The Enhanced Tumor Selectivity of an Oncolytic Vaccinia Lacking the Host Range and Antiapoptosis Genes SPI-1 and SPI-2

Research Article

Z. Sheng Guo,1 Arpana Naik,3 Mark E. O’Malley,1 Petar Popovic,1 Richard Demarco,1,2 Yun Hu,3 Xiaoyu Yin,1,5 Shuting Yang,1 Herbert J. Zeh,1 Bernard Moss,4 Michael T. Lotze,1,2 and David L. Bartlett1,3

1Division of Surgical Oncology, University of Pittsburgh Cancer Institute and Department of Surgery, School of Medicine; 2Molecular Medicine Institute, University of Pittsburgh, Pittsburgh, Pennsylvania; 3Surgery Branch, Center for Cancer Research, National Cancer Institute; 4Laboratory of Viral Diseases, National Institute of Allergy and Infectious Diseases, NIH, Bethesda, Maryland; and 5Department of Hepatobiliary Surgery, First Affiliated Hospital, Sun Yat-Sen University, Guangzhou, Guangdong, China

Abstract With replicating viral vectors, levels of gene expression are higher The ability of cancer cells to evade apoptosis may permit and transduction efficiency is improved due to viral replication survival of a recombinant vaccinia lacking antiapoptotic and subsequent spread to surrounding cells. Antitumor effects genes in cancer cells compared with normal cells. We have attributable to virus-mediated cell death are observed (1, 6–8). explored the deletion of two vaccinia virus host range/ Virus-associated toxicity is a concern and various modifications antiapoptosis genes, SPI-1 and SPI-2, for their effects on the have been explored in an effort to improve both tumor specificity viral replication and their ability to induce cell death in and safety profiles (1). infected normal and transformed cells in vitro. Indeed, in Our laboratory has explored the application of tumor-selective three paired normal and transformed cell types, the SPI-1 and replicating vaccinia virus (WR strain) for cancer therapy (4, 9). SPI-2 gene-deleted virus (vSP) preferentially replicates in We have previously shown that a double deletion of the thymidine transformed cells or p53-null cells when compared with their kinase (TK) and vaccinia growth factor (VGF) genes significantly normal counterparts. This selectivity may be derived from the decreases pathogenicity and increases tumor selectivity. A TK-virus fact that vSP-infected normal cells died faster than infected requires TTP for DNA synthesis from the nucleotide pool present in cancer cells. A fraction of infected cells died with evidence of dividing cells. The TK deletion leads to preferential viral replication necrosis as shown by both flow cytometry and detection of in dividing cells. The VGF gene encodes the vaccinia growth factor, high-mobility group B1 protein released from necrotic cells a secreted protein produced early in viral infection that acts as a into the culture supernatant. When administered to animals, mitogen to prime surrounding cells for subsequent viral infection. vSP retains full ability to replicate in tumor tissues, whereas Deletion of this gene causes decreased viral replication in resting replication in normal tissues is greatly diminished. In a model cells. Compared with the wild-type virus, the dual-deletion mutant of viral pathogenesis, mice treated with vSP survived sub- displayed reduced viral recovery from resting NIH3T3 cells but stantially longer when compared with mice treated with the equivalent viral recovery from dividing NIH3T3 cells in vitro. wild-type virus. The mutant virus vSP displayed significant In tumor models in mice, the TK/VGF double-deletion mutant antitumoral effects in an MC38 s.c. tumor model in both nude displayed higher tumor-targeting capacity and potent tumoricidal (P < 0.001) and immunocompetent mice (P < 0.05). We activity with reduced viral pathogenicity (10). However, most solid conclude that this recombinant vaccinia vSP shows promise human tumors have a low percentage of cells in S-phase compared for oncolytic virus therapy. Given its enhanced tumor with rapidly growing murine tumors. Thus, this virus may not be as selectivity, improved safety profile, and substantial oncolytic effective when applied in some types of human cancer. Therefore, effects following systemic delivery in murine models, it should other strategies for creating more efficient oncolytic vaccinia need also serve as a useful vector for tumor-directed gene therapy. to be explored. (Cancer Res 2005; 65(21): 9991-8) Viruses have evolved a number of mechanisms, encoding a large number of specific proteins, designed to interfere with host Introduction antiviral defense to maximize viral replication (11, 12). Poxviruses encode a number of serine protease inhibitors (members of the Tumor-directed gene therapy has been limited by low transduc- serpin superfamily), which function to regulate key biological tion efficiency and relatively low levels of gene expression from processes, including inflammation, fibrinolysis, and cell migration current gene transfer vectors. This reduces its therapeutic potential (13–15). Indeed, whereas some poxvirus serpins regulate inflam- despite modifications that allow tumor targeting and tumor- mation or apoptosis, the function of other poxvirus serpins remains specific gene expression. A resulting trend in vector development unknown. Vaccinia encodes three serpins designated as SPI-1, for cancer therapy has been to explore replicating oncolytic viruses, SPI-2, and SPI-3 (16, 17). Of these serpins, SPI-1 (encoded by B22R) such as adenovirus, herpes simplex virus, and vaccinia virus (1–5). is implicated in the inhibition of apoptosis based on studies of rabbitpox SPI-1 (18, 19). SPI-1 binds cathepsin G and functions to inhibit apoptosis through effects on mitochondria in some cell

Requests for reprints: David L. Bartlett, Division of Surgical Oncology, University types (20). Wasilenko et al. (21) have shown that vaccinia virus of Pittsburgh Cancer Institute, Room 460, The Cancer Pavilion, 5150 Center Avenue, infection directly affects the mitochondrial apoptosis cascade by Pittsburgh, PA 15232. Phone: 412-692-2852; Fax: 412-692-2520; E-mail: guozs@ influencing the permeability transition pore, as shown by using upmc.edu. I2005 American Association for Cancer Research. the Copenhagen strain that naturally lacks the SPI-2 gene. SPI-2 doi:10.1158/0008-5472.CAN-05-1630 (encoded by B13R) inhibits the proteolytic activity of interleukin 1h www.aacrjournals.org 9991 Cancer Res 2005; 65: (21). November 1, 2005

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2005 American Association for Cancer Research. Cancer Research converting enzyme (ICE) and ICE-like enzymes as well as granzyme (FBS), 2 mmol/L glutamine, and antibiotics (100 units/mL penicillin and B; it can also block apoptosis induced by individual stimuli, 100 Ag/mL streptomycin). Cells were maintained in an incubator at 37jC including signaling through Fas receptor or the type 1 tumor with 5% CO2. necrosis factor (TNF) receptor (22–24). Interestingly, both SPI-1 Vaccinia viruses. All vaccinia viruses used in this study are derivatives of the WR strain. The pseudo-wild-type vF13L+, a WR strain virus with lacZ and SPI-2 genes of vaccinia virus and rabbitpox were characterized gene insertion and no viral deletions (31), as well as the single deletions of as host range genes because the deletion of either gene exhibited SPI-1 (DSPI-1) and SPI-2 (DSPI-2) have all been described (25). A double- host range defects (19, 25). SPI-3 (encoded by K2L gene) is distantly deletion virus vDD-CD, with deletion of TK and VGF and insertion of the related to SPI-1 and SPI-2, and the protein inhibits cell-to-cell suicide gene Escherichia coli cytosine deaminase (10, 32), has been fusion during infection (17, 26). However, its function in apoptosis previously described. is unclear. Creation of a vaccinia with dual mutation of SPI-1 and SPI-2 Tumor cells have accrued genetic defects in apoptotic pathways genes. The viruses deleting either SPI-1 gene (DSPI-1) or SPI-2 gene during tumorigenesis, thus becoming resistant to intrinsic and (DSPI-2) have been described previously (25). A shuttle vector for extrinsic apoptotic pathways, one of the hallmarks of cancer deleting SPI-2 was constructed using the plasmid pBR-SPI2 that contains (27, 28). Cancer cells can be induced to die by nonapoptotic a 1,020 bp SPI-2 DNA fragment cloned into the HindIII and BamHI sites of pBR322. The SPI-2 fragment was generated by PCR using vaccinia mechanisms, such as necrosis, senescence, autophagy, and mitotic genomic DNA as a template and then cut with HindIII and BglII. The catastrophe (29, 30). In normal cells, the default pathway in lacZ expression cassette was inserted into the EcoRV site in the SPI-2 response to insults, such as viral infection, is to die via apoptosis. gene, resulting in a vector for insertional mutation of SPI-2 gene Based on these strikingly different properties of normal cells and (pVDSPI2). For constructing the recombinant virus with dual deletions cancer cells, we hypothesized that a vaccinia deleted of the SPI-1 (vSP), the shuttle vector pVDSPI2 was transfected into CV-1 cells. Cells and SPI-2 genes would selectively replicate in tumor cells and were then infected with virus DSPI-1 at a multiplicity of infection (MOI) represent a safe and effective virus for oncolytic therapy. Normal of 0.1. After three rounds of selection and amplification with confir- cells infected with SPI-1– and SPI-2–deleted vaccinia virus (vSP) mation of the deletion, one of the clones was selected for amplification would undergo apoptosis early and thus reduce viral replication, and purification. whereas cancer cells infected with the same mutant virus in vitro DNA extraction. Confluent CV-1 cells were infected with recombinant would still be apoptosis resistant and thus allow for viral vaccinia virus. After 2 to 3 days when viral cytopathic effects were complete, supernatant was removed and cells were washed and harvested. The DNA replication before the cells die. In addition, the normal antiviral purification was done as described previously (10). cytokine mileu produced in vivo in response to virus exposure, PCR. Cloning of the SPI-2 gene used a forward primer of 5V- including IFNa, may be more effective at controlling this serpin- CTAGAAGCTTGAACCTCTGGAATTAGTTAG-3V (with HindIII site under- deleted vaccinia replication in normal cells than in cancer cells, lined); the reverse primer is, GTCAAGATCTGCTATAATCTCCAGTTGAAC leading to selective survival in cancer cells in vivo. As products of (with BglII site underlined). Standard PCR used 50 AL of the PCR reaction the host range genes, other intrinsic properties of the two proteins containing purified vaccinia DNA, 1 AL of each primer (100 Amol/L), 1 AL may confer an advantage to the mutant virus, enabling better of deoxynucleotide triphosphates (10 mmol/L; Invitrogen), 2.5 units of Taq survival and proliferation in cancer cells. In either case, the SPI-1 polymerase (Promega Corp., Madison WI), and PCR buffer. PCR j and SPI-2 mutant virus could display significant selectivity in amplification parameters consisted of 15 seconds of denaturing at 94 C, j j tumor cells. 30 seconds of annealing at 55 C, and 2 minutes extension at 72 C for 35 cycles. In this study, we have shown that vSP is significantly attenuated Virus replication in cultured cells in vitro. Confluent cells grown in in normal cells in vitro but retains or even enhances its replication six-well plates were infected at a MOI of 0.1 in 1 mL of medium competency in cancer cells. This selectivity may be derived partially supplemented with 2% FCS for 2 hours at 37jC. After washing with 1Â PBS, from the fact that vSP-infected normal cells die faster than infected medium with 10% FCS was added and cells were incubated until harvesting cancer cells, thus reducing the viral yield in normal cells. In s.c. at 24 hours postinfection. After three freeze-thaw cycles to lyse the cells tumor models in both immunodeficient and immunocompetent and release virus, virus was quantified by plaque titration on CV-1 cells as mice, systemically delivered vSP virus displayed significant tumor described previously (10). inhibitory activity as well as reduced toxicity. The mutant virus Apoptosis assays. For apoptosis assays, cells were infected with vaccinia exhibits profound tumor selectivity and safety and should, viruses at a MOI of 1, 5, or 50 for over 1 hour in 1 mL of medium therefore, have utility for cancer-directed oncolytic therapy and supplemented with 2% FBS. Following infection, the virus suspension was then aspirated and cells were washed once with 1Â PBS before addition of gene therapy. complete growth medium. The cells were harvested at 18 hours or at specified times postinfection. Cells were stained with Annexin V-phycoerythrin and propidium iodide by using apoptosis kits under conditions Materials and Methods provided by the manufacturer (BioVision, Inc., Mountain View, CA). The Cell cultures. CV-1, HaCAT, HeLa, and H460 cell lines were obtained stained cells were further analyzed by flow cytometry using a Beckman from the American Type Culture Collection (Manassas, VA). MC38, a Coulter XL four-color analyzer. nonmetastatic colon adenocarcinoma cell line derived from C57BL/6 mice, Western blot analysis for high-mobility group B1 protein. Human has been extensively used in our previous studies. Normal human epidermal cancer cells and primary normal fibroblasts in six-well culture plates were keratinocytes and normal human bronchial epithelial cells were obtained infected with either no virus, vF13L+, or vSP at a MOI of 50 for over 1 hour from Cambrex Biosciences (East Rutherford, NJ). They were cultured under in medium containing 2% FBS. The cells were washed once with 1Â PBS conditions provided by the supplier. Normal human primary fibroblast cells before addition of 1 mL of growth medium supplemented with 2% FBS. were obtained from Dr. Teresa Whiteside (University of Pittsburgh Cancer Small aliquots of medium were collected at specific times postinfection Institute, Pittsburgh, PA). The mouse embryonic fibroblasts (p53+/+; p53À/À) (6, 20, and 48 hours). The amount of human high-mobility group B1 protein were gifts from Drs. Charles J. Sherr (St. Jude Children’s Hospital, Memphis, (HMGB1) in the conditioned medium was analyzed by Western blot. TN) and Tyler Jacks (Howard Hughes Medical Institute and Massachusetts Briefly, 12.5 AL of conditioned medium was used in each lane. Proteins Institute of Technology, Cambridge, MA). Most other cell lines were grown were resolved in the 12% SDS-PAGE gel and then electroblotted onto in DMEM supplemented with 10% heat-inactivated fetal bovine serum a polyvinylidene difluoride membrane (Millipore, Bedford, MA). The

Cancer Res 2005; 65: (21). November 1, 2005 9992 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2005 American Association for Cancer Research. Tumor-Selective Replicating Oncolytic Vaccinia membrane was first incubated with a rabbit anti-HMGB1 polyclonal In vitro replication of vSP and vF13 viruses in normal and antibody at 1:2,000 dilution (BD Biosciences, San Jose, CA), then incubated transformed cells. Confluent normal cells and transformed cells with secondary antirabbit whole antibody conjugated to horseradish were infected with vaccinia vF13 or vSP at a MOI of 0.1. The cells peroxidase (Amersham Biosciences, Piscataway, NJ). Following application were harvested at various times following infection and the yields of West Pico chemiluminescent substrate (Pierce, Rockford, IL) to the of infectious viruses from those infected cells were determined by membrane, signals were detected by exposure to X-ray films (Blue Basic Autorad film; ISC BioExpress, Kaysville, UT). lysing cells and titering on CV-1 cells. Three paired cell types were Mice. Female athymic nude mice and C57BL/6 immunocompetent mice, used: primary normal human epidermal keratinocyte and trans- 6 weeks of age, were obtained from the NIH Small Animal Facility formed keratinocyte cells (HaCAT); primary normal human (Frederick, MD). They were housed in standard conditions and given food bronchial epithelial cell and human lung cancer cells (H460); and and water ad libitum. Animal studies were approved by the Animal Care mouse normal fibroblasts as well as p53À/À mouse fibroblasts and Use Committees of the host institutions. derived from p53 knockout mice. The yields of virus in transformed Biodistribution of the viruses. For examination of viral replication and cells were compared with their reciprocal counterparts. In trans- 7 viral yields in tissues, nude mice were injected i.p. with 1 Â 10 plaque- formed or p53À/À cells, vF13L+ and vSP had similar replication forming unit (pfu) of vF13L+, vCD, or vSP. Eight days following viral efficiency. However, vSP replicated less efficiently in normal cells treatment, mice were sacrificed and whole sections of normal tissues and when compared with the wild-type vF13L+. The ratio of infectious tumor were homogenized in 1Â HBSS and stored at À70jC until use. One milliliter of the appropriately diluted homogenate was incubated on CV-1 virus in each of three cell type–matched pairs was calculated (Fig. 1). In all cases, vF13L+ virus replicated with similar efficiency cells in six-well plates at 37jCin5%CO2 and titers were determined as described previously (10). Viral titers were normalized to total protein in in both normal cells and transformed or mutated counterparts, the cell lysate and expressed as pfu/mg protein. For marker gene lacZ with ratios between 0.8 and 2.7. The mutant virus vSP, however, expression from the viruses, tumor and normal tissues were collected replicated with greater efficiency in transformed cells and in 5 days after virus administration and immediately frozen and stored at p53À/À mouse fibroblasts when compared with normal counter- À70jC. The reporter gene assays were done essentially as described parts (with a ratio between 11 and 122). Thus, a vaccinia virus previously (33). Briefly, frozen tissue samples were thawed, homogenized, deleted of SPI-1 and SPI-2 replicates preferentially in transformed A h and lysed in 750 L reporter gene lysis buffer with the -galactosidase or p53 null cells compared with normal cells. enzyme assay system (Promega). The relative enzyme activity is determined The replication of vaccinia, as well as many other viruses, is by light emission with a TD-20/20 luminometer (Turner Designs, Sunnyvale, CA). The concentration of total protein in each sample was modulated by host production of cytokines and chemokines, which determined using a bicinchoninic acid protein assay kit (Pierce) with are themselves modulated by viral infection. Vaccinia virus bovine serum albumin as standard. The h-galactosidase activity is expresses many soluble receptors and binding proteins for both expressed in relative light units per milligram of protein (RLU/mg). cytokines and chemokines (34). In response to viral infection, Viral pathogenicity. Viral pathogenicity was assessed with survival cytokines, such as IFN and TNF, are produced by host cells in vivo. studies done on both nude mice and immunocompetent C57BL/6 mice. We examined the effects of some individual cytokines on the 7 Naive nude mice were injected i.p. with 1 Â 10 pfu of vF13L+, vDD-CD, or relative replication efficiency of the viruses under defined 8 vSP in 200 AL of HBSS. C57BL/6 mice were injected i.p. with 1 Â 10 pfu of conditions in vitro. Confluent paired cells, normal human epidermal A virus in 200 L of HBSS per mouse. Mice were observed daily throughout keratinocytes and HaCAT, were infected with vF13L+ or vSP at a the course of the experiment. MOI of 10 and then cultured alone, with IFN-a, with IFN-g,or Tumor models and antitumor effect. MC-38 tumor cells (2.5 Â 105 a g cells in 100 AL of HBSS) were injected s.c. into the right flanks of 7- to with both (IFN- /IFN- ). At 24 hours postinfection, cells were 8-week-old female mice. When the tumors reached f5 Â 5 mm in diameter harvested and infectious virus was titered on CV-1 cells. In the (75-125 mm3 in volume), 1 Â 108 pfu of vF13L+, vSP, vDD-CD, or HBSS normal human epidermal keratinocyte cells, the viral yields saline were injected i.p. The health of mice was monitored daily and tumor sizes were measured thrice each week. Tumor volume was calculated as [(width)2 Â length] 0.52. Statistics. Statistical analysis was done using the Mann-Whitney test for nonparametric data when appropriate. Tumor volumes between groups were assessed using ANOVA for repeated measures. Survival analysis was done using the method of Kaplan-Meier and differences between curves were assessed using the log-rank test. All statistics were generated using StatView Software (Abacus Concepts, Inc., Berkeley, CA) and P < 0.05 was considered significant.

Results Creation of vaccinia viruses with deletions in both SPI-1 and SPI-2 genes. As described, a shuttle vector for the SPI-2 deletion was constructed and used to generate a deletion of SPI-2 in the parental virus DSPI-1. The resulting virus, vSP, contains a 585 bp deletion of the SPI-1 gene with insertion of a functional guanine phosphoribosyl transferase expression cassette. At the SPI-2 locus, the coding sequence was disrupted by an E. coli lacZ gene Figure 1. Viral replication is limited in normal cells when compared with three expression cassette. Recombinant virus plaques were selected and matched sets of transformed or p53-null cells. Confluent cells were infected with amplified as described. A number of assays were used to con- viruses at a MOI of 0.1. At 24 hours postinfection, cells were collected and processed. The viral titers were determined by titering on CV-1 cells. The ratios firm the mutation of the target genes, including PCR assays using of virus yield in each of the three sets of mutated cell lines versus matched SPI-1– and SPI-2–specific primers. normal cells are presented. www.aacrjournals.org 9993 Cancer Res 2005; 65: (21). November 1, 2005

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2005 American Association for Cancer Research. Cancer Research remained the same under all conditions for both viruses. However, similar kinetics in cancer cells. With normal human primary in HaCAT cells, cytokines moderately inhibited viral yields, with fibroblasts (Fig. 2B), 8% of control (mock-infected) cells are dying/ 2- to 3-fold reduction of both vF13L+ and vSP in the presence of dead. Normal human primary fibroblasts infected with vaccinia, either or both cytokines (data not shown). However, vSP still either vF13L+ or vSP, are dying with a faster kinetics with 63% retained much of the preferential replication in transformed cells. dying/dead in vF13L+-infected cells and 70% dying/dead in vSP- Therefore, vSP displayed preferential activity of replication in infected cells. More propidium iodide–positive cells were found in transformed cells regardless of the absence or presence of IFNs. vSP-infected cells (37%) than in vF13L+-infected cells (14%). In vSP induced both apoptosis and necrosis in infected normal summary, vaccinia infection caused normal human primary and cancer cells. Cells infected with vaccinia eventually die; fibroblasts to die with faster kinetics compared with cancer cells. this death does not occur via apoptosis in most cell lines studied In addition, vSP seemed to induce more normal cells to die via (35–37). Vaccinia virus encodes a number of antiapoptotic genes, necrosis (propidium iodide–positive cells) at this time point. including SPI-1 and SPI-2. We hypothesized that deletion of these Necrotic cells release HMGB1, an abundant and conserved antiapoptotic genes may enable infected normal cells to die via constituent of vertebrate nuclei (38, 39). We examined vaccinia- apoptosis. In contrast, cancer cells are intrinsically resistant to infected cell release of HMGB1 into culture medium. Cancer and death through apoptosis; thus, cancer cells infected with vaccinia normal cells were infected with vF13L+, vSP, or mock-infected, and lacking the viral antiapoptotic genes SPI-1 and SPI-2 may survive then grown in complete medium containing 2% FBS. The long enough for the virus to proliferate efficiently. We examined the conditioned medium was collected at various times following mechanisms of cell death under similar conditions we previously infection and was spun briefly to remove cell debris. Western blots used to analyze the replication efficiency of vSP compared with confirmed the presence of HMGB1 in the culture medium (Fig. 3). vF13L+ in three paired cell types. The key feature in this Under normal growth conditions, there is no detectable HMGB1 in experiment was that there were no external stimuli for apoptosis, the medium from either cancer cell lines (H460 and HT-29); such as FasL, TNF, or IFN-g. Under these conditions, we have HMGB1 was also not released into the medium from mock-infected analyzed cell death by Annexin V and propidium iodide staining at cells. At 6 hours after infection with either vF13L+ or vSP, no visible 6, 12, and 18 hours postinfection. Figure 2 shows the representative HMGB1 was detected in the medium. However, 20 hours after data from cells at 18 hours postinfection. In the control H460 infection, a faint band of HMGB1 was visible, indicating that some cancer cells, 14% were dying/dead cells (cells that are Annexin V infected cells had begun to die via necrosis and had started to and/or propidium iodide positive). In the cells infected with either release HMGB1 into the medium. These results are consistent with vF13L+ or vSP, 58% to 61% H460 cells are dying/dead cells, those previously observed with only a small percentage of necrotic suggesting that vF13L+ and vSP infection induced cell death with cells around this time point (Fig. 2A). By 48 hours postinfection,

Figure 2. Comparable apoptosis of various constructs tested in vaccinia-infected cells. [Human cancer H460 cells (A) and normal human primary fibroblasts (NHF; B)] were infected with vaccinia viruses at a MOI of 5 for over 1 hour in 1 mL medium with 2% FBS. Virus was aspirated and the cells were washed with 1Â PBS once before complete growth medium was added. The cells were harvested at 18 hours after infection. Cells were stained with Annexin V-phycoerythrin and propidium iodide (PI) by using apoptosis kits under the conditions provided by the manufacturers. The stained cells were analyzed by flow cytometry.

Cancer Res 2005; 65: (21). November 1, 2005 9994 www.aacrjournals.org

Figure 3. Human HMGB-1 protein is released from vaccinia-infected human cancer cells. The cancer cells grown in six-well culture dishes were infected with vaccinia at a MOI of 50 for 2 hours. Following infection, the cells were washed with 1Â PBS and fed with 1 mL of medium supplemented with 2% FBS. At various time points, aliquots of medium were taken and stored at À20jC. For Western blot analysis, 12.5 AL of medium were used. P, 1.5 ng of HMGB-1 standard; B, blank well; M, mock-infected cancer cell. S6, S20, and S48, conditioned medium at 6, 20, and 48 hours postinfection.

both cancer cell lines infected with either vF13L+ or vSP released reduced viral gene expression in some normal tissues while causing significant amounts of HMGB1 into the medium. When examined enhanced viral gene expression in tumor tissue. under microscopy, most of the cells are nonviable. As for normal In a separate experiment, the infectious virus recovery from human primary fibroblasts infected with either virus, smaller but tissues was analyzed. Eight days following injection of virus, visible bands of HMGB1 were detected in the medium at 20 or samples of tumor and normal tissues, including brain, liver, lung, 48 hours following infection (data not shown). These results spleen, and ovary, were harvested. The infectious viruses from showed that vaccinia-infected cancer cells release significant these tissues were titered on CV-1 cells and viral yield was amounts of HMGB1 into the culture medium in the late infection calculated per milligram protein (Fig. 6). Interestingly, the viral phase, reflecting a necrotic death. The deletion of SPI-1 and SPI-2 yield in tumors indicated that vSP generated amounts of had little effect on the release of HMGB1 from infected cancer cell infectious virus similar to wild-type virus. The second control lines. mutant vDD-CD also generated similar amounts, consistent with Reduced pathogenicity of vSP. Nude mice were injected with a previous study done in this laboratory (10). In contrast, vSP was vaccinia vF13L+ or vSP at 1 Â 107 pfu i.p. and then followed for recovered at markedly lower titers compared with vF13L+ in all survival (Fig. 4A). As expected, wild-type virus was extremely normal tissues examined except brain (P < 0.05). These results virulent, with vF13L+-treated mice all dying within 20 days. The were consistent with marker gene expression studies as shown in median survival was 13 days. The exact mechanism of viral Fig. 5. The data are also consistent with the in vitro observation pathogenicity and death of mice is unclear. However, we know that using three paired types of normal/transformed or p53-null cells WR vaccinia is a murine neurovirulent strain and that the virus (Fig. 1). Thus, both marker gene expression and infectious virus replicates in brain, lung, spleen, ovary, and other organs (see below). Mice infected with vSP survived longer with a median survival time of 32 days. The pathogenicity of the viruses was also tested in immunocompetent mice (Fig. 4B). Both viruses were injected into C57BL/6 mice at a 10-fold higher dose, 1.0 Â 108 pfu/mouse. All 10 mice injected with 1.0 Â 108 pfu of vSP survived and remained healthy for at least 102 days, the date of sacrifice. Of mice injected with pseudo-wild-type vF13L+, 8 of 10 mice died within 1 week. The two mice that survived the initial phase of viral pathogenicity survived throughout the duration of the experiment and seemed as healthy as those treated with the mutant virus vSP. These results, obtained from both nude mice and immunocompetent mice, showed that vSP is significantly attenuated in mice and is much less pathogenic. Enhanced tumor selectivity of vSP in vivo. The tissue distribution of the mutant vaccinia was examined using marker gene expression in tissues and by titering the infectious viruses recovered from tumor and normal tissues in tumor-bearing mice. S.c. MC38 tumor-bearing nude mice were injected with 107 pfu i.p. of vF13L+ or vSP. Five days following virus administration, tumor and normal tissues were harvested and lacZ expression was analyzed and expressed as RLU/mg protein (Fig. 5). In liver and spleen, there was 1 to 2 log of magnitude reduction of marker gene expression in vSP-infected animals relative to vF13L+. In Figure 4. Increased survival of mice treated with vSP. A, survival of nude mice treated with vaccinia. Mice were treated with 1.0 Â 107 pfu of vF13L+ or vSP brain, there was a trend toward decreased level of marker gene by i.p. injection (P < 0.0001). B, survival of C57BL/6 mice treated with vF13L+ or expression in vSP-treated mice. Increased h-galactosidase expres- vSP at dose of 1.0 Â 108 pfu of vF13L+ or vSP by i.p. injection. Eight of 10 mice sion was seen in the tumor of vSP-infected animals relative to treated with vF13L+ died within 7 days, whereas the remaining two survived for at least 102 days. No toxicity was seen in the group of mice treated with vSP. vF13L+; the difference is statistically significant (P < 0.05). These Kaplan-Meier survival statistics were done as described with the log-rank test results together suggest that deletion of the two genes results in (P = 0.0003). www.aacrjournals.org 9995 Cancer Res 2005; 65: (21). November 1, 2005

Therefore, other modifications that enhance vaccinia tumor selectivity through different mechanisms are urgently needed. Tumor cells are generally more resistant to apoptosis, frequently sequestering p53 in the cytosol and overexpressing antiapoptotic proteins, including survivin, Bcl-2, and Bcl-XL (27, 28). However, tumor cells can still be induced to die by apoptotic or nonapoptotic mechanisms, such as necrosis, senescence, autophagy, and mitotic catastrophe (29, 30). Many viruses encode antiapoptotic proteins, and under some circumstances proapoptotic proteins, to enable expansion within their specialized niches of their host (11, 12). We designed a new mutant vaccinia to enable selective replication in cancer cells. We deleted two viral serpin genes, SPI-2 and SPI-1, that are host range genes providing antiapoptotic properties to infected cells. The site of disruption of apoptosis by these gene products (mitochondria and ICE) should be compensated for by mutations in cancer cells (e.g., p53). This virus termed vSP exhibited enhanced tumor-selective replication and reduced pathogenicity. We have observed that normal cells infected with vaccinia died Figure 5. lacZ expression in tumor and normal tissues following systemic delivery of vaccinia. Nude mice with s.c. MC38 tumors (75-125 mm3) were faster than those infected cancer cells (Fig. 2). In addition, more injected i.p. with 1 Â 107 pfu of vF13L+ or vSP. On day 5, mice were sacrificed normal human primary fibroblast cells infected with vSP died via and tissues were collected. The tissues were homogenized and h-galactosidase necrosis (propidium iodide positive) than apoptosis (Annexin V activity in the lysates was measured as described in Materials and Methods. The activities were normalized to protein concentration and then expressed as positive) compared with those infected with vF13L+. However, RLU/mg of protein. Columns, median values from 10 mice per group some caution should be exercised when we interpret these data (*P = 0.058; **P < 0.05, between the groups of vF13L+ and vSP). with Annexin V staining. First, in the vaccinia life cycle, the exit and entry of various forms of vaccinia are complex processes (40). For example, the intracellular enveloped vaccinia exits the cells via titers showed that vSP retained high efficiency of replication in fusion of outer membrane with the plasma membrane to produce cancer cells and significantly diminished efficiency in normal a cell-associated enveloped virus particle by exocytosis. These tissues. It is important to point out that, when evaluated in the processes might change the conformation and structure of the same experiment, vSP displayed even higher tumor selectivity plasma membrane to create Annexin V–positive staining, which than vDD-CD, the best one our group had ever made previously (Fig. 6). Potent antitumor effect of vSP. We examined the antitumor activity of the mutant virus in s.c. tumor models in both nude and immunocompetent mice (Fig. 7). In nude mice, the growth of tumors in those mice treated with vSP was inhibited compared with those treated with saline alone (P < 0.001). The virus vF13L+ displayed similar antitumor activity at an early stage after viral administration. All mice treated with vF13L+ died between days 8 and 16 due to adverse effects of the wild-type virus (Fig. 7A). In immunocompetent mice, significant antitumor activity was also observed for vSP when compared with the group treated with saline alone (P < 0.05; Fig. 7B). Thus, vSP displayed significant antitumor activity and less pathogenicity when compared with the wild-type vaccinia in both immunocompetent and immunodeficient mice.

Discussion Our group previously showed that a TK- and VGF-deleted vaccinia virus reduced replication efficiency in nondividing cells both in vitro and in vivo (10). Viral pathogenicity was also decreased, and significantly reduced recovery of the mutant virus from normal tissues of nude mice was confirmed. In addition, a significant antitumor effect was observed following systemic injection in tumor Figure 6. Enhanced recovery of vSP vaccinia from tumor when compared with normal tissues. MC38 cells (2.5 Â 105) were injected s.c. into athymic nude mice. models in nude mice. Therefore, a clinical trial using this virus to 3 7 When the tumors reached f75 to 125 mm (in f9 days), 1 Â 10 pfu of treat cutaneous malignancies has been proposed at our institution. specified vaccinia virus were injected i.p. into each mouse. Eight days after virus The selectivity of this double-gene-deletion virus seems to depend administration, tumor and normal tissues were collected. The median values of virus titers (pfu/mg protein) were determined by titration of the virus in tissue on the rapid proliferation of cancer cells to achieve its efficacy. It lysates on CV-1 cells. P < 0.05 for normal tissues except brain between the may not work as effectively in slowly growing human tumors (4, 9). groups treated with vF13L+ and vSP.

Cancer Res 2005; 65: (21). November 1, 2005 9996 www.aacrjournals.org

Viruses can kill cells by either apoptosis and/or necrosis; frequently, the choice of pathway depends not only on the pathogen but also on the MOI as well as the cell type being studied. There are several potential mechanisms by which viruses activate apoptotic pathways. Mechanisms by which viruses cause infected cells to die via necrosis are not very clearly delineated. Cell death via necrosis is characterized by the release of cellular contents, including HMGB1, lactate dehydrogenase, S100 proteins, heat shock proteins, uric acid, and ATP (44). HMGB1 is a largely nuclear chromatin-binding protein that can be released from necrotic cells (38) and is secreted by activated macrophages and natural killer cells; it acts as a cytokine via binding to the receptors Toll-like receptor 2, Toll-like receptor 4, and receptor for advanced glycation end products, and triggers an inflammatory response associated with extensive tissue damage, thereby promoting tumor growth (38, 44–46). It is interesting to note that two animal RNA viruses, West Nile virus and infectious salmon anemia virus, induce host cell death via necrosis and release HMGB1 under certain conditions (47, 48). To our knowledge, our study is the first direct demonstration that infection with a DNA virus causes necrosis and release of HMGB1 from host cells. Many additional interesting questions remain to be addressed. How virus infection induces the release of HMGB1 from target cells and what role HMGB1 plays in the host immune response to viral infection are important subjects for further studies, especially in the context of using oncolytic viruses for cancer therapy. Another relevant question under intensive study has been the roles of cell necrosis and HMGB1 in tumor growth and the anticancer immune response (44–46). The decreased pathogenicity of vSP is an important finding in the development of vaccinia for uses beyond oncolytic therapy, including its use as a safer vaccine against smallpox. Previous studies showed no viral attenuation on deletion of either serpin gene alone (49). These studies used an intranasal mode of infection that may have decreased sensitivity compared with systemic injections. Also, given the overlapping nature of many antihost Figure 7. Diminished MC38 tumor growth in mice treated with vSP virus. Mice response proteins, a single mutation may not have a significant (nude and C57BL/6) were injected s.c. with 2.5 Â 105 MC38 tumor cells. effect on pathogenesis. We have clearly shown that the combined At the median tumor volume of 75 to 125 mm3, mice were injected i.p. with 1.0 Â 108 pfu of vaccinia virus vSP, vF13L+, or saline HBSS. The tumor sizes deletion of SPI-1 and SPI-2 markedly attenuates the virus, with no and health of mice were monitored. A, MC38 tumor in nude mice. In the group observed pathogenicity in immunocompetent mice following a of mice treated with vF13L+ (wt), all mice died between days 8 to 16 and, systemic injection at a dose of 108 pfu. therefore, no further tumor measurement was considered after day 8. Data are representative of two independent experiments (P < 0.001). B, MC38 tumor In this study, we have shown that a mutant vaccinia alone, in the in immunocompetent C57BL/6 mice. Tumor-bearing mice were injected with absence of a therapeutic gene, is capable of causing antitumor 8 2.0 Â 10 pfu of viruses i.p. Data are representative of five independent effects from viral replication and subsequent cell death. This is not experiments (P < 0.05). an immunologic response against the tumor as the effect is more profound in the immunodeficient mice. The most unique aspect is normally is an indicator of early apoptosis. Second, based on that this is achieved with a single systemic injection of the virus, previous studies, vaccinia induces cell death via nonapoptotic demonstrating its remarkable selectivity and efficiency. In contrast, pathways in most cell types (35, 36). Third, all previous experiments many other studies using adenovirus and herpes simplex virus as demonstrating antiapoptotic effects for SPI-1 and SPI-2 proteins oncolytic viruses have used intratumoral injection of viruses were done under specific sets of conditions. For example, the multiple times or in combination with chemotherapy and/or inhibition of apoptosis by SPI-1 protein of rabbitpox, which occurs radiation therapy to produce profound inhibition of tumor growth. late in the infection although SPI-1 gene is expressed early, was This report is the first from our laboratory to show that an shown using nonpermissive human A549 cells (19). The anti- oncolytic vaccinia suppresses tumor growth in an immunocompe- apoptotic function of SPI-2 in HeLa cells was shown using strong tent model. Finally, it is worthy to emphasize the possibility that external apoptosis stimuli, such as Fas or TNF-a (22). Finally, WR our use of murine tumors that may be less sensitive to vaccinia- strain vaccinia encodes a number of other antiapoptotic proteins, mediated killing than human cancer cells may underestimate the including F1L and E3L, in addition to SPI-1 and SPI-2 proteins. F1L efficacy that would be evident in human cancer. encodes a mitochondrial-associated inhibitor of apoptosis (41, 42). In summary, vaccinia viruses are widely investigated as plat- E3L encodes a double-stranded RNA-binding protein, also display- forms for in vivo vaccine development and have gained recent ing antiapoptotic and oncogenic properties (43). These gene interest as a vector for cancer gene delivery and oncolytic viral products may work together or separately in different cell types therapy (6–8, 50, 51). Here, we have created a tumor-selective or under different conditions. replicating vaccinia virus by deleting both SPI-1 and SPI-2 genes. www.aacrjournals.org 9997 Cancer Res 2005; 65: (21). November 1, 2005

This virus may be used as an oncolytic agent on its own or as a Acknowledgments vector for cancer gene therapy by incorporating suicide or cytokine Received 5/11/2005; revised 7/22/2005; accepted 8/31/2005. genes. An independent study deleting these two genes has shown Grant support: NIH RO1 grant CA 100415 (D.L. Bartlett) and Competitive Medical the ability of this virus to function as an excellent vaccine (52). Research Fund grant 10303 from the University of Pittsburgh Medical Center Health System (Z.S. Guo). This virus may also function as an effective vector expressing The costs of publication of this article were defrayed in part by the payment of page tumor-associated antigens and costimulatory molecules in the charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. setting of tumor immunotherapy. Additional mutations with vSP as We thank Drs. Charles J. Sherr and Tyler Jacks for the mouse embryonic fibroblasts a backbone may further enhance tumor selectivity. (p53+/+; p53À/À) and Dr. Teresa Whiteside for the primary human fibroblast cells.

References rabbitpox virus serpin gene controls host range by postbinding step of vaccinia virus entry into Chinese inhibiting apoptosis in restrictive cells. J Virol 1995;69: hamster ovary cells. Virology 1998;242:138–49. 1. Chiocca EA. Oncolytic viruses. Nat Rev Cancer 2002;2: 7688–98. 36. Li M, Beg AA. Induction of necrotic-like cell death by 938–50. 20. Moon KB, Turner PC, Moyer RW. SPI-1-dependent tumor necrosis factor a and caspase inhibitors: novel 2. Mastrangelo MJ, Lattime EC. Virotherapy clinical trials host range of rabbitpox virus and complex formation mechanism for killing virus-infected cells. J Virol 2000; for regional disease: in situ immune modulation using with cathepsin G is associated with serpin motifs. J Virol 74:7470–7. recombinant poxvirus vectors. Cancer Gene Ther 2002;9: 1999;73:8999–9010. 37. Humlova Z, Vokurka M, Esteban M, Melkova Z. 1013–21. 21. Wasilenko ST, Meyers AF, Helm KV, Barry M. Vaccinia Vaccinia virus induces apoptosis of infected macro- 3. Vile R, Ando D, Kirn D. The oncolytic virotherapy virus infection disarms the mitochondrion-mediated phages. J Gen Virol 2002;83:2821–32. treatment platform for cancer: unique biological and pathway of the apoptotic cascade by modulating the 38. Scaffidi P, Misteli T, Bianchi ME. Release of biosafety points to consider. Cancer Gene Ther 2002;9: permeability transition pore. J Virol 2001;75:11437–48. chromatin protein HMGB1 by necrotic cells triggers 1062–7. 22. Dobbelstein M, Shenk T. Protection against apopto- inflammation. Nature 2002;418:191–5. 4. Zeh HJ, Bartlett DL. Development of a replication- sis by the vaccinia virus SPI-2 (B13R) gene product. 39. Rovere-Querini P, Capobianco A, Scaffidi P, et al. selective, oncolytic poxvirus for the treatment of human J Virol 1996;70:6479–85. HMGB1 is an endogenous immune adjuvant released by cancers. Cancer Gene Ther 2002;9:1001–12. 23. Macen JL, Garner RS, Musy PY, et al. Differential necrotic cells. EMBO Rep 2004;5:1–6. 5. Stanziale SF, Fong Y. Novel approaches to cancer inhibition of the Fas- and granule-mediated cytolysis 40. Smith GL, Law M. The exit of vaccinia virus from therapy using oncolytic viruses. Curr Mol Med 2003;3: pathways by the orthopoxvirus cytokine response infected cells. Virus Res 2004;106:189–97. 61–71. modifier A/SPI-2 and SPI-1 protein. Proc Natl Acad Sci 41. Wasilenko ST, Stewart TL, Meyers AF, Barry M. 6. Guo ZS, Bartlett DL. Vaccinia as a vector for gene U S A 1996;93:9108–13. Vaccinia virus encodes a previously uncharacterized delivery. Expert Opin Biol Ther 2004;4:901–17. 24. Kettle S, Alcami A, Khanna A, Ehret R, Jassoy C, mitochondrial-associated inhibitor of apoptosis. Proc 7. Thorne SH, Kirn DH. Future directions for the field Smith GL. Vaccinia virus serpin B13R (SPI-2) inhibits Natl Acad Sci U S A 2003;100:14345–50. of oncolytic virotherapy: a perspective on the use of interleukin-1h-converting enzyme and protects virus- 42. Stewart TL, Wasilenko ST, Barry M. Vaccinia virus vaccinia virus. Expert Opin Biol Ther 2004;4:1307–21. infected cells from TNF- and Fas-mediated apoptosis, F1L protein is a tail-anchored protein that functions at 8. Shen Y, Nemunaitis J. Fighting cancer with vaccinia but does not prevent IL-1h-induced fever. J Gen Virol the mitochondria to inhibit apoptosis. J Virol 2005;79: virus: teaching new tricks to an old dog. Mol Ther 2005; 1997;78:677–85. 1084–98. 11:180–95. 25. Shisler JL, Isaacs SN, Moss B. Vaccinia virus serpin-1 43. Garcia MA, Guerra S, Gil J, Jimenez V, Esteban M. 9. Bartlett DL. Vaccinia virus. In: Herna´iz Driever P, deletion mutant exhibits a host range defect character- Anti-apoptotic and oncogenic properties of the dsRNA- Rabkin SD, editors. Replication-competent viruses for ized by low levels of intermediate and late mRNAs. binding protein of vaccinia virus, E3L. Oncogene 2002; cancer therapy. Monogr Virol. Vol. 22. Basel (Switzer- Virology 1999;262:298–311. 21:8379–87. land): Karger; 2001. p. 130–59. 26. Law KM, Smith GL. A vaccinia serine protease 44. Zeh HJ, Lotze MT. Addicted to death: invasive cancer 10. McCart JA, Ward JM, Lee J, et al. Systemic cancer inhibitor which prevents virus-induced cell-fusion. J Gen and the immune response to unscheduled cell death. therapy with a tumor-selective vaccinia virus mutant Virol 1992;73:549–57. J Immunother 2005;28:1–9. lacking thymidine kinase and vaccinia growth factor 27. Hanahan D, Weinberg RA. The hallmarks of cancer. 45. Vakkila J, Lotze MT. Inflammation and necrosis genes. Cancer Res 2001;61:8751–7. Cell 2000;100:57–70. promote tumour growth. Nat Rev Immunol 2004;4: 11. Hay S, Kannourakis G. A time to kill: viral manipu- 28. Igney FH, Krammer PH. Death and anti-death: 641–8. lation of the cell death program. J Gen Virol 2002;83: tumour resistance to apoptosis. Nat Rev Cancer 2002; 46. Lotze MT, Tracey KJ. High-mobility group box 1 1547–64. 2:277–88. protein (HMGB1): nuclear weapon in the immune 12. Boya P, Pauleau AL, Poncet D, Gonzalez-Polo RA, 29. Okada H, Mak TW. Pathways of apoptotic and non- arsenal. Nat Rev Immunol 2005;5:331–42. Zamzami N, Kroemer G. Viral proteins targeting apoptotic death in tumor cells. Nat Rev Cancer 2004;4: 47. Chu JJH, Ng ML. The mechanism of cell death during mitochondria: controlling cell death. Biochim Biophys 592–603. West Nile virus infection is dependent on initial Acta 2004;1659:178–89. 30. Edinger AL, Thompson CB. Death by design: infectious dose. J Gen Virol 2003;84:3305–14. 13. Elkert PG, Silke J, Vaux DL. Caspase inhibitors. Cell apoptosis, necrosis and autophagy. Curr Opin Cell Biol 48. Joseph T, Cepica A, Brown L, Ikede BO, Kibenge FSB. Death Diff 1999;6:1081–6. 2004;16:663–9. Mechanism of cell death during infectious salmon 14. Silver GA, Bird PI, Carrell RW, et al. The serpins are 31. Roper RL, Moss B. Envelope formation is blocked by anemia virus infection is cell type-specific. J Gen Virol an expanding superfamily of structurally similar but mutation of a sequence related to the HKD phospho- 2004;85:3027–36. functionally diverse proteins. J Biol Chem 2001;276: lipid metabolism motif in the vaccinia virus F13L 49. Kettle S, Blake NW, Law KM, Smith GL. Vaccinia virus 33293–6. protein. J Virol 1999;73:1108–17. serpins B13R (SPI-2) and B22R (SPI-1) encode M(r) 38.5 15. Everett H, McFadden G. Poxviruses and apoptosis: a 32. McCart JA, Puhlmann M, Lee J, et al. Complex and 40K, intracellular polypeptides that do not affect time to die. Curr Opin Microbiol 2002;5:395–402. interactions between the replicating oncolytic effect and virus virulence in a murine intranasal model. Virology 16. Kotwal GJ, Moss B. Vaccinia virus encodes two the enzyme/prodrug effect of vaccinia-mediated tumor 1995;206:136–47. proteins that are structurally related to members of the regression. Gene Ther 2000;7:1217–23. 50. Moss B. Genetically engineered poxviruses for plasma serine protease inhibitor superfamily. J Virol 33. Gnant MFX, Puhlmann M, Alexander HR, Jr., Bartlett recombinant gene expression, vaccination, and safety. 1989;63:600–6. DL. Systemic administration of a recombinant vaccinia Proc Natl Acad Sci U S A 1996;93:11341–8. 17. Zhou J, Sun XY, Fernando GJ, Frazer IH. The vaccinia virus expressing the cytosine deaminase gene and 51. Essajee S, Kaufmann HL. Poxvirus vaccines for virus K2L gene encodes a serine protease inhibitor subsequent treatment with 5-fluorocytosine leads to cancer and HIV therapy. Expert Opin Biol Ther 2004;4: which inhibits cell-cell fusion. Virology 1992;189:678–86. tumor specific gene expression and prolongation of 575–88. 18. Ali AN, Turner PC, Brooks MA, Moyer RW. The SPI-1 survival in mice. Cancer Res 1999;59:3396–404. 52. Legrand FA, Verardi PH, Jones LA, Chan KS, Peng Y, gene of rabbitpox virus determines host range and is 34. Mahalingam S, Karupiah G. Modulation of chemo- Yilma TD. Induction of potent humoral and cell- required for hemorrhagic pock formation. Virology 1994; kines by poxvirus infections. Curr Opin Immunol 2000; mediated immune responses by attenuated vaccinia 202:305–14. 12:409–12. virus vectors with deleted serpin genes. J Virol 2004;78: 19. Brooks MA, Ali AN, Turner PC, Moyer RW. A 35. Ramsey-Ewing A, Moss B. Apoptosis induced by a 2770–9.

Cancer Res 2005; 65: (21). November 1, 2005 9998 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2005 American Association for Cancer Research. The Enhanced Tumor Selectivity of an Oncolytic Vaccinia Lacking the Host Range and Antiapoptosis Genes SPI-1 and SPI-2

Z. Sheng Guo, Arpana Naik, Mark E. O'Malley, et al.

Cancer Res 2005;65:9991-9998.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/65/21/9991

Cited articles This article cites 50 articles, 16 of which you can access for free at: http://cancerres.aacrjournals.org/content/65/21/9991.full#ref-list-1

Citing articles This article has been cited by 12 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/65/21/9991.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/65/21/9991. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.