordinate endocytosis. J. Cell Sci.113, 183-92.
Roudier, N., Lefebvre, C. and Legouis, R. (2005) CeVPS-27 is an Endosomal Protein Required for the Molting and the Endocytic Trafficking of the Low-Density Lipoprotein Receptor-Related Protein 1 in Caenorhabditis elegans. Traffic. 6, 695–705.
Sanlioglu, S., Zhang, X., Baader, S. L. and Oberdick, J. (1998) Regulation of a Purkinje cell-specific promoter by homeodomain proteins: repression by engrailed-2 vs. synergistic activation by Hoxa5 and Hoxb7. J Neurobiol. 36:559-71.
186 Scheetz, A. J., Nairn, A. C. and Constantine-Paton, M. (2000) NMDA receptor-mediated control of protein synthesis at developing synapses. Nature Neurosci. 3, 211-217.
Schrader, M., Danielsson, C., Wiesenberg, I. and Carlberg, C. (1996) Identification of natural monomeric response elements of the nuclear receptor RZR/ROR. J Biol Chem, 271, 19732-6.
Schmidt, A. E., Miller, T., Schmidt, S. L., Shiekhattar, R. and Shilatifard, A. (1999) Cloning and characterization of the EAP30 subunit of the ELL complex that confers derepression of transcription by RNA polymerase II. J Biol Chem. 274, 21981–5.
Serinagaoglu (2007) Analysis of Pcp-2/L7 gene expression and function. OSU thesis.
Serinagaoglu, Y., Zhang, R., Zhang, Y., Zhang, L., Hartt, G., Young, A. P. and Oberdick, J. (2007) A promoter element with enhancer properties, and the orphan nuclear receptor RORalpha, are required for Purkinje cell-specific expression of a G(i/o) modulator. Mol Cell Neurosci, 34, 324-42.
Siderovski, D. P., Diverse-Pierluissi, M. and De Vries, L. (1999) The GoLoco motif: a Galphai/o binding motif and potential guanine-nucleotide exchange factor. Trends Biochem Sci. 24, 340-1.
Slagsvold, T., Aasland, R., Hirano, S., Bache, K. G., Raiborg, C., Trambaiolo, D., Wakatsuki, S. and Stenmark, H. (2005) Eap45 in mammalian ESCRT-II binds ubiquitin via a phosphoinositide-interacting GLUE domain. J Biol Chem. 280, 19600-6.
Smeyne, R. J., Chu, T., Lewin, A., Bian, F., S.-Crisman, S., Kunsch, C., Lira, S. and Oberdick, J. (1995) Local control of granule cell generation by cerebellar Purkinje cells. Mol. Cell. Neurosci. 6, 230-51.
Soriano P. (1999) Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat. Genet. 21, 70–1.
Sperk, G., Schwarzer, C., Tsunashima, K. and Kandlhofer, S. (1998) Expression of GABA(A) receptor subunits in the hippocampus of the rat after kainic acid-induced seizures. Epilepsy Res. 32,129–39.
Steward, O. (1995) Targeting of mRNAs to subsynaptic microdomains in dendrites. Curr Opin Neurobiol. 5, 55–61.
187 Steward, O. and Falk, P. M. (1985) Polyribosomes under developing spine synapses: growth specializations of dendrites at sites of synaptogenesis. J. Neurosci. Res. 13, 75–88.
Steward, O. and Levy, W. B. (1982) Preferential localization of polysomes under the base of dendritic spines in granule cells of the dentate gyrus. J. Neurosci. 2, 284-91.
Steward, O. and Reeves, T. M. (1988) Protein–synthetic machinery beneath postsynaptic sites on CNS neurons: association between polyribosomes and other organelles at the synaptic site. J. Neurosci. 8, 176–84.
Steward, O. and Schuman, E. M. (2001) Protein synthesis at synaptic sites on dendrites. Annu. Rev. Neurosci. 24, 299-325.
Steward, O., Wallace, C., Lyford, G. and Worley, P. (1998) Synaptic activation causes the mRNA for the IEG Arc to localize selectively near activated postsynaptic sites on dendrites. Neuron. 21, 741-751.
Takeda, K., Cowan, A. and Fong, G. H. (2007) Essential role for prolyl hydroxylase domain protein 2 in oxygen homeostasis of the adult vascular system. Circulation. 116, 774-81.
Tiedge, H. and Brosius, J. (1996) Translational machinery in dendrites of hippocampal neurons in culture. J. Neurosci. 16, 7171–81.
Tiedge, H., Fremeau, R. T., Weinstock, P. H., Arancio, O. and Brosius, J. (1991) Dendritic localization of neural BC1 RNA. Proc. Natl Acad. Sci. USA. 88, 2093–7.
Tiruchinapalli, D. M., Oleynikov, Y., Kelic, S., Shenoy, S. M., Hartley, A., Stanton, P. K., Singer, R. H. and Bassell, G. J. (2003). Activity-dependent trafficking and dynamic localization of zipcode binding protein 1 and beta- actin mRNA in dendrites and spines of hippocampal neurons. J. Neurosci. 23, 3251-61.
Torre, E. R. and Steward, O. (1996) Protein synthesis within dendrites: glycosylation of newly synthesized proteins in dendrites of hippocampal neurons in culture. J. Neurosci. 16, 5967–78.
Triqueneaux, G., Velten, M., Franzon, P., Dautry, F. and Jacquemin-Sablon, H. (1999) RNA binding specificity of Unr, a protein with five cold shock domains. Nucleic Acids Res. 27, 1926-34.
188 Vandaele, S., Nordquist, D. T., Feddersen, R. M., Tretjakoff, I., Peterson, A. C. and Orr, H. T. (1991) Purkinje cell protein-2 regulatory regions and transgene expression in cerebellar compartments. Genes Dev. 5, 1136-48.
Vassileva, G., Smeyne, R. J. and Morgan, J. I. (1997) Absence of neuroanatomical and behavioral deficits in L7/pcp-2-null mice. Brain Res. Mol. Brain Res. 46, 333-7.
Wanner, I., Baader, S., Brich, M., Oberdick, J. and Schilling, K. (1997) Subcellular localization of specific mRNAs and their protein products in Purkinje cells by combined fluorescence in situ hybrdization and immunocytochemistry. Histochem. Cell Biol. 108, 345-357.
Wanner, I., Baader, S. L., Oberdick, J. and Schilling, K. (2000) Changing subcellular distribution and activity-dependent utilization of a dendritically localized mRNA in developing Purkinje cells. Mol Cell Neurosci. 15, 275-87.
Weber, J. T. De Zeeuw, C. I., Linden, D. J. and Hansel, Christian. (2003) Long-Term Depression of Climbing Fiber-Evoked Calcium Transients in Purkinje Cell Dendrites. Proc. Natl Acad. Sci. U S A. 100, 2878-83.
Webb, C. K, McCudden, C. R, Willard, F. S, Kimple, R. J, Siderovski, D. P, Oxford, G. S. (2005) D2 dopamine receptor activation of potassium channels is selectively decoupled by Galpha-specific GoLoco motif peptides. J Neurochem. 92, 1408-18.
Wells, D. G., Richter J. D. and Fallon J. R. (2000) Molecular mechanisms for activity-regulated protein synthesis in the synapto-dendritic compartment. Curr. Opin. Neurobiol. 10, 132-7.
Wickens, M. (1990) How the messenger got its tail: addition of poly(A) in the nucleus. Trends Biochem. Sci. 15, 277-81.
Willard, F. S., McCudden, C. R. and Siderovski, D. P. (2006) G-protein alpha subunit interaction and guanine nucleotide dissociation inhibitor activity of the dual GoLoco motif protein PCP-2 (Purkinje cell protein-2). Cell Signal. 18, 1226-34.
Womack, M. D. and Khodakhah, K. (2004) Dendritic control of spontaneous bursting in cerebellar Purkinje cells. J Neurosci. 24, 3511-21.
Yajima, I., Belloir, E., Bourgeois, Y., Kumasaka, M., Delmas, V. and Larue, L. (2006) Spatiotemporal gene control by the Cre-ERT2 system in melanocytes. Genesis. 44, 34-43.
189 Yi, J. J and Ehlers, M. D. (2007) Emerging roles for ubiquitin and protein degradation in neuronal function. Pharmacol Rev. 59, 14-39.
Zhang, R., Zhang, X., Bian., F. and Oberdick., J. (2008) 3’UTR-dependent localization of a Purkinje cell mRNA in dendrites. The Cerebellum. In press.
Zhang, R., Zhang, X. L., Gebhart, N., Bian, F. and Oberdick, J. (2008) Vps36 and Csde1 (Unr): candidate 3'UTR binding proteins for dendritic localization and/or translation of a Purkinje cell mRNA. Submitted.
Zhang (2001) Molecular analysis of L7/Pcp-2 messenger RNA and its interacting proteins. OSU thesis.
Zhang, X., Baader, S., Bian, F., Muller, W. and Oberdick, J. (2001) High level Purkinje cell-specific expression of green fluorescent protein in transgenic mice. Histochem. Cell Biol. 115, 455-64.
Zhang, X. L., Zhang, H. L. and Oberdick, J. (2002) Conservation of the developmentally regulated dendritic localization of a Purkinje cell-specific mRNA that encodes a G-protein modulator: comparison of rodent and human Pcp2(L7) gene structure and expression. Mol Brain Res. 105, 1-10.
Zou, L., Hagen, S. G., Strait, K. A. and Oppenheimer, J. H. (1994) Identification of thyroid hormone response elements in rodent Pcp-2, a developmentally regulated gene of cerebellar Purkinje cells. J Biol Chem. 269, 13346-52.
Zuker, M. (2003) Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31, 3406-3415.
190