A Homologue of Dermatopontin from Haliotis Diversicolor and Its Response to Pathogenic Infection

Aquaculture Research, 2015, 46, 1537–1549 doi:10.1111/are.12305

A homologue of dermatopontin from Haliotis diversicolor and its response to pathogenic infection

Guodong Wang1, Ziping Zhang2, Shi Lin1, Lili Zhang1, Baozhen Wang1, Shuhong Wang1 & Yilei Wang1 1Key Laboratory of Healthy Mariculture for East China Sea, Ministry of Agriculture, Fisheries College, Jimei University, Xiamen, Fujian, China 2Department of Biological Science, Seton Hall University, South Orange, NJ, USA

Correspondence: Prof. Y Wang, Key Laboratory of Healthy Mariculture for East China Sea, Ministry of Agriculture, Fisheries College, Jimei University, Xiamen, Fujian, China. E-mail: [email protected]

protein (Okamoto, Suzuki, Kimura & Shinkai Abstract 1996). It has been found in mammals (Forbes, Dermatopontin (DPT), a component of the extracel- Cronshaw, MacBeath & Hulmes 1994), arthropod lular matrix, plays important roles in cell-matrix (Fujii, Minetti, Nakhasi, Chen, Barbehenn, Nunes & interactions and matrix assembly. Some studies Nguyen 1992), molluscs (Sarashina, Yamaguchi, have revealed that it has more general functions in Haga, Iijima, Chiba & Endo 2006) and a sponge biological activities. However, its function in mol- (Schutze,€ Krasko, Diehl-Seifert & Muller€ 2001). The luscs is poorly understood. In this study, a mollus- protein has a widespread tissue distribution in can DPT gene, saDPT2, was cloned from small mammals (including skin, skeletal muscle, heart, abalone Haliotis diversicolor. The full-length cDNA lung, kidney, cartilage and bone) (Forbes et al. of saDPT2 sequence is 620 bp, with a 531 bp open 1994), and displays a striking tendency to bind to reading frame encoding a protein of 177 amino the small dermatan sulphate proteoglycans (Okam- acids (aa). Amino acid sequence analysis revealed oto et al. 1996). Furthermore, DPT promotes cell that saDPT2 shares conserved signature motifs attachment and cytoplasmic spreading of dermal with other DPT proteins, including three repeats of fibroblasts, and is mediated by cell surface integrin, 10-residue motif (S-X-H-X-N-X-Y-E-D-R), which is another extracellular matrix protein (Lewandowska, similar to mammalian 6-residue repeating sequence Choi, Rosenberg, Sasse, Neame & Culp 1991). DPT of D-R-E/Q-W-X-F/Y. Quantitative real-time PCR was found to interact with transforming growth fac- was employed to investigate the tissue distribution tor b (TGF-b) and influence TGF-b bioactivity of saDPT2 mRNA, its expression at different devel- (Okamoto, Fujiwara, Abe & Sato 1999). In silico opmental stages, and in abalone under bacteria analysis revealed progesterone receptor binding sites challenge. The saDPT2 mRNA could be detected in in the DPT promoter region (Kim & Cheon 2006). all examined tissues and developmental stages. DPT is also shown to be a downstream target of Moreover, the saDPT2 mRNA was up-regulated in Vitamin D receptor in the differentiation of multipo- haemocytes and gills after bacteria injection. The tential stromal cells into osteoblasts (Pochampally, results indicate that the saDPT2 could respond to Ylostalo, Penfornis, Matz, Smith & Prockop 2007). pathogenic infection and may play a role in adult Although the mammal DPT appears to be abalone immune system. involved in the formation of some pathological conditions of connective tissue, such as wound healing, Keywords: Dermatopontin, Immune response, fibrosis and tumour invasion, the effect of mollusc Gene expression, Small abalone DPT on pathological conditions is poorly understood. In molluscs, DPT is considered to be a major component of the shell matrix proteins (Marxen & Introduction Becker 1997; Marxen, Nimtz, Becker & Mann Dermatopontin (DPT), also called tryosin-rich acidic 2003). The mollusc DPT is found to be more than matrix protein, is a 22 kDa extracellular matrix one type, one of them being a shell matrix protein

© 2013 John Wiley & Sons Ltd 1537 A homologue of dermatopontin from Haliotis diversicolor G Wang et al. Aquaculture Research, 2015, 46, 1537–1549 and the others having more general functions (Sa- understanding the innate immune system of aba- rashina et al. 2006). For example, there are three lone for aquaculture development. The goal of this types of DPT genes in Lymnaea stagnalis and two research is to investigate the possible role of DPT in types of DPT genes in Euhadra brandtii. Although mediating immune response to infection in small the deduced protein sequences of DPTs are highly abalone H. diversicolor. conserved, the tissue expression patterns of DPT genes are different. DPT 1 gene from L. stagnalis Materials and methods and E. brandtii expressed at an extremely high level only in the mantle tissue. DPT 2 gene from L. stag- Molecular cloning of saDPT2 nalis expressed at a high level in the kidney tissue rather than in the mantle tissue. Expression of DPT A normalized cDNA library was constructed using 2 gene from E. brandtii and DPT 3 gene from L. mRNA isolated from hepatopancreas of tributyltin stagnalis were detected in all examined tissues with- (TBT) stimulated abalone (H. diversicolor). The basic out significant differences. procedure of cDNA library construction, normaliza- The homologue of DPT from horseshoe crab (Lim- tion and initial sequencing were described in our ulus polyphemus) and sponge (Suberites domuncula) previous report (Jia, Zhang, Wang, Zou, Wang, induces cell aggregation (Fujii et al. 1992; Schutze€ Huang & Wang 2009). BLAST analysis of all ESTs et al. 2001). Unlike vertebrate DPT, this factor of of the abalone cDNA library revealed that a partial horseshoe crab is believed to be stored in large dense sequence was homologous to known sequences of secretory granules and it is also secreted extracellu- DPT2 and it was denoted as saDPT2, because its larly by certain stimuli (Fujii et al. 1992). There is sequence shares highest similarity with freshwater also the change of mRNA expression of DPT homo- snail Biomphalaria glabrata DPT2. To obtain the full logue in a freshwater snail Biomphalaria glabrata length sequence of saDPT2, rapid amplification of after infection of a parasite Echinostoma caproni cDNA ends (RACE) was performed. Briefly, total (Bouchut, Roger, Coustau, Gourbal & Mitta 2006; RNAs were extracted from the hepatopancreas of Hanington, Lun, Adema & Loker 2010). The the bacteria-challenged abalones using TRIZOL researchers found that the expressions of DPT-2 reagent following the manufacturer’s instructions and -3 were constitutively up-regulated in resistant (Invitrogen, Carlsbad, CA, USA) and quantified with snails, compared with that in susceptible snails. The an Ultrospec 2100 pro spectrophotometer (GE expression of DPT-2 in the resistant snail was time- Healthcare Life Sciences, Piscataway, NJ, USA). dependently up-regulated and reached maximum at Based on the known partial saDPT2 sequence, the 48 h after infection by E. caproni (Bouchut et al. RACE PCR was carried out with primers saDPT2- 2006; Hanington et al. 2010). out and saDPT2-inner (Table 1). The first strand The DPT homologue of amphioxus Branchios- cDNA synthesis and the RACE reactions were per- toma belcheri is reported to be up-regulated after formed using the SMART RACE cDNA Amplifica- Vibrio parahaemolyticus infection (Huang, Liu, Han, tion Kit (Clontech, Mountain View, CA, USA) Fan, Zhang, Liu, Yu, Zhang, Chen, Dong, Wang & according to the manufacturer’s instructions. Xu 2007). These results suggest that DPT plays a Expected PCR products were purified from gel using role in mediating the innate immune response to a Qiaquick Gel Extraction Kit (Qiagen, Hilden, Ger- pathogen infection in invertebrates. many), and ligated into the T/A cloning vector Small abalone (Haliotis diversicolor) is an impor- pMD19-T (TaKaRa, Dalian, Liaoning Province, tant mollusc species for commercial production in China) followed by transformation into E. coli Southeast China. However, outbreaks of mass mor- JM109 competent cells. The positive clones were tality among cultured abalone which have caused sequenced at least twice using ABI 3730 automated catastrophic losses to aquaculturists are considered sequencers (Applied Biosystems, Foster City, CA, to be a major limitation to abalone culture (Murray USA) at Shanghai Sangon Biological Engineering & Peeler 2005). Since late 2000, farmers have Technology & Services Co., Ltd (China). experienced mass mortality of abalone during grow-out stage and settlement failure of larvae dur- Sequence analysis ing nursery stage (Cheng, Hsiao & Chen 2004). To establish health management systems for farmed Isoelectric point and molecular weight were com- abalone, more investigation is required to aid in puted using ‘Compute pI/Mw tool’ (http://cn.

Table 1 Oligo nucleotide primers used in this article

Primer name Nucleotide sequence (5′?3′) Purpose saDPT2-out CATTTACACATTGGAAGGTCAAGGGTT 5′ RACE saDPT2-inner GAAATCCCACACTCGGTCCTCAAA saDPT2-realtime-F AACTGGGACGAACACATGGACTA Target gene expression analysis saDPT2-realtime-R GCTGTCGATACCGTGCATGA b-actin-F CCGTGACCTTACAGACTACCT Reference gene b-actin-R TACCAGCGGATTCCATAC expasy.org/tools/pi_tool.html). The signal peptide placed immediately in liquid nitrogen for RNA was predicted with SignalP (http://www.cbs.dtu. preparation. All of the tissue samples and haemo- dk/services/SignalP/). The protein motifs were cytes were immediately frozen in liquid nitrogen and analysed with the Predict Protein server (http:// stored at À80°C until being used for RNA isolation. www.predictprotein.org/). Protein multiple-align- Samples of haemocytes, mantle, kidney, gills, ments were performed with the BioEdit program epipodium, mucous gland and hepatopancreas (http://www.mbio.ncsu.edu/bioedit/bioedit.html). were collected from five healthy adult abalone and Phylogenies of protein sequences were estimated placed immediately in liquid nitrogen for RNA using neighbour-joining (NJ) method by MEGA preparation. In addition, the seven different devel- 4.0 software (Tempe, AZ, USA). The bootstrap val- opmental stages of H. diversicolor eggs, embryos ues were replicated 1000 times to obtain the con- and larvae (including fertilized eggs, two cells, fidence value for the analysis. blastula, trochophore, veliger, post larvae and juvenile abalone post 10 days metamorphosis) were also collected from the same farm and imme- Abalones culture, immune challenge and diately frozen in liquid nitrogen for RNA isolation. preparation of samples Each developmental stage of H. diversicolor was Adult small abalones (body length 5.00 Æ 0.50 cm, confirmed by microscope according to the refer- weight 10.55 Æ 3.00 g), were purchased from a ence (Lu, Chen, Wu, Zeng & Su 2001). As eggs, local commercial farm (Dadeng Island, Xiamen, embryos and larvae of abalone are so small that Fujian Province). All abalones were maintained in single specimen is impossible to afford enough polyethylene tanks, each containing 20 animals in total RNA for PCR, many specimens from same 50 L aerated sand-filtered seawater at 23–25°C, developmental stages were collected together, and and fed with kelp. The culture medium was were regarded as one sample. There were five renewed with fresh seawater everyday. Abalones batches of eggs. And each batch of eggs came were left undisturbed for 2 weeks to acclimate to from same parents. The samples of different devel- their environment before bacterial challenge. Five opmental stages were collected with the develop- individuals were used in each experimental condi- ment of each batch of eggs. So there were five tion. Abalones were challenged by being injected samples at each developmental stage. into the footmuscle, with 50 lLofV. parahaemolyticus (isolated from diseased abalone) in 0.9% Isolation of total RNA and synthesis of cDNA NaCl (6.7 9 107 cfu/mL) (challenged groups), or 50 lL of 0.9% NaCl (control groups). After injec- Total RNA was extracted from different tissues and tion, the abalones were returned to their original embryos at different stages as described above tanks containing seawater of the same tempera- using Trizol Reagent (Invitrogen). Total RNA was ture. Just before injection, the samples were col- examined by agarose gel electrophoresis. The lected and regarded as 0 phase. At 3, 6, 12 and absorbance at 260 nm from ultraviolet spectropho- 24 h post injection, the samples were collected tometer was used to calculate the quantity of total and was regarded as 3, 6, 12 and 24 h phase RNA. The purity of RNA was estimated by the respectively. Each sample contains five individuals. OD260/OD280 (the rate of absorbance between In detail, haemolymph was separately collected by 260 nm and 280 nm), OD260/OD230(the rate of cutting the foot, and haemocytes were then isolated absorbance between 260 nm and 230 nm) and by centrifugation at 2000 9 g,at4°C for 5 min and the result of agarose gel electrophoresis. Then the

© 2013 John Wiley & Sons Ltd, Aquaculture Research, 46, 1537–1549 1539 A homologue of dermatopontin from Haliotis diversicolor G Wang et al. Aquaculture Research, 2015, 46, 1537–1549 total RNA was treated with RQ1 RNase-Free Dnase and 0.5 lL of each primer (10 pmol lLÀ1). (Promega, Beijing, China) to remove contaminat- Reactions were performed with the SYBR Green ing DNA. 2 lg total RNA and 0.5 lM random pri- PCR Master Mix (Applied Biosystems) and analy- mer (Promega) were used to synthesize cDNA from sed in the ABI 7500 realtime System. The cycling each sample by M-MLV reverse transcriptase (Pro- conditions for both saDPT2 and b-actin were as mega). Finally, synthesized cDNA was diluted ten- follows: 1 min at 95°C, followed by 40 cycles fold (total 200 lL) before storing at À20°C. (15 s at 95°C, 1 min at 60°C). Melting curves were also plotted (60–90°C) to make sure that a single PCR product was amplified for each pair of saDPT2 mRNA expression analysis by quantitative primers. Data were expressed as mean and real-time PCR standard error of the mean (SEM) unless otherwise The expression level of saDPT2 in abalone tissues stated. Five separate individuals at each time were was analysed by quantitative real-time PCR. tested, each assayed in triplicate. Statistical analysis saDPT2 gene specific primers (saDPT2-realtime-F, of the normalized CT values was performed with saDPT2-realtime-R; Table 1) were designed based one-way analysis of variance (one-way ANOVA); on the saDPT2 coding sequence. And the product followed by Duncan test in tissue expression and of quantitative real-time PCR with saDPT2 gene temporal expression, an unpaired two-tailed t-test specific primers was sequenced to confirm whether in bacterial challenges. Differences were considered it is saDPT2. The saDPT2 expression in bacterial significant at P < 0.05. challenge was analysed by relative quantitative real-time PCR. The gene coding for the abalone Results b-actin protein (GenBank accession no. ABY87412) was selected as a reference gene, and was amplified Identification and characterization of a full-length using b-actin-F and b-actin-R gene specific primers saDPT2 cDNA from abalone (Table 1). The comparative threshold cycle (CT) method (user Bulletin#2, the ABI PrismR 7500 The full-length cDNA of saDPT2 (GenBank acces- Sequence detector, Applied Biosystems) was used sion no. ACH48240) is 620 bp, with 31 bp 5′ to calculate the relative concentrations. This UTR (untranslated region) and 55 bp 3′UTR method involves obtaining CT values for the (Fig. 1). The complete amino acid sequence of saDPT2, normalizing them to the housekeeping saDPT2 was deduced from the full-length cDNA. gene, b-actin, and comparing the relative expres- The open reading frame is comprised of 531 bp, sion level. Experiments were performed routinely which encoded a protein of 177 amino acid residues, with five challenged abalones and five control with a calculated molecular mass of 20.7 kDa. The abalones with values presented as 2À△△CT for the calculated isoelectric point (4.62) indicated that expression levels of saDPT2 normalized with saDPT2 is acidic. Analysis using SignalP 3.0 b-actin (△CT = CT of saDPT2 minus CT of b-actin, (http://www.cbs.dtu.dk/services/SignalP) showed △△CT = △CT of challenged sample minus △CT of that N terminal segment up to residue 19 is a sig- calibrator sample). nal peptide (Fig. 1). A same amino acid motif The mRNA expression of saDPT2 in embryo, lar- (S-X-H-D-N-X-X-E-D-R) was repeated three times vae, juvenile, and different tissues of adult animal (Fig. 2). Moreover, analysis using PredictProtein were analysed by absolute quantitative real-time showed that mature saDPT2 has four intramolecu- PCR followed the protocol of ABI. Based on the lar disulphide bonds, two N-glycosylation sites linear relationships between cycle threshold (CT) in the putative amino acid sequence (Fig. 1). and different lg concentrations of saDPT2 RNA PSI-BLAST showed that the deduced amino acid standard (transcribed in vitro according to the sequence of saDPT2 shares 46, 45, 44, 41, 28% protocol of Promega P1300), the copy number of identity with DPT2 of freshwater snail Biomphalar- saDPT2 RNA was calculated and analysed as the ia glabrata (GenBank accession no. AAZ80785.1), mRNA expression level in different tissues and haemagglutinin/amebocyte aggregation factor developmental stages. (HAAF) of Atlantic salmon Salmo salar (GenBank Real-time PCR was carried out in a 20 lL reac- accession no. ACI58653.1), DPT of African clawed tion volume containing 9 lL of 1:10 diluted origi- frog Xenopus laevis (GenBank accession no. AAI5- nal cDNA, 10 lLof29 SYBR Green Master Mix, 5365.1), DPT1 of zebrafish Danio rerio (GenBank

Figure 1 Full-length cDNA sequence and deduced amino acid sequence of saDPT2. Nucleotides and amino acid residues are numbered on both ends. The initiation codon (atg), the stop condon (tag) and the polyadenylation signal sequence (ATAAA) are characterized in purple bold. The signal peptide is underlined. The three repeat sequences (S-X-H-XN-X-Y-E-D-R) are boxed in red, while potential N-glycosylation sites are boxed in purple. The cysteines forming intramolecular disulphide bonds are circled.

accession no. CAI20663.1), DPT of Human Homo According to the linear relationships between sapiens (GenBank accession no. NP_001928.2) cycle threshold (CT) and logarithm of saDPT2 respectively. Multiple alignment analysis further mRNA concentration (base 10), the copies of saD- revealed that saDPT2 lacks prominent 6-residue PT2 mRNA per lg total RNA in different tissues repeating sequence of D-R-E/Q-W-X-F/Y and was calculated. They were detected in all exam- RGAT sequences, which are well-conserved among ined tissues. The ANOVA showed that is the expres- mammals. sion level had no significant difference among assayed tissues (P > 0.05). Phylogenetic analysis of dermatopontin Developmental expression of saDPT2 gene Twenty-two sequences of available animal DPTs and HAAF were used for the phylogenetic tree The developmental expression profiles of saDPT2 construction by neighbour-joining method (Fig. 3). gene were analysed by real-time PCR (Fig. 5). All the members were mainly clustered into two saDPT2 gene was detected in all selected abalone groups. Group 1 contains HAAFs and invertebrate developmental stages, but there were obvious fluc- DPTs, Group 2 contains vertebrate DPTs. In group tuations during the developmental process. From 1, sponge DPT is one clade. Mollusc DPTs and fertilized eggs to blastula, the mRNA level of saD- HAAFs clustered another big clade, in which PT2 was middle. Then the mRNA level decreased gastropods DPTs clustered one small clade. In during planktonic larva stages. After metamorpho- group 2, the DPTs of fish and tetrapod clustered sis, the mRNA level sharply increased. One-way one clade respectively. ANOVA showed that there was significant difference during larvae development (P < 0.05). The multiple comparison showed that the mRNA level of Tissue mRNA expression of saDPT2 gene juvenile abalone was significantly higher than that Tissue mRNA expression of saDPT2 was analysed of the other developmental stages (P < 0.05). And using absolute quantitative real-time PCR in there was no significant difference among the various tissues from normal abalone (Fig. 4). other developmental stages (P > 0.05).

Figure 2 Multiple sequence alignment of the saDPT2 amino acid sequence with other known vertebrate and invertebrate DPT proteins. Three repeat sequences (S-X-H-XN-X-Y-E-D-R) of invertebrate DPTs and their corresponding sequences in other species are indicated in blue rectangles. Six-residue three repeat sequences (D-R-E/Q-W-X-F/Y) conserved in mammals and their corresponding sequences in other species are indicated in red rectangles. The N-Y-D and its corresponding sequences are indicated in a yellow rectangle. The integrin-binding R-G-A-T sequence and its corresponding sequences are indicated in a green rectangle. The cysteines forming intramolecular disulphide bonds are indicated in triangles. The GenBank accession numbers of selected DPTs are Homo sapiens: NP_001928; Bos taurus: NP_001039368; Mus musculus: NP_062733; Ornithorhynchus anatinus: XP_001514078; Gallus gallus: XP_001231676; Danio rerio: NP_001025256; Haliotis diversicolor: ACH48240; Haliotis discus discus: ABO26644; Biomphalaria glabrata: AAZ80785; Pinctada martensi: AFK64754; Suberites domuncula: CAC38786.

difference of saDPT2 mRNA level between the con- Analysis of saDPT2 gene expression pattern in trol and bacterial challenge at 12 h (P < 0.05), no abalones after bacterial challenges difference at the other time (Fig. 6a). In gills, there Expression profiles of saDPT2 in haemocytes and was also significant difference of saDPT2 mRNA gills after bacterial challenge are shown in Fig. 6. level between the control group and bacterial chal- All comparisons were done between the control lenge group at 12 h (P < 0.05). Although the group and bacterial challenge group at the same saDPT2 mRNA level of bacterial challenge group phase. In haemocytes, there was significant was higher than that of the control group at 3

99 DPT2 Biomphalaria glabrata

91 DPT3 Biomphalaria glabrata DPT3 Lymnaea stagnalis 86 71 DPT2 Lymnaea stagnalis DPT1 Lymnaea stagnalis 54 99 DPT1 Biomphalaria glabrata 42 DPT2 Mandarina aureola 90 DPT1 Euhadra herklotsi 24 Group 1 DPT Haliotis discus discus

65 DPT2 Haliotis diversicolor 60 HAAF Salmo salar HAAF Xenopus tropicalis 34 HAAF Limulus polyphemus 42 DPT Pinctada martensi DPT Suberites domuncula

98 DPT Danio rerio 90 DPT Carassius auratus DPT Oreochromis niloticus Group 2 100 DPT Xenopus laevis DPT Taeniopygia guttata 100 61 DPT Mus musculus 91 DPT Homo sapiens

0.1

Figure 3 Phylogenetic relationships between the deduced amino acid sequence of H. diversicolor DPT2 (triangle) complete coding sequence and other DPT-related sequences found in databases. The respective GenBank accession numbers are as follows: DPT2 Haliotis diversicolor: ACH48240; HAAF Salmo salar: NP_001134776; DPT2 Biompha- laria glabrata: AAZ80785; DPT3 Biomphalaria glabrata: AAZ80787; HAAF Limulus polyphemus: Q01528; DPT3 Lym- naea stagnalis: BAD97852; DPT Pinctada martensi: AFK64754; DPT Haliotis discus discus: ABO26644; HAAF Xenopus (Silurana) tropicalis: XP_002932704; DPT2 Lymnaea stagnalis: BAD97851; DPT Suberites domuncula: CAC38786; DPT2 Mandarina aureola: BAD97862; DPT1 Euhadra herklotsi: BAD97857; DPT1 Lymnaea stagnalis: BAD97850; DPT1 Biomphalaria glabrata: BAD97853; DPT Danio rerio NP_001025256; DPT Carassius auratus BAJ76677; DPT Oreochromis niloticus: XP_003444267; DPT Taeniopygia guttata:XP_002193672; DPT Xenopus laevis: NP_001167486; DPT Mus musculus: NP_062733; DPT Homo sapiens: NP_001928. and 6 h, there was no significant difference sequence is corresponding to the end of the first, between these two groups. (P > 0.05) (Fig. 6b). third, and the fourth loop structures (Okamoto & Fujiwara 2006). The three 6–residue repeat regions (D-R-E/Q-W-X-F/Y) may function as part of a gly- Discussion cosaminoglycan binding site (Takeuchi 2010). In invertebrates, there is no similar 6-residue repeating Structure sequence of D-R-E/Q-W-X-F/Y (Fig. 1 and Fig. 2). In mammalia, there is a 6-residue repeating But, Iguchi and his collaborators suggested that sequence of D-R-E/Q-W-X-F/Y (Neame, Choi & there are three ‘10-residue motif (S-X-H-X-N-X-Y-E- Rosenberg 1989) that appears three times (red D-R)’ repeats in fire corals (Millepora spp.) (Iguchi, rectangles in Fig. 2). Okamoto and his collabora- Iwanaga & Nagai 2008). We also found that the tors suggested that the 6-residue repeating similar 10-residue motif (S-X-H-D-N-X-X-E-D-R)

22 20 18 16 14 12 10 8 6 copies/ug total RNA) 4 2 0 Gi Hp Hm Ep Mg Mn Ki saDPT2 mRNA expression (ten thousand Different tissues

Figure 4 Expression of saDPT2 mRNA analysed by real-time PCR in different abalone tissues. Mn, mantle; Gi, gills; Ki, kidney; Ep, epipodium; Mg, mucous gland; Hp, hepatopancreas; Hm, hemocytes. Each bar is means Æ SEM (N = 5).

38 * 36 34 32 30 28 26 24 22 20 18 16 14 12 10

copies/ug total RNA) 8 6 4 2 0 FE TC BL TR VE PL JA saDPT mRNA expression (ten thousand Developmental stages

Figure 5 Developmental expression of saDPT2 mRNA from fertilized eggs to juvenile. FE: fertilized eggs; TC, two cells; BL, blastula; TR, trochophore; VE, veliger; PL, post larvae; JA, juvenile abalone post 10 days metamorphosis. The values are shown as mean Æ SEM (N = 5). Differences are considered statistically signiﬁcant (*)atP< 0.05.

was repeated three times in small abalone. The mul- The RGD (Arg-Gly-Asp) motif is a cell attach- tiple alignment analysis showed that the three ment site of a large number of adhesive extracellu- 10-residue repeats motif is conserved in inverte- lar matrix, blood and cell surface proteins brates. And we also found that the 10-residue motif (Ruoslahti 1996). The EDR (Glu-Asp-Arg) motif, is located before the 6-residue repeating sequence, the last part of the conserved sequence motif of with two residues overlap. It suggested that the S-X-H-X-N-X-Y-E-D-R in saDPT2, is similar to the 10-residue motif and the 6-residue repeating sequ- RGD motif, and this motif is comprised of three ence constitute a bigger motif. Although the 10-resi- amino acids residues and contains both acidic and due motif and the 6-residue repeating sequence basic amino acid. This EDR motif could be func- are well-conserved among species and they thus tionally important because it is conserved among seem to have some roles, no biologically signiﬁcant all invertebrate DPTs examined so far (Fujii et al. characteristics have yet been demonstrated. 1992; Sarashina et al. 2006).

(a) 14 Bacteria * 12 Saline

in hemocytes 4

0 Relative saDPT2 mRNA expression 0 h 3 h 6 h 12 h 24 h Hours post injection

(b) 4

3.5 Bacteria Saline * 3

2.5

in gills 1.5

0.5

0 Relative saDPT2 mRNA expression 0 h 3 h 6 h 12 h 24 h Hours post injection

Figure 6 Temporal expression of saDPT2 mRNA in haemocytes (a) and in gills (b) after bacterial challenge. The time scale is the hours post bacterial challenge. The values are shown as mean Æ SEM (N = 5). Signiﬁcant difference between challenged and control group (Saline-injected) is indicated by (*)atP < 0.05. b-actin served as reference gene.

Moreover, intramolecular disulphide bonds are are expected to play important roles in shell for- well-conserved between vertebrates and inverte- mation (Sarashina et al. 2006). N-linked glycosyla- brates. In bovine and L. polyphemus DPTs, the tion is a common posttranslational modification presence of five disulphide bonds has been deter- that is known to play an important role in protein mined experimentally by digestion with chymo- folding and cell adhesion (Bhatiam & Mukhopadhyay trypsin and thermolysin respectively (Fujii et al. 1999). This N-linked glycosylation seems to be 1992; Cheng et al. 2004). Mature saDPT2 has functionally important for the shell matrix DPTs four intramolecular disulphide bonds. But the posi- (Sarashina et al. 2006). There was high identity tions of the four disulphide bonds are likely to be (45%) between Atlantic salmon HAAF and conserved among L. polyphemus, bovine and aba- saDPT2. In consideration of the far evolutionary lone because of the conserved nature of the cyste- relationship between abalone and salmon, the ine positions in the primary structures of those high identity is surprising. On the other hand, DPTs (Fig. 2). PSI-BLAST results showed that only 10 sequences The Asparagines (N), indicated by box in purple named HAAF from four species in the top 100 in Fig. 1, are predicted to form an acceptor site for homologue sequences. Moreover, no characteristic N-linked glycosylation together with an adjacent sequences of HAAF could be identified. Although amino acid. Those Asns are the candidates that the clustal result showed that DPTs and HAAF

(GenBank accession no. AAA28272.1) (Fig. 2) the dead individuals were rejected because they share high conserved sequences, but in a phyloge- did not attach to abalone settlement substrates. So netic tree of homologue protein sequences using the high expression level of saDPT2 at juvenile neighbour-joining method (Fig. 3), saDPT did not stage was from the survivals. It is partly due to directly cluster with HAAF. Most invertebrate high expression level of saDPT2 that the juvenile DPTs (including saDPT2) were clustered a clade, abalone can survive. Although there is no consen- and continued clustered into a big clade with the sus as to which specific pathogen leads to the mor- HAAF. Thus, the saDPT2 is a DPT rather than a tality, many researchers believed that vibrio is the HAAF, but there may be same function between most possible (Liu, Chen, Huang & Lee 2000), saDPT2 and HAAF. because vibrio is the predominant bacteria present in abalone settlement substrates (Wang, Yang, Hao, Song & Ma 2009b; Wang, Zhang, Wang, Expression Zou, Wang, Wang, Jia & Lin 2009a). The saDPT2 There are two or three dematopontin homologues may play a role in resisting pathogen infection in mollusc. For example, three DPT homologues such as vibrio during juvenile stage. After meta- were found in German landsnail Lymnaea stagnalis morphosis, larvae become juvenile abalone. The and freshwater snail B. glabrata, two homologues juvenile abalone is highly similar to adult in mor- in Japanese landsnail Euhadra brandtii (Bouchut phology and ecological habit except smaller in size et al. 2006; Sarashina et al. 2006). We found two and absence of developed gonad. It is believed that dematopontin homologues from two normalized there is similar immunological mechanism cDNA libraries from hepatopancreas and between juvenile abalone and adult abalone. The haemocytes in small abalone (Jia et al. 2009). saDPT2 may play similar role between juvenile One is named saDPT2 (GenBank accession no. stage development and response of vibrio chal- ACH48240), because of high similarity to DPT-2 lenged in adult, because of up-regulated expression of freshwater snail B. glabrata. The other sequence pattern were observed in both cases. is more similar to DPT-3 of freshwater snail B. The mRNA of saDPT2 was found in all assayed glabrata, so we named it as saDPT3 (GenBank tissues. In mollusc, the shell matrix proteins are accession no. JQ682870). Up to date, we do not secreted from epithelial cells in mantle tissues find any sequence similar to mollusc DPT-1 in (Marin, Luquet, Marie, Medakovic & Gerald 2008). small abalone. To distinguish the two dematopon- As a shell matrix protein, DPT of gastropods is tin homologues of small abalone, we designed mainly expressed in mantle (Bouchut et al. 2006; saDPT2 quantitative real-time PCR primers Sarashina et al. 2006). For example, L. stagnalis (sa-DPT-realtimeF, sa-DPT-realtimeR) at unique DPT-1 was expressed exclusively in mantle, the sequence of saDPT2. And the sequencing result of DPT-2 mainly in mantle and kidney, whereas quantitative real-time PCR product showed that DPT-3 was expressed evenly in mantle, foot, kidney the sequence belongs to saDPT2, not saDPT3. and haematopancreas. E. brandtii DPT-1 and 2 In abalone, shell formation starts from trocho- distributions were similar to those of L. stagnalis phore. But the mRNA level of saDPT2 is lowest at DPT-1 and 3 (Sarashina et al. 2006). There are few trochophore stage. Moreover, there is higher reports suggested that DPT is expressed in haemo- expressing level before shell formation (from fertil- cytes. The expression of DPT homologues was ized eggs to blastula). In addition, there is differ- detected in haemolymphs of B. glabrata (Bouchut ence of developmental expression pattern between et al. 2006) and of Pinctada martensii (Jiao, Wang, saDPT2 and the other molluscan shell genes. Most Du, Zhao, Wang, Huang & Deng 2012), but haemo- of mullsucan shell genes have similar expression cytes of B. glabrata are not the main expressing tis- level from planktonic larval stages to juvenile sues of DPT. The expression level of DPT of stage (Jackson, Worheide€ & Degnan 2007). But P. martensii. in haemolymphs is significantly lower the mRNA level of saDPT2 at juvenile stage is sig- than mantle with the highest expression of and Jiao nificantly higher than that at planktonic larval et al. (2012) suggested that DPT participated in stages. This means that saDPT2 has no close rela- macre formation in P. martensii. But the expression tion with shell formation. There is a high mortal- level of saDPT2 mRNA in haemocytes is similar to ity after settlement during juvenile stage. When the mantle. It suggests that saDPT2 may have more the samples were collected during juvenile stage, functions than shell matrix protein.

Moreover, some invertebrates’ DPT induces hae- example, Huang and his collaborators found that magglutination. For example, a Limulus polyphemus DPT of amphioxus Branchiostoma belcheri tsingtau- DPT homologue induces a strong haemagglutina- nese had a 900-fold induction after the V. parahaemo- tion of horseshoe crab erythrocytes at low concen- lyticus infection (Hanington et al. 2010). trations (Fujii et al. 1992). At relatively high The researchers examined the expression of DPT concentrations, the DPT homologue also promotes in these haemolymphs and found that the expres- the aggregation of L. s gametocytes (Fujii et al. sions of DPT-2 and -3 were constitutively higher in 1992). Similarly, another invertebrate DPT homo- resistant snails by ten and three times, respectively, logue from the marine sponge Suberites domuncula, compared with that in susceptible snails (Bouchut in its recombinant form, induces S. domuncula cell– et al. 2006). The up-regulation of DPT may help cell aggregation (Schutze€ et al. 2001). Okamoto and remove parasites or bacteria by acting on haemo- his collaborators had investigated the possible hae- cytes aggregation/agglutination. In addition, the magglutination activity of bovine DPT using rabbit expression dynamics of amphioxus DPT was similar erythrocytes, but no agglutination activity was to saDPT2, both starting at 12 h after challenge found (Okamoto & Fujiwara 2006). In addition, (Huang et al. 2007). In amphioxus, there are many horseshoe crab DPT is produced by haemocytes and homologues of mammalian acute immune defence stored in large secretary granules (Fujii et al. 1992). genes with similar temporal expression pattern to The characterization of the complete coding saDPT2 (Huang et al. 2007). In small abalone, sequence (CDS) of saDPT2 revealed that the precur- there are also many immune defence genes, such sors contain signal peptides suggesting that they as macrophage expressed gene (Wang, Zhang, could be constitutively secreted or stored and Zhang, Zou, Jia, Wang, Lin & Wang 2008), macro- released from haemocytic granules. In consider- phage migration inhibitory factor (Wang et al. ation of aggregation/agglutination activities, the 2009a,b) and CuZn superoxide dismutase (Zhang, invertebrate DPT may play a role in immune system. Wang, Zou, Jia, Wang, Lin, Chen, Zhang & Wang Based on the saDPT2 sequence conservation and 2008), with similar expression pattern to saDPT2. saDPT2 high expression level of the mRNA in hae- There is another possibility that DPT involves mocytes, we suggested that saDPT2 also may be immune response by transforming growth factor b involved in immune response. In molluscs, haemo- (TGF-b). DPT has interaction with TGF-b, and can cytes are involved not only in coagulation but also inﬂuence TGF-b bioactivity (Okamoto et al. 1999). in encapsulation, cytotoxicity and melanization Many reports show that TGF-b has pleiotropic and (Soderh€ all,€ Cerenius & Johansson 1996). Many profound effects on the immune system (Yang reports showed that these were observable immune 2010; Yang, Pang & Moses 2010). TGF-b modu- response in haemocytes (Cheng et al. 2004; Gopala- lates the behaviour of many cell types by interact- krishnan, Thilagam, Huang & Wang 2009). In our ing with its receptors and by transducing signals to previous articles, we found that gills are another tis- the cell nucleus through the successive phosphory- sue with observable immune response of small aba- lation of intracellular messenger molecules. lone (Ge, Wang, Zhang, Zhang, Wang, Zou, Yan & Wang 2011; Ge, Wang, Zhang, Wang, Zou, Yan, Acknowledgments Wang & Zhang 2012; Li, Zhang, Zhang, Wang, Zou, Wang & Wang 2012). In the other molluscs, The work was supported by the National Natural gills and haemocytes are used to detect the expres- Science Foundation of China (Nos. 41006105, sion of immune genes (Park, Kim, Nam, Kong, Kim, 41176152), the program for outstanding young Lee, Kong & Choi 2008; Zhang, Jiang, Jiang, Ma, scientists in Fujian Province University, the pro- Su, Qiu, Zhu & Xu 2009; Zhou, Ni, Wang, Wang, gram of the Science and Technology Department Wang, Shi, Yue, Liu & Song 2012). So, we exam- of Fujian Province (No. 2011N0022), the Innova- ined the expression pattern of saDPT2 in haemo- tion Team Foundation of Jimei University cytes and gills at different times after being (No. 2010A001). challenged with V. parahaemolyticus. The result showed that mRNA level of saDPT2 was higher in References bacterial challenged group. In agreement with our results, higher mRNA levels of DPT were monitored Bhatiam P.K. & Mukhopadhyay A. (1999) Protein after pathogen challenge in many studies. For glycosylation: implications for in vivo functions and

therapeutic applications. Advances in Biochemical Engi- during ecological transitions. BMC Evolutionary Biology neering/Biotechnology 64, 155–201. 7, 160. Bouchut A., Roger E., Coustau C., Gourbal B. & Mitta G. Jia X., Zhang Z., Wang G., Zou Z., Wang S., Huang B. & (2006) Compatibility in the Biomphalaria glabrata/Echi- Wang Y. (2009) Expressed sequence tag analysis for nostoma caproni model: potential involvement of adhe- identification and characterization of genes related to sion genes. International Journal for Parasitology 36, Tributyltin (TBT) exposure in the abalone Haliotis 175–184. diversicolor supertexta. Comparative Biochemistry Physiol- Cheng W., Hsiao I.S. & Chen J.C. (2004) Effect of ammo- ogy Part D Genomics Proteomics 4, 255–262. nia on the immune response of Taiwan abalone Halio- Jiao Y., Wang H., Du X., Zhao X., Wang Q., Huang R. & tis diversicolor supertexta and its susceptibility to Vibrio Deng Y. (2012) Dermatopontin, a shell matrix protein parahaemolyticus. Fish & Shellfish Immunology 17, gene from pearl oyster Pinctada martensii, participates 193–202. in nacre formation. Biochemical and Biophysical Forbes E.G., Cronshaw A.D., MacBeath J.R. & Hulmes Research Communications 425, 679–683. D.J. (1994) Tyrosine-rich acidic matrix protein Kim H.S. & Cheon Y.P. (2006) Spatio-temporal expres- (TRAMP) is a tyrosine-sulphated and widely distributed sion and regulation of dermatopontin in the early protein of the extracellular matrix. FEBS Letters 351, pregnant mouse uterus. Molecular Cell 22, 262–268. 433–436. Lewandowska K., Choi H.U., Rosenberg L.C., Sasse J., Fujii N., Minetti C.A.S., Nakhasi H.L., Chen S.W., Barbehenn Neame P.J. & Culp L.A. (1991) Extracellular matrix E., Nunes P.H. & Nguyen N.Y. (1992) Isolation, cDNA adhesion-promoting activities of a dermatan sulfate cloning, and characterization of an 18-kDa hemaggluti- proteoglycan-associated protein (22K) from bovine nin and amebocyte aggregation factor from Limulus fetal skin. Journal of Cell Science 99, 657–668. polyphemus. JournalofBiologicalChemistry267, 22452– Li N., Zhang Z., Zhang L., Wang S., Zou Z., Wang G. & 22459. Wang Y. (2012) Insulin-like growth factor binding Ge H., Wang G., Zhang L., Zhang Z., Wang S., Zou Z., protein7, a member of insulin-like growth factor signal Yan S. & Wang Y. (2011) Molecular cloning and pathway, involved in immune response of small aba- expression of interleukin-1 receptor-associated kinase lone Haliotis diversicolor. Fish & Shellfish Immunology 4, an important mediator of Toll-like receptor signal 33, 229–242. pathway, from small abalone Haliotis diversicolor. Fish Liu P., Chen Y., Huang C. & Lee K.K. (2000) Virulence & Shellfish Immunology 30, 1138–1146. of Vibrio parahaemolyticus isolated from cultured small Ge H., Wang G., Zhang L., Wang S., Zou Z., Yan S., abalone, Haliotis diversicolor supertexta, with withering Wang Y. & Zhang Z. (2012) haracterization of inter- syndrome. Letters in Applied Microbiology 31, 433–437. leukin-1 receptor-associated kinase 1 binding protein 1 Lu J., Chen Z., Wu J., Zeng H. & Su G. (2001) Embryonic gene in small abalone Haliotis diversicolor. Gene 506, development of abalone (Haliotis diversicolor reeve). Acta 417–422. Zoologica Sinica 47, 317–323. Gopalakrishnan S., Thilagam H., Huang W. & Wang K. Marin F., Luquet G., Marie B., Medakovic D. & Gerald (2009) Immunomodulation in the marine gastropod P.S. (2008) Molluscan Shell Proteins: primary Struc- Haliotis diversicolor exposed to benzo(a)pyrene. Chemo- ture, Origin, and Evolution. Current Topics in Develop- sphere 75, 389–397. ment Biology 80, 209–276. Hanington P.C., Lun C.M., Adema C.M. & Loker E.S. Marxen J.C. & Becker W. (1997) The organic shell (2010) Time series analysis of the transcriptional matrix of the freshwater snail Biomphalaria glabrata. responses of Biomphalaria glabrata throughout the Comparative Biochemistry and Physiology 118B,23–33. course of intramolluscan development of Schistosoma Marxen J.C., Nimtz M., Becker W. & Mann K. (2003) mansoni and Echinostoma paraensei. International Journal The major soluble 19.6 kDa protein of the organic for Parasitology 40, 819–831. shell matrix of the freshwater snail Biomphalaria glabra- Huang G., Liu H., Han Y., Fan L., Zhang Q., Liu J., Yu ta is an N-glycosylated dermatopontin. Biochimica et X., Zhang L., Chen S., Dong M., Wang L. & Xu A. Biophysica Acta 1650,92–98. (2007) Profile of acute immune response in Chinese Murray A.G. & Peeler E.J. (2005) A framework for amphioxus upon Staphylococcus aureus and Vibrio para- understanding emerging diseases in aquaculture. Pre- haemolyticus infection. Developmental and Comparative ventive Veterinary Medicine 67, 223–235. Immunology 31, 1013–1023. Neame P.J., Choi H.U. & Rosenberg L.C. (1989) The iso- Iguchi A., Iwanaga S. & Nagai H. (2008) Isolation and lation and primary structure of a 22-kDa extracellular characterization of a novel protein toxin from fire matrix protein from bovine skin. Journal of Biological coral. Biochemical Biophysical Research Communication Chemistry 264, 5474–5479. 365, 107–112. Okamoto O. & Fujiwara S. (2006) Dermatopontin, a Jackson D., Worheide€ G. & Degnan B. (2007) Dynamic Novel Player in the Biology of the Extracellular Matrix. expression of ancient and novel molluscan shell genes Connective Tissue Research 47, 177–189.

Okamoto O., Suzuki Y., Kimura S. & Shinkai H. (1996) Wang G., Zhang K., Zhang Z., Zou Z., Jia X., Wang S., Extracellular matrix 22-kDa protein interacts with Lin P. & Wang Y. (2008) Molecular cloning and decorin core protein and is expressed in cutaneous responsive expression of macrophage expressed gene fibrosis. The Journal of Biological Chemistry 119, from small abalone Haliotis diversicolor supertexta. Fish 106–114. & Shellfish Immunology 24, 346–359. Okamoto O., Fujiwara S., Abe M. & Sato Y. (1999) Der- Wang B., Zhang Z., Wang Y., Zou Z., Wang G., Wang S., matopontin interacts with transforming growth factor Jia X. & Lin P. (2009a) Molecular cloning and charac- beta and enhances its biological activity. Biochemical terization of macrophage migration inhibitory factor Journal 337(Pt 3), 537–541. from small abalone Haliotis diversicolor supertexta. Fish Park E., Kim Y., Nam B., Kong H., Kim W., Lee S., Kong & Shellfish Immunology 27,57–64. I. & Choi T. (2008) Cloning, characterization and Wang L., Yang Q., Hao J., Song Z. & Ma Y. (2009b) Iso- expression analysis of the gene for a putative lipopoly- lation and identification of bacteria from the environ- saccharide-induced TNF-a factor of the Pacific oyster. ment of mass mortality during Haliotis diversicolor Crassostrea gigas Fish Shellfish Immunol 24,11–17. supertexta larvae stage. J Oceanogr Taiwan Strait 28, Pochampally R.R., Ylostalo J., Penfornis P., Matz R.R., 210–216. Smith J.R. & Prockop D.J. (2007) Histamine receptor Yang L. (2010) TGF-beta, a potent regulator of tumor H1 and dermatopontin: new downstream targets of microenvironment and host immune response, implica- the vitamin D receptor. Journal of Bone and Mineral tion for therapy. Current Molecular Medicine 10, Research 22, 1338–1349. 374–380. Ruoslahti E. (1996) RGD and other recognition Yang L., Pang Y. & Moses H.L. (2010) TGF-b and sequences for integrins. Annual Review of Cell and Devel- immune cells: an important regulatory axis in the opmental Biology 12, 697–715. tumor microenvironment and progression. Trends in Sarashina I., Yamaguchi H., Haga T., Iijima M., Chiba S. Immunology 31, 220–227. & Endo K. (2006) Molecular evolution and function- Zhang K., Wang G., Zou Z., Jia X., Wang S., Lin P., Chen ally important structures of molluscan dermatopontin: Y., Zhang Z. & Wang Y. (2008) Cloning, characteriza- implications for the origins of molluscan shell matrix tion and TBT exposure response of CuZn superoxide proteins. Journal of Molecular Evolution 62, 307–318. dismutase from Haliotis diversicolor supertexta. Molecular Schutze€ J., Krasko A., Diehl-Seifert B. & Muller€ W.E.G. Biology Reports 36, 583–594. (2001) Cloning and expression of the putative aggre- Zhang D., Jiang J., Jiang S., Ma J., Su T., Qiu L., Zhu C. gation factor from the marine sponge Geodia cydonium. & Xu X. (2009) Molecular characterization and expres- Journal of Cell Science 114, 3189–3198. sion analysis of a putative LPS-induced TNF-a factor Soderh€ all€ K., Cerenius L. & Johansson M.W. (1996) The (LITAF) from pearl oyster Pinctada fucata. Fish & Shell- prophenoloxidase activating system in invertebrates. fish Immunology 27, 391–396. In: New directions in invertebrate immunology (ed. by Zhou Z., Ni D., Wang M., Wang L., Wang L., Shi X., Yue K. Soderh€ all,€ S.G. R Iwanaga & G.R. Vasta) pp. 229– F., Liu R. & Song L. (2012) The phenoloxidase activity 253. Fair Haven, NJ: SOS Publications. and antibacterial function of a tyrosinase from scallop Takeuchi T. (2010) Structural comparison of dermato- Chlamys farreri. Fish & Shellfish Immunology 33, pontin amino acid sequences. Biologia 65, 874–879. 375–381.