Dietary Peroxidized Lipids and Intestinal Apolipoprotein Synthesis

Dissertation

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

Xueting Jiang, M.A.

Graduate Program in Ohio State University Nutrition Program

The Ohio State University

2014

Dissertation Committee:

Dr.Sampath Parthasarathy, Advisor

Dr. Martha Belury, Co-Advisor

Dr. Zhenguo Liu

Dr. Ouliana Ziouzenkova

Copyrighted by

Xueting Jiang

2014

Abstract

The goals of this project are to investigate the metabolic fate of free fatty acid peroxide and its decomposition products in the presence of intestinal cells and to determine their roles in apolipoprotein synthesis by intestinal and hepatic cells.

Oxidative stress and peroxidized lipids are seen as harmful molecules with respect to cardiovascular diseases. Most of these reports come from studies on systemic lipid peroxidion. Diet plays a major role in the development of atherosclerosis, a major form of cardiovascular disease. Peroxidized lipids and their degradation products are generated in the diet as a result of prolonged exposure to air, heating, and perhaps due to high content of polyunsaturated fatty acids in some cooking oils. Both pro- and anti-atherosclerotic effects have been ascribed to the dietary presence of peroxidized lipids. For example, a significant number of in vitro and in vivo studies indicate an activation of the synthesis of apolipoprotein A1, a major component of the beneficial lipoprotein HDL and a decrease in plasma triglyceride (TG). In contrast, dietary peroxidized lipids have been shown to increase atherosclerosis in cholesterol fed mouse models of atherosclerosis, and to even increase in plasma lipids. Peroxidized lipids readily decompose to a variety of products, including hydroxides, aldehydes, ketones, and carboxylic acids. There is a void of knowledge in the understanding of when to expect harmful effects and when the beneficial effects could be realized. The

ii effects of some of the decomposition products were poorly studied.

Understanding of how dietary oxidized lipids are metabolized by the intestinal cells could help to eliminate the pro-atherosclerotic effects while retaining the beneficial components.

Free linoleic acid peroxide (hydroperoxycotadecadienoic acid, 13-HPODE) was used in the study. Results presented in this thesis would indicate that in the presence of Caco-2 cells, 13-HPODE was rapidly reduced to hydroxides (13-

HODE) as a result of loss of peroxide function. Upon entering the cell, 13-HODE appears to undergo esterification. HPODE also underwent auto-decomposition to generate aldehydes as well. In this study, I focussed on the decomposition product from the carboxylic end of the fatty acid chain, namely 9-oxononanoic acid (ONA). ONA is not commercially available. I synthesized non-radioactive and radioactive forms of ONA to determine whether this toxic aldehyde could be converted to beneficial AzA. The latter compound has been known to be anti- inflammatory and anti-atherogenic. I found that ONA was oxidized to AzA rapidly in the cell medium and AzA was poorly absorbed by intestinal cells and stayed stable in the cell medium for up to 18 hours.

HPODE, ONA and AzA were used to treat poorly differentiated, fully differentiated Caco-2 and HepG2 cells. The former lacks the absorbing surface brush border and the later expresses markers of differentiation and the brush border architecture. An increased ApoA1 secretion was observed in Caco-2 cells by ELISA and Western blot whereas such induction was not observed in HepG2

iii cells. However, HPODE treatments suppressed PON1 activity in the medium as measured by p-nitrophenyl acetate hydrolysis suggesting the induced secretion of

ApoA1 by HPODE may not represent functional HDL. On the other hand, AzA induced both ApoA1 secretion and PON1 activity while suppressing ApoB secretion in fully differentiated Caco-2 cells but not in HepG2 cells. HPODE and

ONA were also found to supress ApoB secretion by differentiated Caco-2 cells. A marginal modulation at mRNA level was noticed suggesting the existence of intestine specific post-translational regulation. These results suggested that sustaining the oxidation to AZA levels might be important in the beneficial actions of dieteray peroxidized lipid derived aldehydes.

This is the first study to address the metabolic fate of ONA and AzA in the intestine. Our current results indicated that the anti-atherogenic effects of AzA might be important and might relate to the increased apoA1 and PON activation, among other effects. Considering that not much uptake of AZA was seen could indicate a potent cellular effects, perhaps mediated by specific saturable uptake mechanisms and signaling events. Our data also pointed that intestine can be a novel target for anti-atherogenic drug as it represented a significant part of

ApoA1, PON1 and ApoB in circulation. Our study also provided evidence that intestine has its own regulation of lipoprotein secretion that is distinct from liver.

Acknowledgments

At the outset, I would like to express my deep gratitude and respect to my mentors, Dr.Sampath Parthasarathy and co-mentor Dr. Martha Belury, for their invaluable guidance and support throughout my graduate training. I thank them for providing an ideal niche to learn and develop professionally. Their passion for science and plethora of scientific achievements have been a true inspiration and their role as my mentors will continue throughout my career as I truly value their input and advice.

I would like to thank my committee members, Dr. Zhenguo Liu and Dr.

Ouliana Ziouzenkova for always being approachable and encouraging. I thank them for their time, critical feedback and suggestions. A great deal of knowledge and insight has been gained from the discussions with them.

Both the Nutrition Department at Ohio State University and University of

Central Florida has taught me a lot about nutrition. I have enjoyed interacting with researchers with expertise in different fields. I am grateful to the American

Heart Association for recognizing the novelty of my dissertation project and for granting me the predoctoral fellowship.

I thank every current and former member of the laboratory for helping me and for contributing towards my research. I have had the opportunity to work

v with wonderful colleagues who have influenced my life in their own way. The time spent in the laboratory has been enjoyable and memorable.

Finally, this journey could not have been possible without the love and support of my parents, my husband and the rest of my family and friends.

Vita 2000-2003 ...... Shenzhen Senior High, China

2003-2007 ...... B.E. Bioengineering, South China

University of Technology

2007-2009 ...... M.A. Nutrition Science, Syracuse

University

2009- to present ...... Graduate Research Associate,

Department of Nutrition, The Ohio State

University

Publications

Ø Xueting Jiang, Zhaohui Yang, Aluganti Narasimhulu Chandrakala, Dawn Pressley, Sampath Parthasarathy. Oxidized low-density lipoproteins-Do we know enough about them? Review Cardiovascular drugs and therapy. 25:367–377, 2011.

Ø Chandrakala Aluganti Narasimhulu, Xueting Jiang, Yang Zhaohui, Krithika Selvarajan and Parthasarathy Sampath. Is There a Connection Between Inflammation and Oxidative Stress? Chronic inflammation Molecular pathophysiology, nutritional and therapeutic interventions 2012: 138-152.

Ø Aluganti. N. Chandrakala, Dmitry Litvinov, Xueting Jiang, Yang Zhaohui, and Sampath Parthasarathy. Atherosclerosis: Oxidation hypothesis Molecular Basis of Oxidative Stress: Chemistry, Mechanisms, and Disease Pathogenesis (2013).

Fields of Study

Major Field: Ohio State University Nutrition Program

vii

Table of Contents

Abstract ...... ii

Acknowledgments ...... v

Vita ...... vii

Table of Contents ...... viii

List of Tables ...... xiii

List of Figures ...... xiv

Abbreviation ...... xxiv

Chapter 1: Introduction ...... 1

1.1 Background ...... 1

1.2 Fatty Acid Peroxidation and Decomposition ...... 2

1.3 Abundance of Peroxidized Lipids in the Diet ...... 6

1.4 Intestine Physiology ...... 9

1.5 Caco-2 Cells ...... 10

1.6 Intestinal Lipid Absorption ...... 12

1.7 Intestinal Lipoprotein Assembly ...... 15

1.8 Absorption of Dietary Peroxidized Lipids ...... 16

1.9 Physiological Consequences of Dietary Peroxidized Lipids ...... 17

viii

1.10 Lipid Oxidation and Atherosclerosis ...... 18

1.11 HDL and Reverse Cholesterol Transport ...... 21

1.12 Paraoxonase 1 ...... 21

1.13 Apolipoprotein A1 (ApoA1) ...... 23

1.14 Apolipoprotein B ...... 24

1.15 Mechanisms Involved in ApoA1 and PON1 Regulation ...... 26

1.16 Scope of the study ...... 27

Chapter 2: Materials and Methods ...... 30

2.1 HPODE/HODE Preparation ...... 31

2.2 Radioactive 14C-HPODE/14C-HODE Preparation ...... 32

2.3 Synthesis of 9-Oxononanoic Acid (ONA) ...... 32

2.4 Synthesis of 14C-9-Oxononanoic Acid (ONA) ...... 33

2.5 Leucomethylene Blue Assay ...... 34

2.6 TBARS Assay ...... 35

2.7 Peroxide Detection in Cooking Oil ...... 35

2.8 Alkaline Phosphatase Activity Assay ...... 36

2.10 TLC and Radio-autography of 14C-HPODE ...... 36

2.11 Free Fatty Acid Methyl Ester (FAME) Preparation ...... 37

2.12 Gas Chromatograph-Mass Spectrometry Analysis ...... 38

2.13 Cell Culture Studies Using PCR Method ...... 38

2.14 Incubation of Caco2 with HPODE and its Decomposition Products ...... 39

2.15 RNA Isolation From Cultured Cells ...... 40

2.16 cDNA Synthesis ...... 41

2.17 Real Time-PCR ...... 42

2.18 Western Blot Measurements ...... 44

2.19 ELISA Assays ...... 46

2.20 PON1 Assay ...... 47

2.21 Statistical analysis ...... 48

Chapter 3: Results ...... 49

3.1 The presence of Lipid Peroxide in Oxidized Linoleic Acid ...... 49

3.2 Detection of Peroxide in Heated Cooking Oil ...... 49

3.3 The Reduction of Lipid Peroxide by Cells ...... 51

3.4 Cellular Uptake of Lipid Peroxide ...... 54

3.5 Generation of Aldehydes from Lipid Peroxides ...... 59

3.6 9-Oxononanoic Acid and AzA Metabolism ...... 61

3.7 Summary I ...... 69

3.8 ApoA1 Expression in the Presence of Lipid Peroxide (13-HPODE) and its

Decomposition Products (ONA & AzA) ...... 70

3.9 PON1 Expression in the Presence of Lipid Peroxide and its Decomposition

Products ...... 79

3.10 ApoB48 Expression in the Presence of Lipid Peroxide and its Decomposition

Products ...... 85

3.11 Summary II ...... 94

Chapter 4: Discussion ...... 97

4.1 Current Dietary Recommendations Relating to PUFA ...... 97

4.2 Concerns Regarding Dietary PUFA Intake ...... 98

4.3 The Presence of HPODE and HODE ...... 101

4.4 The Absorption of HPODE and HODE ...... 103

4.5 The Presence and Metabolism of Aldehydes and Corresponding Oxidation

Products in Heated Cooking Oil and HPODE ...... 106

4.6 Regulation of ApoA1 Secretion ...... 109

4.7 ApoA1 Secretion Modulators ...... 110

4.8 Liver and Intestinal Differences in ApoA1 Regulation ...... 111

4.9 PON1 Activity as the Marker for HDL Functionality ...... 112

4.10 ApoB Response with Ox-FA and their Breakdown Products ...... 114

4.11 AzA could be a Potential Drug for the Treatment of Postprandial

Dyslipidemia ...... 116

Chapter 5: Conclusions ...... 118 xi

Chapter 6: Significance of the Study ...... 120

Bibliography ...... 122

xii

List of Tables

Table 1. Linoleic Acid Content of Commonly Used Cooking Oil ...... 8

Table 2. Dietary Peroxide Content [34] ...... 8

Table 3. Suggested Mechanisms for the Oxidation of LDL [85] ...... 20

Table 4. Functional Roles of PON1 [99] ...... 23

Table 5. Function of HDL ...... 24

Table 6. cDNA Synthesis Mix Preparation ...... 41

Table 7. Primer Sequences for Real-Time PCR ...... 42

Table 8. PCR Components for Master Mix Preparation ...... 43

xiii

List of Figures

Figure 1. Steps Involved in the Oxidation of Lipids ...... 3

Figure 2. Decomposition of 13-HPODE to 4-HNE and ONA ...... 4

Figure 3. Mechanisms for Cleavage of HPODE for Generation of 4-HNE and ONA

...... 5

Figure 4. Anatomy of Small Intestine [39] ...... 10

Figure 5. Electron Microscopy of Caco-2 Cells [19] ...... 12

Figure 6. Absorption of TG by Intestine ...... 14

Figure 7. Progression of Atherosclerosis [105] ...... 20

Figure 8.Conjugated dienes and peroxide content in HPODE and linoleic acid. (A)

After adding SLO to linoleic acid in PBS, the formation of conjugated diene

was monitored by wavelength scan from 200-300 nm over time. A peak at

234 nm can be observed. (B) Wavelength scan of formed HPODE and

linoleic acid showing the difference between 13-HPODE and linoleic acid, at

the end of reaction. (C) LMB assay of HPODE and linoleic acid. This

experiment was conducted for 3 times in duplicates, data are mean ± SE,

linoleic + SLO vs linoleic in PBS, *P<0.01. This reaction was routinely used

to prepare oxidized linoleic acid...... 50

Figure 9. Peroxide Content in Heated Cooking Oil. After heating for the

designated period of time, peroxide content was determined by LMB assay

by adding 10µl of cooking oil in acetone (1% v:v) with 100 µl 1%SDS and 100

xiv

µl LMB reagent. This experiment was conducted for two times in triplicates,

data are mean ± SE as shown in the figure. Each oil: 0 hour vs 4 hour & 8

hour, *P<0.05...... 51

Figure 10. Lipid peroxides in the presence of cells. (A)HPODE was incubated with

poorly differentiated Caco-2 cells, conjugated diene and peroxide retention

was measured in cell culture medium over time. (B) Wavelength scan of

Caco-2 cell culture medium over time. (C) 1 hour retention comparison of

peroxide and conjugated diene of HPODE-treated, poorly differentiated

Caco-2, differentiated Caco-2, and HepG2 cell medium. (D) Loss of peroxide

of HPETE in the presence of poorly differentiated Caco-2 cells. In the

presence of cells vs cell free medium. This experiment was conducted for

three times in triplicates, data are mean ± SE as shown in the figure.

*P<0.05...... 52

Figure 11. Assay of factors that may be involved in the lipid peroxide reduction

and decomposition. 20 nmol of HPODE was incubated with various amino

acids, antioxidants and medium. Y-axis was expressed as the absorbance at

660 nm. This experiment was conducted for two times in triplicates with

mean ± SE as shown in the figure. Control (PBS) vs treatments, *P<0.05,

**P<0.01...... 54

Figure 12. Cellular uptake of linoleic acid and its oxidized products. Uptake of 14-

C labeled linoleic acid, HPODE and HODE by poorly differentiated Caco-2,

fully differentiated Caco-2 and HepG2 cells was determined and adjusted by

protein concentrations. Counts were measured by collecting cell lysate and

adjusting for protein concentrations. This experiment was conducted for

three times in triplicates with mean±SE as shown in the figure. Poorly

differentiated Caco-2 vs differentiated Caco-2 and HepG2, Linoleic acid vs

HPODE and HODE treatments, *P<0.05...... 55

Figure 13. TLC radio-autography of the lipid fraction in the medium and cells.

Representative graph of radio-autography scan of TLC plate on lipid fraction

in extracted differentiated Caco-2 cell medium (A) and cells (B), poorly

differentiated Caco-2 cell medium (C) and cells (D). In B and D, B is before

saponification and A is after saponification. HODE fractions were marked in

red dotted circle. This experiment was conducted for three times and

representative graphs were shown...... 57

Figure 14. Most intracellular HODE exists in the esterified form. (A) TLC radio-

autography of the intracellular lipid fraction before and after saponification.

Samples were presented in duplicates. Letter B was labeled as before

saponification and A was after saponification. (B) Quantification of

radioactive counts in HODE and TG fractions on TLC plate. Y-axis was

expressed as the total counts collected in each TLC fraction. This experiment

was conducted in for three times in duplicates with mean±SE as shown in

the figure. SP:Saponification, HODE before SP vs HODE after SP, *P<0.05.

...... 59

xvi

Figure 15. Malondialdehyde contents in heated cooking oil. MDA content was

determined by a TBAR assay by adding 100 µl of cooking oil in acetone (10 µl

of oil to 1ml of acetone) with 0.3 ml 6N HCl and 1ml TBAR reagent.

Colorimetric readings were taken at 532 nm. This experiment was conducted

for two time in triplicates with mean ± SE as shown in the figure. All oil 0

hour vs 4 hour & 8 hour, *P<0.05...... 60

Figure 16. Decomposition products from HPODE. (A) Gas chromatogram of

HPODE (B) Gas chromatogram of HODE (C) GC-MS quantification of the

quantity of ONA and AzA in fresh and 2 days room temperature HPODE and

HODE samples. This experiment was conducted for three times in duplicates

with mean ± SD as shown in the figure. ONA and AzA in fresh HPODE vs in

2 days RT and HODE, *P<0.05...... 61

Figure 17. 9-Oxononanoic Acid Synthesis Reactions ...... 62

Figure 18. Characteristics of 9-Oxononanoic Acid. (A) TLC of ONA in the solvent

system of chloroform, tetrahydrofuran and acetic acid (90:10:0.5). ONA was

marked in red dotted circle. (B) Gas chromatogram of the synthesized ONA.

Figure 20. AzA remained in Differentiated Caco-2 Cell Culture Medium. （A1&A2）

Representative image of gas chromatogram of lipid extract of AzA treated

Caco-2 cells and medium. (B) GC-MS quantification of intracellular AzA

after saponification. (C) GC-MS quantification of AzA in differentiated Caco-

2 cell culture medium. All measurements were duplicated in three

xvii

independent experiments. 0-hour vs 1h, 3h&18hours, *P<0.05, ns-not

significant...... 67

Figure 21. Intracellular ONA and AzA before and after saponifcation. (A) TLC

radio-autography of 14C-ONA-treated differentiated Caco-2 cell lipid extracts

before and after saponification. ONA fraction was marked in red dotted

circle. (B) Radioactive counts of each fraction on TLC before and after

saponification. All measurements were run in triplicates in two independent

experiments. After saponification vs before saponification, *P<0.05,

**P<0.01...... 68

Figure 22. Scheme of the metabolic fates of HPODE, ONA and AzA...... 70

Figure 23. Normalized gene expression of ApoA1 with increasing concentrations

of HPODE treatment for 24 hours of (A) poorly differentiated Caco-2 cells (B)

fully differentiated Caco-2 cells and (C) HepG2 cells. This experiment was

conducted in duplicates and repeated 3 times with mean ± SE as shown in

the figure. Control vs treatments, *P<0.05...... 71

Figure 24. Normalized gene expression of ApoA1 with increasing concentrations

of ONA for 24 hours of (A) poorly differentiated Caco-2 cells (B) fully

differentiated Caco-2 cells and (C) HepG2 cells. This experiment was

conducted in duplicates and repeated 3 times with mean ± SE as shown in

the figure. No significant difference between control and treatments was

noticed...... 72

xviii

Figure 25. Normalized gene expression of ApoA1 with increasing concentrations

of AzA for 24 hours for (A) poorly differentiated Caco-2 cells (B) fully

differentiated Caco-2 cells and (C) HepG2 cells. This experiment was

conducted in duplicates and repeated 3 times with mean ± SE as shown in

the figure. No significant difference between control and treatments was

noticed...... 73

Figure 26. ApoA1 ELISA assay of HPODE-treated cell medium after 24-hour

incubation. (A) Poorly differentiated Caco-2 cells (B) fully differentiated

Caco-2 cells and (C) HepG2 cells. This experiment was conducted in

triplicates and repeated 3 times with mean ± SE as shown in the figure.

Control vs treatments, *P<0.05, **P<0.01...... 74

Figure 27. ApoA1 ELISA assay of ONA-treated cell medium after 24-hour

incubation. (A) Poorly differentiated Caco-2 cells (B) fully differentiated

Caco-2 cells and (C) HepG2 cells. This experiment was conducted in

triplicates and repeated 3 times with mean ± SE as shown in the figure.

Control vs treatments, *P<0.05...... 75

Figure 28. ApoA1 ELISA assay of AzA-treated cell medium after 24-hour

incubation. (A) Poorly differentiated Caco-2 cells (B) fully differentiated

Caco-2 cells and (C) HepG2 cells. This experiment was conducted in

triplicates and repeated 3 times with mean ± SE as shown in the figure.

Control vs treatments, *P<0.05...... 76

xix

Figure 30. Western blot protein quantification of ApoA1 from differentiated

Caco-2 cell lysates normalized against expression of β-Actin and control. (A)

HPODE treatment (B) ONA and AzA treatments at 50 µM and 100 µM. This

experiment was repeated 3 times. No significant difference between control

and treatments was noticed...... 78

Figure 31. Normalized gene expression of PON1 for HPODE increasing dose

treatment for 24 hours of (A) poorly differentiated Caco-2 cells (B) fully

differentiated Caco-2 cells and (C) HepG2 cells. This experiment was

conducted in duplicates and repeated 3 times with mean ± SE as shown in

the figure. Control vs treatments, *P<0.05...... 80

Figure 32. Normalized gene expression of PON1 for ONA increasing dose

treatment for 24 hours of (A) poorly differentiated Caco-2 cells (B) fully

differentiated Caco-2 cells and (C) HepG2 cells. This experiment was

conducted in duplicates and repeated 3 times with mean ± SE as shown in

the figure. Control vs treatments, *P<0.05...... 81

Figure 33. Normalized gene expression for PON1 of AzA increasing dose

treatment for 24 hours of (A) poorly differentiated Caco-2 cells (B) fully

differentiated Caco-2 cells and (C) HepG2 cells. This experiment was

conducted in duplicates and repeated 3 times with mean ± SE as shown in

the figure. No significant difference between control and treatments was

noticed...... 82

Figure 34. PON1 activity assay in the medium of differentiated Caco-2 cells of

HPODE, ONA and AzA treatment for 24 hours of (A) HPODE-treated cell

medium (B) ONA-treated cell medium (C) AzA-treated cell medium. This

experiment was conducted in triplicates and repeated 3 times with mean ±

SE as shown in the figure. Control vs treatments, *P<0.05...... 83

Figure 35. PON1 activity assay in the medium of poorly differentiated Caco-2 cells

of HPODE, ONA and AzA treatment for 24 hours of (A) HPODE-treated cell

medium (B) ONA-treated cell medium (C) AzA-treated cell medium. This

experiment was conducted in triplicates and repeated 3 times with mean ±

SE as shown in the figure. Control vs treatments, *P<0.05...... 84

Figure 36. PON1 activity assay in the medium of HepG 2 cells of HPODE, ONA

and AzA treatment for 24 hours of (A) HPODE-treated cell medium (B)

ONA-treated cell medium (C) AzA-treated cell medium. This experiment was

conducted in triplicates and repeated 3 times with mean ± SE as shown in

the figure. Control vs treatments, *P<0.05...... 85

Figure 37. ApoB ELISA assay of HPODE-treated cell medium after 24-hour

incubation. (A) Poorly differentiated Caco-2 cells (B) fully differentiated

Caco-2 cells and (C) HepG2 cells. This experiment was conducted in

triplicates and repeated 3 times with mean ± SE as shown in the figure.

Control vs treatments, *P<0.05...... 86

Figure 38. ApoB ELISA assay of ONA-treated cell medium after 24-hour

incubation. (A) Poorly differentiated Caco-2 cells (B) fully differentiated

xxi

Caco-2 cells and (C) HepG2 cells. This experiment was conducted in

triplicates and repeated 3 times with mean ± SE as shown in the figure.

Control vs treatments, *P<0.05...... 87

Figure 40. ApoB western blot of fully differentiated Caco-2 (A) and HepG2 (B)

medium, normalized against control. Control vs treatments, This experiment

was repeated 3 times. *P<0.05...... 89

Figure 41. ApoB100 gene expression of HepG2 cells. (A) HPODE treatment; (B)

ONA treatment; (C) AzA treatment. This experiment was conducted in

triplicates and repeated 3 times with mean ± SE as shown in the figure.

Control vs treatments, *P<0.05. No significant difference between control

and treatments was noticed...... 90

Figure 42. Gene expression of ApoB100 and ApoB48 of differentiated Caco-2

cells. (A) HPODE treatment; (B) ONA treatment; (C) AzA treatment. Left

dark shade is ApoB100 gene expression and right side light shade is ApoB48

gene expression. This experiment was conducted in triplicates and repeated

3 times with mean ± SE as shown in the figure. Control vs treatments,

*P<0.05. No significant difference between control and treatments was

noticed...... 91

Figure 43. Gene expression of ApoB100 and ApoB48 of poorly differentiated

Caco-2 cells. (A)HPODE treatment; (B) ONA treatment; (C) AzA treatment.

Left dark shade is ApoB100 gene expression and right side light shade is

ApoB48 gene expression. This experiment was conducted in triplicates and

xxii

repeated 3 times with mean ± SE as shown in the figure. Control vs

treatments, *P<0.05. No significant difference between control and

treatments was noticed...... 92

Figure 44. Gene Expressions of ApoA1, ApoB and PON1 expression among cell

types. (A) Comparisons among poorly differentiated Caco-2, differentiated

Caco-2 and HepG2 cells. (B) Enlarged figure to compare between poorly

differentiated and fully differentiated Caco-2 cells. Poorly differentiated

Caco2 vs differentiated Caco2 and HepG2 cells, This experiment was

conducted in triplicates and repeated 3 times with mean ± SE as shown in

the figure. *P<0.05, **P<0.01,***P<0.001...... 93

Figure 45. ApoA1 and ApoB are secreted at different levels in Caco-2 cells and

HepG2 cells. (A) ApoA1 ELISA of poorly differentiated, differentiated Caco-2

and HepG2 cells. Values were expressed in percentage of expression as

compared to poorly differentiated Caco-2 cells in the medium. (B) ApoA1

ELISA of poorly differentiated and fully differentiated Caco-2 cells. (C) ApoB

ELISA of poorly differentiated, differentiated Caco-2 cells and HepG2 cells.

This experiment was conducted in triplicates and repeated 3 times with

mean ± SE as shown in the figure. Poorly differentiated Caco2 vs

differentiated Caco2 and HepG2 cells, *P<0.05, **P<0.01...... 94

Figure 46. Summary of the protein secretion by HPODE, ONA and AzA treatment

for Caco-2 and HepG2 cells. Green boxes indicate an increase, red boxes

represent a decrease, and grey represents no significant change...... 96

xxiii

Abbreviation

ADMEM Advanced Dulbecco’s eagle medium ALDH Aldehyde dehydrogenase APO Apolipoprotein ATCC American type of culture collection ATP Adenosine tri phosphate AzA Azelaic acid BHT Butylated hydroxyl toluene CVD Cardiovascular disease DAG Diacylglycerol DG Diglycerides DGAT Diacylglycerol acyltransferase DNP Dinitrophenyl hydrazine DPM Disintegration per minute ELISA Enzyme linked immunosorbent assay FATP Fatty acid transfer protein GAPDH Glyceraldehyde phosphate dehydrogenase GI Gastrointestinal GSH Glutathione HBSS Hanks balanced salt solution HETE Hydroxy eicosa tetraenoic acid HPETE Hydroperoxy eicosa tetraenoic acid HDL High density lipoprotein 4-HNE 4-Hydroxy nonenal HPODE Hydroperoxy octadecadienoic acid LDL Low-density lipoprotein LMB Leucomethylene blue LysoPtdCho Lysophosphatidylcholine MAG Monoacylglycerol MDA Malondialdehyde MGAT Monoacylglycerol acyltransferase MnSOD Manganese superoxide dismutase MUFA Monounsaturated fatty acid xxiv

ONA 9-Oxononanoic acid Ox-LDL Oxidized LDL PBS Phosphate buffer saline PL Phospholipids PNP Paranitrophenyl phosphate PNPA Paranitrophenyl acetate PPAR Peroxisome proliferator-activated receptor PON1 Paraoxonase PUFA Polyunsaturated fatty acid RCT Reverse cholesterol transport ROS Reactive oxygen species SDS Sodium dodecyl sulfate SREBP Sterol regulatory element binding protein TBARS Thiobarbituric acid reactive substances TG Triglycerides TICE Trans intestinal cholesterol efflux USA United States of America VLDL Very low density lipoprotein

xxv

Chapter 1: Introduction

1.1 Background

Peroxidized lipids are seen as harmful compounds [1, 2]. They are viewed as inducers of oxidative stress, generators of toxic molecules such as aldehydes, and modifiers of many biological molecules, such as proteins, lipids, and nucleic acids [3-6]. Their involvement has been extensively studied with respect to cardiovascular disease (CVD), cancer and other diseases [7-10]. Most studies represented in the literature pertain to in situ generated lipid peroxides as a result of enzymatic and non-enzymatic actions of oxidants on polyunsaturated fatty acid-containing lipids [11].

Diet also is a major source of peroxidized lipids [12, 13]. Heated oil, in the form of fried food in the diet, contains high levels of peroxidized fat and their decomposition products [13]. It has long been recognized that deep frying or heating edible oils at high temperature results in considerable formation of peroxides and their decomposition products [14-17]. Both pro- and anti- atherosclerotic effects have been ascribed to the dietary presence of these peroxides and decomposition products [15, 16, 18-21]. For example, it has been noted that pure forms of fatty acid peroxides increase the atherogenic actions of a cholesterol containing diet in mouse models of atherosclerosis [20]. On the other

1 hand, peroxidized fatty acids also increase the expression of apoprotein A1

(ApoA1), a component of high density lipoprotein (HDL), generally believed to a beneficial anti-atherogenic lipoprotein [21]. In addition, it has also been reported that feeding fatty acid peroxides reduces triglyceride (TG) levels in certain mouse strains [22].

There is a lack of understanding of when to expect harmful versus beneficial effects from these compounds. Understanding dietary oxidized lipids could provide knowledge on how to limit the anti-atherosclerotic effects of these lipids while simultaneously retaining the beneficial impacts.

1.2 Fatty Acid Peroxidation and Decomposition

Polyunsaturated fatty acids (PUFA), which contains two or more double bonds are extremely susceptible to oxidation and are the primary targets of reactive oxygen species（ROS）or oxygen free radicals [23]. This reaction can be initiated by the presence of enzymes, high temperatures, ultraviolet light exposure, ozone, transition metals such as copper and iron or simply by auto- oxidation [23-26]. Free radical chain reactions consist of chain initiation, propagation, and termination (Figure 1) [26].

Figure 1. Steps Involved in the Oxidation of Lipids

At the initial stage of oxidation, PUFAs undergo hydrogen abstraction to generate lipid radicals [26]. A conjugated diene is formed by molecular rearrangement of one of the double bonds. In the propagation step, a peroxyl radical is generated by adding one molecular oxygen to the lipid radical [26]. One hydrogen atom is abstracted from another lipid molecule (L-H) by a peroxyl radical to generate lipid peroxide and a lipid radical, which propagates the chain reaction [26]. Coupling of two radicals can terminate the reaction. If the recombination reactions are between two peroxyl radicals, an unstable tetroxide intermediate will be generated and decomposed to aldehyde, alcohol and molecular oxygen [26].

Linoleic acid is the most abundant PUFA in plants and mammals so its peroxidation products likely exist in larger amounts compared to other PUFAs

[27]. While it cannot be directly synthesized in the mammalian system, humans consume large quantities of linoleic acid via vegetables and meat products. 13- 3 hydroperoxy-9,11,octadecadienoic acid (13-HPODE) and 9-hydroperoxy-

10,12,octadecadienoic acid (9-HPODE) are the two main products generated from linoleic acid peroxidation [28]. While enzymes, such as lipoxygenases, might generate stereospecific molecular species due to the enzymatic stereo- specificity, free radical or auto-oxidation generally yields a mixture of isomers

[29]. In our laboratory, enzymatically induced peroxidation was accomplished using soybean lipoxygenase type V to prepare optically pure 13-(S)-HPODE as a model of study. 13-(S)-HPODE decomposes to generate 4-hydroxynonenal (4-

HNE) and 9-oxononanoic acid (ONA) (Figure 2).

Figure 2. Decomposition of 13-HPODE to 4-HNE and ONA

These products are of our specific interest as studies have shown involvement of 4-HNE in a variety of diseases. ONA, unlike 4-HNE, has been poorly studied. The chemical mechanisms of such cleavage to generate 4-HNE and ONA from HPODE have been proposed three ways (Figure 3) [30].

Figure 3. Mechanisms for Cleavage of HPODE for Generation of 4-HNE and ONA

Acidified hydroperoxide yields a good leaving group and Hock rearrangement occurs of a C-C to C-O bond [30]. The resulting carbonium ion is unstable and hydrolysis takes place. Cyclized peroxy radical forms dioxetane that is a carbon-centered radical [30]. The dioxetane can rearrange by a 2-electron process resulting in cleavage of the dioxetane ring and the generation of 4-HNE and ONA [30]. In the presence of transition metals such as Fe2+, hydroperoxide is reduced to an alkoxy radical and followed by β-scission [30]. In short, the presence of –OOH group is necessary to initiate the cleavage.

On the other hand, fatty acid peroxides (FAOOH) are readily reduced by glutathione (GSH) related enzymes to the corresponding fatty acid hydroxides

(FAOH). Aw et al. [31] suggested that the stomach and intestine are capable of reducing FAOOH to FAOH by GSH-dependent processes. The latter has no oxidative capacity on its own and yet possesses biological properties that are distinct from those of non-oxidized fatty acids.

1.3 Abundance of Peroxidized Lipids in the Diet

Oxidized lipid consumption varies with food choices and greatly increases with the intake of processed and fried foods [32]. Due to public policies and

Gobernmental regulations, oils with higher smoke points such as peanut, safflower, soybean and canola oil etc. are recommended for the usage of deep frying [33], in which many of the oils are PUFA rich. In the United States (US)

6 where fried foods and fast-food restaurants are so abundant, large quantities of

PUFAs that have been heated or processed to various degrees are common in the diet. For example, PUFA-rich cooking oil, such as corn oil, soybean oil, and vegetable oil (Table 1), is widely used in fast-food settings and stays in commercial fryers for up to 18 hours daily at temperatures between 150ºC -180ºC.

A confounding problem is that most often, these oils are not changed but are replenished or “topped off”. It has been estimated that greater than 15% of

PUFAs in cooking oil become oxidized in the process of preparing commercial french fries. A medium serving of French fries at McDonald’s® (117 grams of total weight), contains 19 grams of total fat, of which 16.5 grams are unsaturated fat.

These french fries could contain roughly 2.475 grams of oxidized fat, equivalent of 9 mmol. In recent years, the emerging of high oleic cooking oil varieties such as high oleic sunflower oil and high oleic canola oil, etc. may help reduce the net comsumption of lipid peroxides [34]. However, lipid peroxides are not only in fries, but also a variety of PUFA containing foods. Yagi et al. did a survey on 30 types of foods, such as crackers and frozen shrimp and found the peroxide content to be between 30-600 nmol per gram of food [35]. A study conducted in

Britain estimated that the average daily intake of lipid peroxide in that region was

1.5 mmol per day [36]. This estimation was based on the accumulated lipid peroxide contents in typical dietary fat fractions (Table 2) [36]. It is expected that individual lipid peroxide intake would vary widely and would depend upon individual food choices. A high fat diet containing highly processed and fried

7 foods results in a higher consumption of lipid peroxides as well as various lipid peroxidation products such as 4-hydroxy nonenal and 4-hydroxy hexenal, etc. [37,

38].

Percent of Linoleic acid Name content Safflower oil 74.62% Sunflower oil 65.70% Corn oil 59% Soybean oil 51% Sesame oil 45% Peanut oil 32% Canola oil 21% Olive oil 10% High oleic sunflower oil 4% Butter 2% Coconut oil 2% Table 1. Linoleic Acid Content of Commonly Used Cooking Oil

Lipid peroxide Associated lipid Daily contents peroxide Lipid type intake(g) (µmol/g) intake (µmol/day) Butter 5.7 0.4 2.3 Margarine 10 2.7 27 Lard and compound cooking fat 2.2 59.7 131.3 Vegetable and salad oil 6.5 3.6 23.4 All other fat 59.5 20 1190 Total Dietary fat 83.9 1374

Table 2. Dietary Peroxide Content [36] 8

1.4 Intestine Physiology

The small intestine is the location where most of the food absorption takes place. In the gastrointestinal (GI) tract, the small intestine is in between the stomach and large intestine, and is composed of the duodenum, jejunum, and ileum [39]. Most lipid absorption takes place in the proximal jejunum and is complete within a few hours [39]. Due to the fold structures of mucosa, villi and microvilli (brush border), the human small intestine has a greatly extended surface area of about 200m2 (Figure 4) [39].

Fully differentiated intestinal epithelial cells, which have a brush border and are specialized in nutrient absorption, are called enterocytes. Enterocyte stem cells are localized in the crypt at the base of each villus [39]. With the differentiation process, enterocytes move from the crypt to the villus and stay there for about 3 days before they slough off into the intestinal lumen [39].

Enterocytes take up nutrients generally by four mechanisms, which include transporter-mediated absorption, passive diffusion, pinocytosis and the paracellular pathway [39]. Transporter-mediated absorption can be passive or active and the transporters can be uniports, symports or antiports [39]. Passive diffusion applies for water, gas and lipid-soluble small molecules such as fatty acids [39]. Pinocytosis is the mechanism for uptake of large molecules and the paracellular pathway is essential for maintaining osmolality in the intestinal lumen [39].

Figure 4. Anatomy of Small Intestine [40]

1.5 Caco-2 Cells

The Caco-2 cell line used in this study was purchased from American Type

Culture Collection (ATCC; Manassas, VA, USA). Caco-2 cells can be differentiated and exhibit features such as microvilli that are similar to healthy small intestinal cells [41]. The differentiation of Caco-2 cells is induced by cell-to-cell contact when cultured post-confluence [41]. Upon differentiation, Caco-2 cells develop microvilli (Figure 5) which are essential for absorption [19]. Caco-2 cells, which are cultured for 14 days post-confluence are considered fully differentiated, whereas cells cultured for 4 days or until they become confluent are considered to be poorly differentiated, as they lack brush borders [41]. Intestinal alkaline

10 phosphatase (IAP) presented on the brush border is used as a marker for differentiation [41]. It is to be noted that both 4 and 14 day old cells used in the study are both confluent but differ only in their differentiation status. Alkaline phosphatase activity was used as a marker for differentiation.

In contrast to arterial cells (endothelial cells, smooth muscle cells etc), there are not many cell lines available for representing intestinal cells [42].

Primary cultures of intestinal cells are hard to establish and have to be used as a mucosal cell suspension [43]. On the other hand, intestinal slices and segments, everted intestinal sacs, and ex vivo intestinal intubation have been used for metabolic studies [44, 45]. Caco-2 cells that represent a colon cancer cell line have long been used for lipid absorption/transport [46-51] and lipoprotein synthesis studies [52-54]. A search of pubmed revealed over 600 publications using these cells for lipoprotein studies. They have the machinery to synthesize chylomicrons and HDL [55]. The use of these cells to synthesize TG and chylomicron in the presence of external FFA has been well documented in high impact journals such as the Journal of Biological Chemistry, Journal of Lipid

Research, and others [56-65].

Differentiated Caco-2 cell exhibits great similarity to enterocytes in both morphological and biochemical properties and it is human source. The use of

Caco-2 cell line has allowed researchers to obtain a lot of information about the composition, structure and distribution of lipoproteins [66-71] as well as nutrient uptake and metabolism [49, 72-76]. Yet another significant difference between

11 mouse and human is the localization and regulation of apoA1, a fact that appears to have enormous physiological significance as noted by Karathanasis and coworkers [77]. The co-localization of apoA1, CIII, and AIV gene cluster seems to undergo important regulatory events, one that is not seen in mouse [77].

Figure 5. Electron Microscopy of Caco-2 Cells [19]

1.6 Intestinal Lipid Absorption

Dietary fat constitutes a significant source of calories in the diet. A typical

American diet contains 75-100 grams of fat per day, which is as much as 35% of total caloric intake [78]. It has generally been accepted that a PUFA-rich diet is beneficial for health in comparison with saturated fat and trans-fat rich diets [78].

The American Heart Association recommends that 30% or less of total caloric intake come from fat and 10% or less from saturated fat [79].

Upon ingestion, dietary fat enters the stomach and is digested by lingual lipase and gastric lipase secreted by the salivary gland and the gastric mucosa, respectively [39]. Both of these lipases are more efficient at hydrolyzing short and medium chain triglycerides (TG) and do not work on phospholipids and cholesterol ester [39]. The primary immediate hydrolytic products are diglycerides (DG) and free fatty acids. Gastric chyme is then propelled into the small intestine, where bile and pancreatic juice are released [39]. Bile plays a major role in the emulsification of larger fat droplets into smaller particles that can efficiently be absorbed by the epithelial cells of the gut. Pancreatic lipase acts with colipase as a cofactor and contributes to most of the digestion of TG at the sn-1 and sn-2 positions [39]. The digestion of phospholipids and cholesterol occurs in the small intestine as well. Phospholipids are hydrolyzed by pancreatic phospholipase A2 at the sn-2 position to yield a free fatty acid and lysophosphatidylcholine (LysoPtdCho) [80]. Dietary cholesterol exists mostly in the free form with only 10-15% as the sterol ester [81]. Human cholesterol esterase has broad specificity for neutral lipids and its activity is greatly enhanced by bile salts [82]. The absorption of digested products such as monoacylglycerol

(MAG), LysoPtdCho, cholesterol and FA takes place by passive diffusion and fatty acid transport proteins (FATPs)-mediated mechanisms [80, 83]. The concentration gradient between brush border surface and intracellular compartment drives passive diffusion and the low intracellular concentration of fatty acids is maintained by rapid reesterification [84]. Stahl et al. identified

FATP4, a member of the fatty acid transport proteins (FATPs) as a mediator for fatty acidtransportation [85]. By silencing expression of FATP4, approximately

50% of lon g chain fatty acid transportation was compromised at the concentration of 100 µmol/L [85]. It has been speculated that FATP4 facilitates fatty acid transportation at low concentrations and is essential to ensure the absorption of fatty acids during fat deprivation [85].

After entering the enterocytes, with the help of fatty acid binding protein

(FABP), FA and MAG is transported to the endoplamsic reticulum (ER), where biosynthesis of complex lipids takes place [85]. Within the ER, fatty acids are activated by coenzyme A (CoA) acylation and further esterified to MAG by monoacylglycerol acyltransferase (MGAT) to form diacylglycerol (DAG) [85].

Acetylation of DAG to form TG is catalyzed by acyl-CoA:diacylglycerol acyltransferase (DGAT). Acyl-CoA cholesterol acyltranferase (ACAT) is responsible for intracellular cholesterol re-esterification [84] (Figure 6).

Figure 6. Absorption of TG by Intestine[19] 14

1.7 Intestinal Lipoprotein Assembly

The most notable lipoprotein produced by intestine is chylomicron, which mainly consists of ApoB48 and plays a major role in exogenous TG transportation during the postprandial stage [39]. Chylomicrons are released by exocytosis to the mesenteric lymph and enter the blood circulation via the thoracic duct [39].

The intestine also synthesizes ApoA1 (a major component of HDL) and secretes HDL [86]. Intestinal synthesis is a significant source of ApoA1 for circulating HDL lipoproteins. In the mouse model, the same gene encodes ApoA1 in both the liver and small intestine [86]. Intracellular intestinal HDL has been isolated from the Golgi fraction of rat intestinal epithelial cells by sequential ultracentrifugation [86]. Intestinal HDL also has been isolated from lymph [86].

Unsaturated fatty acids can stimulate ApoA1 secretion from newborn swine intestinal epithelial cells [87]. It is worth noting that ApoA1 and ApoB48 synthesis was not dependent on the quality and quantity of dietary un-oxidized

TGs [88]. Hayashi et al. demonstrated that the number of chylomicrons produced by the intestine does not change after lipid infusion while lymphatic TG output increased 7-8 fold [89]. In our previous studies, we documented that

FAOOH increased ApoA1 synthesis, presumably via a PPAR-α dependent mechanism [21]. During fasting, when chylomicron assembly is at a minimum, it was believed that VLDL was the only lipoprotein produced by the intestine, but a recent study showed ApoA1 was also secreted apically into the gut lumen, which

15 may play a role in trans-intestinal cholesterol efflux (TICE) [90]. TICE has been proposed as a liver-independent route of cholesterol secretion. It plays a significant role in neutral sterol disposal and may account for approximately 30 percent of total reverse cholesterol transport (RCT) [91].

1.8 Absorption of Dietary Peroxidized Lipids

Our laboratory previously reported through cell culture and rat everted intestinal sac studies, that the HPODE was absorbed and esterified by enterocytes [19]. Straprans et al. demonstrated dietary heated oil was incorporated in chylomicrons and could be found in the plasma for up to 8 hours postprandially as detected by increased absorbance of conjugated dienes in the isolated chylomicron fraction [92]. The lag time for chylomicron in vitro oxidation by adding Cu2+ decreased and the amount of oxidized lipids in the chylomicron fraction was correlated with oxidized lipid consumption [92].

Kanazawa et al. studied hydroperoxide of trilinolein and demonstrated that when the compound is consumed by rats, hydroperoxide of trilinolein is hydrolyzed in the stomach and is mostly absorbed before reaching the small intestine [93]. Aw et al. infused rat proximal intestine with lipid peroxide and found lipid peroxide can be transported to lymph and luminal elimination of peroxide can be affected by the presence of GSH [94]. In human feeding studies, Naruszewicz et al. reported ingestion of heated soy oil resulted in elevated levels of oxidized lipids in

16 chylomicrons in humans [95]. The intestinal absorption of decomposition products from lipid peroxides such as 4-HNE (4-hydroxy-2-nonenal) and 4-HHE

(4-hydroxy-2-hexenal) from omega-3 PUFA was also investigated, and intestinal cells have been shown to absorb significant amounts of such aldehydes [96].

Downstream effects such as oxidative stress and inflammation have also been demonstrated by Awada et al. [96]. Thus, the evidence suggests that dietary oxidized lipids or their metabolic products can be significantly absorbed and packaged into chylomicrons, but the extent of absorption and esterification is less than that of native fatty acids [97].

1.9 Physiological Consequences of Dietary Peroxidized Lipids

Peroxidized lipids are generally considered atherogenic [98]. Many studies from others as well as our laboratory have documented that dietary lipid peroxides pose an atherogenic risk [98]. Heated dietary oils (that presumably contain peroxidized lipids) have been noted to enhance the atherogenicty of a high fat diet [99, 100]. It has been suggested that peroxidized lipids are carried in the chylomicron and are repackaged by the liver as peroxidized lipid carrying

VLDL (and subsequently as LDL) [92]. While most of these studies used heated oil mixtures, we used purified 13-HPODE, the oxidation product of the most abundant PUFA found in nature, and documented increased atherosclerosis in

17 cholesterol-fed animals, independent of plasma cholesterol levels in LDL- receptor deficient animals [20].

There is an apparent contradiction in the actions of FAOOH, where both pro- and anti-atherogenic actions are seen. FAOOH have been reported to have numerous perplexing, beneficial that are contradictory to their presumed

“harmful” nature. For example, FAOOH has been reported to increase MnSOD, catalase, heme oxygenase, and glutathione synthesis [18]. We also reported that ingestion of FAOOH decreased plasma triglyceride (TG) levels, as a result of decreased ApoCIII and increased ApoAV gene expressions. There was also an activation of acyl CoA oxidase gene expression which might suggest a PPARα dependent mechanism of action [22]. Oxidized lipids and their breakdown products (such as 13-oxo-9-11octadecadienoic acid and azelaic acid) have been reported to be ligands for PPAR alpha and gamma [101-103]. In addition, dietary oxidized lipids have been shown to inhibit the maturation of SREBPs, suppressing fatty acid synthesis and cholesterol homeostasis, which may also be due to the activation of PPARα [104, 105].

1.10 Lipid Oxidation and Atherosclerosis

Atherosclerosis is a chronic inflammatory disease accounting for 75% of all cardiovascular related death in the US [106]. It has been estimated that the disease occurs in 2 of 3 men and 1 of 2 women after the age of forty [107]. A

18 number of risk factors have been identified such as smoking, hypertension, dyslipidemia, age, diabetes mellitus, etc. The oxidation hypothesis of atherosclerosis was established in the late 1980s’, and suggests the involvement of oxidatively modified LDL [108]. In the normal condition, native LDL is recognized by the LDL receptor, which is expressed on the cell surface to mediate cellular cholesterol uptake of LDL. Once the cholesterol accumulates inside the cell, the expression of LDL receptors is down regulated as a negative feedback control mechanism to prevent cholesterol from accumulating in excess [109].

Native LDL can be oxidized by a variety of in vivo factors (Table 3). It is also spectulated that external lipid perixides from the diet may also contribute the presence of oxLDL [92]. In the intima of the artery, oxidized LDL is recognized by scavenger receptors, expressed on macrophages and smooth muscle cells, to initiate uncontrolled cholesterol loading forming foam cells. Fatty streak lesions are formed by the accumulation of lipids in foam cells in the intima space. With the progression of the disease, blood vessels become narrower and cause blood flow occlusion, finally leading to the clinical endpoints of myocardial infarction or stroke (Figure 7).

Mechanisms

1 Lipoxygenase reaction 2 Copper and ceruloplasmin-mediated oxidation 3 Iron mediated oxidation 4 Peroxidase-mediated oxidation, including myeloperoxidase and heme 5 Peroxynitrite mediated oxidation 6 Thiol-dependent oxidation 7 Xanthine oxidase, NADPH oxidase and other superoxide generators 8 AAPH or other means of radical generation including cytochromes 9 Heme and cytochromes 10 Lysosomal oxidation Table 3. Suggested Mechanisms for the Oxidation of LDL [110]

Figure 7. Progression of Atherosclerosis [111]

1.11 HDL and Reverse Cholesterol Transport

As suggested by its name, HDL is a class of lipoprotein high in density

(1.063-1.21g/ml) but is small in size (5-17 nm diameter). It consists primarily of

ApoA1 and A2, enzymes such as paraoxonase 1 (PON1), lipoprotein associated phospholipase A2 (Lp-PLA2) and platelet-activating factor acetylhydrolase (PAF-

AH), and lipid transfer proteins, including lecithin cholesterol acetyltransferase

(LCAT) and cholesteryl ester transfer protein (CETP). HDL has been known as a major player in RCT and causes lesion regression in the pathology of atherosclerosis [112]. In RCT, HDL delivers excess cholesterol from peripheral tissues to the liver for excretion. Foam cells originating from macrophages are the primary cell type associated with cholesterol over-loading and atherosclerotic lesions. Therefore, macrophage-specific RCT has become the focus of intense research. At the initial step, pre-β-HDL, the lipid poor, disc-shaped ApoA1 particles, which are secreted by the liver and small intestine, bind with ABCA1, a cell surface transporter mediating ATP-dependent cholesterol efflux from cholesterol rich cells to lipid poor pre-β-HDL. After lipid loading, mature HDL, a spherical particle, is formed, and interacts with ABCG1 to continue the lipid loading from peripheral tissues. Finally, the liver takes up HDL from the circulation via an SR-B1 mediated pathway [113].

1.12 Paraoxonase 1

Human paraoxonase-1 (PON1) is a calcium-dependent, HDL-associated enzyme with antioxidant properties. PON1 is capable of hydrolyzing a variety of compounds such as lipid peroxide, and is thereby considered to be anti- atherogenic [114]. In various mouse models, over-expressing PON1 is associated with decreased atherosclerosis by reducing circulating Ox-LDL and increasing the RCT mechanism [115-117]. Mackness et al. first showed PON1 delayed LDL oxidation in vitro [118]. Triglycerides containing oxidized linoleic acid are a natural substrate for PON1. PON1 likely acts by suppressing lipid autoxidation and macrophage ROS generation induced by oxidized lipids [119]. Genetic modulation of scavenger receptor class B, type 1 (SR-B1) demonstrated that elevated SR-B1 increases HDL-associated PON1 secretion by improving the docking of HDL to the cell surface [120]. Several signaling pathways are involved in PON1 regulation. Statins and quercetin modulates PON1 translocation through sterol regulatory binding protein 2 (SREBP2) and specific protein 1 (SP1) binding to the PON1 promoter. Aspirin and resveratrol promote PON1 via aryl hydrocarbon receptors, berberine induces PON1 through the JNK-c-JUN pathway, and pomegranate juice works via the PPARγ-PKA-cAMP signaling cascade [121]. In humans, PON1 is mainly expressed in the liver, kidney and intestine [122]. PON1 mRNA and protein expression has been shown to be highest in the duodenum in human biopsy samples [123]. The functional roles of

PON1 are summarized in Table 4.

Functional roles of PON1 • Protective effect against lipid peroxidation of HDL, LDL and biological membranes • Detoxification of toxic metabolite of homocysteine, homocysteine- thiolactone which damages protein by homocysteinylation of lysine residues. • Protective effect exerted against postprandial oxidative stress • Inhibition of cholesterol biosynthesis in macrophages • Stimulation of cholesterol efflux from macrophages • Modulation of lipid metabolism of human adipose tissue Table 4. Functional Roles of PON1 [124]

1.13 Apolipoprotein A1 (ApoA1)

Human ApoA1 is a 28kD protein with 243 amino acids. It is the major lipoprotein in HDL and the has been shown to have atheroprotective properties if it is not oxidized [125]. While the liver mostly excretes free ApoA1 that converts to mature HDL in circulation, the small intestine produces significant amounts of

ApoA1, some of which are associated with chylomicrons [90]. Upon secretion, chylomicrons-associated ApoA1 transfers to HDL in the blood. ApoA1 alone is able to induce RCT via ABCA1/ABCG1 and activates lecithin cholesterol acyltransferase (LCAT) [126]. Genetically modified animals that over-express

ApoA1 are protected from atherosclerosis [127]. Aside from its core role in RCT, the anti-inflammatory properties of ApoA1 have also come into focus.

Reconstituted ApoA1 was observed to inhibit cytokine-induced expression of inflammatory cell adhesion molecules such as vascular cell adhesion molecule-1

(VCAM-1) and intercellular adhesion molecule-1 (ICAM-1) in cultured endothelial cells [128]. As the Ox-LDL has been identified as the key player in atherogenesis,

HDL is identified to have inhibitory effects on lipid peroxidation and prevents

LDL from being oxidized [129].

Functional HDL Dysfunctional HDL • Good cholesterol • Bad-cholesterol • Anti-inflammatory • Pro-inflammatory • Antioxidant • Pro-oxidant • Anti-thrombotic • Pro-thrombotic • Anti-apoptotic • Pro-Apoptotic • Anti-atherogenic • Pro-atherogenic • Efficient RCT • Impaired RCT • Protective and healing activities on • No such effect ECs • Vasodilator • Unable to vasodilate • Detoxification of oxidized sterols • Toxic and PLs • Inhibits monocyte chemotaxis • Enhances monocyte chemotaxis Table 5. Function of HDL

However, HDL may lose its functionality if it is oxidized. Several site specific amino acid positions of ApoA1 have been identified to involve in such oxidative modification [130, 131]. HDL function and its comparison to dysfunctional HDL are summarized in Table 5. Subsequent research noted this effect can be attributed to ApoA1 as ApoA1 mimicking peptides were able to

24 reproduce this effect [125]. PPAR-α agonists, such as fibrates, can induce the expression of ApoA1 [132]. It is worth noting that the ApoA1 induction effect on

PPAR-α agonists may not reproducible in rodents given the absence of proper

PPAR-response element (PPRE) in the rodent ApoA1 promoter [132]. Hepatic and intestinal ApoA1 expression also may not be regulated in the same way due to the fact that the two cell types are distinct in ApoA1 promoter locations [133].

1.14 Apolipoprotein B

Apolipoprotein B (ApoB) lipoprotein contains 2 main isoforms, ApoB48 and ApoB100 [134]. ApoB48 is synthesized exclusively by small intestine and is the major component of chylomicron [134]. ApoB100, on the other hand, is produced from liver and secreted in VLDL. It is also the major LDL associated lipoprotein. These two lipoproteins are encoded by the same gene and as the result of the RNA editing, ApoB48 and ApoB100 have the same N terminal but

ApoB48 got 48% of the sequence of ApoB100 [134]. The regulation of ApoB production is very complex. Surprisingly, the quantity of secreted ApoB by the liver is largely depends on the proportion of protein that escapes from degradation. Most newly synthesized ApoB is degraded rather than secreted [135].

Insulin, for example, suppressed ApoB secretion by the liver via translational inhibition without altering mRNA level [135]. Regulation of ApoB secretion in intestine is poorly studied and it seems to be unique from the liver. Resveratrol,

25 for instance, is able to inhibit intestinal ApoB secretion but the mechanism is unknown yet [136]. Since ApoB is largely present in atherogenic lipoproteins such as VLDL, IDL, LDL and Chylomicrons, the reduction of ApoB secretion is believed to have health benefits [137].

1.15 Mechanisms Involved in ApoA1 and PON1 Regulation

ApoA1 is known to be regulated by PPAR-α, and PPAR-α agonists, such as fibrates, can induce the expression of ApoA1 [132]. Fatty acids can also activte

PPAR-α, and oxidized fatty acids serve as better ligands than unoxidized fatty acids [138]. HPODE has been reported to induce ApoA1 expression via PPAR-α pathway [21]. However, it is not clear so far of the functionality of HPODE induced ApoA1 in RCT. HPODE is an oxidant and it might potenitally involve in the oxidative modification of ApoA1 amino sequence [130, 131]. PON1 is an HDL associated antioxidant enzyme and Tavori et al. showed that HPODE inhibited

PON1 activity in human carotid lesion [139]. In the present study, HPODE and its decomposition products from the carboxylic end were included, namely ONA and

AzA to identify potential beneficial compunds to increase the secretion of ApoA1 without the proposed confounding effects. AzA is reported as a PPARγ activator

[103, 140] and PON1 can be activated via PPARγ pathway [121].

ApoA1 secretion can be regulated by other mechanisms as well. Bile acid decreased ApoA1 secretion and gene expression in liver via Farnesyl X Receptors

(FXR) [141]. HPODE is similar to bile salt in physiochemical structure [142]. It unknown that if HPODE can also go through FXR pathway to modulate ApoA1 secretion.

A genome-wide screen for liver ApoA1 secretion modulators was conducted in 2013 and found 40 genes of interest [143], in which decreased farnesyltransderase (FNTA) mRNA and protein was indentified to increase

ApoA1 secretion in HepG2 cells. However, very less is known about intestinal

ApoA1 secretion.

Epigenetic regulation of ApoA1 was also recently reported [144]. A natural antisense transcript ApoA1-AS was identifed as a negative transcription regulator of ApoA1. Silencing such ApoA1-AS by siRNA enhanced ApoA1 expression in hepatic cells [143].

1.16 Scope of the study

Intestinal cells are exposed to peroxidized lipids of dietary origin largely in the form of peroxidized free fatty acids and their degradation products after lipolysis in the gut lumen [17, 20, 145]. Fatty acid peroxides are susceptible to self-decomposition to generate short chain products and can be reduced to by

GSH-dependent systems [30, 37, 38]. Our in vitro studies have indicated that during the breakdown of fatty acid peroxides, both aldehydes and their corresponding carboxylic acids are formed. The formation of the former (e.g.,

MDA or HNE) has been known for a long time and their toxic effects also have been well documented [37]. However, aldehydes are very unstable and in addition to their ability to react with thiols, lysine, and other amino acids, they are readily oxidized to carboxylic acids. For example, the oxidation of malondialdehyde to malonic acid has been noted by others, as well as our laboratory [129, 146]. The oxidation of 4-HNE to 4-hydroxy-nonenoic acid has also been reported as one of the fates of 4-HNE [30]. However the fate of 9- oxononanoic acid (ONA) in the presence of cells has never been reported so far.

The intestinal uptake of Azelaic acid (AzA), the oxidation product of ONA is poorly understood. This study used 13-HPODE as a model for free fatty acid peroxide and Caco-2 cell as an enterocyte model for 13-HPODE, ONA and AzA uptake and metabolism assessments as well as apolipoprotein measurements.

It has been noted that pure forms of fatty acid peroxides increase the atherogenic actions of a cholesterol-containing diet in mouse models of atherosclerosis [20]. On the other hand, peroxidized fatty acids also increase the expression of ApoA1, a component of HDL, generally believed to a beneficial anti- atherogenic lipoprotein [21]. In addition, it has also been reported that feeding fatty acid peroxides reduces TG levels in certain mouse strains [22]. We recently reported that AzA decreases atherosclerosis in LDL-R-/- mice without altering plasma lipids [147]. This study focused on intestinal and hepatic apolipoprotein secretion modulated by 13-HPODE and its breakdown products. By investigating each individual compounds, it provided information to clarify the pros and cons

28 of physiological effects by dietary lipid peroxides. The following goals of the study have been proposed:

Specific aims: I propose the following specific aims:

(1) To determine the decomposition of and uptake of lipid peroxides by poorly

differentiated and differentiated Caco-2 cells.

(2) To determine the metabolic fate of aldehydes and corresponding dicarboxylic

acid generated from lipid peroxides by differentiated Caco-2 cells.

(3) To determine effects of HPODE and its decomposition products in the

secretion of ApoA1 and ApoB by Caco-2 and HepG2 cells.

Chapter 2: Materials and Methods

Materials: Linoleic acid, soybean lipoxygenase type V, Azelaic acid, silica gel G TLC plates, tetramethylpentamine-2,4-dinitrophenyl hydrazine, bromocresol green, pyruvic acid, 13% BF3 in methanol were purchased from

Sigma (St. Louis, MO). Leucomethylene blue（LMB）is obtained from Alfa Aesar

(Ward Hill, MA). TrizolTM reagent was purchased from Invitrogen (Carlsbad, CA).

Human anti- apolipoprotein A-I (Goat) antibody was bought from Rockland

Immunochemicals (Gilbertsville, PA). Mouse anti-Human-β-actin antibody was obtained from Sigma Aldrich (St. Louis, MO). Secondary horse radish peroxidase

(HRP) conjugated rabbit anti-goat antibody was purchased from R&D Systems

(Minneapolis, MN). Secondary HRP conjugated goat anti-mouse antibody was obtained from Santa Cruz Biotechnology (Dallas, TX). Ethyl ether contains no preservatives was purchased from Honeywell Burdick&Jackson(Muskegon, MI).

Radioactive compounds oleic acid[1-14C] and linoleic acid[1-14C] was bought from

American Radiolabeled Chemicals (St. Louis, MO). ELISA kit of ApoA1 was bought from Mabtech (Cincinnati, OH)

SureBlue Reserve TMB microwell peroxidase substrate was purchased from

Kirlegaard&Perry Laboratories (Gaithersbury, MD)

2.1 HPODE/HODE Preparation

Peroxidized lipids are difficult to prepare and separate from unoxidized lipids. In most studies in literature just heated oil was used to represent peroxidized lipids. Our laboratory developed the expertise of preparing gram quantities of peroxidized fatty acids by treating linoleic acid with soybean lipoxidase V. This method yields 13-S-HPODe with 100% optical purity in greater than 90% yield in as little as in 30 minutes. The specific synthesis of the other isomer 13-R-HPODE has not been reported in the literature and is not available.

There are also no reported methods for the separation of R and S isomers. In the studies presented, I exclusively used 13-S-HPODE, which required no additional purification.

Linoleic acid stock (200 mM) was prepared in ethanol and protected from light at 40C. 200 µM linoleic acid was then prepared from stock in 10ml phosphate-buffered saline (PBS, pH 7.4) and oxidized by the addition of 10 IU soybean lipoxygenase V [148]. The oxidation reaction was allowed to complete at room temperature over a period for up to 2 hours. The formation of conjugated diene (HPODE) was monitored spectrophotometrically by scanning the absorption between 200 and 300 nm (Uvikon XL, Biotek Instruments, El Cajon,

CA). The conversion of linoleic acid into its peroxidized form was observed as an increase in the optical density at 234 nm. 13-HPODE was extracted with BHT free ether to remove lipoxygenase and the ether phase was dried under stream of nitrogen. Freshly prepared HPODE was used immediately in all the experiments.

HODE was prepared by adding twice the amount of sodium pyruvate to HPODE and incubated in 37oC for 3 hours. LMB assay (will be described later) was used to confirm the removal of peroxide. Similarly, HPETE/HETE from arachidonic acid was prepared by adding soybean lipoxygenase V and used for the experiments.

2.2 Radioactive 14C-HPODE/14C-HODE Preparation

Similar to the preparation of cold HPODE, 1000 DPM/nmol, 200 µM

HPODE was prepared in PBS with the addition of soybean lipoxygenase. No observed increase in optical density at 234 nm was suggesting the complete of reaction. Ether extraction was performed and samples were dried under nitrogen stream. 14C-HPODE was reconstituted in PBS or HBSS for experiments. 14C-

HODE was prepared by adding sodium pyruvate to 14C-HPODE and incubated at

37oC water bath for 3 hours.

2.3 Synthesis of 9-Oxononanoic Acid (ONA)

9-Oxononanoic acid was prepared from oleic acid via eryther-9,10- dihydroxysteric acid (DHSA) [149, 150]. Briefly, 100 mg of oleic acid was hydroxylated with 80 mg of aqueous potassium permanganate solution in hot sodium hydroxide solution (0.25 M). The reaction mixture was chilled with 90 ml

32 ice-cold water and decolorized with sodium bisulfite (500 mg in 10 ml water) to remove MnO2. After the reaction was completed, 3 ml of 12 N hydrogen chloride was added and cooled on ice. The precipitate was separated by filtration using filter paper and filtrate was extracted 2 times with 10ml ether. Ether phase was centrifuged at 500 g for 20 min and supernatant was collected and dried under nitrogen. The bright white solid residue was dihydroxysteric acid, DHSA. DHSA was dissolved in 500 µL solvent of acetone, water, acetic acid (3:1:0.2). 15.4 mg of sodium periodate was added and the reaction mixture was heated at 40oC for 1 hour. Sodium periodate cleaves vicinal hydroxyl groups to generate aldehydes.

After the reaction was finished, centrifugation was performed at 400 g for 5 minutes at 4oC to clarify the supernatant. Supernatant was dried under nitrogen and purified by TLC using solvent system of chloroform, tetrahydrofuran and acetic acid (30/3.3/0.16). GC-MS (Perkin Elmer Clarus 560S Mass Spectrometer,

Clarus 500 Gas Chromatograph) was used to confirm the quality of the preparation. The yield was about 30% based on weight (theoretical-about 51%).

For cell culture experiment ONA was suspended in chloroform, dried under nitrogen and reconstituted with ethanol and used as needed.

2.4 Synthesis of 14C-9-Oxononanoic Acid (ONA)

Similar to the synthesis of cold ONA, 14C-ONA was synthesized in smaller scale from 14C-oleic acid and regular oleic acid to make a specific radioactivity of

1000 DPM/nmol. 5 µCi of 14C-oleic acid was mixed with 3 mg cold oleic acid and added to 0.5 ml of hot sodium hydroxide solution (0.25 M). 5 ml ice-cold water was added to the mixture with 4 mg of potassium permanganate. After 5 minutes, the reaction mixture was decolorized with sodium bisulfite (25 mg in 0.5 ml water). The solution turned colorless through brownish and 150 µl of 12 N hydrochloric acid was added and cooled for 20 minutes. Centrifugation was performed at 2000 rpm at 40C for 20 minutes to remove supernatant. 1ml of ether was added to the precipitate and centrifuged at 2000 rpm at 40C for 20 minutes. Supernatant was collected and dried under stream of nitrogen. The prepared DHSA was then proceed with oxidation following the protocol described in cold 9-ONA synthesis.

2.5 Leucomethylene Blue Assay

Leucomethylene blue assay (LMB) assay was used for detection of peroxides [151]. Leucomethylene blue reagent was prepared as following. 5.5mg hemoglobin and 1.4 gm of Triton X-100 was added to 80 ml of 0.05 M phosphate buffer. 5 mg of benzyl-leucomethylene blue was dissolved in 8 ml dimethyl formamide and added to the solution and made up to 100 ml with phosphate buffer. LMB reagent was aliquoted and stored in -200C for future use.

100 µL of LMB reagent was added to 100 µL of experimental samples containing in 96-well plate and incubated at room temperature for 15-20 minutes.

Absorbance was measured at 660 nm using a microtiter plate reader (Bio-Rad

Benchmark Plus). All experiments were performed in triplicates.

2.6 TBARS Assay

TBARS assay was developed to detect malondialdehyde (MDA) [152].

TBARs reagent containing 0.67% thiobarbituric acid in 0.05 N sodium hydroxide was prepared and used. Samples were mixed with 0.3 ml of 6N hydrogen chloride and 1ml of TBAR reagent and kept in boiling water for 15min. Triplicated samples were loaded in 96-well plate and measured at 532 nm.

2.7 Peroxide Detection in Cooking Oil

Different kinds of cooking oil (2 ml) were added to glass tubes and placed in heating block at 100oC for determined period of time. 100µl of each oil was then dissolved in 1ml of acetone. LMB assay was carried in 96-well plates by adding 100 µl of 1%SDS solution, 10 µl oil in acetone and 100 µl of LMB reagents to each well. TBARs assay was performed by adding 100µl of oil in acetone, 0.3 ml of 6N hydrogen chloride and 1ml TBARs reagent in glass tubes.

2.8 Alkaline Phosphatase Activity Assay

Caco-2 cells cultured in T-75 flasks were harvested gently by adding 1 ml of cold saline and phenylmethylsulfonyl fluoride (PMSF) at 40 µg/5 ml and cells were scraped and transferred into 1.5 ml eppendorf tubes. Saline was aspirated after centrifugation of the samples at 700 rpm for 5 minutes at 4°C. The cell pellet was then resuspended in 1 ml of 2 mM Tris, 50 mM D-Mannitol containing

PMSF at 40 µg/5 ml. Cells were further homogenized using a tissue homogenizer for 15 seconds on ice. The homogenized cell suspension was then centrifuged at

1,000 rpm for 10 minutes at 4°C in order to remove the nuclear membrane. The supernatant was transferred to a 1.5 ml eppendorf tube and protein estimation was carried out using BioRad protein (Lowry’s) assay kit method [153]. 100 µg of total cellular protein was incubated with 500 µL of freshly prepared substrate, 7 mM p-nitrophenyl phosphate (PNP) in 0.1 M sodium bicarbonate, 5 mM magnesium chloride buffer for 20 minutes at 37°C. The reaction was then quenched by adding 1 ml of 0.1 M solution of sodium hydroxide and read by the

UV-spectrophotometer at a wavelength of 410 nm. The absorbance readings obtained were plotted on a 2-D bar graph to compare the activity of alkaline phosphatase in poorly differentiated and fully differentiated Caco-2 cells.

2.10 TLC and Radio-autography of 14C-HPODE

Cell medium and cell lipid extracts were dissolved in 20 µl of chloroform and loaded on Silica Gel G TLC plate (Sigma, St. Louis, MO) with standards.

Chloroform: Tetrahydrofuran: Acetic acid (90:10:0.5) was used as solvent system.

After the separation, the TLC plate was left in the chemical hood for 10 minutes to let solvents to evaporate. Dried TLC plate was covered with saran wrap and exposed to Storage Phosphor screen (Perkin Elmer, MultiSensitive Storage

Screen) for up to 48 hours. Radio-autography was performed by Cyclone Plus

(Perkin Elmer Storage Phosphor System). Each fraction on TLC plate was then collected and counted by scintillation counter (Perkin Elmer, 2450 MicroBeta2 counter)

2.11 Free Fatty Acid Methyl Ester (FAME) Preparation

Free fatty acid methyl ester (FAME) was prepared by boron trifluoride

(BF3)/methanol method. In brief, 0.5 ml of 13% boron trifluoride in methanol was added to dried samples and kept in heat block at 900C for 2 minutes. After the tubes were chilled to room temperature, 2.5 ml hexane and 1 ml water was added, centrifuged at 300 g for 5 minutes. Upper hexane phase was collected and gently dried in nitrogen. FAMEs were reconstituted in 50 µl of hexane and transferred into 5x25 mm vial insert (Perkin Elmer) for GC-MS.

2.12 Gas Chromatograph-Mass Spectrometry Analysis

Samples were added with 100 pmol of sebacic acid as internal control and proceed with FAME preparation. The gas chromatography was run on Perkin

Elmer Clarus 500 using Elite-Wax (L 40m ID 0.18 DF 0.3) column. Separation was performed on Helium as mobile phase with sample injection volume of 2 µl.

GC oven program was initiated at 1200C for 0.50 min and at 5.0 deg/min to

200oC, hold for 13.50 minutes. Perkin Elmer Clarus 560s Mass Spectrometer was used to carry out negative ion electrospray tandem mass spectrometric analysis in multiple reactions monitoring mode. All data were collected by Turbo Mass

(version 5.4.2.1617).

2.13 Cell Culture Studies Using PCR Method

Caco-2 cells (HTB-37) were purchased from American Type Culture

Collection (ATCC) (Rockville, MD). These were cultured in advanced Dulbecco’s modified eagle medium (ADMEM) supplemented with 15% fetal bovine serum

(FBS), 2 mM L-glutamine, 1% penicillin-streptomycin. After attaining confluence, cells were cultured in the same medium supplemented with 7.5% FBS while keeping the other constituents same. Confluent cells were trypsinized using 0.25%

Trypsin-EDTA solution. Caco-2 cells were seeded in 6 and 12 well plates depending on experiment needs. Experiments were carried out on days 3-5 and

14-21 after each passage. In order to ascertain confluence on days 3-5, cells were seeded at a higher density.

HepG-2 cells (HB-8065) were purchased from ATCC (Rockville, MD).

These were cultured in ADMEM supplemented with 10% FBS, 2 mM L-glutamine,

1% penicillin-streptomycin. Confluent cells were trypsinized using 0.25%

Trypsin-EDTA solution. HepG2 cells were seeded in 6 and 12 well plates depending on experiment needs. All cells were maintained in a 5% CO2 atmosphere at 370C, under sterile conditions.

2.14 Incubation of Caco2 with HPODE and its Decomposition Products

In vitro studies showed that HPODE decomposed after several days of incubation at 37 degrees [148]. We anticipated that cells might accelerate the decomposition of fatty acid peroxides. To monitor the changes in gene expressions of APOA1 and PON1, poorly differentiated/ differentiated Caco2 and

HepG2 cells were pre-incubated in serum-free ADMEM for 3 hours. After 3 hours cells were treated with dose dependent concentrations of HPODE and its decomposition products ONA and AzA and incubated at 37ºC. Respective controls were maintained. At the end of 24 hours of incubation, cells were harvested in TrizolTM for RNA isolation and in RIPA lysis buffer for protein isolation. Medium was collected from all the samples for protein/ELISAs and stored at -80ºC.

2.15 RNA Isolation From Cultured Cells

RNA was isolated using TRIzol reagent (Invitrogen). 1 ml of TRIzol reagent was added to each well of a 6-well plate of Caco-2 cells. Cells lysate was transferred to a 1.5 ml eppendorf tube. Incubation for 5 minutes at room temperature was performed to ensure complete homogenization and dissociation of the nucleoprotein complex. 200 µL of chloroform was then added to the tubes.

The tubes were tightened securely followed by vigorous shaking for 15 seconds.

Tubes were allowed to stand for 3 minutes at room temperature followed by centrifugation at 12,000 x g for 15 minutes at 4°C. The aqueous phase was removed carefully and transferred to a new 1.5 ml eppendorf tube, while the lower organic phase was stored at -80°C for isolating proteins. 500 µL of 100% isopropanol was added to the aqueous phase for precipitating RNA. The tubes were incubated at room temperature for 10 minutes. They were then centrifuged at 12,000 x g for 10 minutes at 4°C. The supernatant was aspirated and 1 ml of 75% ethanol was added to the RNA pellet for washing. The sample was vortexed briefly and centrifuged at 7,500 x g for 5 minutes at 4°C. This wash step was carried out three times. RNA was then air dried for 10 minutes and resuspended in 50 µL of RNase free water. RNA concentration was determined using a nanodrop instrument (Thermo Scientific) and was scaled to use exactly 1 µg of

RNA for cDNA synthesis.

2.16 cDNA Synthesis

cDNA synthesis was carried out using SuperScript III First-Strand

Synthesis SuperMix for qRT-PCR kit from Invitrogen (Life Technologies). The reagents were thawed and mixed well prior to making the master mix. The following kit components were combined together in a tube on ice

Component Amount per Reaction 2X RT Reaction Mix 10 µL RT Enzyme Mix 2 µL RNA (1 µg) x µL DEPC-treated water Volume made upto 20 µL Total Volume 20 µL Table 6. cDNA Synthesis Mix Preparation

The RT Enzyme Mix includes SuperScript III RT and RNaseOUT. 2X RT

Reaction Mix includes oligo(dT)20 (2.5 µM), random hexamers (2.5 ng/µL), 10 mM MgCl2, and dNTPs. The contents of the tube were mixed gently and incubated at 25°C for 10 minutes followed by incubation at 50°C for 30 minutes.

Further, the reaction was terminated at 85°C for 5 minutes and the tubes were allowed to be chilled on ice. These cycles were carried out in a thermo cycler

(VWR). 1 µL (2 U) of E.coli RNase H was then added and tubes were further incubated for 20 minutes at 37°C. Finally, samples were stored at -20°C until use. 41

2.17 Real Time-PCR

For setting up Real-Time PCR, SYBR GreenER qPCR SuperMix for iCycler(Invitrogen) was used. The run was carried out on a Bio-Rad iQ5

Multicolor Real-Time PCR Detection System using a 96 well PCR plate (Bio-Rad).

Primers used in this study were represented as shown in Table 7.

Primer Sequence (5' to 3')

Forward: TGGGATCGAGTGAAGGACCT ApoA1 Reverse: CTCCTCCTGCCACTTCTTCTG

Forward:AGACTTTGAAACTTGAAGACACACCA ApoB100 Reverse: GCCCATCTTCTTAGTACCTCACC

Forward:TTTAGCCATCGGCTCAAC ApoB48 Reverse: AACGGGGCCATTACAG

Forward: CTCACTGAGGCGGTCATGTT Alkaline Phosphatase (ALP) Reverse: TAGGCTTTGCTGTCCTGAGC

Forward: CTCACTGAGGCGGTCATGTT PON1 Reverse: TAGGCTTTGCTGTCCTGAGC

Forward: AGTCAACGGATTTGGTCGTA GAPDH Reverse: GGAACATGTAAACCATGTAGTTGAG Table 7. Primer Sequences for Real-Time PCR

The following components were mixed together to create a master mix for each gene that was analyzed (Table 8).

Component Amount per reaction tube

2X SYBR GreenER Supermix 10 µL

1 µL Forward Primer, 10 µM

Reverse Primer, 10 µM 1 µL

DEPC-treated water 7 µL

Total Volume 19 µL Table 8. PCR Components for Master Mix Preparation

19 µL of master mix was loaded in each well of the PCR plate followed by 1 µL of cDNA. The PCR plate was sealed using a microseal optical adhesive film (Bio-Rad) and centrifuged at 1,200 rpm for 10 minutes at 4°C. The PCR plate was then placed in the iCycler instrument and the PCR was programmed for 1 cycle of 50°C for 2 minutes followed by 1 cycle of 95°C for 8 minutes, 30 seconds. Further, 40 cycles each of 95°C for 15 seconds and 60°C for 1 minute was performed. Melt curve analysis was performed at 95°C for 1 minute, 55°C for another minute followed by 80 cycles of 55°C ± 0.5°C/cycle for 10 seconds until the temperature reached 95°C. After the run, Ct values and melt curves were analyzed using iQ5

Optical System Software provided by Bio-Rad. Primers for human targets were used as in table 2-3. The mRNA levels were normalized with respect to corresponding GAPDH gene expression levels.

2.18 Western Blot Measurements

Proteins were isolated using RIPA buffer. This buffer was constituted with protease inhibitor cocktail, PMSF and sodium orthovanadate (Santa Cruz) by adding 10 µl of each per 1 ml of RIPA on ice immediately prior to use. The growth medium from the cells was gently aspirated and cells were washed twice with 1X

PBS to remove minor contaminants. To each well of the 6-well plate, 200 µl of

RIPA buffer was added and the plate was incubated on ice for 10 minutes for lysis to take place. The cells were then gently scraped and the lysate was transferred to a 1.5 ml Eppendorf tube on ice. The samples were then centrifuged at 10,000 rpm for 10 minutes at 4˚C and the supernatant containing proteins was transferred to a new 1.5 ml Eppendorf tube. Protein concentration was determined using Bio-

Rad protein assay.

Western Blot was carried out for detecting ApoA1 and ApoB48. 12% SDS- polyacrylamide gel was prepared freshly. 15 µg of cellular protein samples or 30µl medium samples were mixed in a 1:1 ratio with Laemmli sample buffer (Bio-Rad) constituted with β-mercaptoethanol (Fisher Scientific) and placed in boiling water for 5 minutes. The samples were then allowed to snap cool on ice for 5 minutes, followed by a quick spin down and were loaded along with precision plus protein standard (Bio-Rad). Electrophoresis was carried out in 1X running buffer (10X Tris-Glycine- SDS Running Buffer, pH 8.3, 30.2 g Tris base, 144 g

Glycine and 10 g SDS for 1 L volume) at 100 V for 2 hours at room temperature.

After the run was completed, the proteins were transferred to a PVDF membrane

(Bio-Rad). Transfer was carried out at 100 V for 2 hours at 4°C in transfer buffer

(10X Tris-Glycine-SDS Running Buffer (80 ml), 20% methanol and de-ionized water (720 ml) for a total volume of 1 L). After completion of transfer, membrane was kept for blocking in an orbital shaker at room temperature for 1 hour. 5% non-fat dry milk (Bio-Rad) in Tris Buffer Saline-Tween 20 (TBS-T: 12.11 g Tris, 9 g NaCl, 0.1% Tween-20, pH 7.5 for 1 L volume) was used as blocking reagent.

After blocking, the membrane was rinsed twice with TBS-T followed by washing three times for 10 minutes each. The membrane was incubated with primary antibodies (1:4000, vol/vol in blocking reagent) overnight on a shaker at 4°C.

Next day, the membrane was washed three times with TBS-T for 10 minutes each and incubated with secondary antibody (anti-goat IgG conjugated to HRP,

1:5000, vol/vol in blocking reagent) for 1 hour on a shaker at room temperature.

After 3 washes in TBS-T for 10 minutes each, the signal was detected with a chemiluminescence kit (Bio-Rad Immun-Star Western Kit). The membrane was first exposed to this solution, dried and then exposed to an X-ray film (CL-

XPosure Film, ThermoScientific). The film was developed using an AFP image film processor and finally the protein bands were identified. The membrane was then stripped in mild stripping buffer (1.5% Glycine, 0.1% SDS, 1% Tween-20, pH

2.2) by washing three times for 10 minutes each on a shaker at room temperature.

The membrane was then reprobed with anti-β-actin antibody (1:2000, vol/vol dilution in blocking reagent) for 2 hours shaking at room temperature followed by washing with TBS-T. Secondary antibody was then incubated with the

45 membrane (Goat anti-mouse antibody conjugated to HRP, 1:5000, vol/vol in blocking reagent) for 1 hour on a shaker at room temperature. β-actin was used as a loading control for cellular protein samples.

2.19 ELISA Assays

ApoA1 ELISA

ELISA for human apolipoprotein A1 kit (Mabtech) was purchased from

Mabtech (Cincinnati, OH). 2 µg/ml of mAB HDL 110 in PBS was precoated in high protein binding 96-well ELISA plate overnight at 40C. On the second day, the coated plate was washed twice with 200 µL/ml PBS and then blocked by adding 200 µL/ml of PBS with 0.05% Tween 20 containing 0.1% BSA. The plate was incubated for 1 hour at room temperature and followed by five times washing with PBS containing 0.05% Tween. ApoA1 standards were prepared from 1-80 ng/ml and stored in aliquots at -200C.

100 µL of cell culture medium or standards were added to the plate and incubated at room temperature for 2 hours. After incubation, the plate was washed for five times with PBS containing 0.05% Tween. 100 µl/well of 0.5

µg/ml of mAb HDL was added and incubated for 1 hour at room temperature and followed by five times of washing as described previously. 100 µl/well of

Streptavidin-HRP was (diluted 1:1000) added and incubated 1 hour at room temperature and followed by 5 times of washing. 100 µl/well of SureBlue reserve

3,3',5,5' tetramethylbenzidine (TMB) microwell peroxidase substrate was added and after 30 minutes, 100 µl/well of 1 N HCl was used as stop solution and absorbance was measured read at 450 nm.

ApoB48 ELISA

ELISA for human ApoB48 kit was purchased from Abnova and experiment was performed according to manufacturer’s protocol. Briefly, 50µl of ApoB48 standards or cell culture medium were added to each pre-coated well for 2 hours.

After 2 hours of incubation, plate was washed five times with 200 µl of wash buffer. 50 µl of Biotinylated Human Apo B Antibody was added to each well for 1 hour and followed by 5 times washing. 50 µl of Streptavidin-Peroxidase

Conjugate was added to each well and incubated for 30 minutes followed by washing as previously described. 50 µl of Chromogen Substrate was added per well and incubated for about 8 minutes or till optimal the blue color developed.

Then 50 µl of Stop Solution was added to each well and the absorbance was measured at 450 nm. Correction absorbance was measured at 570 nm to avoid optical imperfections in the plate.

2.20 PON1 Assay

The cell culture medium PON1 aryl esterase activity was measured by following the method of Jaichander et al. [154]. Briefly, 10 µl cell culture medium was incubated with 1 mM para-nitrophenyl acetate (p-NPA) in 100 µl phosphate

47 buffer with 2 mM CaCl2 and MgCl2 at 37°C for 30 minutes. The reaction was set up in 96-well plate and the reaction for sample was set up in triplicates. p-NPA was used as the substrate for PON1 enzyme activity and the resultant product p-

Nitrophenol conversion was measured at 410 nm.

2.21 Statistical analysis

Statistical significance for differences was evaluated using Student’s t-test.

Differences were considered significant at P<0.05.

Chapter 3: Results

3.1 The presence of Lipid Peroxide in Oxidized Linoleic Acid

13-HPODE was prepared from linoleic acid by treatment with soybean lipoxygenase V (SLO) in PBS. Increase in absorbance at 234 nm was used as an indicator of conjugated diene formation (Figure 8A). After 2 hours of incubation at room temperature, the absorbance at 234 nm almost reached saturation and the LMB assay was performed as a measurement for peroxide group formation.

Cumene hydroperoxide was used as a standard. The LMB assay showed 150 µM of HPODE formed from 200 µM linoleic acid after two hours of reaction (Figure

8B & 8C).

3.2 Detection of Peroxide in Heated Cooking Oil

Linoleic acid is abundant in the diet. Sesame oil approximately contains 45% of its total oil composition as linoleic acid while canola oil has about 21%. Olive oil is rich in monounsaturated fatty acids, which are resistant to lipid peroxidation. The linoleic acid content of olive oil is approximately 10%. Butter, on the other hand, is mostly saturated fat that cannot be further oxidized. The linoleic acid content of butter is approximately 2%. We chose sesame and canola oil due to their availability in the laboratory.

Figure 8.Conjugated dienes and peroxide content in HPODE and linoleic acid. (A) After adding SLO to linoleic acid in PBS, the formation of conjugated diene was monitored by wavelength scan from 200-300 nm over time. A peak at 234 nm can be observed. (B) Wavelength scan of formed HPODE and linoleic acid showing the difference between 13-HPODE and linoleic acid, at the end of reaction. (C) LMB assay of HPODE and linoleic acid. This experiment was conducted for 3 times in duplicates, data are mean ± SE, linoleic + SLO vs linoleic in PBS, *P<0.01. This reaction was routinely used to prepare oxidized linoleic acid.

All three types of oil were used as examples of commonly used cooking oil.

We took aliquots of each type of oil, placed them on a heating block at 1000C for up to 8 hours, and measured time-dependent peroxide contents. A significant amount of lipid peroxides were generated from the heating process of canola oil whereas sesame oil is comparable to olive oil and butter, generating not many lipid peroxides with prolonged heating (Figure 9). The lessened formation of peroxides in sesame oil as compared to canola oil, despite higher levels of PUFA in the former, could be due to higher antioxidant content (sesamol, vitamin E, etc.). The results also may indicate that sesame oil-derived peroxides decompose

50 more readily than those of canola oil, resulting in aldehyde and carboxylic acid products.

Figure 9. Peroxide Content in Heated Cooking Oil. After heating for the designated period of time, peroxide content was determined by LMB assay by adding 10µl of cooking oil in acetone (1% v:v) with 100 µl 1%SDS and 100 µl LMB reagent. This experiment was conducted for two times in triplicates, data are mean ± SE as shown in the figure. Each oil: 0 hour vs 4 hour & 8 hour, *P<0.05.

3.3 The Reduction of Lipid Peroxide by Cells

Freshly prepared 13-HPODE was incubated with HepG2 cells, fully differentiated, and poorly differentiated Caco-2 cells. An LMB assay and conjugated diene measurements were performed over time. All cells efficiently remove the peroxide group from HPODE (Figure 10A). The absorbance at 234 nm measuring conjugated diene also decreases with time but at a much slower 51 speed as compared to the LMB assay (Figure 10B). Figure 10C measured the percentage of rentation peroxide and conjugated diene in the presence of absence of cells after 1 hour of incubation. These data suggested the peroxide group was lost faster than the loss of conjugated diene structure. A similar loss of peroxide was also observed in the presence of HPETE (arachidonic acid 5-hydroperoxide)

(Figure 10D), cumene peroxide, and hydrogen peroxide (data not shown).

Figure 10. Lipid peroxides in the presence of cells. (A)HPODE was incubated with poorly differentiated Caco-2 cells, conjugated diene and peroxide retention was measured in cell culture medium over time. (B) Wavelength scan of Caco-2 cell culture medium over time. (C) 1 hour retention comparison of peroxide and conjugated diene of HPODE-treated, poorly differentiated Caco-2, differentiated Caco-2, and HepG2 cell medium. (D) Loss of peroxide of HPETE in the presence of poorly differentiated Caco-2 cells. In the presence of cells vs cell free medium. This experiment was conducted for three times in triplicates, data are mean ± SE as shown in the figure. *P<0.05. 52

A significant aldehyde generation should result in loss of both peroxides and conjugated dienes, while lipid peroxide reduction to hydroxide would only cause the decrease in peroxides. These results showed, in the presence of cells, peroxides were almost completely lost within 1 hour of incubation, while approximately 90% of the conjugated diene remained. These observations suggest that most of the lipid peroxides were reduced to corresponding hydroxides by cells in the medium. Since the peroxide group is necessary for the generation of aldehydes during the decomposition, we speculated that limited quantity of aldehyde might be generated in the presence of cells. We also investigated the factors that may play a role in peroxide reduction, such as amino acids. Various amino acids, antioxidants, as well as serum and culture medium were included in the assay (Figure 11). Thiol group-containing amino acid and peptides, including cysteine, glutathione and N-acetyl cysteine, were very effective in the reduction of peroxides within 1 hour of incubation at 1:1 ratio.

Vitamin C at 100 nmol was able to effectively reduce 20 nmol peroxide within 1- hour incubation at 37oC. 50 µl serum could also completely reduce 20 nmol peroxide within 1 hour at 37oC. Methionine, lysine, glutamine, pyruvate, vitamin

E and BHT also had the capacity to significantly reduce peroxide, as did DMEM.

We also added SLO to linoleic acid in DMEM, but found only HODE but not

HPODE was generated (data not shown). All these experiments indicated that free lipid peroxide was not stable and could be reduced to corresponding hydroxides by a variety of factors.

Figure 11. Assay of factors that may be involved in the lipid peroxide reduction and decomposition. 20 nmol of HPODE was incubated with various amino acids, antioxidants and medium. Y-axis was expressed as the absorbance at 660 nm. This experiment was conducted for two times in triplicates with mean ± SE as shown in the figure. Control (PBS) vs treatments, *P<0.05, **P<0.01.

3.4 Cellular Uptake of Lipid Peroxide

Poorly and fully differentiated Caco-2 as well as HepG2 cells were incubated with 14C-HPODE, 14C-HODE and 14C-linoleic acid at a concentration of

50 µM at 370C for 1 hour (Figure 12). Cell-associated radioactivity was measured and adjusted for cell protein concentration. Linoleic acid, in comparison to

HPODE and HODE, was more efficiently taken up by fully differentiated Caco-2 cells and HepG2 cells. Poorly differentiated Caco-2 cells were less capable of uptake, especially of HPODE and HODE. In intestinal cells, the brush border is essential for fatty acid absorption to take place. Both differentiated Caco-2 cells

54 and HepG2 cells were able to uptake oxidized fatty acids reasonably well but not as well as native linoleic acid.

Figure 12. Cellular uptake of linoleic acid and its oxidized products. Uptake of 14-C labeled linoleic acid, HPODE and HODE by poorly differentiated Caco-2, fully differentiated Caco-2 and HepG2 cells was determined and adjusted by protein concentrations. Counts were measured by collecting cell lysate and adjusting for protein concentrations. This experiment was conducted for three times in triplicates with mean±SE as shown in the figure. Poorly differentiated Caco-2 vs differentiated Caco-2 and HepG2, Linoleic acid vs HPODE and HODE treatments, *P<0.05.

These total counts showed us the intracellular or extracellular presence of

14C-labeled fatty acids. We then proceeded to look at the formation of 14C-HPODE when incubated with cells. 14C-HPODE was treated with differentiated and poorly differentiated Caco-2 cells for up to 19 hours in HBSS. The medium was collected and extracted with ether. Cellular lipids were extracted using chloroform and methanol (following the method of Bligh and Dyer). Half of the cell lipid extracts 55 were subjected to saponification and the other half were kept as is. Thin layer chromatography (TLC) was performed to separate lipid fractions in the solvent system of chloroform, tetrahydrofuran and acetic acid (90:10:0.5v/v/v). This solvent system was specifically developed to separate linoleic acid, HPODE,

HODE, ONA and AzA. Radioactive materials can be used by this TLC method.

Radio-autography data indicated that HPODE was converted to HODE in the medium. The conversion gradually increased with time (Figure 13A & C). HODE was gradually lost in the medium but increased in the cell, indicating HODE was taken up by cells. At 19 hours post-treatment, the HODE fraction still could be identified inside the cell (Figure 13B & D). Similar observations were also made from radioactive counts measured in each TLC fraction (Date not shown).

After saponification, cellular lipids have a denser HODE fraction as shown in the TLC, indicating most intracellular HODE exists in the esterified form

(Figure 14A) and quantification also represented (Figure 14B).

A. Fully differentiated Caco-2 cells medium

B. Fully differentiated Caco-2 cell lipid extracts

continued

Figure 13. TLC radio-autography of the lipid fraction in the medium and cells. Representative graph of radio-autography scan of TLC plate on lipid fraction in extracted differentiated Caco-2 cell medium (A) and cells (B), poorly differentiated Caco-2 cell medium (C) and cells (D). In B and D, B is before saponification and A is after saponification. HODE fractions were marked in red dotted circle. This experiment was conducted for three times and representative graphs were shown. 57

Figure 13 continued

C. Poorly differentiated Caco-2 cells medium

D. Poorly differentiated Caco-2 cell lipid extracts

Figure 14. Most intracellular HODE exists in the esterified form. (A) TLC radio-autography of the intracellular lipid fraction before and after saponification. Samples were presented in duplicates. Letter B was labeled as before saponification and A was after saponification. (B) Quantification of radioactive counts in HODE and TG fractions on TLC plate. Y-axis was expressed as the total counts collected in each TLC fraction. This experiment was conducted in for three times in duplicates with mean±SE as shown in the figure. SP:Saponification, HODE before SP vs HODE after SP, *P<0.05.

3.5 Generation of Aldehydes from Lipid Peroxides

As described previously, a variety of cooking oils were heated for a certain period of time and an LMB assay was performed to measure the peroxide level.

We also did a TBARs assay to measure the presence of malondialdehyde (MDA)

(Figure 15). We found a significant increase in the amount of MDA in canola oil with an 8-hour heating process. MDA is one of the decomposition products of arachidonic acid peroxide and linolenic acid peroxide. This experiment indicated lipid peroxide decomposition products existed in the PUFA-rich cooking oil after a prolonged heating process. 59

Figure 15. Malondialdehyde contents in heated cooking oil. MDA content was determined by a TBAR assay by adding 100 µl of cooking oil in acetone (10 µl of oil to 1ml of acetone) with 0.3 ml 6N HCl and 1ml TBAR reagent. Colorimetric readings were taken at 532 nm. This experiment was conducted for two time in triplicates with mean ± SE as shown in the figure. All oil 0 hour vs 4 hour & 8 hour, *P<0.05.

The identification of ONA was more difficult than MDA. GC-MS was used to compare the fatty acid profiles of HPODE stored at room temperature for two days (old HPODE) in comparison to freshly prepared HPODE. In the gas chromatogram, both ONA and AzA peaks are present in samples of old HPODE but not in fresh ones (Figure 16A & B). Quantification of ONA and AzA in fresh and ‘old’ HPODE and HODE samples was also represented (Figure 16C).

This experiment showed evidence of the natural presence of lipid peroxide derived aldehyde (in this case, ONA) and corresponding oxidation products (AzA) in lipid peroxide samples. In the context of cooking oil, the decomposition of lipid peroxide might happen along with the peroxide generation. It is expected that

ONA and AzA would be present in cooking oil and related food products, which are processed by prolonged heating.

Figure 16. Decomposition products from HPODE. (A) Gas chromatogram of HPODE (B) Gas chromatogram of HODE (C) GC-MS quantification of the quantity of ONA and AzA in fresh and 2 days room temperature HPODE and HODE samples. This experiment was conducted for three times in duplicates with mean ± SD as shown in the figure. ONA and AzA in fresh HPODE vs in 2 days RT and HODE, *P<0.05.

3.6 9-Oxononanoic Acid and AzA Metabolism

As previously shown, cooking oil with a prolonged heating process generates lipid peroxides. Lipid peroxides can be self-decomposed to aldehydes and we have demonstrated ONA as one of the HPODE decomposition products 61 from the carboxylic end. Very little was known about the metabolic fate and physiological effects of ONA. Since ONA is not a commercially available compound, I synthesized and characterized ONA in our laboratory, both in cold and in radioactive forms, for this study. The scheme of chemistry reactions relating to ONA synthesis is presented in Figure 10. Oleic acid was oxidized by potassium permanganate to erythro-9,10-dihydroxysteric acid, which is then further oxidized by sodium periodate to generate ONA (Figure 17).

Figure 17. 9-Oxononanoic Acid Synthesis Reactions

TLC and GC-MS were used to check the quality of synthesis. TLC indicated the ONA could be stained by 2,4-Dinitrophenylhydrazine (DNP) reagent that is specifically for the aldehyde group and the ONA fraction travels between HPODE and AzA on the TLC plate (Figure 18A) in the solvent system of chloroform, tetrahydrofuran and acetic acid (90:10:0.5). In gas chromatography,

ONA has a retention time at 15.94 minutes (Figure 18B) with signature mass peaks in MS at 74, 87, 111, 143 and 155, which is over a 90% match with the existing MS library for ONA (Figure 18C). Lab-synthesized ONA was stored in chloroform at -200C. Before each usage for cell treatment, ONA in chloroform was dried under nitrogen and reconstituted in ethanol.

Figure 18. Characteristics of 9-Oxononanoic Acid. (A) TLC of ONA in the solvent system of chloroform, tetrahydrofuran and acetic acid (90:10:0.5). ONA was marked in red dotted circle. (B) Gas chromatogram of the synthesized ONA. (C) The mass spectrum of ONA.

In this study, synthesized ONA was incubated with differentiated Caco-2 cells. At a designated time, the medium and cells were collected and the lipid components were extracted. The entire cellular lipid was analyzed after saponification to release free fatty acids. Lipids from the cell medium were extracted and processed without saponification. In a gas chromatogram, a decrease of ONA in the medium with time was observed with a corresponding increase of AzA (Figure 19A1-A4). After 18 hours of incubation, AzA, which has a retention time of 17.42 min, became the major peak in the field (Figure 19A4). A slight increase was observed in intracellular AzA content over time. GC-MS quantification of ONA (Figure 19B) and AzA (Figure 19C) was also represented.

Radioactive 14C-ONA was also prepared and purified by TLC. In the presence of differentiated Caco-2 cells, within 1 hour of treatment a significant increase was observed in the AzA fraction with a corresponding decrease in the ONA fraction compared to a 1-hour, cell-free control and time zero control (Figure 19D). These experiments demonstrated that differentiated Caco-2 cells oxidized ONA to AzA very efficiently in the medium.

continued

Figure 19. GC-MS analysis of ONA-treated medium and cells. (A) Representative image of gas chromatogram of lipid extract of ONA-treated Caco-2 cell medium. (C) GC-MS quantification of ONA concentration in ONA-treated Caco-2 cell medium over time. All experiments were duplicated in three independent experiments. (D) Representative TLC radioautography of 14C- ONA treated with differentiated Caco-2 cells for 37oC for 1 hour with medium extracted, in comparison with cell-free control and time 0 hour control. Cell free control vs cell medium, *P<0.05.

Figure 19 continued

AzA was used at a concentration of 50 µM to treat differentiated Caco-2 cells. Similar GS-MS analysis was performed on cell medium and cell lipid extract

(Figure 20A). We observed an increase of intracellular AzA, which remained relatively constant from 3 hours to 18 hours post-treatment (Figure 20B). This result suggested the intracellular AzA concentration was tightly controlled and the turnover of intracellular AzA was relatively slow. AzA stayed stable as the free

66 fatty acid in the medium until 18 hours post-treatment, suggesting AzA was not well absorbed by differentiated Caco-2 cells (Figure 20C).

Figure 19. AzA remained in Differentiated Caco-2 Cell Culture Medium. （ A1&A2 ） Representative image of gas chromatogram of lipid extract of AzA treated Caco-2 cells and medium. (B) GC-MS quantification of intracellular AzA after saponification. (C) GC-MS quantification of AzA in differentiated Caco-2 cell culture medium. All measurements were duplicated in three independent experiments. 0-hour vs 1h, 3h&18hours, *P<0.05, ns-not significant.

TLC radioautography scan (Figure 21A) was also performed on cell lipid extracts of differentiated Caco-2 cells treated with 14C-ONA. A significant increase in radioactive counts in the ONA fraction after saponification was observed, suggesting ONA can be esterified in the cells (Figure 21B).

Figure 20. Intracellular ONA and AzA before and after saponifcation. (A) TLC radio-autography of 14C-ONA-treated differentiated Caco-2 cell lipid extracts before and after saponification. ONA fraction was marked in red dotted circle. (B) Radioactive counts of each fraction on TLC before and after saponification. All measurements were run in triplicates in two independent experiments. After saponification vs before saponification, *P<0.05, **P<0.01.

3.7 Summary I

We first demonstrated the nutritional relevance of HPODE, ONA and AzA by documenting the presence of lipid peroxides in cooking oil and as the products of linoleic acid peroxidation. Aldehydes and corresponding carboxylic acids have also been identified in auto-decomposition of lipid peroxides. The metabolic fate of HPODE in the presence of intestinal and hepatic cells was then investigated.

HPODE was reduced by cells to HODE efficiently in the medium, which then entered the cells and was esterified. The net absorption of HPODE and HODE by intestinal and liver cells was less than that of unoxidized linoleic acid. In the intestinal cells, the presence of a brush border was necessary for the absorption to take place. The metabolic fate of ONA and AzA, generated from the decomposition of HPODE, was then investigated. We demonstrated that ONA could be efficiently oxidized to free AzA in the cell medium. AzA, on the other hand, stayed stable in the cell medium for up to 18 hours, suggesting its poor cellular absorption. Intracellular ONA and AzA are kept at very low levels, and most likely in the esterified form (Figure 22).

Figure 21. Scheme of the metabolic fates of HPODE, ONA and AzA.

3.8 ApoA1 Expression in the Presence of Lipid Peroxide (13-HPODE) and

its Decomposition Products (ONA & AzA)

We treated poorly and fully differentiated Caco-2 as well as HepG2 cells with an increasing concentration of HPODE for 24 hours and found minimal regulation of ApoA1 expression at the gene level in all three cell types. A trend of decreasing ApoA1 gene expression with increasing concentration of HPODE in poorly differentiated Caco-2 cells (Figure 23A) and an increasing trend in fully differentiated Caco-2 cells in response to increasing concentration of HPODE was observed (Figure 23B). No change in gene expression of ApoA1 with HPODE treatment was observed in HepG2 cells (Figure 23C).

Figure 22. Normalized gene expression of ApoA1 with increasing concentrations of HPODE treatment for 24 hours of (A) poorly differentiated Caco-2 cells (B) fully differentiated Caco-2 cells and (C) HepG2 cells. This experiment was conducted in duplicates and repeated 3 times with mean ± SE as shown in the figure. Control vs treatments, *P<0.05.

Increasing concentrations of ONA were used to treat all three cell types for

24 hours and ApoA1 gene expression was measured (Figure 24). No significant change of ApoA1 gene expression was observed in ONA-treated poorly differentiated Caco-2, fully differentiated Caco-2 and HepG2 cells (Figure24A-C).

Figure 23. Normalized gene expression of ApoA1 with increasing concentrations of ONA for 24 hours of (A) poorly differentiated Caco-2 cells (B) fully differentiated Caco-2 cells and (C) HepG2 cells. This experiment was conducted in duplicates and repeated 3 times with mean ± SE as shown in the figure. No significant difference between control and treatments was noticed.

In AzA-treated poorly differentiated Caco-2, fully differentiated Caco-2 and HepG2 cells (Figure 25A-C), only a slight increase in ApoA1 gene expression was observed at 100 µM AzA concentration in differentiated Caco-2 cells (Figure

25 B). It appears that at the gene expression level, ApoA1 is not affected by the

HPODE, ONA and AzA treatments in Caco-2 and HepG2 cells. Time course experiments were also performed at 2, 4, 6 hours of treatments. No significant change in ApoA1 gene expression was observed (data not shown). Further study

72 using cycloheximide or other transcription and translation inhibitors may needed to further explore HPODE, ONA and Aza effects at mRNA level.

Figure 24. Normalized gene expression of ApoA1 with increasing concentrations of AzA for 24 hours for (A) poorly differentiated Caco-2 cells (B) fully differentiated Caco-2 cells and (C) HepG2 cells. This experiment was conducted in duplicates and repeated 3 times with mean ± SE as shown in the figure. No significant difference between control and treatments was noticed.

We then conducted an ELISA assay for the ApoA1 protein in the cell medium after 24 hours of treatment. In poorly differentiated Caco-2 cells (Figure

26A), significantly (P<0.05) higher expression of ApoA1 was found in HPODE- treated medium, while a similar increase was also observed in fully differentiated

Caco-2 cells (Figure 26B). However, a significant decrease (P<0.001) in ApoA1

73 was obtained in the HepG2 cell medium (Figure 26C), which is contradictory to the findings with Caco-2 cells, suggesting ApoA1 expression in Caco-2 cells and

HepG2 cells are regulated differently.

Figure 25. ApoA1 ELISA assay of HPODE-treated cell medium after 24-hour incubation. (A) Poorly differentiated Caco-2 cells (B) fully differentiated Caco-2 cells and (C) HepG2 cells. This experiment was conducted in triplicates and repeated 3 times with mean ± SE as shown in the figure. Control vs treatments, *P<0.05, **P<0.01.

Similar observations of ApoA1 secretion were found with ONA-treated cell medium using ELISA (Figure 27). There is a trend of increasing ApoA1 with increasing concentrations of ONA in both poorly differentiated Caco-2 and fully

74 differentiated Caco-2 cell media (Figure 27A&B). HepG2 cells did not show any change in ApoA1 secretion after 24-hours of ONA treatment (Figure 27C).

Figure 26. ApoA1 ELISA assay of ONA-treated cell medium after 24-hour incubation. (A) Poorly differentiated Caco-2 cells (B) fully differentiated Caco-2 cells and (C) HepG2 cells. This experiment was conducted in triplicates and repeated 3 times with mean ± SE as shown in the figure. Control vs treatments, *P<0.05.

In AzA-treated cell medium (Figure 28A-C), a significant (P<0.05) dose- dependent increase was observed in both poorly differentiated and fully

75 differentiated Caco-2 cells. HepG2 cells were not responsive in ApoA1 secretion to AzA treatment.

Figure 27. ApoA1 ELISA assay of AzA-treated cell medium after 24-hour incubation. (A) Poorly differentiated Caco-2 cells (B) fully differentiated Caco-2 cells and (C) HepG2 cells. This experiment was conducted in triplicates and repeated 3 times with mean ± SE as shown in the figure. Control vs treatments, *P<0.05.

Western blots of the cell culture medium of differentiated Caco-2 cells were also performed and similar inductions of ApoA1 secretion were found after

24-hour HPODE, ONA and AzA treatments (Figure 29A-D). 76

Figure 29. Western blot protein quantification of ApoA1 from differentiated Caco-2 cell medium normalized against control. (A) HPODE treatments for 24 hours (B)AzA treatments for 24 hours (C) ONA treatment for 24 hours (D) Comparison of ApoA1 expression in 100µM HPODE, ONA and AzA treated differentiated Caco-2 cell medium. This experiment was repeated 3 times. Control vs treatments, *P<0.05, **P<0.01.

Western blot of differentiated Caco-2 cell lysate was also performed and no significant inductions of intracellular ApoA1 of HPODE, AzA and ONA treatments were observed (Figure 30A&B).

A B

Figure 28. Western blot protein quantification of ApoA1 from differentiated Caco-2 cell lysates normalized against expression of β-Actin and control. (A) HPODE treatment (B) ONA and AzA treatments at 50 µM and 100 µM. This experiment was repeated 3 times. No significant difference between control and treatments was noticed.

In summary, we used ELISA and Western blot to measure ApoA1 in cell medium after HPODE, ONA and AzA treatment after 24 hours and found significant secretion in Caco-2 cells but not in HepG2 cells. However, gene expression and intracellular ApoA1, as measured by western blot, did not show much difference after HPODE, ONA and AzA treatments, in contrast to secreted

ApoA1 protein in the medium.

There are several reasons for the differences between mRNA expression and protein determinations. First, ApoA1 is a secreted protein and its levels do not need to correlate with gene expression. For example, in a closed cell culture system, the protein levels may represent the release of stored and cumulative 78 levels. As intestinal absorption is a rapid process that is fully completed in a couple of hours, it is possible that mRNA levels were increased at an earlier time point and could have reached control levels by the time measurements were made.

3.9 PON1 Expression in the Presence of Lipid Peroxide and

its Decomposition Products

We measured the gene expression of PON1 in HPODE-treated poorly differentiated Caco-2, fully differentiated Caco-2 and HepG2 cells. With increasing concentrations of HPODE for 24 hours, a trend of increasing PON1 gene expression was observed in HPODE-treated poorly and fully differentiated

Caco-2 cells (Figure 31A&B). In HepG2 cells, a significant decrease in PON1 gene expression was observed at high concentrations (≥ 50 µM) of HPODE treatments

(Figure 31C).

Figure 29. Normalized gene expression of PON1 for HPODE increasing dose treatment for 24 hours of (A) poorly differentiated Caco-2 cells (B) fully differentiated Caco-2 cells and (C) HepG2 cells. This experiment was conducted in duplicates and repeated 3 times with mean ± SE as shown in the figure. Control vs treatments, *P<0.05.

Increasing concentrations of ONA were also used to treat all three cell types for 24 hours and PON1 gene expression was measured (Figure 32A-C). A slight decrease was observed in ONA-treated poorly and fully differentiated Caco-

2 cells. No significant changes in PON1 gene expression were observed in ONA- treated HepG2 cells.

Figure 30. Normalized gene expression of PON1 for ONA increasing dose treatment for 24 hours of (A) poorly differentiated Caco-2 cells (B) fully differentiated Caco-2 cells and (C) HepG2 cells. This experiment was conducted in duplicates and repeated 3 times with mean ± SE as shown in the figure. Control vs treatments, *P<0.05.

In AzA-treated cells, only a slight increase in PON1 gene expression was observed in poorly and fully differentiated Caco-2 cells (Figure 33A-C). No significant change in PON1 gene expression was observed in AzA-treated HepG2 cells.

Figure 31. Normalized gene expression for PON1 of AzA increasing dose treatment for 24 hours of (A) poorly differentiated Caco-2 cells (B) fully differentiated Caco-2 cells and (C) HepG2 cells. This experiment was conducted in duplicates and repeated 3 times with mean ± SE as shown in the figure. No significant difference between control and treatments was noticed.

A PON1 activity assay was performed with the medium of HPODE, ONA and AzA-treated fully differentiated Caco-2 cells (Figure 34A-C), poorly differentiated Caco-2 cells (Figure 35A-C) and HepG2 cells (Figure 36A-C). We found a significant (P<0.05) decrease in PON1 activity with increasing concentration of HPODE treatment in differentiated Caco-2 cells. PON1 activity data were less consistent with ONA-treated cell medium, whereas AzA treatment significantly (P<0.05) increased PON1 activity in the differentiated Caco-2 cell medium (Figure 34C). No significant PON1 activity changes after treatments 82 occurred in poorly differentiated Caco-2 cell medium, which may be due to total low enzyme activity in the medium (Figure 35). Decreased PON1 activity was observed in HepG2 cell medium after HPODE and ONA treatment, whereas no change was observed in AzA treatment (Figure 36 A, B&C).

Figure 32. PON1 activity assay in the medium of differentiated Caco-2 cells of HPODE, ONA and AzA treatment for 24 hours of (A) HPODE-treated cell medium (B) ONA-treated cell medium (C) AzA-treated cell medium. This experiment was conducted in triplicates and repeated 3 times with mean ± SE as shown in the figure. Control vs treatments, *P<0.05.

HPODE did not inhibit PON1 gene expression in all three cell types but significantly suppressed PON1 activity, suggesting HPODE may have inhibitory

83 effect on PON1 enzymatic activity. Reduced PON1 activity is associated with HDL dysfunction and the presence of HPODE may contribute to the loss of functionality of HDL. ONA treatments were inconsistent among cell types. In differentiated Caco-2 cells, a trend of increased PON1 activity was observed while

HepG2 showed a trend of decreasing activity. AzA significantly enhanced the

PON1 activity in differentiated Caco-2 medium but not in poorly differentiated

Caco-2 and HepG2 cell medium.

Figure 33. PON1 activity assay in the medium of poorly differentiated Caco-2 cells of HPODE, ONA and AzA treatment for 24 hours of (A) HPODE-treated cell medium (B) ONA-treated cell medium (C) AzA-treated cell medium. This experiment was conducted in triplicates and repeated 3 times with mean ± SE as shown in the figure. Control vs treatments, *P<0.05.

Figure 34. PON1 activity assay in the medium of HepG 2 cells of HPODE, ONA and AzA treatment for 24 hours of (A) HPODE-treated cell medium (B) ONA-treated cell medium (C) AzA-treated cell medium. This experiment was conducted in triplicates and repeated 3 times with mean ± SE as shown in the figure. Control vs treatments, *P<0.05.

3.10 ApoB48 Expression in the Presence of Lipid Peroxide and

its Decomposition Products

We then conducted an ELISA assay of ApoB protein, using an antibody which binds to both ApoB48 and ApoB100, which are secreted by the intestine and liver, respectively. Poorly differentiated Caco-2 cells secreted very little ApoB into the medium, resulting in blank readings in all poorly differentiated Caco-2 medium samples (Figure 37A, 38A & 39A). In fully differentiated Caco-2 cells and HepG2 cells, HPODE at 100 µM concentration inhibits ApoB secretion in cell

85 medium after 24 hours of treatment (Figure 37B & C). In fully differentiated

Caco-2 cells, a concentration-dependent decrease was observed in ApoB secretion, which is not found in HepG2 cells at the corresponding concentration, suggesting that Caco-2 cells are more sensitive to externally added HPODE in ApoB secretion.

Figure 35. ApoB ELISA assay of HPODE-treated cell medium after 24-hour incubation. (A) Poorly differentiated Caco-2 cells (B) fully differentiated Caco-2 cells and (C) HepG2 cells. This experiment was conducted in triplicates and repeated 3 times with mean ± SE as shown in the figure. Control vs treatments, *P<0.05.

A similar measurement was made for ONA-treated cell medium (Figure

38). At 100 µM of ONA, a significant decrease (P<0.05) in ApoB secretion was found in fully differentiated Caco-2 cells (Figure 38B). There was no change in

ApoB secretion in HepG2 cell medium with ONA treatment (Figure 38C).

Figure 36. ApoB ELISA assay of ONA-treated cell medium after 24-hour incubation. (A) Poorly differentiated Caco-2 cells (B) fully differentiated Caco-2 cells and (C) HepG2 cells. This experiment was conducted in triplicates and repeated 3 times with mean ± SE as shown in the figure. Control vs treatments, *P<0.05.

In AzA-treated cell medium, we found a significant decrease in ApoB secretion in fully differentiated Caco-2 cells at concentrations of both 50 µM and

100 µM (Figure 39B). No significant change in ApoB secretion was observed in

HepG2 cells with AzA treatment (Figure 39C).

Figure 39. ApoB ELISA assay of AzA-treated cell medium after 24 hour incubation. (A) Poorly differentiated Caco-2 cells (B) fully differentiated Caco-2 cells and (C) HepG2 cells. This experiment was conducted in triplicates and repeated 3 times with mean ± SE as shown in the figure. Control vs treatments, *P<0.05.

Western blot was performed to confirm the findings from ELISA. ApoB antibody can bind to the N-terminal of the ApoB protein, which is the sequence

88 shared by both ApoB100 and ApoB48. The test consistently showed that in fully differentiated Caco-2 cells ONA and AzA at 100 µM concentration suppressed

ApoB secretion. However, HPODE-treated differentiated Caco-2 cell medium did not show a reduction in ApoB secretion (Figure 40A). HPODE at 100 µM concentration suppressed ApoB secretion in HepG2 cells (Figure 40B).

Figure 37. ApoB western blot of fully differentiated Caco-2 (A) and HepG2 (B) medium, normalized against control. Control vs treatments, This experiment was repeated 3 times. *P<0.05.

We did not observe significant changes in HepG-2 ApoB100 gene expression after HPODE, ONA and AzA treatments (Figure 41A-C).

Figure 38. ApoB100 gene expression of HepG2 cells. (A) HPODE treatment; (B) ONA treatment; (C) AzA treatment. This experiment was conducted in triplicates and repeated 3 times with mean ± SE as shown in the figure. Control vs treatments, *P<0.05. No significant difference between control and treatments was noticed.

It has been suggested that, unlike intestine tissue, Caco-2 cells secrete both

ApoB100 and ApoB48 [155]. Therefore, both ApoB100 and ApoB48 gene expression were measured, however, we did not see the inhibition at the gene level in contrast to our findings in protein secretion inhibition in Caco-2 cells

(Figures 42 & 43 A-C).

Figure 39. Gene expression of ApoB100 and ApoB48 of differentiated Caco-2 cells. (A) HPODE treatment; (B) ONA treatment; (C) AzA treatment. Left dark shade is ApoB100 gene expression and right side light shade is ApoB48 gene expression. This experiment was conducted in triplicates and repeated 3 times with mean ± SE as shown in the figure. Control vs treatments, *P<0.05. No significant difference between control and treatments was noticed.

Figure 40. Gene expression of ApoB100 and ApoB48 of poorly differentiated Caco-2 cells. (A)HPODE treatment; (B) ONA treatment; (C) AzA treatment. Left dark shade is ApoB100 gene expression and right side light shade is ApoB48 gene expression. This experiment was conducted in triplicates and repeated 3 times with mean ± SE as shown in the figure. Control vs treatments, *P<0.05. No significant difference between control and treatments was noticed.

Basal gene expression and secretion of ApoA1, PON1 and ApoB by fully differentiated, poorly differentiated Caco-2 cells and HepG2 cells was determined by RT-PCR (Figure 44A & B) and ELISA (Figure 45A-C) respectively. Even though that no evidence shows that HepG2 cells express ApoB48, ApoB48 primer, that also binds to the ApoB100 sequence, was used to determine relative

92 expression compared to poorly and fully differentiated Caco-2 cells. HepG2 secreted the highest level of both ApoA1 and ApoB in all three cell types and poorly differentiated Caco-2 cells secreted the least. With the differentiation process, Caco-2 cells increase the amount of ApoA1 and ApoB lipoprotein secretion as well as PON1 production.

Figure 41. Gene Expressions of ApoA1, ApoB and PON1 expression among cell types. (A) Comparisons among poorly differentiated Caco-2, differentiated Caco-2 and HepG2 cells. (B) Enlarged figure to compare between poorly differentiated and fully differentiated Caco-2 cells. Poorly differentiated Caco2 vs differentiated Caco2 and HepG2 cells, This experiment was conducted in triplicates and repeated 3 times with mean ± SE as shown in the figure. *P<0.05, **P<0.01,***P<0.001.

Figure 42. ApoA1 and ApoB are secreted at different levels in Caco-2 cells and HepG2 cells. (A) ApoA1 ELISA of poorly differentiated, differentiated Caco-2 and HepG2 cells. Values were expressed in percentage of expression as compared to poorly differentiated Caco-2 cells in the medium. (B) ApoA1 ELISA of poorly differentiated and fully differentiated Caco-2 cells. (C) ApoB ELISA of poorly differentiated, differentiated Caco-2 cells and HepG2 cells. This experiment was conducted in triplicates and repeated 3 times with mean ± SE as shown in the figure. Poorly differentiated Caco2 vs differentiated Caco2 and HepG2 cells, *P<0.05, **P<0.01.

3.11 Summary II

ApoA1 is the main protein component of HDL and PON1 is an HDL- associated enzyme correlated with the functionality of HDL. ApoB48 is the major lipoprotein in chylomicrons secreted by the intestine and ApoB100 is secreted by the liver in VLDL and subsequently forms LDL in the circulation. In the current

94 study, we largely focus on these three proteins and investigate if their productions could be regulated by HPODE, ONA or AzA treatments in poorly differentiated, fully differentiated Caco-2 and HepG2 cells. In the gene expression studies, we only observed marginal modulations of ApoA1, PON1 and

ApoB upon treatment. Intracellular ApoA1 levels measured by western blot also did not show significant differences between treatments in differentiated Caco-2 cells. Cell culture medium was used for ApoA1 and ApoB ELISA and western blot, while a PON1 activity assay was also conducted. As summarized in Figure 46, we observed increased secretion of ApoA1 upon HPODE, ONA and AzA treatments in the cell medium. HepG2 ApoA1 secretion was decreased by HPODE treatments.

HPODE also decreased PON1 activity in differentiated Caco-2 and HepG2 cells.

ONA decreased PON1 activity in HepG2 cell medium and AzA increased PON1 activity in differentiated Caco-2 cell medium. We observed a dosage-dependent decrease in ApoB secretion upon HPODE, ONA and AzA treatments in differentiated Caco-2 cell medium. We only observed a similar decrease of ApoB in the HepG-2 medium at a concentration of 100 µM HPODE. Poorly differentiated Caco-2 cells did not secrete significant amounts of ApoB into the medium.

Apo ApoA1 PON1 B48/100 Poorly differentiated Caco-2 HPODE N/A ONA N/A AzA N/A Fully differentiated Caco-2 HPODE ONA AzA HepG2 HPODE 100µM Conc. ONA AzA Figure 43. Summary of the protein secretion by HPODE, ONA and AzA treatment for Caco-2 and HepG2 cells. Green boxes indicate an increase, red boxes represent a decrease, and grey represents no significant change.

Chapter 4: Discussion

4.1 Current Dietary Recommendations Relating to PUFA

Considerable epidemiological evidence has shown that there is a relationship between a high fat diet and the incidence of CVD [156-158]. While the distinction has not been made between high fat diets containing saturated fat and high fat diet containing PUFA, PUFAs are often referred by health professionals and nutritionists as “good” fat. The 2010 Dietary Guidelines for

Americans from the USDA [159] recommends Americans “consume less than 10 percent of calories from saturated fatty acids by replacing them with monounsaturated and polyunsaturated fatty acids” and to “use oils to replace solid fats where possible.” The Harvard School of Public Health created the

“Healthy eating plate” [160] and recommended Americans “choose foods with healthy fats, limit foods high in saturated fat, and avoid foods with trans fat.” The school defined the “good” fats as monounsaturated and polyunsaturated fats, including oils such as olive, canola, sunflower, soy and corn, and “bad” fats as saturated and trans fat. The American Heart Association also recommends reducing saturated fat intake to less than 5-6% of total calories and increasing n-3 fatty acid consumption [161].

4.2 Concerns Regarding Dietary PUFA Intake

In the mid-1980s, Mattson and Grundy [162] compared the effects of dietary SFA,

MUFA and PUFA on plasma lipids and lipoprotein in man and found both MUFA and PUFA were able to reduce plasma LDL cholesterol levels while PUFA reduced HDL-C along with LDL-C. In the early 1990s, Berry et al. [163] organized the Jerusalem Nutrition Study to compare the effects of high MUFA vs. high

PUFA diets on plasma lipoprotein. After 24 weeks in a crossover study, Berry’s group found a high PUFA diet resulted in slightly lower plasma total cholesterol and LDL-C while a high MUFA diet decreased the susceptibility of LDL to oxidation. A high PUFA diet significantly increased the levels of plasma lipid peroxidation. Later, Reaven and Parthasarathy et al. [164] conducted a more specific study and showed dietary fatty acid composition could effectively alter the fatty acid distribution in lipoproteins. They also demonstrated that plasma

LDL isolated from subjects fed a high linoleic acid diet compared to a high oleic acid diet, was more susceptible to oxidation. In this context, it seems that MUFAs are preferable to PUFAs when it comes to protecting LDL from oxidation [164].

However, despite MUFAs improving oxidation-related surrogate markers of CVD risk, PUFAs fell into favor by animal studies, epidemiologic studies, and clinical trials which directly measured the risks and extent of CVDs. The Nurses

Health Study [165] correlated low dietary PUFA intake (2.9% of total energy) with increased myocardial infarction risk (n=80,082 women). A similar observation was made in the Western Electric study [166] (n=1900 men). The

Greenland Eskimos study [167] in the late 1970s found n-3 PUFA from fish has preventive effects on CVDs, which gave rise to the popular health industry of fish oil. Numerous studies have shown beneficial effects of PUFAs, particularly n-3

PUFAs, on cardiovascular disease prevention [168-174].

PUFAs contain multiple double bonds which make them highly susceptible to oxidation. Prolonged storage, exposure to air, heating, and deep frying of oils have long been recognized to impart rancidity and induce peroxide formation of edible oils. Oxidative stress is widely believed to be involved in the pathology of

CVD. Almost all risk factors involved in the pathology of cardiovascular diseases, such as diabetes, hypertension, lack of physical activity, obesity and hypercholesterolemia, have been suggested to involve some form of oxidative stress.

Many studies have warned of the probable metabolic consequences of consuming large quantities of peroxidized fat over prolonged periods of time. It has been noted that pure forms of fatty acid peroxides increase the atherogenic actions of a cholesterol-containing diet in a mouse model of atherosclerosis [20].

However, peroxidized fatty acids also serve as better PPAR alpha ligands than unoxidized fatty acids [138], which may mediate anti-atherogenic effects such as the increased expression of apoprotein A1, a component of HDL, the lipoprotein generally believed to a beneficial [21]. In addition, it has also been reported that feeding fatty acid peroxides reduced TG levels in certain mouse strains [22].

During the prolonged heating process and exposure to air, not only are lipid peroxides generated from PUFA, but also decomposition products, such as a variety of aldehydes and carboxylic acids. We recently reported that AzA, a dicarboxylic acid product derived from the decomposition of lipid peroxides, decreased atherosclerosis in LDL-R-/- mice without altering plasma lipids [147].

On the basis of our results, we pose the question of whether dietary oxidized fatty acids are friends or foes, either individually or via their metabolic products.

Further, we question whether oxidized fatty acids may create additional, externally-derived oxidative stress and exacerbate the atherogenic process. On the other hand, we would like to point out the seemingly paradoxical idea that dietary oxidized lipids or their decomposition products act as PPARα agonists, yet appear to enhance the production of ApoA1/PON1 (the major components of

HDL) by intestinal cells. If this is the case, is the synthesized HDL beneficial, and how is the synthesis affected in the liver? Further, what are the effects of this synthesis on inflammation and the progression of atherosclerosis?

In this study, we aim to shed light on these questions by closely examining the lipid oxidation products, in particular 13-HPODE, which is a known peroxidation product of linoleic acid, the most abundant PUFA in nature. The lipid peroxide decomposition products from the omega end (such as 4-HNE and

4-HHE), have been intensively studied, while the products from the carboxylic end are poorly known. In this study, we focus on a decomposition product from

100 the carboxylic end, namely 9-oxononanoic acid and its further oxidation product

AzA.

4.3 The Presence of HPODE and HODE

First, we demonstrated the generation and presence of 13-HPODE in pure linoleic acid and commonly used cooking oils. Higher PUFA content in cooking oil is positively correlated with an increased amount of lipid peroxide after the heating process, while cooking oils which have lower PUFA fractions, such as olive oil and butter, are more resistant to peroxidation with prolonged heating.

Then, poorly differentiated Caco-2, differentiated Caco-2 and HepG2 cells were treated with 13-HPODE. We used both poorly differentiated and fully differentiated Caco-2 cells because the rapid turnover of enterocytes in the intestine means villi are represented by differentiated Caco-2 cells, while poorly differentiated Caco-2 cells imitate the enterocytes located in the crypts. We found a rapid decrease of peroxide content in the cell medium of all three cell types.

Meanwhile, the conjugated dienes in the cell medium were also monitored throughout the treatments and were found to remain relatively stable. This finding suggested that cells could effectively reduce 13-HPODE, which has both a peroxide group and conjugated diene, to 13-HODE, which only has a conjugated diene, in the medium. A slower reduction rate of 13-HPODE was observed by poorly differentiated Caco-2 cells, suggesting a differentiated stage in Caco-2 cells

101 might contribute to the reduction. Different factors which may be involved in the reduction were tested, such as various antioxidants, amino acids, plasma and cell culture medium. Thiol-containing amino acids and peptides, such as cysteine, N- acetyl cysteine, and glutathione, very effectively reduced 13-HPODE, as did vitamin C, BHT, and human serum. Methionine, lysine, pyruvate, vitamin E and

DMEM medium also contribute to such a reduction significantly (P<0.05) within

1 hour of 370C incubation. The effectiveness of the thiol group may be due to the formation of a disulfide bond while reducing HPODE to HODE or the formation of a covalent bond with fatty acid peroxide. In the context of dietary peroxide lipids, which are hydrolyzed by a variety of lipases (mostly by pancreatic lipase) to free fatty acid peroxides in the GI tract, dietary fatty acid peroxides are presented in a mixture in chime, along with amino acids, peptides and antioxidants from the diet. Within 3-4 hours after digestion, it is expected that fatty acid peroxides would be mostly reduced by various dietary components and via contact with intestinal cells. In the context of liver cells, lipoprotein lipase and hepatic lipase are able to release free fatty acids from the ester form in lipoproteins. Serum and hepatic cells are both able to mediate such reduction to generate 13-HODE. Thiol-containing cysteinyl leukotrienes which are secreted in response to inflammation, may also play a role in such reduction. In addition to the traditional G-protein mediated signal transduction and chemotactic effect of leukotrienes, we are proposing a new mechanism of cysteinyl leukotrienes to relieve oxidative stress by chemically reducing the peroxide group.

102

Yuan et al. [175] used mass spectrometry to show that 9-HODE and 13-

HODE were two of the major metabolites of oxidized linoleic acid in rat plasma.

The amount of HODE in LDL is 20-100-fold higher in subjects suffering from atherosclerosis and aging than in normal, healthy controls [176] and HODE has been proposed as a biomarker for early detection of type 2 diabetes [177]. All this evidence supports our conclusion that HODE is the major metabolite of HPODE present in lipoproteins. However, Kanazawa and Ashida [93] showed that

HPODE was released from TG in the stomach and decomposed to aldehydes before reaching the small intestine. We have shown in vitro that under acidic conditions, 13-HPODE breaks down to aldehydes. Significant amounts of aldehydes can be detected by DNP reagent after 8 hours of incubation in vitro.

Food normally stays in the stomach for approximately 2 hours, leading to our expectation that the decomposition pathway of aldehyde generation would not be significant.

4.4 The Absorption of HPODE and HODE

Radioactively labeled 13-HPODE and 13-HODE were used to measure uptake of these compounds by intestinal and hepatic cells. Compared with linoleic acid, 13-HPODE and 13-HODE were less efficiently absorbed by these cell types. Differentiated Caco-2 and HepG2 cells absorbed 13-HPODE better than poorly differentiated Caco-2 cells, suggesting the uptake depends on

103 differentiation stage of intestinal cells. Penumetcha et al. [19] found that 13-

HPODE competed with linoleic acid in its absorption by differentiated Caco-2 cells and such absorption is not saturable, suggesting 13-HPODE intestinal absorption may share the same pathway with unoxidized fatty acids through passive diffusion. Interestingly, Nathalie et al. [97] showed that oleic acid did not compete with HPODE in absorption by smooth muscle cells and such absorption reached saturation at approximately 10% of total HPODE added. Smooth muscle cells take up much less HPODE compared to differentiated Caco-2 cells and

HepG2 cells, suggesting different cells may have different mechanisms and characteristics of HPODE absorption.

Radio-autography of lipid fractions of both the cell lysate and medium were scanned on TLC from 13-HPODE treated-poorly differentiated and fully differentiated Caco-2 cells. We found a clear shift from 13-HPODE to 13-HODE with time in the medium. An increased amount of intracellular 13-HODE was identified in post-saponification samples, suggesting intracellular 13-HODE was incorporated into TG or other esters. In comparison with poorly differentiated

Caco-2 cells, fully differentiated Caco-2 cells mediated the reduction more efficiently. It is believed that the reduction of HPODE to HODE is a detoxification process, as HPODE is more cytotoxic than HODE. Poorly differentiated Caco-2 cells are probably more susceptible to HPODE-induced cytotoxicity, since the reduction to HODE in these cells is less efficient compared to that in differentiated cells. Winger et al. [178] showed that low gastrointestinal

104 glutathione peroxidase levels correlated to selenium deficiency impair the

HPODE absorption by rat intestine. This result was consistent with our finding that only HODE was present in intracellular lipids and poorly differentiated

Caco-2 cells had a suboptimal capacity to mediate HPODE reduction and absorption.

Enterocytes are known to package absorbed hydrophobic lipids into chylomicrons. Studies by Staprans and co-workers [92, 98, 179, 180] suggest that dietary peroxidized lipids can be secreted into chylomicrons and that these chylomicrons are more susceptible to in vitro oxidation [21]. Further, this group fed normolipidaemic subjects oxidized oil and demonstrated that the markers for oxidized lipids in chylomicrons were increased [98, 180]. These investigators also showed the presence of oxidized lipids in VLDL and LDL after the consumption of heated oils, suggesting that peroxidized lipids in the diet might contribute to the atherogenicity of lipoproteins [98]. Naruszewicz et al. [95] showed that oral administration of thermally-oxidized soybean oil increased the conjugated diene content in chylomicrons, and that such chylomicrons increased the accumulation of cholesterol in mouse macrophages. This study also demonstrated that oral administration of heated oil in humans could cause a significant postprandial increase in plasma levels of oxidized lipids.

On the other hand, lipid peroxide and hydroxide are more hydrophilic than native fatty acid because of the added peroxide or hydroxide group, respectively. Our results indicate that lipid hydroxide can be absorbed into the

105 cells and incorporated into TG. When these TG containing lipid hydroxides are packaged into chylomicrons, the extra hydroxyl group may cause alterations to the structure of chylomicrons, which may induce further effects.

4.5 The Presence and Metabolism of Aldehydes and Corresponding

Oxidation Products in Heated Cooking Oil and HPODE

Even though we have demonstrated HODE as the major metabolite of

HPODE in the presence of cells, various other aldehydes are also considered to be important lipid peroxidation products. We measured the MDA content in our cooking oil samples, as described previously. A similar pattern of increased MDA, an important aldehyde generated from lipid peroxidation, as compared to peroxide content was found in high PUFA-containing canola oil after heating. In

HPODE samples that had been kept at room temperature for 2 days, ONA and

AzA levels were significantly increased, as measured by GC-MS. Since ONA is not a commercially available compound, we synthesized ONA and 14C-ONA in our laboratory using methods described previously in chapter 2. We found ONA was oxidized to AzA in the cell medium very efficiently. This may help to explain why

ONA is not as toxic as HPODE and 4-HNE when measured via cytotoxicity assays

[181]. The metabolism of MDA has been investigated by Draper et al. [146], and their results suggested that MDA was rapidly oxidized to acetate and CO2 in vivo rat liver mitochondria. Urinary secretion accounted for approximately 10% of

106 total radioactivity administrated, mostly in the form of N-acetyl-ε-(2-propenal) lysine. We observed similarly rapid oxidation of ONA to AzA in cultured intestinal cells, but the oxidation reaction appeared to be extracellular rather than mediated by the mitochondria. Our 14C-ONA experiment indicated that a small amount of ONA entered the cells, as did AzA. Extracellular ONA was oxidized to AzA in the cell medium efficiently.

It is known that aldehydes generated from lipid peroxidation can be oxidized to corresponding carboxylic acids by enzymes such as the aldehyde dehydrogenase super family and aldehyde oxidase. The aldehyde dehydrogenase super family is widely present in most tissues and cell compartments. The ALDH1 family is well known for the oxidation of retinaldehyde to retinoic acid [182].

ALDH2, also known as alcohol oxidase, is a mitochondrial enzyme largely involved in the metabolism of acetaldehyde. The ALDH3 family includes

ALDH3A1, ALDH3B1, and ALDH3A2, and is specific to medium to long chain aliphatic aldehydes. ALDH3A2 is also known as fatty aldehyde dehydrogenase.

ALDH1 and ALDH2 have a high catalytic efficiency for 4-HNE, another other lipid peroxidation product [183]. ALDH3, however, with a relatively high

Km value for 4-HNE, is resistant to aldehyde-induced enzyme inactivation at high concentration (in the range of mM), and therefore may be involved in the defense mechanism against aldehyde toxicity. Aldehyde oxidase, highly expressed in the liver, is capable of utilizing a wide range of chemical structures and plays an important role in drug detoxification. It is speculated that aldehyde oxidase

107 may be involved in the metabolism of lipid peroxidation products as well [184].

We speculated that the enzyme responsible for ONA oxidation may be plasma membrane-bound so that it will have catalytic properties in the cell medium. For cytosolic ALDHs and aldehyde oxidase, it is required for aldehydes to enter the cells and then be oxidized. However, in our observation of ONA oxidation to AzA, such entrance into the cell is not necessary for the oxidation reaction. Only a small amount of ONA and AzA has been identified intracellularly. ALDH3B1 is the only plasma membrane-bound enzyme that we have identified thus far by literature research, having the capability of oxidizing fatty aldehyde [185].

Intracellular ONA, though kept at a very low level, is presented in esterified form, suggesting that it can be further packaged into chylomicrons and distributed throughout the body. We do not know yet if transported ONA imposes additional oxidative stress in the circulation or if it could be detoxified as the esterified form.

AzA, on the other hand, stayed stable in the differentiated Caco-2 medium for up to 18 hours, while less than 5% of treated AzA was found inside the cells.

Grego et al. [186] found that intravenous (i.v) infusion of AzA resulted in more than a 50% loss in the urine and suggested that AzA was not suitable as an energy substrate in parenteral nutrition. Passi et al. also suggested that AzA serum concentrations and urinary excretion are more achievable by intravenous or intra-arterial infusions than oral administration [187]. However, not all dicarboxylic acids are metabolized in the same manner; sebacic acid (C10) and dodecanedioic acid (C12) were less likely to be eliminated by urine during IV

108 infusion as compared to AzA (C9) [186]. Oral administration of sebacic acid improved glycemic control in human subjects and dodecanedioic acid intake relieved muscle fatigue in diabetes mellitus (DM) patients [188]. Our laboratory previously reported the anti-atherosclerotic property of AzA in LDLR-/- mice feeding studies [147] and my current results may shed light on the mechanism at play. Due to the poor absorption of AzA, the anti-atherosclerotic effects may be restricted to the intestine.

4.6 Regulation of ApoA1 Secretion

The intestine is a very important organ for lipoprotein production.

Mammalian ApoA1 is synthesized principally in the liver and small intestine. It has been shown that the rat intestine secretes 56% of the ApoA1, 59% of the

ApoAV and 16% of the ApoB in the circulation [189], while up to 30% of HDL was of intestinal origin, as identified in humans [190]. It has also been reported that fatty acids stimulate ApoA1 secretion from newborn swine intestinal epithelial cells [191]. Based on our previous studies [21], using Caco-2 cells as an in vitro model system; we compared the effects of peroxidized linoleic acid (13-HPODE), and its decomposition products (ONA and AzA) on ApoA1 secretion and steady- state mRNA expression in intestinal and liver cells. At the level of gene expression, we did not find significant changes in ApoA1 expression in poorly differentiated, differentiated Caco-2 and HepG2 cells after HPODE, ONA and

109

AzA treatments. We also did not observe significant differences in intracellular

ApoA1 with treatments in differentiated Caco-2 cells via western blot. However, in both ELISA and Western blot studies for the cell culture medium, a significant increase in ApoA1 secretion was observed. We speculate that our treatments might induce ApoA1 secretion in an ApoA1 mRNA-independent manner.

4.7 ApoA1 Secretion Modulators

Miles et al. [143] conducted a genome-wide screen for liver ApoA1- secretion modulators and found 40 genes of interest. Farnesyltransferase (FNTA) received most of their attention and they found that decreased FNTA mRNA and protein led to increasing ApoA1 secretion in HepG2 cells. They proposed that

FNTA post-translationally modified the cysteine residue of ApoA1. Facilitated by the hydrophobicity of the farnesyl group, ApoA1 was targeted to the cell membrane for secretion. Based on our observations, it is possible that AzA treatment may involve the post-translational modification of ApoA1 and thereby increase its secretion. FNTA is the gene involved in ApoA1 secretion regulation which has been identified in HepG2 cells; in our studies, we have not found much difference in ApoA1 secretion among treatments in HepG2 cells, suggesting the existence of intestine-specific ApoA1 secretion modulators. Despite the fact that both the intestine and liver are known to express ApoA1, the regulation of its expression may vary in these tissues.

110

4.8 Liver and Intestinal Differences in ApoA1 Regulation

It has been reported that bile acids, via Farnesyl X Receptors (FXR) modulators, decrease ApoA1 secretion and gene expression [141] in the liver. Due to the physicochemical similarity of HPODE to bile acids [142], HPODE in the liver may be activated though the FXR pathway rather than PPARα to reduce

ApoA1 production. The PPARα pathway may play a major role in the induction of

ApoA1 secretion in intestinal cells [21]. Ginsburg et al. [77] reported that HepG2 and Caco-2 ApoA1 proteins are regulated by two separate and distinct sets of promoters. In HepG2 cells, the region of nucleotides from -192 to -41 is essential for ApoA1 expression, while Caco-2 cells require the region between -595 and -

192. ApoA1, ApoCIII and ApoAV are genes closely located within a 15-kb DNA segment in the mammalian genome. Human ApoA1 and ApoCIII are convergently transcribed from opposite DNA strands and the ApoAV gene is upstream of the ApoCIII gene; ApoAV is transcribed in the same direction as

ApoA1. The dietary oxidized linoleic acid mouse feeding study published from our laboratory previously [22] suggested that the observed triglyceride-lowing effects of oxidized lipid might due to the modulation of ApoAV and ApoCIII expression.

Very little is known about intestinal ApoA1 secretion regulation. Shen et al.

[192] did a genome-wide association study and tried to identify genes which could reduce 30% of hepatic ApoB secretion while increasing ApoA1 secretion by

30%. The genome-wide screen did not successfully identify any candidate gene in

HepG-2 cells. However, our present study shows, in differentiated Caco-2 cells,

111 that AzA at 100µM levels could increase ApoA1 secretion by 50% while inhibiting

80% of ApoB secretion. The intestine seems to be regulated differentially from liver in lipoprotein secretion, which may create a novel approach to search for anti-atherosclerotic targets. In this study, we provide a new mechanism to explain the anti-atherosclerotic effects of AzA [147] that were reported from our laboratory previously. The topic of intestinal-specific lipoprotein secretion also warrants more research.

4.9 PON1 Activity as the Marker for HDL Functionality

PON1 is able to modulate HDL function and prevent the accumulation of oxidized lipids from lipoproteins (HDL and LDL) and membranes, as well as reduce the atherogenic and inflammatory response induced by lipid peroxidation products [122, 161, 193, 194]. Previous studies have demonstrated that systemic inflammation and oxidative stress convert HDL to a dysfunctional form which loses anti-inflammatory and anti-atherogenic properties [195, 196]. Paraoxonase proteins were associated with both plasma membranes and cytosol. The presence of PONs in plasma membranes plays a protective role against the oxidative modification of plasma membrane lipids, an antioxidant protection of other extracellular lipids (within circulation, interstitial/intercellular fluid, gastrointestinal luminal content), or other potentially unidentified roles. It is known that lipoproteins and oxidized lipids interact with the cell plasma

112 membrane, and the localization of PONs at the plasma membrane may thus provide an ideal site for the inactivation of such harmful oxidized molecules.

Furthermore, PONs’ presence in the plasma membrane may represent a step in the process of their secretion to the extracellular space, either associated with

HDL or not. Due to the importance of PON1, we checked the PON1 activity as an indicator of the functionality of the induced ApoA1 from intestinal cells. At the mRNA level, HPODE treatment suppressed PON1 gene expression in HepG2 cells.

ONA and AzA did not modulate PON1 gene expression significantly in all three cell types. However, surprisingly, we observed a significant increase in PON1 activity in AzA treated differentiated Caco-2 medium, while HPODE suppressed

PON1 activity in both differentiated Caco-2 and HepG2 cells. The extent of PON1 activity inhibition (>50%) was larger than gene expression (<20%). We speculated that lipid peroxide may inactive PON1 enzyme activity and suppress

PON1 gene expression. Several signaling pathways are involved in PON1 regulation. As mentioned earlier, statins and quercetin modulates PON1 translocation through SREBP2 and SP1 binding to the PON1 promoter. Aspirin and resveratrol promotes PON1 via the aryl hydrocarbon receptor while berberine induces PON1 through the JNK-c-JUN pathway; pomegranate juice works via the PPARγ-PKA-cAMP signaling cascade [121]. Our next goal is to elucidate the signaling pathways responsible for the PON1 gene expression modulation. Our current finding helps to explain the paradoxical question we posed previously, namely if HPODE induced ApoA1, why did it not have anti-

113 atherosclerotic effects? The HPODE-induced HDL may not be fully functional.

Our results also bring AzA in focus, which induces intestinal secretion of ApoA1 and PON1 simultaneously, suggesting the induced HDL by AzA is functional.

4.10 ApoB Response with Ox-FA and their Breakdown Products

The intestine is known to secrete ApoB48, which is the main lipoprotein in chylomicrons, while the liver makes ApoB100 in VLDL. Interestingly, the secretion of lipoproteins was known not to be affected by dietary TG and cholesterol and at the fasted stage, lipoproteins are still produced and secreted in the lipid-free form [90, 197]. Fat-feeding may increase the size rather than the number of intestinal-secreted lipoproteins [89]. Postprandial TG have been identified as a strong indicator for CVD risk [198].

The present studies have determined the synthesis of organ-specific forms of ApoB in human liver and intestine and compared their regulation in the presence of HPODE and its breakdown products. Even though we did not find a significant increase or decrease in gene expression results, western blot and

ELISA of cell medium showed significantly reduced levels of ApoB100/48 with

HPODE, ONA and AzA in differentiated Caco-2 cells. In HepG2 cells, we only observed similar inhibition effects of ApoB secretion with the highest concentration (100 µM) of HPODE treatment.

114

The biogenesis of ApoB100, an essential protein component for the plasma lipoproteins, very low density, intermediate density, and low density lipoproteins, and lipoprotein(a), is regulated in the liver at the translational and post- translational levels by degradation in a pre-Golgi compartment [143, 155] and has been used as a model for secretory proteins regulated by intracellular degradation [189, 192]. Liao et al. [155] described the intracellular degradation of

ApoB100, where the proteasome-ubiquitin pathway was identified as a major mechanism for the intracellular degradation of ApoB100. ApoB degradation has been assumed to be a universal and inevitable phenomenon. The production of

ApoB requires the co-expression of microsomal triglyceride transfer protein

(MTP) in the absence of which the newly synthesized ApoB100 is completely degraded [199].

ApoB48 is an essential structural component of intestinal chylomicrons. It is the translational product of an edited ApoB mRNA [155]. The production of

ApoB48 also requires MTP [199]. Whether ApoB48 is degraded by proteasome- mediated events in intestinal cells is unknown. Bakillas et al. [200] demonstrated that ApoB100 and ApoB48 are quantitatively recovered in the cellular lysate and the medium in Caco-2 cells, and they escape from proteasome-mediated degradation. The fact that ApoB100 (and ApoB48) in a model intestinal cell line escapes intracellular degradation has important implications for the use of ApoB as a paradigm for proteasomal protein degradation. These studies also demonstrated that Caco-2 cells have the capacity to tag some of their intracellular

115 proteins for degradation by the proteasome pathway, but the ApoB100 and

ApoB48 produced by Caco-2 cells managed to largely escape this fate.

Our studies suggested the existence an intestinal specific ApoB regulation pathway, which is poorly understood as yet. However, beyond the HPODE, ONA and AzA that we used in the experiments, several other compounds, such as resveratrol, have similar effects to depress secretion of ApoB48 from the intestine.

Even though the mechanism is poorly understood, SIRT1 and AMPK are proposed to be involved [201].

4.11 AzA could be a Potential Drug for the Treatment of

Postprandial Dyslipidemia

As mentioned earlier, aldehydes are readily oxidized, even by air exposure, to the corresponding carboxylic acid. It is expected that lipid peroxidation- derived aldehydes would also be oxidized to their carboxylic acid derivatives.

While the aldehydes decomposed from the omega end have attracted considerable attention, the carboxylic end of the decomposition product of oxidized fatty acid such as ONA has attracted little attention. ONA is of great biological significance as it is readily oxidized to azelaic acid. AzA is a lipophilic dicarboxylic acid, as opposed to short chain dicarboxylic acids such as malonic acid, despite the reactive methylene group of the latter. Therefore, it would be expected to be formed and to accumulate in greater amounts in lipid-rich

116 domains. AzA has several beneficial properties, such as its anti-inflammatory, antimicrobial, anti-tumoral, and anti-keratinizing effects. AzA has been used in various formulations to treat rosacea, acne, and melisma [202]. Although the mechanism of the reduction in atherosclerosis by AzA is unclear, the main conclusion of Dmitry et al. [147] studies is that the ingestion of AzA can slow the progress of atherosclerosis. Due to the poor absorption of AzA and minimal hepatic response to AzA treatments as characterized in the Result Section, the beneficial effects of AzA may be restricted to the intestine, and the intestine may be a novel target of anti-atherosclerotic drugs.

117

Chapter 5: Conclusions

v Lipid peroxides and their decomposition products are present in dietary

PUFA. v Enterocytes and hepatocytes both efficiently reduce lipid hydro peroxides to

corresponding hydroxides. v Thiol-containing compounds and some antioxidants can also contribute to

such reduction. v Oxidized lipids can be taken up by Caco-2 and HepG2 cells but not as

efficiently as unoxidized fatty acid. Poorly differentiated Caco-2 cells cannot

take up as much oxidized lipids as differentiated cells. v Lipid hydroxide (HODE) can enter the cell and be esterified in Caco-2 cells. v ONA is generated from the decomposition of HPODE from the carboxylic

end. v ONA can be oxidized rapidly to AzA without entering the cell. v ONA enters the cells and is esterified. Intracellular ONA is kept at very low

concentration, v AzA stays stable in the cell medium for up to 18 hours and very little uptake

was observed in the differentiated Caco-2 cells. v HPODE, ONA and AzA induced ApoA1 secretion by Caco-2 cells. HPODE

118

suppressed ApoA1 in HepG2 cells. These effects were only observed in

secreted protein, but not at mRNA level or intracellular protein. v HPODE suppressed PON1 activity in the medium of Caco-2 and HepG2

cells. v AzA enhanced PON1 activity in differentiated Caco-2 cells. v HPODE, ONA and AzA suppressed ApoB secretion in differentiated Caco-2

cells. v HPODE only at the highest concentration (100 µM) suppressed ApoB

secretion by HepG2 cells. v Differentiated Caco-2 cells produce more ApoA1, ApoB and PON1 than

poorly differentiated cells.

119

Chapter 6: Significance of the Study

This study provided supporting evidence for the formation of HPODE,

ONA and AzA in the heated cooking oil. By carefully studying the metabolic fate of HPODE, it is concluded that in the presence of cells, HPODE can be reduced to

HODE efficiently. Various factors, such as thiol-containing peptides, amino acids and antioxidants may contribute to the reduction. HODE can further enter the cells and be esterified. Our findings suggested that dietary peroxides may not be a significant source of lipid peroxide in circulation as they can be reduced to hydroxides during the digestion process. The reported increased oxidative stress from the heated oil in vivo studies may due to the secondary effects from lipid peroxide rather than the orginal compounds. We have demonstrated in this study that, for example, HPODE decreased PON1 activity, which might be one of the mechanisms to mediate such oxidative stress.

This is the first study to demonstrate the metabolic fate of ONA, which is the decomposition product from the carboxylic end of linoleic peroxide that is the most abundant lipid peroxide in nature. GC-MS and 14C-labeled analytical chemistry techniques were used to show the accelerated oxidation of ONA to AzA in the presence of cells. The place of oxidation is in the extracellular medium suggesting plasma membrane-bound aldehyde oxidizing enzymes may play a role

120 in such a reaction. Even though to a lesser extent, ONA can enter the differentiated Caco-2 cells and be esterified, suggesting ONA can be further packaged into chylomicrons and distributed throughout the body.

AzA is a potential drug to have anti-atherosclerotic effects. This is the first study to demonstrate its poor absorption by the intestine and suggest it as an efficient modulator of intestinal lipoprotein secretion. AzA effectively enhanced

ApoA1 and PON1 production, which are main components in HDL, while suppressed ApoB secretion in differentiated Caco-2 cells. AzA did not modulate lipoprotein secretion by HepG2 cells.

This study also shed light on the intestine as a novel anti-atherosclerotic target. The regulation of intestinal lipoprotein secretion may be different from that of the liver. My results suggest the existence of intestinal specific modulators at the post-transcription level to modify lipoprotein production, which is as yet poorly understood.

121

Bibliography

1. Glavind, J. and S. Hartmann, The occurrence of peroxidized lipids in atheromatous human aortas. Experientia, 1951. 7(12): p. 464.

2. Desai, I.D. and A.L. Tappel, DAMAGE TO PROTEINS BY PEROXIDIZED LIPIDS. J Lipid Res, 1963. 4: p. 204-7.

3. Mickel, H.S. and J. Horbar, The effect of peroxidized arachidonic acid upon human platelet aggregation. Lipids, 1974. 9(2): p. 68-71.

4. Mukai, F.H. and B.D. Goldstein, Mutagenicity of malonaldehyde, a decomposition product of peroxidized polyunsaturated fatty acids. Science, 1976. 191(4229): p. 868-9.

5. Nielsen, H., Reaction between peroxidized phospholipid and protein: I. Covalent binding of peroxidized cardiolipin to albumin. Lipids, 1978. 13(4): p. 253-8.

6. Nielsen, H., Reaction between peroxidized phospholipid and protein: II. Molecular weight and phosphorus content of albumin after reaction with peroxidized cardiolipin. Lipids, 1979. 14(11): p. 900-6.

7. Barsacchi, R., et al., Correlation between hydroperoxide-induced chemiluminescence of the heart and its function. Biochim Biophys Acta, 1983. 762(2): p. 241-7.

8. Gulati, J., et al., Effects of peroxidized oil on the development of experimental atherosclerosis in rabbits. Indian Heart J, 1992. 44(4): p. 235-9.

9. Hegstad, A.C., H. Strand, and K. Ytrehus, Phospholipid peroxidation after 60 min of global ischaemia and 10 min of reperfusion. A study in the isolated rat heart. J Mol Cell Cardiol, 1994. 26(5): p. 569-78.

10. Ytrehus, K. and E.M. Aspang, Phospholipid peroxidation in isolated perfused rat hearts subjected to hypothermia followed by rewarming: inverse relation to loss of function. Cryobiology, 1994. 31(3): p. 263-71.

11. Yoshino, K., et al., Production of aliphatic aldehydes on peroxidation of various types of lipids. Chem Pharm Bull (Tokyo), 1991. 39(7): p. 1788-91.

122

12. Lemieux, H., et al., Dietary fatty acids and oxidative stress in the heart mitochondria. Mitochondrion, 2011. 11(1): p. 97-103.

13. Behniwal, P.K., et al., In vitro absorption of nutrients from small intestine of rats fed peroxidized oil. Indian J Exp Biol, 1993. 31(7): p. 658-9.

14. Leong, X.F., et al., Association of elevated blood pressure and impaired vasorelaxation in experimental Sprague-Dawley rats fed with heated vegetable oil. Lipids Health Dis, 2010. 9: p. 66.

15. Awney, H.A., The effects of Bifidobacteria on the lipid profile and oxidative stress biomarkers of male rats fed thermally oxidized soybean oil. Biomarkers, 2011. 16(5): p. 445-52.

16. Boler, D.D., et al., Effects of oxidized corn oil and a synthetic antioxidant blend on performance, oxidative status of tissues, and fresh meat quality in finishing barrows. J Anim Sci, 2012. 90(13): p. 5159-69.

17. Kamisah, Y., et al., Deep-fried keropok lekors Increase Oxidative Instability in Cooking Oils. Malays J Med Sci, 2012. 19(4): p. 57-62.

18. Parthasarathy, S., et al., Potential role of oxidized lipids and lipoproteins in antioxidant defense. Free Radic Res, 2000. 33(3): p. 197-215.

19. Penumetcha, M., N. Khan, and S. Parthasarathy, Dietary oxidized fatty acids: an atherogenic risk? J Lipid Res, 2000. 41(9): p. 1473-80.

20. Khan-Merchant, N., et al., Oxidized fatty acids promote atherosclerosis only in the presence of dietary cholesterol in low-density lipoprotein receptor knockout mice. J Nutr, 2002. 132(11): p. 3256-62.

21. Rong, R., et al., Dietary oxidized fatty acids may enhance intestinal apolipoprotein A-I production. J Lipid Res, 2002. 43(4): p. 557-64.

22. Garelnabi, M., et al., Dietary oxidized linoleic acid lowers triglycerides via APOA5/APOClll dependent mechanisms. Atherosclerosis, 2008. 199(2): p. 304-9.

23. Goheen, S.C., L. O'Rourke, and E.C. Larkin, Ozone and the peroxidation of polyunsaturated fatty acids in vivo. Environ Res, 1986. 40(1): p. 47-57.

24. Christopher, J. and B. Axelrod, On the different positional specificities of peroxidation of linoleate shown by two isozymes of soybean lipoxygenase. Biochem Biophys Res Commun, 1971. 44(3): p. 731-6.

123

25. Zalejska-Fiolka, J., et al., Effects of oxidized cooking oil and alpha-lipoic acid on blood antioxidants: enzyme activities and lipid peroxidation in rats fed a high-fat diet. Biol Trace Elem Res, 2012. 145(2): p. 217-21.

26. Yin, H. and N.A. Porter, New insights regarding the autoxidation of polyunsaturated fatty acids. Antioxid Redox Signal, 2005. 7(1-2): p. 170- 84.

27. Bergstrom, S., Autoxidation of linoleic acid. Nature, 1945. 156: p. 717.

28. Spiteller, G., Lipid peroxidation in aging and age-dependent diseases. Exp Gerontol, 2001. 36(9): p. 1425-57.

29. Schneider, C., et al., Synthesis of dihydroperoxides of linoleic and linolenic acids and studies on their transformation to 4- hydroperoxynonenal. Lipids, 2005. 40(11): p. 1155-62.

30. Spickett, C.M., The lipid peroxidation product 4-hydroxy-2-nonenal: Advances in chemistry and analysis. Redox Biol, 2013. 1(1): p. 145-152.

31. Aw, T.Y., Intestinal glutathione: determinant of mucosal peroxide transport, metabolism, and oxidative susceptibility. Toxicol Appl Pharmacol, 2005. 204(3): p. 320-8.

32. Hack, D.M., P.L. Bordi, Jr., and S.W. Hessert, Jr., Nutrition, sensory evaluation, and performance analysis of hydrogenated frying oils. Int J Food Sci Nutr, 2009. 60(8): p. 647-61.

33. .

34. Aladedunye, F. and R. Przybylski, Frying stability of high oleic sunflower oils as affected by composition of tocopherol isomers and linoleic acid content. Food Chem, 2013. 141(3): p. 2373-8.

35. Yagi, K., et al., Use of a new methylene blue derivative for determination of lipid peroxides in foods. Biochem Int, 1986. 12(2): p. 367-71.

36. Wolff, S.P. and J. Nourooz-Zadeh, Hypothesis: UK consumption of dietary lipid hydroperoxides--a possible contributory factor to atherosclerosis. Atherosclerosis, 1996. 119(2): p. 261-3.

37. Zarate, J., et al., A study of the toxic effect of oxidized sunflower oil containing 4-hydroperoxy-2-nonenal and 4-hydroxy-2-nonenal on cortical TrkA receptor expression in rats. Nutr Neurosci, 2009. 12(6): p. 249-59.

124

38. Nakagawa, F., et al., 4-Hydroxy hexenal derived from dietary n-3 polyunsaturated fatty acids induces anti-oxidative enzyme heme oxygenase-1 in multiple organs. Biochem Biophys Res Commun, 2014. 443(3): p. 991-6.

39. Stipanuk, M.H., Biochemical, physiological, molecular aspects of human nutrition. 2006.

40. Available from: Small intestine anatomy.

41. Grasset, E., et al., Epithelial properties of human colonic carcinoma cell line Caco-2: electrical parameters. Am J Physiol, 1984. 247(3 Pt 1): p. C260-7.

42. Alqahtani, S., L.A. Mohamed, and A. Kaddoumi, Experimental models for predicting drug absorption and metabolism. Expert Opin Drug Metab Toxicol, 2013. 9(10): p. 1241-54.

43. Kaeffer, B., Mammalian intestinal epithelial cells in primary culture: a mini-review. In Vitro Cell Dev Biol Anim, 2002. 38(3): p. 123-34.

44. van de Kerkhof, E.G., I.A. de Graaf, and G.M. Groothuis, In vitro methods to study intestinal drug metabolism. Curr Drug Metab, 2007. 8(7): p. 658-75.

45. Alam, M.A., F.I. Al-Jenoobi, and A.M. Al-Mohizea, Everted gut sac model as a tool in pharmaceutical research: limitations and applications. J Pharm Pharmacol, 2012. 64(3): p. 326-36.

46. Ranaldi, G., K. Islam, and Y. Sambuy, Epithelial cells in culture as a model for the intestinal transport of antimicrobial agents. Antimicrob Agents Chemother, 1992. 36(7): p. 1374-81.

47. Augustijns, P.F., Uptake and transport characteristics of chloroquine in an in-vitro cell culture system of the intestinal mucosa, Caco-2. J Pharm Pharmacol, 1996. 48(3): p. 277-80.

48. Failla, M.L., et al., Unsaturated fatty acids promote bioaccessibility and basolateral secretion of carotenoids and alpha-tocopherol by Caco-2 cells. Food Funct, 2014.

49. Gulseren, I., A. Guri, and M. Corredig, Effect of interfacial composition on uptake of curcumin-piperine mixtures in oil in water emulsions by Caco- 2 cells. Food Funct, 2014. 125

50. Peng, Y., et al., Applications of a 7-day Caco-2 cell model in drug discovery and development. Eur J Pharm Sci, 2014. 56: p. 120-30.

51. Wang, S.J., et al., Bioavailability of caffeic acid in rats and its absorption properties in the Caco-2 cell model. Pharm Biol, 2014.

52. Hussain, M.M., J. Shi, and P. Dreizen, Microsomal triglyceride transfer protein and its role in apoB-lipoprotein assembly. J Lipid Res, 2003. 44(1): p. 22-32.

53. Hussain, M.M., et al., Intestinal lipoprotein assembly. Curr Opin Lipidol, 2005. 16(3): p. 281-5.

54. Iqbal, J. and M.M. Hussain, Intestinal lipid absorption. Am J Physiol Endocrinol Metab, 2009. 296(6): p. E1183-94.

55. Levy, E., M. Mehran, and E. Seidman, Caco-2 cells as a model for intestinal lipoprotein synthesis and secretion. FASEB J, 1995. 9(8): p. 626-35.

56. Levy, E., et al., Caco-2 cells and human fetal colon: a comparative analysis of their lipid transport. Biochim Biophys Acta, 1999. 1439(3): p. 353-62.

57. Hussain, M.M., A proposed model for the assembly of chylomicrons. Atherosclerosis, 2000. 148(1): p. 1-15.

58. Levy, E., et al., The polymorphism at codon 54 of the FABP2 gene increases fat absorption in human intestinal explants. J Biol Chem, 2001. 276(43): p. 39679-84.

59. Chitchumroonchokchai, C., S.J. Schwartz, and M.L. Failla, Assessment of lutein bioavailability from meals and a supplement using simulated digestion and caco-2 human intestinal cells. J Nutr, 2004. 134(9): p. 2280-6.

60. Anwar, K., J. Iqbal, and M.M. Hussain, Mechanisms involved in vitamin E transport by primary enterocytes and in vivo absorption. J Lipid Res, 2007. 48(9): p. 2028-38.

61. Bateman, P.A., et al., Differences in cell morphology, lipid and apo B secretory capacity in caco-2 cells following long term treatment with saturated and monounsaturated fatty acids. Biochim Biophys Acta, 2007. 1771(4): p. 475-85.

126

62. During, A. and E.H. Harrison, Mechanisms of provitamin A (carotenoid) and vitamin A (retinol) transport into and out of intestinal Caco-2 cells. J Lipid Res, 2007. 48(10): p. 2283-94.

63. Ghoshal, S., et al., Chylomicrons promote intestinal absorption of lipopolysaccharides. J Lipid Res, 2009. 50(1): p. 90-7.

64. Nakano, T., et al., Lysophosphatidylcholine for efficient intestinal lipid absorption and lipoprotein secretion in caco-2 cells. J Clin Biochem Nutr, 2009. 45(2): p. 227-34.

65. Marcil, V., et al., Modification in oxidative stress, inflammation, and lipoprotein assembly in response to hepatocyte nuclear factor 4alpha knockdown in intestinal epithelial cells. J Biol Chem, 2010. 285(52): p. 40448-60.

66. Alemany, L., et al., Relative expression of cholesterol transport-related proteins and inflammation markers through the induction of 7- ketosterol-mediated stress in Caco-2 cells. Food Chem Toxicol, 2013. 56: p. 247-53.

67. Kim, B., et al., Polyphenol-rich black chokeberry (Aronia melanocarpa) extract regulates the expression of genes critical for intestinal cholesterol flux in Caco-2 cells. J Nutr Biochem, 2013. 24(9): p. 1564-70.

68. Nicod, N. and R.S. Parker, Vitamin E secretion by Caco-2 monolayers to APOA1, but not to HDL, is vitamer selective. J Nutr, 2013. 143(10): p. 1565-72.

69. Park, Y. and T.P. Carr, Unsaturated fatty acids and phytosterols regulate cholesterol transporter genes in Caco-2 and HepG2 cell lines. Nutr Res, 2013. 33(2): p. 154-61.

70. Haas, M.J., et al., Induction of apolipoprotein A-I gene expression by black seed (Nigella sativa) extracts. Pharm Biol, 2014.

71. Nicod, N., et al., Green Tea, Cocoa, and Red Wine Polyphenols Moderately Modulate Intestinal Inflammation and Do Not Increase High-Density Lipoprotein (HDL) Production. J Agric Food Chem, 2014. 62(10): p. 2228-32.

72. Beduneau, A., et al., A tunable Caco-2/HT29-MTX co-culture model mimicking variable permeabilities of the human intestine obtained by an original seeding procedure. Eur J Pharm Biopharm, 2014.

127

73. Kimura, O., et al., Carrier-mediated uptake of nobiletin, a citrus polymethoxyflavonoid, in human intestinal Caco-2 cells. Food Chem, 2014. 154: p. 145-50.

74. Lasa-Saracibar, B., et al., In Vitro Intestinal Co-Culture Cell Model To Evaluate Intestinal Absorption Of Edelfosine Lipid Nanoparticles. Curr Top Med Chem, 2014.

75. Yu, J., et al., Intestinal transportations of main chemical compositions of polygoni multiflori radix in caco-2 cell model. Evid Based Complement Alternat Med, 2014. 2014: p. 483641.

76. Zhou, W., et al., Effect of various absorption enhancers based on tight junctions on the intestinal absorption of forsythoside A in Shuang- Huang-Lian, application to its antivirus activity. Pharmacogn Mag, 2014. 10(37): p. 9-17.

77. Ginsburg, G.S., J. Ozer, and S.K. Karathanasis, Intestinal apolipoprotein AI gene transcription is regulated by multiple distinct DNA elements and is synergistically activated by the orphan nuclear receptor, hepatocyte nuclear factor 4. J Clin Invest, 1995. 96(1): p. 528-38.

78. Weech, M., et al., Development of a Food-Exchange Model to Replace Saturated Fat with MUFAs and n-6 PUFAs in Adults at Moderate Cardiovascular Risk. J Nutr, 2014.

79. Bell, S.J., et al., The new dietary fats in health and disease. J Am Diet Assoc, 1997. 97(3): p. 280-6; quiz 287-8.

80. Mansbach, C.M., 2nd and S. Parthasarathy, Regulation of de novo phosphatidylcholine synthesis in rat intestine. J Biol Chem, 1979. 254(19): p. 9688-94.

81. Lombardo, D. and O. Guy, Studies on the substrate specificity of a carboxyl ester hydrolase from human pancreatic juice. II. Action on cholesterol esters and lipid-soluble vitamin esters. Biochim Biophys Acta, 1980. 611(1): p. 147-55.

82. Swell, L., et al., Mechanism of cholesterol absorption. II. Changes in free and esterified cholesterol pools of mucosa after feeding cholesterol-4-C14. J Biol Chem, 1958. 233(1): p. 49-53.

83. Stremmel, W., Uptake of fatty acids by jejunal mucosal cells is mediated by a fatty acid binding membrane protein. J Clin Invest, 1988. 82(6): p. 2001-10.

128

84. Phan, C.T. and P. Tso, Intestinal lipid absorption and transport. Front Biosci, 2001. 6: p. D299-319.

85. Stahl, A., et al., Identification of the major intestinal fatty acid transport protein. Mol Cell, 1999. 4(3): p. 299-308.

86. Magun, A.M., T.A. Brasitus, and R.M. Glickman, Isolation of high density lipoproteins from rat intestinal epithelial cells. J Clin Invest, 1985. 75(1): p. 209-18.

87. Gonzalez-Vallina, R., et al., Lipoprotein and apolipoprotein secretion by a newborn piglet intestinal cell line (IPEC-1). Am J Physiol, 1996. 271(2 Pt 1): p. G249-59.

88. Davidson, N.O., et al., Intestinal apolipoprotein A-I and B-48 metabolism: effects of sustained alterations in dietary triglyceride and mucosal cholesterol flux. J Lipid Res, 1987. 28(4): p. 388-402.

89. Hayashi, H., et al., Fat feeding increases size, but not number, of chylomicrons produced by small intestine. Am J Physiol, 1990. 259(5 Pt 1): p. G709-19.

90. Danielsen, E.M., et al., Apolipoprotein A-1 (apoA-1) deposition in, and release from, the enterocyte brush border: a possible role in transintestinal cholesterol efflux (TICE)? Biochim Biophys Acta, 2012. 1818(3): p. 530-6.

91. van der Velde, A.E., Reverse cholesterol transport: from classical view to new insights. World J Gastroenterol, 2010. 16(47): p. 5908-15.

92. Staprans, I., et al., Oxidized lipids in the diet are a source of oxidized lipid in chylomicrons of human serum. Arterioscler Thromb, 1994. 14(12): p. 1900-5.

93. Kanazawa, K. and H. Ashida, Dietary hydroperoxides of linoleic acid decompose to aldehydes in stomach before being absorbed into the body. Biochim Biophys Acta, 1998. 1393(2-3): p. 349-61.

94. Aw, T.Y. and M.W. Williams, Intestinal absorption and lymphatic transport of peroxidized lipids in rats: effect of exogenous GSH. Am J Physiol, 1992. 263(5 Pt 1): p. G665-72.

95. Naruszewicz, M., et al., The effect of thermally oxidized soya bean oil on metabolism of chylomicrons. Increased uptake and degradation of oxidized chylomicrons in cultured mouse macrophages. Atherosclerosis, 1987. 66(1-2): p. 45-53. 129

96. Awada, M., et al., Dietary oxidized n-3 PUFA induce oxidative stress and inflammation: role of intestinal absorption of 4-HHE and reactivity in intestinal cells. J Lipid Res, 2012. 53(10): p. 2069-80.

97. Auge, N., et al., Uptake of 13-hydroperoxylinoleic acid by cultured cells. Arterioscler Thromb Vasc Biol, 1999. 19(4): p. 925-31.

98. Staprans, I., et al., The role of dietary oxidized cholesterol and oxidized fatty acids in the development of atherosclerosis. Mol Nutr Food Res, 2005. 49(11): p. 1075-82.

99. Esterbauer, H., G. Wag, and H. Puhl, Lipid peroxidation and its role in atherosclerosis. Br Med Bull, 1993. 49(3): p. 566-76.

100. Stringer, M.D., et al., Lipid peroxides and atherosclerosis. BMJ, 1989. 298(6669): p. 281-4.

101. Sulzle, A., F. Hirche, and K. Eder, Thermally oxidized dietary fat upregulates the expression of target genes of PPAR alpha in rat liver. J Nutr, 2004. 134(6): p. 1375-83.

102. Bull, A.W., et al., Activation of PPAR gamma in colon tumor cell lines by oxidized metabolites of linoleic acid, endogenous ligands for PPAR gamma. Carcinogenesis, 2003. 24(11): p. 1717-22.

103. Mastrofrancesco, A., et al., Azelaic acid modulates the inflammatory response in normal human keratinocytes through PPARgamma activation. Exp Dermatol, 2010. 19(9): p. 813-20.

104. Konig, B., et al., Activation of PPARalpha lowers synthesis and concentration of cholesterol by reduction of nuclear SREBP-2. Biochem Pharmacol, 2007. 73(4): p. 574-85.

105. Koch, A., et al., Thermally oxidized oil increases the expression of insulin- induced genes and inhibits activation of sterol regulatory element- binding protein-2 in rat liver. J Nutr, 2007. 137(9): p. 2018-23.

106. Robinson, J.G., et al., Atherosclerosis profile and incidence of cardiovascular events: a population-based survey. BMC Cardiovasc Disord, 2009. 9: p. 46.

107. Rosamond, W., et al., Heart disease and stroke statistics--2008 update: a report from the American Heart Association Statistics Committee and Stroke Statistics Subcommittee. Circulation, 2008. 117(4): p. e25-146.

130

108. Quinn, M.T., et al., Oxidatively modified low density lipoproteins: a potential role in recruitment and retention of monocyte/macrophages during atherogenesis. Proc Natl Acad Sci U S A, 1987. 84(9): p. 2995-8.

109. Goldstein, J.L. and M.S. Brown, Expression of the familial hypercholesterolemia gene in heterozygotes: model for a dominant disorder in man. Trans Assoc Am Physicians, 1974. 87: p. 120-31.

110. Jiang, X., et al., Oxidized low density lipoproteins--do we know enough about them? Cardiovasc Drugs Ther, 2011. 25(5): p. 367-77.

111. Bernstein, L.H.

112. Glomset, J.A., The plasma lecithins:cholesterol acyltransferase reaction. J Lipid Res, 1968. 9(2): p. 155-67.

113. Berrougui, H., C.N. Momo, and A. Khalil, Health benefits of high-density lipoproteins in preventing cardiovascular diseases. J Clin Lipidol, 2012. 6(6): p. 524-33.

114. Costa, L.G., G. Giordano, and C.E. Furlong, Pharmacological and dietary modulators of paraoxonase 1 (PON1) activity and expression: the hunt goes on. Biochem Pharmacol, 2011. 81(3): p. 337-44.

115. Zhang, C., et al., Studies on protective effects of human paraoxonases 1 and 3 on atherosclerosis in apolipoprotein E knockout mice. Gene Ther, 2010. 17(5): p. 626-33.

116. Precourt, L.P., et al., The three-gene paraoxonase family: physiologic roles, actions and regulation. Atherosclerosis, 2011. 214(1): p. 20-36.

117. Rosenblat, M., N. Volkova, and M. Aviram, Injection of paraoxonase 1 (PON1) to mice stimulates their HDL and macrophage antiatherogenicity. Biofactors, 2011. 37(6): p. 462-7.

118. Mackness, M.I., S. Arrol, and P.N. Durrington, Paraoxonase prevents accumulation of lipoperoxides in low-density lipoprotein. FEBS Lett, 1991. 286(1-2): p. 152-4.

119. Tavori, H., et al., Paraoxonase 1 protects macrophages from atherogenicity of a specific triglyceride isolated from human carotid lesion. Free Radic Biol Med, 2011. 51(1): p. 234-42.

120. James, R.W., et al., The scavenger receptor class B, type I is a primary determinant of paraoxonase-1 association with high-density lipoproteins. Arterioscler Thromb Vasc Biol, 2010. 30(11): p. 2121-7. 131

121. Mackness, M. and B. Mackness, Targeting paraoxonase-1 in atherosclerosis. Expert Opin Ther Targets, 2013. 17(7): p. 829-37.

122. Mackness, B., et al., Human tissue distribution of paraoxonases 1 and 2 mRNA. IUBMB Life, 2010. 62(6): p. 480-2.

123. Shamir, R., et al., Paraoxonases (PONs) 1, 2, and 3 are expressed in human and mouse gastrointestinal tract and in Caco-2 cell line: selective secretion of PON1 and PON2. Free Radic Biol Med, 2005. 39(3): p. 336- 44.

124. Ferretti, G. and T. Bacchetti, Effect of dietary lipids on paraoxonase-1 activity and gene expression. Nutr Metab Cardiovasc Dis, 2012. 22(2): p. 88-94.

125. Gordon, S.M. and W.S. Davidson, Apolipoprotein A-I mimetics and high- density lipoprotein function. Curr Opin Endocrinol Diabetes Obes, 2012. 19(2): p. 109-14.

126. Vuilleumier, N., et al., Pro- or anti-inflammatory role of apolipoprotein A-1 in high-density lipoproteins? Swiss Med Wkly, 2013. 143: p. w13781.

127. Gordon, D.J., et al., High-density lipoprotein cholesterol and coronary heart disease in hypercholesterolemic men: the Lipid Research Clinics Coronary Primary Prevention Trial. Circulation, 1986. 74(6): p. 1217-25.

128. Baker, P.W., et al., Ability of reconstituted high density lipoproteins to inhibit cytokine-induced expression of vascular cell adhesion molecule-1 in human umbilical vein endothelial cells. J Lipid Res, 1999. 40(2): p. 345-53.

129. Parthasarathy, S., J. Barnett, and L.G. Fong, High-density lipoprotein inhibits the oxidative modification of low-density lipoprotein. Biochim Biophys Acta, 1990. 1044(2): p. 275-83.

130. Didonato, J.A., et al., Site-specific Nitration of Apolipoprotein A-I at Tyrosine 166 Is Both Abundant within Human Atherosclerotic Plaque and Dysfunctional. J Biol Chem, 2014. 289(15): p. 10276-92.

131. Huang, Y., et al., An abundant dysfunctional apolipoprotein A1 in human atheroma. Nat Med, 2014. 20(2): p. 193-203.

132. Staels, B. and J. Auwerx, Regulation of apo A-I gene expression by fibrates. Atherosclerosis, 1998. 137 Suppl: p. S19-23.

132

133. Chehade, J.M., et al., Induction of apolipoprotein A-I gene expression by glucagon-like peptide-1 and exendin-4 in hepatocytes but not intestinal cells. Metabolism, 2013. 62(2): p. 265-74.

134. Cohn, J.S., C. Marcoux, and J. Davignon, Detection, quantification, and characterization of potentially atherogenic triglyceride-rich remnant lipoproteins. Arterioscler Thromb Vasc Biol, 1999. 19(10): p. 2474-86.

135. Haas, M.E., A.D. Attie, and S.B. Biddinger, The regulation of ApoB metabolism by insulin. Trends Endocrinol Metab, 2013. 24(8): p. 391-7.

136. Tome-Carneiro, J., et al., Consumption of a grape extract supplement containing resveratrol decreases oxidized LDL and ApoB in patients undergoing primary prevention of cardiovascular disease: a triple-blind, 6-month follow-up, placebo-controlled, randomized trial. Mol Nutr Food Res, 2012. 56(5): p. 810-21.

137. Charlton-Menys, V., et al., Targets of statin therapy: LDL cholesterol, non-HDL cholesterol, and apolipoprotein B in type 2 diabetes in the Collaborative Atorvastatin Diabetes Study (CARDS). Clin Chem, 2009. 55(3): p. 473-80.

138. Sethi, S., et al., Oxidized omega-3 fatty acids in fish oil inhibit leukocyte- endothelial interactions through activation of PPAR alpha. Blood, 2002. 100(4): p. 1340-6.

139. Tavori, H., et al., Human carotid lesion linoleic acid hydroperoxide inhibits paraoxonase 1 (PON1) activity via reaction with PON1 free sulfhydryl cysteine 284. Free Radic Biol Med, 2011. 50(1): p. 148-56.

140. Briganti, S., et al., Azelaic acid reduced senescence-like phenotype in photo-irradiated human dermal fibroblasts: possible implication of PPARgamma. Exp Dermatol, 2013. 22(1): p. 41-7.

141. Masson, D., et al., Expression of the pregnane X receptor in mice antagonizes the cholic acid-mediated changes in plasma lipoprotein profile. Arterioscler Thromb Vasc Biol, 2005. 25(10): p. 2164-9.

142. Penumetcha, M., N. Khan-Merchant, and S. Parthasarathy, Enhanced solubilization and intestinal absorption of cholesterol by oxidized linoleic acid. J Lipid Res, 2002. 43(6): p. 895-903.

143. Miles, R.R., et al., Genome-wide screen for modulation of hepatic apolipoprotein A-I (ApoA-I) secretion. J Biol Chem, 2013. 288(9): p. 6386-96.

133

144. Halley, P., et al., Regulation of the apolipoprotein gene cluster by a long noncoding RNA. Cell Rep, 2014. 6(1): p. 222-30.

145. Leong, X.F., et al., Intake of repeatedly heated palm oil causes elevation in blood pressure with impaired vasorelaxation in rats. Tohoku J Exp Med, 2009. 219(1): p. 71-8.

146. Draper, H.H., L.G. McGirr, and M. Hadley, The metabolism of malondialdehyde. Lipids, 1986. 21(4): p. 305-7.

147. Litvinov, D., et al., Anti-atherosclerotic actions of azelaic acid, an end product of linoleic acid peroxidation, in mice. Atherosclerosis, 2010. 209(2): p. 449-54.

148. Achuthan Raghavamenon, M.G., Sainath Babu, Alex Aldrich, Dmitry Litvnov, Sampath Parthasarathy, a-Tocopherol Is Ineffective in Preventing the Decomposition of Preformed Lipid Peroxides and May Promote the Accumulation of Toxic Aldehydes: A Potential Explanation for the Failure of Antioxidants to Affect Human Atherosclerosis. ANTIOXIDANTS & REDOX SIGNALING, 2009. 11(6): p. 11.

149. Lopez, M.A., et al., Antagonistic role of 9-lipoxygenase-derived oxylipins and ethylene in the control of oxidative stress, lipid peroxidation and plant defence. Plant J, 2011. 67(3): p. 447-58.

150. Leblanc, P., J. Capone, and G.E. Gerber, Synthesis and biosynthetic utilization of radioactive photoreactive fatty acids. J Biol Chem, 1982. 257(24): p. 14586-9.

151. Ohishi, N., et al., A new assay method for lipid peroxides using a methylene blue derivative. Biochem Int, 1985. 10(2): p. 205-11.

152. Takayama, H., M. Okuma, and H. Uchino, A simple method for estimation of lipoxygenase and cyclo-oxygenase pathways in human platelets--the use of thiobarbituric acid reaction. Thromb Haemost, 1980. 44(3): p. 111- 4.

153. Lowry, O.H., et al., Protein measurement with the Folin phenol reagent. J Biol Chem, 1951. 193(1): p. 265-75.

154. Jaichander, P., et al., Induction of paraoxonase 1 and apolipoprotein A-I gene expression by aspirin. J Lipid Res, 2008. 49(10): p. 2142-8.

155. Liao, W. and L. Chan, Apolipoprotein B, a paradigm for proteins regulated by intracellular degradation, does not undergo intracellular degradation in CaCo2 cells. J Biol Chem, 2000. 275(6): p. 3950-6. 134

156. Chahoud, G., Y.W. Aude, and J.L. Mehta, Dietary recommendations in the prevention and treatment of coronary heart disease: do we have the ideal diet yet? Am J Cardiol, 2004. 94(10): p. 1260-7.

157. Kuller, L.H., Nutrition, lipids, and cardiovascular disease. Nutr Rev, 2006. 64(2 Pt 2): p. S15-26.

158. Lichtenstein, A.H., Dietary fat and cardiovascular disease risk: quantity or quality? J Womens Health (Larchmt), 2003. 12(2): p. 109-14.

159. Post, R., J. Haven, and S. Maniscalco, Putting MyPlate to work for nutrition educators. J Nutr Educ Behav, 2012. 44(2): p. 98-9.

160. Robb-Nicholson, C., Ask the doctor. In the January issue, you recommended the Harvard Healthy Eating Plate, which includes only one to two servings of dairy a day. Don't we need more than that to get enough calcium? Harv Womens Health Watch, 2012. 19(9): p. 8.

161. Kris-Etherton, P.M., W.S. Harris, and L.J. Appel, Omega-3 fatty acids and cardiovascular disease: new recommendations from the American Heart Association. Arterioscler Thromb Vasc Biol, 2003. 23(2): p. 151-2.

162. Mattson, F.H. and S.M. Grundy, Comparison of effects of dietary saturated, monounsaturated, and polyunsaturated fatty acids on plasma lipids and lipoproteins in man. J Lipid Res, 1985. 26(2): p. 194-202.

163. Berry, E.M., et al., Effects of diets rich in monounsaturated fatty acids on plasma lipoproteins--the Jerusalem Nutrition Study: high MUFAs vs high PUFAs. Am J Clin Nutr, 1991. 53(4): p. 899-907.

164. Reaven, P., et al., Effects of oleate-rich and linoleate-rich diets on the susceptibility of low density lipoprotein to oxidative modification in mildly hypercholesterolemic subjects. J Clin Invest, 1993. 91(2): p. 668-76.

165. Hu, F.B., et al., Dietary fat intake and the risk of coronary heart disease in women. N Engl J Med, 1997. 337(21): p. 1491-9.

166. Shekelle, R.B., et al., Diet, serum cholesterol, and death from coronary heart disease. The Western Electric study. N Engl J Med, 1981. 304(2): p. 65-70.

167. Dyerberg, J., et al., Eicosapentaenoic acid and prevention of thrombosis and atherosclerosis? Lancet, 1978. 2(8081): p. 117-9.

135

168. Mori, T.A., et al., Interactions between dietary fat, fish, and fish oils and their effects on platelet function in men at risk of cardiovascular disease. Arterioscler Thromb Vasc Biol, 1997. 17(2): p. 279-86.

169. McVeigh, G.E., et al., Fish oil improves arterial compliance in non- insulin-dependent diabetes mellitus. Arterioscler Thromb, 1994. 14(9): p. 1425-9.

170. Swails, W.S., et al., Fish-oil-containing diet and platelet aggregation. Nutrition, 1993. 9(3): p. 211-7.

171. Kestin, M., et al., n-3 fatty acids of marine origin lower systolic blood pressure and triglycerides but raise LDL cholesterol compared with n-3 and n-6 fatty acids from plants. Am J Clin Nutr, 1990. 51(6): p. 1028-34.

172. Diskin, C.J., et al., Fish oil to prevent intimal hyperplasia and access thrombosis. Nephron, 1990. 55(4): p. 445-7.

173. Hornstra, G., Influence of dietary fish oil on arterial thrombosis and atherosclerosis in animal models and in man. J Intern Med Suppl, 1989. 731: p. 53-9.

174. Lavie, C.J., et al., Management of lipids in primary and secondary prevention of cardiovascular diseases. Mayo Clin Proc, 1988. 63(6): p. 605-21.

175. Yuan, Z.X., et al., Identification and profiling of targeted oxidized linoleic acid metabolites in rat plasma by quadrupole time-of-flight mass spectrometry. Biomed Chromatogr, 2013. 27(4): p. 422-32.

176. Jira, W., et al., Strong increase in hydroxy fatty acids derived from linoleic acid in human low density lipoproteins of atherosclerotic patients. Chem Phys Lipids, 1998. 91(1): p. 1-11.

177. Umeno, A., et al., Singlet oxygen induced products of linoleates, 10- and 12-(Z,E)-hydroxyoctadecadienoic acids (HODE), can be potential biomarkers for early detection of type 2 diabetes. PLoS One, 2013. 8(5): p. e63542.

178. Wingler, K., et al., Gastrointestinal glutathione peroxidase prevents transport of lipid hydroperoxides in CaCo-2 cells. Gastroenterology, 2000. 119(2): p. 420-30.

179. Staprans, I., et al., Oxidized lipids in the diet are incorporated by the liver into very low density lipoprotein in rats. J Lipid Res, 1996. 37(2): p. 420- 30. 136

180. Staprans, I., et al., Effect of oxidized lipids in the diet on oxidized lipid levels in postprandial serum chylomicrons of diabetic patients. Diabetes Care, 1999. 22(2): p. 300-6.

181. Kaneko, T., K. Kaji, and M. Matsuo, Cytotoxicities of a linoleic acid hydroperoxide and its related aliphatic aldehydes toward cultured human umbilical vein endothelial cells. Chem Biol Interact, 1988. 67(3-4): p. 295-304.

182. Petrosino, J.M., D. Disilvestro, and O. Ziouzenkova, Aldehyde Dehydrogenase 1A1: Friend or Foe to Female Metabolism? Nutrients, 2014. 6(3): p. 950-73.

183. Yoval-Sanchez, B. and J.S. Rodriguez-Zavala, Differences in susceptibility to inactivation of human aldehyde dehydrogenases by lipid peroxidation byproducts. Chem Res Toxicol, 2012. 25(3): p. 722-9.

184. Garattini, E., M. Fratelli, and M. Terao, Mammalian aldehyde oxidases: genetics, evolution and biochemistry. Cell Mol Life Sci, 2008. 65(7-8): p. 1019-48.

185. Kitamura, T., et al., Substrate specificity, plasma membrane localization, and lipid modification of the aldehyde dehydrogenase ALDH3B1. Biochim Biophys Acta, 2013. 1831(8): p. 1395-401.

186. Grego, A.V. and G. Mingrone, Dicarboxylic acids, an alternate fuel substrate in parenteral nutrition: an update. Clin Nutr, 1995. 14(3): p. 143-8.

187. Passi, S., et al., Azelaic acid--biochemistry and metabolism. Acta Derm Venereol Suppl (Stockh), 1989. 143: p. 8-13.

188. Mingrone, G., L. Castagneto-Gissey, and K. Mace, Use of dicarboxylic acids in type 2 diabetes. Br J Clin Pharmacol, 2013. 75(3): p. 671-6.

189. Wu, A.L. and H.G. Windmueller, Relative contributions by liver and intestine to individual plasma apolipoproteins in the rat. J Biol Chem, 1979. 254(15): p. 7316-22.

190. Brunham, L.R., et al., Intestinal ABCA1 directly contributes to HDL biogenesis in vivo. J Clin Invest, 2006. 116(4): p. 1052-62.

191. Wang, H., et al., Apolipoprotein secretion and lipid synthesis: regulation by fatty acids in newborn swine intestinal epithelial cells. Am J Physiol, 1997. 272(5 Pt 1): p. G935-42.

137

192. Shen, X., et al., Identification of genes affecting apolipoprotein B secretion following siRNA-mediated gene knockdown in primary human hepatocytes. Atherosclerosis, 2012. 222(1): p. 154-7.

193. Mackness, M.I., P.N. Durrington, and B. Mackness, The role of paraoxonase 1 activity in cardiovascular disease: potential for therapeutic intervention. Am J Cardiovasc Drugs, 2004. 4(4): p. 211-7.

194. Goswami, B., et al., Paraoxonase: a multifaceted biomolecule. Clin Chim Acta, 2009. 410(1-2): p. 1-12.

195. Ferretti, G., et al., Structural modifications of HDL and functional consequences. Atherosclerosis, 2006. 184(1): p. 1-7.

196. Ragbir, S. and J.A. Farmer, Dysfunctional high-density lipoprotein and atherosclerosis. Curr Atheroscler Rep, 2010. 12(5): p. 343-8.

197. Mougin-Schutz, A., D. Vacher, and A. Girard-Globa, Synthesis and secretion of apolipoproteins by pig intestinal mucosa in organ culture. Lack of inhibition of apolipoprotein A-I secretion by colchicine. Biochim Biophys Acta, 1983. 754(2): p. 208-17.

198. Kolovou, G.D., et al., Assessment and clinical relevance of non-fasting and postprandial triglycerides: an expert panel statement. Curr Vasc Pharmacol, 2011. 9(3): p. 258-70.

199. Davidson, N.O. and G.S. Shelness, APOLIPOPROTEIN B: mRNA editing, lipoprotein assembly, and presecretory degradation. Annu Rev Nutr, 2000. 20: p. 169-93.

200. Bakillah, A., et al., Measurement of apolipoprotein B in various cell lines: correlation between intracellular levels and rates of secretion. Lipids, 1997. 32(10): p. 1113-8.

201. Xiao, C., et al., New and emerging regulators of intestinal lipoprotein secretion. Atherosclerosis, 2014. 233(2): p. 608-615.

202. Sieber, M.A. and J.K. Hegel, Azelaic acid: Properties and mode of action. Skin Pharmacol Physiol, 2014. 27 Suppl 1: p. 9-17.

138