2020.02.02.930800V1.Full.Pdf

bioRxiv preprint doi: https://doi.org/10.1101/2020.02.02.930800; this version posted February 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

CLOCK-induced upregulated HMGB1 resulting in circadian rhythms disruption

of inflammatory microglia contributes to non-dipper hypertension in stressed rats

Shutian Zhang a, b*, Li Hu c, Chunmei Xia b

a. Clinical medicine (eight-year program), Shanghai Medical College, Fudan University,

Shanghai, 200032, P.R. China

b. Department of Physiology and Pathophysiology, Basic Medicine College, Fudan University,

Shanghai, 200032, P.R. China details c. Laboratory of Neuropharmacology and Neurotoxicology,for Shanghai Key Laboratory of Bio- DOI Energy Crops, College of Life Science, Shanghai University, Shanghai, 200444, P.R. China. manuscript * CorrespondingWITHDRAWN authorsee Correspondence should be addressed to: Shutian Zhang, MD.

E-mail: [email protected]

Abstract

Increased microglia activation and neuroinflammation within autonomic brain regions

have been implicated in stress-induced hypertension (SIH). The circadian clock affects

physiological cellular and biological processes, including blood pressure (BP) control, but the

mechanisms remain unclear. Microglia possess endogenous timekeeping mechanisms

regulate immune responses. Here, we explore whether SIH is associated with disrupted

diurnal rhythms in microglia proinflammatory factors (PICs) releasing. We found that SIH

exhibit diminished BP circadian rhythms, which showed non-dipper hypertension. Microglia details isolated from the rostral ventrolateral medulla (RVLM) offor SIH rats had aberrant PICs DOI releasing and CLOCK rhythms, while microglia from control rats exhibited robust rhythms of

PICs expression both ex vivomanuscript and in vivo. In the RVLM, stress upregulated CLOCK WITHDRAWNsee expression which is independent of time of day in comparison with that of control. We

further identified that upregulated CLOCK depressed sirt1 expression thereby increased

oxidative stress-related HMGB1- PICs releasing in microglia in RVLM of SIH rats. In

conclusion, the disrupts intrinsic circadian rhythms of microglia-derived PICs releasing

involves in pathogeneses of non-dipper hypertension in stressed rats.

Key words

Stress-induced hypertension; neuroinflammation; microglia; HMGB1; CLOCK

Highlights

⚫ The aberrant rhythms CLOCK gene induced increased HMGB expression in microglia in

the RVLM of stress-induced hypertension rats.

⚫ Aberrant CLOCK depressed sirt1 expression, which resulted in oxidative stress initiated

inflammatory HMGB1 activation in microglia in RVLM of stress-induced hypertension

rats.

⚫ The disrupts intrinsic circadian rhythms of microglia-derived inflammatory factor releasing in the RVLM involving in pathogeneses of non-dipperdetails hypertension. for DOI

manuscript WITHDRAWNsee bioRxiv preprint doi: https://doi.org/10.1101/2020.02.02.930800; this version posted February 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Graphical abstract

details for DOI

manuscript WITHDRAWNsee

Abnormal CLOCK-sirt1- HMGB1 caused the aberrant circadian rhythms of microglial

inflammatory factors releasing contributes to non-dipper hypertension. The disrupted

circadian of CLOCK resulted in HMGB1 activation via sirt1-dependent oxidative stress in

the RVLM.

1. Introduction

Evidence shows that chronic psychosocial stresses activate various neurogenic pathways

such as sympathetic nervous system (SNS), which is pivotal in triggering stress-induced

cardiac and vascular events[1]. Our previous studies identified that interventions of electric

foot-shock combined with noise stress induced a chronic increase in systolic blood pressure

(SBP) in rats[2]. The sympathetic outflow is controlled by important nuclei and their circuits

in the central nervous system (CNS), critically the hypothalamic paraventricular nucleus

(PVN), the rostral ventrolateral medulla (RVLM) and the nucleus tractus solitaries in details hindbrain[3]. for DOI Increased microglia (MG) activation and neuroinflammation within autonomic brain

regions have been implicatedmanuscript in stress-induced hypertension (SIH). Our previous study WITHDRAWNsee showed that central anti-inflammatory treatment by minocycline significantly alleviated

SIH[2]. The alarmin high mobility group box-1 (HMGB1) has been implicated as a key

factor mediating neuroinflammatory processes. It was shown that HMGB1 is also a critical

mediator of stress-induced priming of the microglial pro-inflammatory response to a

subsequent immune challenge. Recent findings suggest that the disulfide form (ds-HMGB1)

is pro-inflammatory[4]. However, the mechanism(s) by which HMGB1 exerts these

neuroinflammatory effects in SIH has not been clarified. Microglia is the primary innate

immune cell of the CNS exhibit diurnal rhythms in clock genes and inflammatory

potential[5]. It follows that several aspects of the immune system are regulated by the

circadian system and disruption of the circadian system is linked to inflammatory pathologies

including cancer, metabolic disorder, and premature aging[6; 7]. bioRxiv preprint doi: https://doi.org/10.1101/2020.02.02.930800; this version posted February 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Blood pressure (BP) usually exhibits a circadian rhythm, which is characterized by lower

BP while sleeping and higher BP during the day. Hypertension typically manifests as one of

four patterns: (i) normal BP dipping (10–20% drop in mean asleep versus awake BP); (ii)

extreme-dipping (>20% drop in mean asleep versus awake BP); (iii) non-dipping (<10% drop

in mean asleep versus awake BP); and (iv) reverse dipping (average asleep BP is higher than

awake blood pressure). The latter three types are generally considered to be abnormal

circadian BP rhythm[8].

Several clock gene transcripts, such as circadian locomotor output cycles kaput (Clock) details exhibited oscillatory diurnal rhythmicity in microglial BV‐2for cells, However, little attention DOI has been paid to the functional role of intrinsic circadian clock system in microglial cells[9].

Therefore, we investigated manuscriptthe involvement of the microglial clock system in the regulation WITHDRAWNsee of pro‐inflammatory cytokine expression and releasing. The protein deacetylase, sirtuin 1

(SIRT1), shows circadian oscillation and regulates the circadian clock. SIRT1 is a NAD(+)-

dependent protein deacetylase that governs many physiological pathways, including SIRT1 in

the brain governs central circadian control by activating the transcription of the two major

circadian regulators, BMAL1 and CLOCK[10]. Microglial isolations take several hours and it

is unclear whether the cells continue to oscillate throughout the isolation procedure and

during the subsequent incubation. Hippocampal microglia sustain clock gene oscillations ex

vivo. Laura K. Fonken et al. identifies that microglial clock gene expression likely continues

to oscillate ex vivo, which set a model for our experiment design in ex vivo[5]. We explore

whether nondipper hypertension is associated with disrupted diurnal rhythms in RVLM

microglia proinflammatory factors (PICs) releasing in SIH rats. Our results suggest the bioRxiv preprint doi: https://doi.org/10.1101/2020.02.02.930800; this version posted February 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

disrupted circadian of CLOCK resulted in HMGB1 activation via sirt1-dependent oxidative

stress in the RVLM. Abnormal CLOCK-sirt1- HMGB1 caused the aberrant circadian

rhythms of microglial inflammatory factors releasing contributes to non-dipper hypertension.

details for DOI

2. Materials and methods

2.1 Drugs and reagents

SRT1720 (Selleck Chemicals, cat#S1129); EX527 (Selleck Chemicals, cat#S1541); N-

acetylcysteine (NAC) (Beyotime, cat#S0077); dimethyl sulfoxide (DMSO) (Beyotime,

cat#ST038); ROS fluorescent probe-DCFH-DA Kit (Beyotime, cat#S0033); Biotin-

maleimide (Sigma, cat#: B1267); Tributylphosphine solution (Sigma, cat#: T7567). The

following antibodies were used: anti-β-actin (Sigma, cat#: A1978); anti-CD86 (CST, cat#:

91882); anti-HMGB1(Abcam, cat#:ab18256); anti-c-fos(CST, cat#:2250); anti-IL-1β(CST, details for cat#:12703); anti-Sirt1(CST, cat#:9475); anti-Foxo1(CST,DOI cat#:2880); anti-Nrf2(CST, cat#:12721); anti-Grx1(Abcam, cat#:ab45953); anti-Trx2(Abcam, cat#: ab185544); anti- manuscript SOD2(CST,WITHDRAWN cat#:13141);see anti-Acetylated-Lysine (Sigma, cat#:9441); Goat Anti-Rabbit IgG H&L (FITC) (Abcam, cat#:ab6717).

2.2 Animals

Wild-type male Sprague-Dawley rats (8-week-old, 250-300 g) were obtained from the animal

centre of Fudan University. Cre-CX3CR1/HMGB1fl/fl and Cre-CX3CR1/CLOCKfl/fl mice

were purchase from the Jackson Laboratory. All experimental procedures were approved by

the Fudan University Animal Care and conformed to the guidelines by the Institutional Ethics

Committee; all efforts were made to minimize the number of animals used and their

suffering. The animals were housed on a 12-h light/dark cycle (lights on at 07:00 am) in a

temperature-controlled room with standard 22±2 ◦C and with food and tap water ad libitum.

There were randomly divided into the following groups: normotensive rats (control), stress- bioRxiv preprint doi: https://doi.org/10.1101/2020.02.02.930800; this version posted February 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

induced hypertension (SIH), SIH+EX 527 (the selective Sirt1 inhibitor) (5 mg/kg, injected

intraperitoneally once daily following the same routine)[11], SIH+SRT1720 (the selective

Sirt1 activator) (100 mg/kg, injected intraperitoneally once daily following the same

routine)[12]. The SIH model of rat was established as previously described[2]. Sample size in

this section of the study consisted of 6 rats per group. Studies were replicated at least 3 times.

2.3 Microglia isolations and ex vivo treatments

RVLM microglia were isolated as we described previously[13]. Cells were grown in Eagle’s

minimum essential medium containing 10% heat-inactivated fetal bovine serum (FBS) details for (Invitrogen, Carlsbad, CA), 100 U/ml of penicillinDOI and 100 μg/ml of streptomycin in a

humidified atmosphere of 5% CO2 at 37°C. Glucocorticoid (10 nM), EX 527 (5 μM) and manuscript SRT1720WITHDRAWN (100 nM)see were used to treat microglia. The concentration and time of incubation of microglia with all the reagents has been reported[14; 15].

2.4 RNA isolation and qPCR analysis

Total RNA was isolated from microglia using TRIzol reagent (Invitrogen; Thermo Fisher

Scientific, Inc.) according to the manufacturer’s instructions. cDNA was transcribed and

SYBR-Green-based real time quantitative PCR was performed as we described

previously[13].

Table 1. Primers used in qPCR. (Primer sequence 5' → 3)

Target Rat Mouse

F: CTGCTGACAAAAGCCAAGAT CLOCK F: CTCCCCACAAGACTGCAGTA R: GACTTTCTTGAGCTTCTGGA R: CCTGTGTGGCCTTTACCCTA bioRxiv preprint doi: https://doi.org/10.1101/2020.02.02.930800; this version posted February 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

F: AAAATGCAAGGGAGGCCCAC BMAL1 F: GGAGAAGGTGGCCCAAA R: TCTAACTTCCGGGACATCGC R: AGGCGATGACCCTCTTA

F: GTGCAGGCTAACCAGGAATA Per1 F: CAGCCGTGCTGCCTACTCATT R: GCGGAGAGTGTATTCAGATG R: AGAGGCAGCTTGGTGTGTGTC

F: ACAAGCGGCTGCAGTAGTGA Per2 F: GGCACATCTCGGGATCG R: TTCAAGGTTGCCAGCGTGCT R: GAGCAGAGGTCCTCGCC

F: CCTTGTGCAAGTGTCTGAAG IL-1β F: CTGTGACTCGTGGGATGATG R: GGGCTTGGAAGCAATCCTTA R: GGGATTTTGTCGTTGCTTGT

F: CAAGGAGGAGAAGTTCCCA TNF-α F: AGGCACTCCCCCAAAAGAT R: TTGGTGGTTTGCTACGACG R: TGAGGGTCTGGGCCATAGAAdetails for F: AGAAAAGAGTTGTGCAATGGCA IL-6 DOIF: CCTCTCTGCAAGAGACTTCCAT R: GGCAAATTTCCTGGTTATATCC F: AGTCTCCTCTCCGGACTTGT

F: TTCCTTCCTGGGTATGGAATmanuscript β-WITHDRAWNactin see F: CACACCTTCTACAATGAGCTGC R: GAGGAGCAATGATCTTGATC R: CATGATCTGGGTCATCTTTTCA

2.5 Immunofluorescent staining

Immunofluorescence technique was used as we previous described[13].

2.6 Intracellular ROS detection

Total intracellular ROS was determined by staining microglia with ROS-specific fluorescent

probe dichlorofluorescin diacetate (DCFH-DA) according to the manufacturer's protocol.

2.7 Western blotting assay

Total proteins were extracted from the isolated microglia and/or RVLM tissue following

immunoblotting as we previous described[13]. bioRxiv preprint doi: https://doi.org/10.1101/2020.02.02.930800; this version posted February 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

2.8 Immunoprecipitation

To assess the HMGB1 acetylation, immunoprecipitation assay was performed following a

previously reported protocol[16]. The resulting immunoprecipitate and input were separated

by SDS-PAGE and probed with anti-HMGB1 or anti- Acetylated-Lysine antibodies in

immunoblotting.

2.10 disulfide-HMGB1 detection

After immunoprecipitation, N-ethylmaleimide was used to block unpaired cysteines of HMGB1. After using Tributyl phosphine to reduce disulfides ofdetails HMGB1, Biotin-maleimide for was used to label the free cysteines and then analyzedDOI by SDS-PAGE[17; 18].

2.11 Statistical analyses manuscript WITHDRAWNsee All data are presented as mean ± standard error of the mean (SEM). For experiments that

involved two groups of samples, Student’s unpaired t test was used. For experiments that

involved multiple groups, one-way or two-way analysis of variance with repeated measures

were used to assess group means. Rhythm data were further tested for a fit to a 24 h cosinor

curve using CircWave analysis software. P < 0.05 was considered statistically significant.

3. Results

3.1 Stress-induced increased HMGB1 thereby disruption of rhythmic microglial

inflammatory cytokine releasing in RVLM

To evaluate potential rhythmic expression of microglial activation markers in control and SIH

RVLM, RVLM was collected from both group rats during the middle of the light (ZT6) or

middle of the dark (ZT18) phase. CD86 expression, a marker of microglia activation, was

significantly elevated in the SIH rats (p < 0.05; Fig 1 A-B). Furthermore, CD86 expression

was elevated during the middle of the dark as compared to the light phase (p < 0.05). As details for expected, the proinflammatory factors (IL-1β, TNFDOI-α and IL-6) mRNA expression (Fig 1 C- E) and HMGB1 protein and the expression of c-fos was significantly increased in SIH rats, manuscript and theWITHDRAWN c-fos circadiansee rhythm is deficiency (p < 0.05; Fig 1 F-H). These results corroborate previous studies showing that SIH rat RVLM have an overall increase in markers of

microglial inflammatory potential (increased CD86, IL-1β, TNF-α and IL-6). Further,

microglial activation markers (CD86, IL-1β, TNF-α and IL-6) that are expressed rhythmically

in control rat RVLM are tonically elevated (in both light and dark phase) in the SIH RVLM.

In order to investigate the effect of HMGB1 on proinflammatory factors releasing in

microglia, we used the RVLM specific HMGB1 knockdown mice (Cre-CX3CR1/HMGB1fl/fl)

to perform the experiment. With previous findings, IL-1β was differentially expressed over

the course of the day in microglia isolated from the RVLM of control mice (p < 0.05, Fig 1 I-

J). In contrast, there was not a significant 24 h rhythm or diurnal differences in IL-1β in

RVLM microglia isolated from stressed mice (p > 0.05, Fig 1 I-J). The microglia isolated

from Cre-CX3CR1/HMGB1fl/fl mice demonstrated an elevation in average IL-1β expression, bioRxiv preprint doi: https://doi.org/10.1101/2020.02.02.930800; this version posted February 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

whereas showed diurnal rhythms in IL-1β expression: lower during the light phase, at high

levels throughout the dark phase. The expression of proinflammatory cytokines in RVLM

were lower in the Cre-CX3CR1/HMGB1fl/fl mice (p < 0.05, Fig 1 K). The blood pressure in

Cre-CX3CR1/HMGB1fl/fl mice was decreased and its circadian rhythm was restored (p <

0.05, Fig 1 L). These results showed that microglia from SIH rats lack diurnal rhythms in

inflammatory cytokine releasing, which mediated by sustained HMGB1upregulation in

RVLM of SIH rats

3.2 Microglia isolated from the RVLM of SIH rats displaying disrupted oscillations of details CLOCK gene rhythms ex vivo, which mediated HMGB1upregulationfor and cytokine DOI expression rhythms disruption manuscript First, WITHDRAWNwe sought to determinesee whether microglia isolated from the RVLM of SIH rats have altered clock gene expression. RVLM microglia were isolated rats at 6 h intervals (ZT0/24,

ZT6, ZT12, and ZT18), and the expression of several circadian clock genes (Per1, Per2,

BMAL1 and CLOCK) was assessed. The Per1 (Fig 2 A), Per2 (Fig 2 B) and BMAL1 (Fig 2

C) were expressed rhythmically both in control and SIH RVLM microglia. In contrast, there

were time of day differences in CLOCK mRNA in RVLM microglia isolated from control

but not SIH rats. The pattern and levels of gene expression were comparable between

microglia isolated from RVLM of SIH rats with respect to CLOCK (Fig 2 D). SIH RVLM

microglia showed altered/dampened diurnal rhythms of the core clock genes CLOCK (p <

0.05). Since microglia from SIH rats show disrupted rhythms in CLOCK expression, we

further check whether CLOCK mediate altered cytokine expression rhythms in microglia. In

order to investigate the effect of CLOCK gene on proinflammatory factors releasing in bioRxiv preprint doi: https://doi.org/10.1101/2020.02.02.930800; this version posted February 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

microglia, we used the RVLM specific CLOCK knockdown mice (Cre-CX3CR1/CLOCK

fl/fl) to perform the experiment. The results showed that the expression of RVLM microglial

inflammatory factors TNF-α (p < 0.05, Fig 2 E) and IL-1β (p < 0.05, Fig 2 F) was increased

at night and decreased in the daytime in the control and specific CLOCK knockdown mice,

which implied a significant circadian rhythm. The expression of inflammatory factors in

RVLM of SIH mice significantly increased had no significant difference between day and

night, which implied CLOCK gene mediated the rhythmically inflammatory factors releasing

(Fig2 E-F). The expression of stress-related protein HMGB1 in RVLM was lower in the Cre-

fl/fl details CX3CR1/CLOCK mic (p < 0.05, Fig 2 G-H). The bloodfor pressure in Cre- CX3CR1/CLOCKfl/fl mice was decreased and its DOIcircadian rhythm was restored (p < 0.05, Fig

2 I). These results showed thatmanuscript stress-induced continuous high expression of CLOCK gene in RVLMWITHDRAWN microglia (losssee of circadian rhythm), resulting in increased expression of HMGB1.

3.3 Microglia rhythms are entrained by CLOCK circadian. CLOCK depresses Sirt1

induced non-dipper hypertension via ROS-HMGB1 activation.

Isolation of RVLM microglia form control, SIH and Cre-CX3CR1/CLOCKfl/fl rats ex vivo

revealed stress suppressed Sirt1, Foxo1 and Nrf2 antioxidant transcriptional factors

expression (p < 0.05, Fig 3 A-B); microglia-specific knockout of CLOCK restored sirt1 and

antioxidant protein expression (including Grx1, Trx2, SOD2) which was reversed by EX527,

the Sirt1 specific inhibitor (p < 0.05, Fig 3 C-D); EX527 treated microglia in RVLM of

knockout CLOCK mice ex vivo showed that the HMGB1 and IL-1β expression are greatly

increased (p < 0.05, Fig3 C). ROS-specific fluorescent probe dichlorofluorescin diacetate

(DCFH-DA) detection showed that the total intracellular ROS was increased in EX527 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.02.930800; this version posted February 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

treated microglia of knockout CLOCK mice in comparison with that of CLOCK knockout

microglia (p < 0.05, Fig3 E-F). EX527 cotreatment with NAC, the ROS scavenger,

significantly inhibited the expression of HMGB1 and IL-1β in stressed microglia (p < 0.05,

Fig3 G-H), which implied that ROS mediated the anti-inflammatory function of sirt1. Recent

findings suggest that the disulfide form (ds-HMGB1) is the pro-inflammatory type. We found

that SRT1720, a sirt1 agonist, significantly inhibited the expression of HMGB1, IL-1β, ds-

HMGB1 and acetyl- HMGB1 expression in stressed microglia (p < 0.05, Fig3 I-L); SRT1720

reduced the IL-1β expression and restore its circadian rhythm in stressed microglia of RVLM details (p < 0.05, Fig3 M-N); furthermore, SRT1720 reduces the forblood pressure of SIH rats and restores the circadian rhythm of blood pressure(pDOI < 0.05, Fig3 O). These results suggest that

sirit1 agonist has the anti-hypmanuscriptertensive effect on stress-induced hypertension. WITHDRAWNsee bioRxiv preprint doi: https://doi.org/10.1101/2020.02.02.930800; this version posted February 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

4. Discussions

Here, we reveal that rhythms in CLOCK gene observed in microglia isolated from the

RVLM of are disrupted in SIH rats. Second, we demonstrate that the sustained high

expression of proinflammatory cytokines in RVLM microglia resulted in high persistent of

expression of alarmin HMGB1 isolated from SIH rats contributed to non-dipper

hypertension. Furthermore, our results suggested that continuous expression high-level

CLOCK gene down-regulated Sirt1 expression, which resulted in oxidative stress and

sustained upregulation of expression of HMGB1. Overall, these results indicate that intrinsic details RVLM microglial rhythms in CLOCK and inflammatory forgenes are dysregulated with DOI persistent stress, which have implications for development of non-dipper blood pressure

rhythm in SIH. manuscript WITHDRAWNsee Microglia inflammatory responses are controlled by an intrinsic circadian clock.

Microglia showed circadian clock mechanisms and display rhythmic fluctuations in basal

inflammatory gene expression as well as inflammatory potential[5] It was reported that the

time-of-day at which an inflammatory challenge occurs affects neuroinflammatory priming

(Johnson et al., 2003) Our result suggested that time-of-day differences in microglia priming

and PICs releasing appear functionally relevant as they are reflected in circadian differences

in blood pressure regulation.

It was noted that activated microglia are the major trigger of neuroinflammation and

oxidative stress, which are associated with sympathetic excitation and hypertension in rats[2].

HMGB1 is a nuclear protein that functions as a danger associated molecular pattern (DAMP), bioRxiv preprint doi: https://doi.org/10.1101/2020.02.02.930800; this version posted February 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

which is released into the extracellular milieu to signal cellular damage, cellular stress, or

pathogen insult (Bianchi, 2007). By targeted knockdown of RVLM microglia in mice, we

have found that HMGB1 mediates the neuroinflammatory priming effects of stressors and

that HMGB1 is sufficient to prime the neuroinflammatory responses (Frank et al., 2015).

Interestingly, these priming effects of HMGB1 were contingent upon the redox state of

HMGB1 such that maily the disulfide form of HMGB1 induced priming. However, it is

important to consider that all nucleated cells are a potential source of HMGB1 given its

constitutive role as a DNA binding protein (Yang et al., 2013). Of note, stress-induced details secretion of HMGB1 in the CNS has not been demonstratedfor[14] . SIRT1 is the founding and most well-studied memberDOI of the mammalian sirtuin family.

SIRT1 is known to deacetylatemanuscript FOXO3a, which has been found to induce antioxidant responsesWITHDRAWN via modulationsee in SOD2 and CAT, FOXO3a has further been shown to regulate

mitochondrial gene production, resulting in modulated ROS levels[19]. It is a master

metabolic regulator, has been shown to be regulated by various transcriptional factors. In this

study, we demonstrate that the expression of SIRT1 is regulated by one of the core circadian

transcription factors, CLOCK. It has been reported that SIRT1 binds to CLOCK, BMAL1,

and PER2 and deacetylates BMAL1 and PER2 to regulate the circadian clock[20]. In

combination with our findings, CLOCK and SIRT1 might coordinate to regulate HMGB1

and microglia function. Recent evidence suggests both 24-h BP and abnormal circadian

rhythm BP are closely related to higher instances of cardiovascular disease (CVD)

Our results showed increased inflammation and oxidative stress, are significantly higher in

the non-dipper hypertension, which is consistent with the previous study[21]. It was reported bioRxiv preprint doi: https://doi.org/10.1101/2020.02.02.930800; this version posted February 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

that the risk for adverse cardiovascular events in human peaks in the morning, possibly due to

the effects of the endogenous circadian system on cardiovascular risk factors, or the

occurrence of mental stress. Mental stress increased hemodynamic function, sympathovagal

balance and epinephrine, and decreased cardiac vagal modulation. Endogenous circadian

variation occurred in all cardiovascular measures: sympathovagal balance peaked in the

circadian morning (∼9 AM), cardiac vagal modulation in the circadian night (∼4 AM), and

heart rate and circulating catecholamines in the late circadian morning/early afternoon

(∼12 PM)[22]. Importantly, the effects of stress and the endogenous circadian system on details cardiovascular function occurred in conjunction, and how forabout the neuroinflammation affected stress-induced unrhythmically sympathovagalDOI balance, which need to be further

investigated. manuscript WITHDRAWNsee bioRxiv preprint doi: https://doi.org/10.1101/2020.02.02.930800; this version posted February 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Acknowledgment

This work was supported by the “Qing Feng” Undergraduate Innovation and

Entrepreneurship Scholarship of Shanghai Medical college, Fudan University (QF1703) to

STZ.

Conflicts of interest

The authors confirm that there are no conflicts of interest.

details for DOI

References

[1] D. Hering, K. Lachowska, M. Schlaich, Role of the Sympathetic Nervous System in

Stress-Mediated Cardiovascular Disease, CURR HYPERTENS REP 17 (2015)80.

[2] Du D, L. Hu, J. Wu, et al., Neuroinflammation contributes to autophagy flux blockage in

the neurons of rostral ventrolateral medulla in stress-induced hypertension rats, J

Neuroinflammation 14 (2017)169.

[3] H. Kumagai, N. Oshima, T. Matsuura, et al., Importance of rostral ventrolateral medulla

neurons in determining efferent sympathetic nerve activity and blood pressure, details HYPERTENS RES 35 (2012)132-141. for [4] M.G. Frank, M.D. Weber, L.R. Watkins, et al.,DOI Stress sounds the alarmin: The role of the

danger-associated molecularmanuscript pattern HMGB1 in stress-induced neuroinflammatory priming,WITHDRAWN BRAINsee BEHAV IMMUN 48 (2015)1-7.

[5] L.K. Fonken, M.G. Frank, M.M. Kitt, et al., Microglia inflammatory responses are

controlled by an intrinsic circadian clock, BRAIN BEHAV IMMUN 45 (2015)171-179.

[6] J.A. Evans, A.J. Davidson, Health consequences of circadian disruption in humans and

animal models, Prog Mol Biol Transl Sci 119 (2013)283-323.

[7] L.K. Fonken, R.J. Nelson, The effects of light at night on circadian clocks and

metabolism, ENDOCR REV 35 (2014)648-670.

[8] G.M. Gabb, A.A. Mangoni, L. Arnolda, Guideline for the diagnosis and management of

hypertension in adults - 2016, Med J Aust 206 (2017)141.

[9] L.K. Fonken, M.G. Frank, M.M. Kitt, et al., Microglia inflammatory responses are

controlled by an intrinsic circadian clock, BRAIN BEHAV IMMUN 45 (2015)171-179. bioRxiv preprint doi: https://doi.org/10.1101/2020.02.02.930800; this version posted February 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

[10] H.C. Chang, L. Guarente, SIRT1 mediates central circadian control in the SCN by a

mechanism that decays with aging, CELL 153 (2013)1448-1460.

[11] Y. Gui, A. Li, F. Chen, et al., Involvement of AMPK/SIRT1 pathway in anti-allodynic

effect of troxerutin in CCI-induced neuropathic pain, EUR J PHARMACOL 769

(2015)234-241.

[12] H. Chen, H. Ji, M. Zhang, et al., An Agonist of the Protective Factor SIRT1 Improves

Functional Recovery and Promotes Neuronal Survival by Attenuating Inflammation after

Spinal Cord Injury, J NEUROSCI 37 (2017)2916-2930. details [13] L. Hu, S. Zhang, H. Wen, et al., Melatonin decreasesfor M1 polarization via attenuating mitochondrial oxidative damage depending onDOI UCP2 pathway in prorenin-treated

microglia, PLOS ONE manuscript14 (2019)e212138. [14] M.G.WITHDRAWN Frank, J.L.see Annis, L.R. Watkins, et al., Glucocorticoids mediate stress induction of

the alarmin HMGB1 and reduction of the microglia checkpoint receptor CD200R1 in

limbic brain structures, BRAIN BEHAV IMMUN (2019).

[15] Y.X. Chen, M. Zhang, Y. Cai, et al., The Sirt1 activator SRT1720 attenuates angiotensin

II-induced atherosclerosis in apoE(-)/(-) mice through inhibiting vascular inflammatory

response, Biochem Biophys Res Commun 465 (2015)732-738.

[16] Z. Yang, L. Li, L. Chen, et al., PARP-1 mediates LPS-induced HMGB1 release by

macrophages through regulation of HMGB1 acetylation, J IMMUNOL 193 (2014)6114-

6123.

[17] C.C. Chin, F. Wold, The use of tributylphosphine and 4-(aminosulfonyl)-7-fluoro-2,1,3-

benzoxadiazole in the study of protein sulfhydryls and disulfides, ANAL BIOCHEM bioRxiv preprint doi: https://doi.org/10.1101/2020.02.02.930800; this version posted February 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

214 (1993)128-134.

[18] I. Braakman, L. Lamriben, G. van Zadelhoff, et al., Analysis of Disulfide Bond

Formation, Curr Protoc Protein Sci 90 (2017)11-14.

[19] C.K. Singh, G. Chhabra, M.A. Ndiaye, et al., The Role of Sirtuins in Antioxidant and

Redox Signaling, Antioxid Redox Signal 28 (2018)643-661.

[20] J. Liu, B. Zhou, M. Yan, et al., CLOCK and BMAL1 Regulate Muscle Insulin

Sensitivity via SIRT1 in Male Mice, ENDOCRINOLOGY 157 (2016)2259-2269.

[21] A.R. Tosu, S. Demir, M. Selcuk, et al., Comparison of inflammatory markers in non- details dipper hypertension vs. dipper hypertension and in normotensivefor individuals: uric acid, C-reactive protein and red blood cell distributionDOI width readings, Postepy Kardiol

Interwencyjnej 10 (2014)98manuscript-103. [22] F.WITHDRAWN Scheer, S.L.see Chellappa, K. Hu, et al., Impact of mental stress, the circadian system

and their interaction on human cardiovascular function, PSYCHONEUROENDOCRINO

103 (2019)125-129.

Figure legend

Figure 1. Circadian differences in RVLM inflammatory factors releasing in microglia

Protein expression of microglia M1 polarization marker CD86 was shown in

immunofluorescent staining section(A-B), which is quantified with time in 24h. The

microglia of RVLM region of different groups were isolated, the expression of inflammatory

factors expression in microglia was detected by RT-PCR. Cytokine diurnally expression in

microglia isolated from control but not SIH rats (C-E). The HMGB1 and c-fos protein

expression was shown in (F-H). All data are expressed relative to β-actin. Microglia isolated details from control rats displayed diurnal variation in basal IL-1β.for In contrast, microglia isolated from SIH rats had relatively high IL-1β expressionDOI with out diurnal rhythm (I-J). The

expression of proinflammatorymanuscript cytokines in RVLM were lower in HMGB1 targeted knockout mice WITHDRAWN(K). HMGB1 seetargeted knockout mice showed decreased and circadian differences BP

(L). Data were analyzed using a 2 × 2 ANOVA with stress and time as the between subjects

factors; results were further analyzed using CircWave for fit to a 24 h cosinor curve. All data

are expressed relative to β-actin and presented as mean ± SEM. In all cases, p < 0.05. Scar

bar = 50 μm.

Figure 2. Circadian clock gene expression in microglia

Microglia were isolated from the RVLM of SIH and control rats at 6 h intervals across the

day (n = 5 per age and time). mRNA concentrations are expressed relative to β-actin and

presented as mean ± SEM. Gene expression for (A) Per1, (B) Per2 and (C) BMAL1 were

evaluated in microglia. There was a 24 h rhythm in per1, per2 and BMAL1 and expression,

and there were no differences between SIH and control group. In contrast, CLOCK was bioRxiv preprint doi: https://doi.org/10.1101/2020.02.02.930800; this version posted February 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

differentially expressed in microglia isolated from control but not SIH rats. A 24 h rhythm in

CLOCK was not detectable in microglia isolated from SIH rats (D). The expression of

RVLM microglial inflammatory factors TNF-α (E) and IL-1β (F) showed a significant

circadian rhythm in the control and CLOCK knockout microglia. Represented immunoblot

showed the expression of stress-related protein HMGB1 in microglia (G-H). The blood

pressure in Cre-CX3CR1/CLOCKfl/fl mice was decreased and its circadian rhythm was

restored (I). Data were analyzed using a 2 × 2 ANOVA with stress and time as the between

subjects factors; results were further analyzed using CircWave for fit to a 24 h cosinor curve. details All data are expressed relative to β-actin and presented as formean ± SEM. In all cases, p < 0.05. Figure 3. Microglia rhythms are entrained by DOICLOCK circadian

(A-B) Sirt1, antioxidative transcriptionalmanuscript factor foxo1 and Nrf2 expression was increased in WITHDRAWNsee CLOCK target knockout microglia; (C-D) while the antioxidative protein (Grx1, Trx2,

SOD2) was decreased and the HMGB1 and IL-1β was increased when treated CLOCK target

knockout microglia with EX527, a Sirt1 inhibitor. (E-F) ROS-specific fluorescent probe

dichlorofluorescin diacetate (DCFH-DA) detection showed that the total intracellular ROS

was increased in EX527 treated CLOCK knockout microglia. (G-H) EX527 cotreatment with

NAC, the ROS scavenger, significantly inhibited the expression of HMGB1 and IL-1β in

stressed microglia. (I-L) IP experiment showed that SRT1720, a Sirt1 agonist, significantly

inhibited the expression of HMGB1, IL-1β, ds-HMGB1 (inflammatory subtype) and acetyl-

HMGB1 expression in stressed microglia; (M-N) SRT1720 reduced the IL-1β expression and

restore its circadian rhythm in stressed microglia of RVLM; furthermore, (O)SRT1720 bioRxiv preprint doi: https://doi.org/10.1101/2020.02.02.930800; this version posted February 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

reduces the blood pressure of SIH rats and restores the circadian rhythm of blood pressure.

Data are expressed as mean ± SEM. In all cases, p < 0.05. scale bar=20 μm

details for DOI

Figure 1

details for DOI

manuscript WITHDRAWNsee

Figure 2

details for DOI

Figure 3

details for DOI

manuscript WITHDRAWNsee