Genetic Mechanisms of Porcine Sapovirus Adaptation to Cell Culture
DISSERTATION
Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University
By
Zhongyan Lu
Graduate Program in Comparative and Veterinary Medicine
The Ohio State University
2015
Dissertation Committee:
Dr. Linda J. Saif (Advisor)
Dr. Qiuhong Wang (Co-Advisor)
Dr. Gireesh Rajashekara
Dr. Armando E. Hoet
Copyrighted by
Zhongyan Lu
2015
Abstract
Human enteric caliciviruses are a leading cause of viral gastroenteritis in humans of all ages worldwide. However, most attempts to grow human enteric caliciviruses in routine cell cultures have failed. This has hampered research on pathogenesis, immunity, virus inactivation, and the development of antivirals and vaccines. Porcine sapovirus
(PoSaV) Cowden strain causes diarrhea in pigs, and is one of only a few culturable enteric caliciviruses. The PoSaV Cowden strain was adapted to a porcine kidney cell line,
LLC-PK, after serially passaging in gnotobiotic pigs and in primary porcine kidney cells.
Compared with the wild-type (WT) PoSaV Cowden strain, the tissue culture-adapted (TC)
PoSaV has eight conserved amino acid substitutions: two in the RNA-dependent RNA polymerase (RdRp) region and six in the capsid protein (VP1) region. By using a reverse genetics system for the TC Cowden strain, pCV4A, four (178, 289, 324, and 328) amino acid substitutions in the VP1, but not the substitutions in the RdRp region, were identified to be critical for the cell culture adaptation of PoSaV Cowden strain. Two (291 and 295) substitutions in the VP1 enhanced virus replication in vitro, but reduced virus replication in vivo. In addition, the 291 and 295 revertants induced higher serum and mucosal antibody responses than TC PoSaV Cowden strain. Three dimensional (3D) structural analysis of the VP1 showed that residue 178 was located in the shell domain near the dimer-dimer interface, which may affect VP1 assembly and oligomerization; residues
ii
289, 291, 324, and 328 were located at the protruding subdomain 2 (P2), which may influence virus binding to the cellular receptors; residue 295 was located at the interface of two monomeric VP1 proteins, which may influence VP1 dimerization.
Next, these findings were tested using other Cowden-like genogroup III PoSaVs.
The complete genomes of two Cowden-like PoSaV strains, WT JJ259 and WT LL14 were sequenced and compared with those of Cowden and TC LL14. Sequence alignment showed that three (178, 289, and 324) of the four critical amino acids in the VP1 of TC
LL14 remained the same as WT Cowden. This result suggested that the critical amino acids for cell culture adaptation are likely strain- and structure-dependent. The hypothesis is that the complete VP1 of TC Cowden may enable unculturable Cowden-like genogroup III PoSaVs to grow in LLC-PK cells. To address this hypothesis, a reverse genetics system for WT LL14 (pLL14) and JJ259 (pJJ259) was established based on the pCV4A system. The VP1 of WT LL14 was replaced with that of TC Cowden to generate a chimera LL14-pCV4AVP1. It replicated in the LLC-PK cells, but to a 2 log10-lower infectious titer compared with pCV4A.
These results confirmed for the first time that the VP1 is critical for the adaptation of not only the Cowden strain, but also other Cowden-like PoSaVs, to LLC-PK cells.
These findings provide important information potentially applicable to the establishment of cell culture systems for human enteric caliciviruses.
iii
Acknowledgments
I would like to express my deepest gratitude to my advisor, Dr. Linda J. Saif, and my co-advisor, Dr. Qiuhong Wang, for their guidance, support, encouragement and constructive criticism for doing research. I would like to thank Dr. Gireesh Rajashekara and Dr. Armando E. Hoet for their helpful comments and advice. I also appreciate the
OARDC that provides me the opportunity to pursue my academic training at The Ohio
State University.
I would like to thank Dr. Tomoichiro Oka and Dr. Masaru Yokoyama for their advice on my experiment, and their help on structural modeling. I am indebted to Dr.
Kwonil Jung and Dr. Thavamathi Annamalai for their support on histopathology and immunology. I also wish to extend my gratitude to Dr. Ning Chen and Dr. Kyeong-Ok
Chang for their support on molecular cloning and in vitro studies.
I would like to thank Dr. Xiang Gao, Dr. Chun-Ming Lin, Dr. Xinsheng Liu, Dr.
Kang Ouyang, Lulu Shao and Yixuan Hou, for their help and advice. I am grateful to
Xiaohong Wang, Susan Sommer-Wagner, and Marcia Lee for their technical support. I also would like to thank Dr. Juliette Hanson, Ronna Wood, Jeff Ogg, and Megan Strother for their great help with animal maintenances.
iv
I wish to express my gratitude to Robyn Weimer and Hannah Gehman for their help. I would thank all the other staff members, graduate students, postdocs and visiting scholars of the Food Animal Health Research Program for their cooperation and support.
I am also grateful to my ex-advisor, Dr. Weihuan Fang in Zhejiang University, for his encouragement. I would like to thank my parents and my fiancée, who always support me and encourage me with their best wishes.
v
Vita
2007 to 2011 ...... B.S., Zhejiang University
2011 to present ...... Graduate Research Assistant, Ohio
Agricultural Research and Development
Center, The Ohio State University
Publications
• Lu Z, Yokoyama M, Chen N, Oka T, Jung K, Chang KO, Annamalai T, Wang Q, Saif LJ. 2015. Mechanism of cell culture adaptation of an enteric calicivirus, porcine sapovirus Cowden strain (Accepted by JVI).
• Liu X, Lin CM, Annamalai T, Gao X, Lu Z, Esseili MA, Jung K, El-Tholoth M, Saif LJ, Wang Q. 2015. Determination of the infectious titer and virulence of an original US porcine epidemic diarrhea virus PC22A strain. Vet Res 46:109.
• Lin CM, Annamalai T, Liu X, Gao X, Lu Z, El-Tholoth M, Hu H, Saif LJ, Wang Q. 2015. Experimental Infection of a US Spike-Insertion Deletion Porcine Epidemic Diarrhea Virus (PEDV) in Conventional Nursing Piglets and Cross-Protection to Original US PEDV Infection. (Accepted by Vet Res).
• Jung K, Hu H, Eyerly B, Lu Z, Chepngeno J, Saif LJ. 2015. Pathogenicity of 2 porcine deltacoronavirus strains in gnotobiotic pigs. Emerging infectious diseases 21:650-654.
• Jung K, Eyerly B, Annamalai T, Lu Z, Saif LJ. 2015. Structural alteration of tight and adherens junctions in villous and crypt epithelium of the small and large intestine of conventional nursing piglets infected with porcine epidemic diarrhea virus. Veterinary microbiology.
vi
• Jung K, Annamalai T, Lu Z, Saif LJ. 2015. Comparative pathogenesis of US porcine epidemic diarrhea virus (PEDV) strain PC21A in conventional 9-day-old nursing piglets vs. 26-day-old weaned pigs. Veterinary microbiology.
• Hu H, Jung K, Vlasova AN, Chepngeno J, Lu Z, Wang Q, Saif LJ. 2015. Isolation and Characterization of Porcine Deltacoronavirus from Pigs with Diarrhea in the United States. Journal of clinical microbiology.
• Jung K, Wang Q, Scheuer KA, Lu Z, Zhang Y, Saif LJ. 2014. Pathology of US porcine epidemic diarrhea virus strain PC21A in gnotobiotic pigs. Emerging infectious diseases 20:662-665.
• Tang Y, Zhang X, Wu W, Lu Z, Fang W. 2012. Inactivation of the sodA gene of Streptococcus suis type 2 encoding superoxide dismutase leads to reduced virulence to mice. Veterinary microbiology 158:360-366.
• Tang Y, Wu W, Zhang X, Lu Z, Chen J, Fang W. 2012. Catabolite control protein A of Streptococcus suis type 2 contributes to sugar metabolism and virulence. Journal of microbiology 50:994-1002.
Fields of Study
Major Field: Comparative and Veterinary Medicine
vii
Table of Contents
Abstract ...... ii
Acknowledgments...... iv
Vita ...... vi
List of Tables ...... ix
List of Figures ...... x
Chapter 1: Literature review: caliciviruses, reverse genetics and animal models ...... 1
Objectives and Hypothesis ...... 79
Chapter 2: Mechanism of cell culture adaptation of an enteric calicivirus, porcine sapovirus Cowden strain ...... 82
Chapter 3: The adaptation of genotype III porcine sapovirus to cell culture relies on the
VP1 protein ...... 138
Conclusions and perspectives ...... 169
Bibliography ...... 171
viii
List of Tables
Table 1. Pathogenesis of representative calicivirus strains ...... 76
Table 2. Summary of reverse genetics systems for caliciviruses...... 78
Table 3. Primers for the generation of the chimeric PoSaV clones...... 131
Table 4. Experimental design for inoculation of Gn pigs with PoSaV Cowden TC, WT, or mutants...... 133
Table 5. Summary of amino acid substitutions in the genomes of different passages of
WT or TC PoSaV Cowden strain...... 134
Table 6. Comparative viral RNA shedding parameters of PoSaV Cowden TC, WT, and mutants...... 136
Table 7. Ratios of villus length/crypt depth in different regions of small intestines of Gn pigs...... 137
Table 8. Primers used to construct full-length clone and chimera of WT PoSaV LL14 strain in this study...... 164
Table 9. The amino acid identities between WT LL14 or WT JJ259 strain and TC
Cowden strain...... 165
ix
List of Figures
Figure 1. Electron microscope graphs of porcine sapovirus Cowden strain...... 73
Figure 2. The genomic organization of caliciviruses...... 74
Figure 3. Quasiequivalent arrangement of a T = 3 icosahedral surface...... 75
Figure 4. Diagrams of the constructions of the TC and WT PoSaV and the mutants derived from the pCV4A backbone...... 120
Figure 5. Growth kinetics and representative plaques of TC-pCV4A (TC) and the culturable mutants, TC-WTRdRp, TCVP1-D291N (291), TCVP1-R295K (295) and
TC-WTVP1-C178S&Y289H (Double) in LLC-PK cells...... 122
Figure 6. Superimposition of the modeled structures of PoSaV Cowden and the template
FCV structure and the 3D models of WT and TC PoSaV VP1...... 124
Figure 7. The changes in △G for each point mutation C178S, Y289H, N291D, K295R,
M324I, and E328G...... 126
Figure 8. The viral RNA shedding in geometric mean titer (GMT) at various post-inoculation days (PIDs) of TCVP1-D291N and TCVP1-R295K compared with
TC-pCV4A and WT PoSaV Cowden strain in Gn pigs...... 127
Figure 9. Histopathological examination of small intestinal samples of WT PoSaV
Cowden or mock (NC) infected Gn pigs...... 128
x
Figure 10. The distribution of antigen positive cells per villus in different regions of the small intestine of WT PoSaV-inoculated pigs...... 129
Figure 11. Serum and mucosal antibody responses in Gn pigs...... 130
Figure 12. The phylogenic tree of GIII PoSaVs based on the VP1 sequences...... 158
Figure 13. The genomic organizations of WT LL14, WT JJ259, LL14-pCV4AVP1, and
JJ259-pCV4AVP1...... 159
Figure 14. The IF staining of the LLC-PK cells infected with the transfection lysates of
WT LL14, chimera LL14-pCV4AVP1, pCV4A (as a positive control), and JJ259, using hyperimmune antiserum to PoSaV Cowden VLPs...... 160
Figure 15. Viral infectivity titers of Cowden TCpCV4A and LL14-pCV4AVP1 from PID 0 to
5...... 161
Figure 16. A representative plaque of LL14-pCV4AVP1 and Cowden TCpCV4A at PID 4, respectively...... 162
Figure 17. The consensus strength of the P2 domain (amino acid position 273 to 424) of the GIII PoSaV strains...... 163
xi
Chapter 1: Literature review: caliciviruses, reverse genetics and animal models
1. Introduction
Caliciviruses, belonging to the family Caliciviridae, are officially classified into five genera: Norovirus, Sapovirus, Vesivirus, Lagovirus and Nebovirus. Unclassified caliciviruses, such as Atlantic salmon calicivirus (1), Bavovirus (found in chickens) (2, 3),
Nacovirus (found in turkeys and chicken) (2, 4), Recovirus (found in rhesus monkeys) (5), and Valovirus (found in pigs) (6), may represent new genera. Caliciviruses are non-enveloped viruses with icosahedral symmetry, and 27-40 nm in diameter (7). The genome of caliciviruses consists of a positive sense, single-stranded RNA of 6.5-8.3 kb, which is typically organized into two or three open reading frames (ORFs), except that a novel ORF4 was characterized in murine norovirus (MNV) (7, 8). The 5’ end of the calicivirus genomic RNA is covalently linked to a viral genome-linked protein (VPg) of
10-15 kDa in size, while the 3’ end of the genome is polyadenylated. During replication, two types of viral RNA are observed in the cytoplasm of the infected cells, which are the genomic RNA and the subgenomic RNA (7). All the non-structural (NS) proteins are processed from a large polyprotein encoded by the genomic RNA ORF1, while the major
(VP1) and minor (VP2) structural proteins are encoded by both the genomic and the subgenomic RNA. The virion capsid consists of VP1. The function of VP2 is unknown.
Caliciviruses have been detected in a broad range of animal species, including
1
humans (9), non-human primates (5), pigs (10), mice (11), cattle (12), rabbits (hares) (13), cats (14), dogs (15), sea lions (16), whales (17), mink (18), chickens and turkeys (2, 3), reptiles (19, 20), fish (1), and amphibians (20). Caliciviruses are causative agents of a number of diseases. Feline calicivirus (FCV), a vesivirus, is a common cause of inapparent or mild upper respiratory disease and oral ulceration, and severe systemic disease characterized by high persistent fever, severe edema of face and limbs, pancreatitis or pneumonia with a high mortality rate in cats (21-23). Rabbit hemorrhagic disease virus (RHDV), a lagovirus, causes fatal acute infections in rabbits and hares, including hepatitis and disseminated intravascular coagulation (24). Neboviruses in the genus Nebovirus, previously known as bovine enteric caliciviruses, Nebraska strain in the
US and Newbury-1 strain in the UK, cause endemic diarrhea in calves (25-27).
Sapoviruses (SaVs), in the genus Sapovirus, cause mild to moderate diarrhea in humans, pigs, and mink (10, 18, 28). Noroviruses (NoVs), in the genus Norovirus, also have been detected in different species, including humans, pigs, cows, goats and sheep, and mice (9,
11, 29-32). Human NoVs (HuNoVs), named for the prototype strain Norwalk virus (NV), are recognized as a major cause of gastroenteritis in humans of all ages (9). NoVs also cause gastroenteritis in pigs and calves (33, 34). MNV usually causes asymptomatic infection in wild-type mice, but in immunodeficient mice, it causes systematic infection with clinical signs (11). Although MNV shedding in feces of mice was detected, MNV can also be found in other organs such as liver and spleen (11). Tulane virus (TV), a recently discovered primate calicivirus, represents a distinct potentially new genus,
Recovirus. It causes diarrhea and fever, but not vomiting or viremia in experimentally infected juvenile rhesus macaques (5). 2
Human SaVs (HuSaVs) and HuNoVs are often referred to as human enteric caliciviruses. Although HuNoVs are recognized as the leading cause of gastroenteritis in humans, research on human enteric caliciviruses has been hampered due to the lack of a robust cell culture system. Only a few caliciviruses grow in cell culture, including several vesiviruses [San Miguel sea lion virus (SMSV) (35), vesicular exanthema of swine virus
(VESV) (36), and FCV (37)], MNV (38), TV (5) and porcine SaV (PoSaV) Cowden strain (39, 40). Therefore, knowledge of the mechanisms of calicivirus replication in vitro has been acquired from the culturable animal caliciviruses. Research on the pathogenesis of human enteric calicivirus infection relies on the establishment of various animal models. HuNoVs have been studied in animal models including chimpanzees (41), gnotobiotic (Gn) pigs and calves (42, 43), and genetically modified mice (44). However, with various clinical features that are different from HuNoV infection in humans, each animal model has advantages and disadvantages. HuSaV studies in animal models have not been reported.
Here the breakthroughs in calicivirus research were summarize and emphasize.
The strategies and application of reverse genetics systems established for caliciviruses were also discuss. The advantage and disadvantage of different animal models in use for human enteric calicivirus will be discussed.
2. History of caliciviruses
2.1 History of caliciviruses
The history of caliciviruses can be traced back to 1932 when an outbreak of an unknown pathogen in swine was reported in Orange County in California, USA (45). A 3
large herd of pigs became sick with vesicular lesions on the feet and snouts after being fed raw garbage from restaurants and institutions. From 1932 to 1939, multiple outbreaks of this disease occurred (45). As the lesions on the feet and snouts were undistinguishable from those caused by foot-and-mouth-disease virus (FMDV), more than 19,000 exposed cattle and pigs were destroyed and buried (45). It was found later that this disease was caused by a virus that did not infect cattle; thus the disease was called vesicular exanthema of swine (VES), and the virus was named VESV. In 1956, the last outbreak of
VESV was reported in the US. In 1959, it was declared to have been eradicated in the US
(45).
The history of FCV can be traced back to 1957, when it was isolated from cell culture by accident (46). Subsequently, FCV was recognized as an important pathogen causing respiratory diseases in cats (14).
In 1972, SMSV, a marine origin calicivirus, was isolated from sea lions (16). At least eight serotypes have been characterized from different ocean species, including
California sea lion, whales, and opaleye perch (17, 35, 47-49). Phylogenetic analysis suggested that VESV and SMSV have a close genetic relatedness, and VESV may originate from SMSV infected marine animals (50).
RHDV was first discovered in China in 1984 in a group of commercially bred rabbits imported from Germany. It killed 140 million domestic rabbits in China in less than a year (51). Thereafter, Europe, North Africa, Australia and America reported outbreaks of RHDV, accompanied with economic losses in the rabbit meat and fur industry (52-55). Mexico, due to the absence of wild European rabbits that are a reservoir of RHDV, is currently the only country that has eradicated RHDV (55). 4
2.2 History of enteric caliciviruses
NV, the prototype of genus Norovirus, was first visualized in 1972 by immune electron microscopy (IEM) in stool filtrates derived from an outbreak of acute gastroenteritis in an elementary school in Norwalk, Ohio in the winter of 1968 (9). The
NV particles were small, round viruses of 27-32 nm as visualized by IEM. The IEM technique in this study is important because the specific antibody to NV in the serum samples of an infected individual aggregated virus particles and increased detection sensitivity compared to the EM method. Thereafter, the IEM technique has been widely applied to the identification of other HuNoVs such as Hawaii virus in 1977 and the Snow
Mountain virus in 1982 (56, 57), which were called Norwalk-like viruses (NLVs).
However, because of the limited detection methods and knowledge of human enteric caliciviruses, they were considered as a small component of the etiological agents related to gastroenteritis (58). Enteric calicivirus particles with typical calicivirus morphology, later classified as HuSaVs, were first found in the stools from children with gastroenteritis in 1976 in Glasgow, Scotland by EM (59, 60).
The prototype of the Sapovirus genus, the Sapporo virus, was first detected in fecal samples collected from children in an infant home in Sapporo, Japan, in 1977 (28).
Later in 1982, it was detected from fecal samples collected from children in an outbreak in the same infant home (61). This strain (Hu/SaV/GI.1/Sapporo/1982/JPN) was studied extensively and became the prototype of the Sapovirus genus. In 1978, another calicivirus was detected from stool specimens from children with symptoms of vomiting and diarrhea in a nursery school in London, UK (62). Calicivirus particles were observed in stools from symptomatic schoolchildren, but not the asymptomatic group, by EM (62). 5
HuSaVs were then recognized as important causative pathogens of human gastroenteritis
(62-64). Sapoviruses have a distinct “Star-of-David” configuration in EM (Figure 1); thus, the viruses with similar morphology were called “Sapporo-like viruses (SLVs)” (65).
PoSaV was first detected by EM in the intestinal contents of a 27-day-old diarrheic nursing pig in 1980, and was the first animal SaV discovered (10). The PoSaV was previously called “porcine enteric calicivirus (PEC)” until it was characterized as a SaV in 1999 (66).
Since the 1990s, molecular characterization methods have been widely used for the detection of different caliciviruses, and the genetic diversity and phylogenetic analyses of SLVs and NLVs. The SLVs and NLVs were officially assigned to the genera
Sapovirus and Norovirus, respectively, in the family Caliciviridae in 2002 (67, 68).
During the last four decades since the first SaV was detected, PoSaV Cowden strain and LL14 strain have been the only reported culturable SaVs. After 13 passages in
Gn pigs followed by 19 passages in primary porcine kidney cells, PoSaV Cowden strain was adapted to a continuous porcine kidney cell line, LLC-PK (39, 40). Besides PoSaV
Cowden strain and LL14 strain, only a few animal caliciviruses in the family
Caliciviridae were culturable in routine cell culture, such as SMSV, VESV, MNV, FCV, and TV (5, 35, 69, 70), among which only TV is primarily an enteropathogenic calicivirus. Many attempts to culture HuNoVs and HuSaVs have been reported, but most failed (71-74). A three-dimensional (3D) rotating wall vessel system using either human embryonic intestinal epithelial cells (Int-407) or human epithelial colorectal adenocarcinoma cells (Caco-2) was described to support HuNoV replication (75).
However, this result was not replicated by others (72). Recently, a human B cell line, 6
BJAB, was reported to support replication of HuNoV GII.4/Sydney strain, as evident by low-level increases in viral genome copy numbers (76). The HuNoV replication was significantly enhanced by enteric bacteria expressing histo-blood group antigens (HBGAs)
(76). Overall, the culturable caliciviruses are still important models to investigate the properties and replication of HuSaVs and HuNoVs in vitro.
3. The classification of caliciviruses
3.1 Phylogenetic classification
Caliciviruses were first considered as a branch of picornavirus or parvovirus, based on their morphology, when NoVs were first visualized using EM (9). Those viruses were officially accepted as a family of small, round and positive-stranded RNA viruses in
1979 (77). In 1995, only one genus, Calicivirus, was recognized for all the discovered caliciviruses, although later prototypes of SaVs, NoVs, and vesiviruses were discovered
(78). The application of PCR and sequencing aided in the classification of caliciviruses.
In 2000, four genera, including Norovirus, Sapovirus, Lagovirus, and Vesivirus were recognized (14). Although the bovine enteric calicivirus Newbury agent-1 was first identified in 1976, it was only recognized as an individual genus in the family
Caliciviridae in 2006, after another bovine enteric calicivirus, Nebraska virus, which was detected from a dairy calf in 1980, became the first nebovirus to be completely sequenced and characterized as a distinct clade of the four genera (27, 79). The Newbury agent-1 and the Nebraska virus were officially classified as the fifth genus Nebovirus in the family Caliciviridae in 2011 (7). The broader detection of caliciviruses in different animals and the improvement of high throughput screening technology have led to the 7
discovery of new caliciviruses. The TV was discovered from a rhesus monkey in 2008 and may represent a novel proposed genus, Recovirus (5). The St-Valerien-like viruses were first detected from pig feces between 2005 and 2007 in Canada and 2011 in the US, and were characterized as a novel calicivirus, which may also represent a novel genus
Valovirus (6, 80). Several novel caliciviruses have been isolated from poultry, named chicken enteric calicivirus Bavaria/04 strain, which belongs to a potential genus
Bavovirus (2, 3); turkey calicivirus strain L11043 and goose calicivirus N strain, which belong to a potential genus Nacovirus (2, 4, 81). Recently, a novel calicivirus causing systemic infection in Atlantic salmon was also isolated and characterized as a potential genus Salovirus of calicivirus (1). As a result, besides the five recognized genera in the family Caliciviridae, the new genera Recovirus, Valovirus, Bavovirus, Nacovirus, and
Salovirus have been proposed.
The early phylogenetic analyses initially classified HuNoVs into two genogroups that were designated genogroup I (GI) and GII. The NV belongs to GI, while the Hawaii virus and the Snow Mountain virus (SMV) belong to GII (82, 83). To date, NoVs are divided into seven genogroups (GI to GVII) and further divided into multiple genotypes within each genogroup (84-86). Among the seven genogroups of NoVs, GI NoVs are exclusively human pathogens, the GII NoVs include both human and porcine NoVs, the
GIII NoVs include both bovine and ovine NoVs, the GIV NoVs include human, feline and canine NoVs, the GV NoVs are exclusively MNVs, the GVI NoVs include feline and canine, and the GVII NoVs are currently only canine NoVs (32, 84, 86-92).
For SaVs, three major genogroups (GI to GIII) and an unclassified genogroup were identified initially (93, 94). With the wider detection of SaVs, SaVs were classified 8
into at least five genogroups, among which HuSaVs were grouped into GI, GII, GIV, and
GV, and PoSaVs were grouped into GIII (95, 96). Besides humans and pigs, SaVs have been detected from a variety of hosts, including mink (18), dogs (97), sea lions (98), and bats (99). Recent comprehensive phylogenetic studies classified SaVs into fourteen genogroups, which grouped mink, dog, and bat SaVs into GXII, GXIII and GXIV, respectively (100, 101). Although HuSaVs remained in GI, GII, GIV, and GV, PoSaVs presented high diversity and relatedness to HuSaVs, and were grouped into GIII, GV,
GVI, GVII, GVIII, GIX, GX, and GXI (100-104).
Caliciviruses have been detected from a broad range of host species, but appeared to be relatively restricted to the host species. Cross-species transmission is mostly associated with vesiviruses of marine origin (105, 106), but rarely recognized in other genera of caliciviruses. The interspecies transmission may be a consequence of accumulative viral mutation and recombination (107). SaVs and NoVs with inconsistent genotyping between the RdRp and VP1 encoding regions have been determined
“recombinant” strains. Recombinants have been reported between NoVs within the same genogroup and the same host species, including pigs and humans, based on the VP1 sequences (29, 108-113). Recombinant SaVs also have been reported (34, 114, 115).
Unlike NoVs, both inter- and intragenogroup recombination were observed in SaVs within the same host species including pigs and humans (116-120). However, due to the fewer reported sequences of RdRp compared to the complete VP1 sequences, the
RdRp-based genotyping is less representative for genotyping. A phylogenetic analysis based on the RdRp and VP1 regions of GI, GII, GIII, GIV, and GV SaVs revealed a conserved amino acid motif “WKGL” in the putative RdRp region (101). As a result, 9
further phylogenetic analysis should use fragments covering both RdRp and VP1 encoding regions to determine recombination events (101).
3.2 Genomic organization of caliciviruses
The genomic RNA of caliciviruses is 6.5 to 8.3 kb in size and polyadenylated at the 3’ end. A VPg of 10-15 kDa is covalently linked to the 5’ end of the genome, and is essential for the initiation of translation (121). The genomic RNA is typically organized into two (genera Lagovirus, Sapovirus, and Nebovirus) or three (genera Vesivirus and
Norovirus) ORFs (Figure 2) (7, 101). A novel ORF4 that overlaps the VP1 coding region was characterized in MNV (8). Subsequently, a protein named virulent factor 1 (VF1) was characterized to be encoded by the ORF4, which was not essential for viral replication in cell culture. It decreased apoptosis in the RAW264.7 cell line in vitro, and inhibited the innate immune response and delayed the onset of clinical signs in vivo (8). It was reported that SaVs in GI, GIV, GV and the potential GXIV genogroups have an
ORF3 of ~500bp overlapping the ORF1 VP1 region, of which the function is unknown
(61, 99, 101, 122).
The genomes of lagoviruses, sapoviruses, and neboviruses consist of two ORFs
(Figure 2A). Using SaV as an example, the ORF1 of the SaV genome encodes a large polyprotein precursor that undergoes proteolytic cleavage into at least six non-structural proteins (NS1, NS2, NS3, NS4, NS5, and NS6-NS7) and the major structural protein VP1
(Figure 2A) (123-125). The NS6 region of SaVs contains a conserved protease functional motif GDCG (126). The in vitro expressed recombinant SaV NS6 itself has proteolytic functions (126, 127). The NS7 region of SaVs contains functional motifs GLPSG and
YGDD, which are conserved in the RdRp region among all caliciviruses (66). The 10
prokaryotic cell expressed recombinant NS7 protein functions in RNA synthesis in vitro and its crystalized structure was analyzed (128). Therefore, the functions of NS6 and NS7 as proteases and RdRp in SaV were confirmed. However, NS6-NS7 fused protein, instead of individual NS6 and NS7 proteins, was detected in PoSaV infected cells, indicating that
NS6-NS7 fused protein is the natural functional form of protease and RdRp of SaVs
(Figure 2A) (129). The SaV NS3 has a conserved NTPase motif, suggesting that NS3 encodes a NTPase (Figure 2A) (66, 126). The SaV NS5 has a conserved VPg motif, and the PoSaV VPg protein was detected from infected cells by antibodies raised against the recombinant PoSaV VPg proteins expressed in prokaryotic cells using the predicted NS5 region (Figure 2A) (129). The functions of the other NS proteins of SaVs have not been experimentally determined. In lagoviruses, sapoviruses, and neboviruses, the ORF2 was predicted to encode the VP2 (Figure 2A) (66, 129).
The genomes of noroviruses and vesiviruses consist of three ORFs (Figure 2B).
As mentioned earlier, ORF4 was characterized in MNV to encode VF1 (8). Using MNV as an example, the ORF1 of MNV encodes the large polyprotein that undergoes proteolytic processing into at least six NS proteins, which include p38.3, p39.6, p18.6, p14.3, p19.2 and p57.5 (130). Among them, p38.3 was the N terminus protein, p39.6 was the NTPase, p14.3 was predicted to encode VPg, p19.2 acted as a protease, and p57.5 acted as the RdRp (Figure 2B) (130). p18.6 of a GII.4 HuNoV strain modulated actin cytoskeleton remodeling in an epithelial cell line HT-29/B6 in vitro (Figure 2B) (131).
Unlike lagoviruses, sapoviruses, and neboviruses that contains two ORFs, the noroviruses and vesiviruses encode the major structural protein VP1 in a separate ORF (ORF2)
(Figure 2B). In the noroviruses and vesiviruses, ORF3 is predicted to encode a minor 11
structural protein VP2 (Figure 2B).
The genomic RNA and the subgenomic RNA of caliciviruses were observed in the cytoplasm of infected cells during viral replication (Figure 2) (7, 132). The subgenomic
RNA of caliciviruses is 2.2 to 2.4 kb in size, and covalently linked to the VPg as the genomic RNA (133, 134). The 5’ end sequence of genomic RNA and subgenomic RNA is conserved. Negative-sense genomic RNA was detected in cells infected with FCV, MNV, and in NoV replicon-bearing cells (135-137), which suggested that the negative-sense genomic RNA intermediate may act as a template for further genomic and subgenomic
RNA synthesis. A conserved stem-loop that positions 6 nucleotides upstream of the start site of the subgenomic RNA was reported to be essential for the initiation of subgenomic
RNA synthesis (135). The subgenomic RNA of caliciviruses is synthesized from the
RdRp-VP1 junction to the end of the genome by RdRp and encodes VP1 and VP2 (128,
138, 139).
Because of the existence of the subgenomic RNA during calicivirus replication, the structural proteins VP1 and VP2 have two sources, which are both genomic and subgenomic RNA. In sapoviruses, lagoviruses, and neboviruses that contain two ORFs,
VP1 is processed from the ORF1 encoded polyprotein by the viral protease, and is expressed from subgenomic RNA, while in caliciviruses that typically contain three
ORFs, such as noroviruses and vesiviruses, VP1 is encoded by the ORF2 in genomic and subgenomic RNA. Since the subgenomic RNA of caliciviruses is presumed to be covalently linked to the VPg at the 5’ end and polyadenylated at the 3’ end, as described in FCV (140), the expression of VP1 from subgenomic RNA may be initiated by the similar VPg-dependent mechanism as the NS proteins from ORF1 (141). It was 12
demonstrated that in FCV, the stop codon (UGA) of the VP1 overlaps the start codon
(AUG) of the VP2 and forms a sequence of AUGA (142). In MNV, the VP2 start codon
(AUG) overlaps the stop codon of the VP1 (UAA) and forms a sequence of UAAUG. It was also reported that in RHDV, a similar mechanism is used for VP2 expression (143).
As a result, the calicivirus VP2 expression is regulated by a termination-reinitiation mechanism, which is dependent on the RNA secondary structure and the binding to 18S rRNA (142, 144, 145).
The VP2 has been considered as a minor structural protein for caliciviruses. In the noroviruses and vesiviruses, VP2 is encoded by ORF3, while in sapoviruses, lagoviruses and neboviruses, VP2 is encoded by ORF2. In NV, it was reported that VP2 was located in the interior of the viral particle and interacted with the S domain in the VP1, and thus may enhance virus assembly and stability (139). In FCV, it was also reported that, although deletions in the 5’ end and 3’ end of ORF3 did not impair viral replication in host cells, infectious virus was not recovered (138, 146). The expression of VP2 is necessary for self-assembly of FCV virus-like particles (VLPs) (138, 146). The
FCV-VLPs generated from VP1 alone showed different sizes and atypical cup depressions, while the FCV-VLPs assembled from VP1 and VP2 showed similar morphology to the native FCV virions (146). The PoSaV-VLPs generated in the baculovirus-expression system were constructed with the VP1 gene only. The VLP yield was low and the VLPs were unstable although they had the similar morphology and antigenicity as PoSaV virions (147).
Besides the function of VP2 as the minor structural protein, MNV VP2 regulated the maturation of antigen presenting cells and correlated with NoV protective immunity 13
(148). Therefore, it may be speculated that the expression of calicivirus VP2 uses a termination-reinitiation mechanism and may stabilize the capsid structure.
3.3 Morphology
Calicivirus virions are non-enveloped particles with T = 3 icosahedral symmetry, and are 27 to 40 nm in diameter (9). The characteristic property of the calicivirus virion is the cup-shaped depression on the surface (149). The calicivirus capsid is composed of 90 dimers of the major structural protein VP1. Like other T = 3 viruses, the calicivirus capsid consists of three quasiequivalent subunits, named A, B, and C following the standard nomenclature (Figure 3) (150). The A and B subunits form A/B dimers, while two C subunits form C/C dimers.
The first structure of a calicivirus was determined for a calicivirus detected from a pygmy chimpanzee (Pan paniscus) in 1994, using cryo-electron microscopy (cryo-EM) and computer assisted image-processing techniques (151). This primate calicivirus was phylogenetically related to SMSV and FCV, and thus grouped into genus Vesivirus (5,
152). Using the same techniques, the first structure of baculovirus-expressed recombinant
Norwalk virus-like (rNV) particles was also determined (153). These two studies revealed the three structural domains in the capsid protein: a shell (S) domain, a protruding (P) domain 1, and a P domain 2 (151, 153). The detection resolution of the cryo-EM method was 22 Å, which was much lower than the resolution of X-ray crystallography. In 1999, the first X-ray structure for the rNV particles (PDB No.: 1IHM) was determined at a resolution of 3.4 Å, which clearly confirmed in the capsid, an
N-terminal arm (NTA) domain (residues 10 to 49), the S (residues 50 to 225) and P
(residues 226 to 520) domains (154). The P domain was further divided into three 14
subdomains, P1A (residues 226 to 278), P2 subdomain (residues 279 to 405) and P1B
(residues 406 to 520) subdomains.
Besides NV, the prototype of HuNoVs, the 3D structures of several other caliciviruses have been determined. The SMSV genome encodes a capsid protein of 60 kDa, which is significantly larger than the capsid of other caliciviruses (≈ 55 kDa). The
3D structure of native SMSV was reported (PDB No.: 2GH8) (155). Like the rNV particle, its capsid protein is divided into NTA, S domain, and P domain (P1 subdomain, residues 362 to 413 and 590 to 703; P2 subdomain, residues 414 to 589) (155).
Although first attempt to determine the structure of FCV was conducted in 1995
(156), the 3D structure of FCV was not determined until 2008 at 16 to 18 Å resolution using cryo-EM and 3D image reconstruction (157). This study showed conformational changes in the P domain of the viral capsid when binding to feline junctional adhesion molecule A (fJAM-A), which is the receptor of FCV. This discovery was confirmed by using X-ray crystallography at a resolution of 3.6 Å (PDB No.: 3M8L) (158). Besides the fundamental morphological properties examined for FCV, 24 soluble receptor-resistant mutants containing one or two point mutations within the VP1 were analyzed. Eight mutations were found to be related to virus growth in vitro and receptor binding (158).
With a higher resolution, it was reported that the capsid protein was also divided into the
NTA, S domain, and P domain (P1 subdomain, 330 to 381 and 551 to 662; P2 domain,
328 to 550) (158).
With improvements in technology, the resolution of cryo-EM has been upgraded from 22 Å to less than 6.5 Å, making cryo-EM a good tool to resolve the 3D structure of caliciviruses. The 3D structure of a lagovirus, RHDV, was determined using cryo-EM at 15
6.5 Å resolution (159). The VP1 of RHDV is divided into NTA, S domain and P domain, which is further divided into P1A, P2 and P1B subdomains. Recently, the 3D structure of a newly discovered primate enteric calicivirus, TV, was reported (160). The TV capsid protein VP1 (≈ 57 kDa) is also composed of NTA, S domain, and P domain. The most distinctive feature of TV is the flexible conformation of C/C dimers that reduced the interaction between the S domain and the P domain (160). It suggested that the flexibility of the P domains was required for interaction with the host cells.
To date, the 3D structures of TV and members in the genera Norovirus, Lagovirus and Vesivirus have been reported, but leaving the structures of Sapovirus and Nebovirus unknown. Regardless of the different species of caliciviruses, the major capsid protein
VP1 is composed of NTA, S domain, and P domain. The P domain is further divided into
P1 and P2 subdomains. The P2 subdomain is the most exposed and variable region of the
VP1 (154, 158, 160). The P2 subdomain may be responsible for the binding to host receptors, and induce host immune responses.
The SaV VP1 expressed in insect and mammalian cells assembled into VLPs spontaneously (147, 161-163). The VLPs are morphologically and antigenically similar to the SaV virions (163). Some researchers divide the VP1 of SaV into the S domain and
P domain (164). Others divide the SaV VP1 into N-terminal variable region (NVR),
N-terminal region (NTR), central variable region (CVR), and C-terminal region (CTR)
(165). The CVR corresponds to the P2 subdomain of other caliciviruses (165).
3.4 Resistance to physicochemical treatment
The physical and chemical properties of caliciviruses are very important to the food industry since caliciviruses are a leading cause of foodborne infections. Research on 16
the physical and chemical properties of caliciviruses have focused on use of culturable caliciviruses such as VESV, FCV, MNV, PoSaV Cowden strain, or use of VLPs as surrogates for unculturable caliciviruses.
Caliciviruses are highly stable in the environment. At room temperature (25℃),
MNV retains infectivity after 7 days or more on stainless steel surfaces (166). When the temperature was raised from 50℃ to 70℃, the infectivity of MNV and FCV decreased dramatically (167, 168). Both MNV and FCV could be inactivated efficiently in a short time in optimal concentration of alcohols, such as 62% to 75% ethanol (169), 50% to 80%
1-propanol (170, 171), and 50% to 70% 2-propanol (170). However, inactivation of
HuNoV using alcohol-based hand sanitizers was proven experimentally to be ineffective
(172), suggesting that HuNoVs are resistant to low concentration of alcohols. Enteric caliciviruses are more resistant to acidic environments than other caliciviruses such as
FCV (168, 173). High hydrostatic pressure combined with heat inactivation is also an effective physical method to inactivate FCV. The combination of 200 MPa and 50℃, efficiently inactivated FCV (174, 175).
The means of inactivating caliciviruses, especially human enteric caliciviruses, have been widely applied to the food industry and personal hygiene practices. The
Centers for Disease Control and Prevention (CDC) suggested using appropriate hand hygiene practices to prevent norovirus infection and transmission, by washing with tap water and plain or antiseptic soap for at least 20 seconds (176, 177). For environmental disinfection, since caliciviruses are highly stable in the environment, chlorine bleach solution is suggested to be applied to hard, nonporous, environmental surfaces at a
17
concentration of 1,000 to 5,000 ppm (177). In health care facilities, it was suggested to apply disinfectants to surfaces following manufacturer's instructions for dilution, application, and contact time (177).
4. Epidemiology of caliciviruses
4.1 Epidemiology of HuNoVs
The CDC estimated that in the US, NoVs cause 21 million cases of illness, resulting in 1.7 million physician’s office visit, 400,000 emergency department visits,
71,000 hospitalizations, and 800 deaths annually (178). The annual cost related to NoV in the US is approximately $777 million (179). All age groups are susceptible to HuNoV infection, although most of the morbidity and mortality occurs in the young and old age groups (180). In pediatric populations, NoVs are second to rotavirus in causing acute gastroenteritis, and cause an estimated 200,000 deaths annually in children younger than
5-year old in developing countries (181-183). NoV is associated with gastrointestinal illness in neonates (184). NoV infection in preterm infants receiving intensive care in a hospital neonatal intensive care unit has been reported (185). Elderly individuals (65 years of age or older) have been at increased risks for NoV associated gastrointestinal illness and death as well (186). It was estimated that in Canada from 2001 to 2004, the average age of hospitalized patients due to NoV infection was 59-year old (187). In Israel, an outbreak occurred in six nursing homes was responsible for about 2% fatality rate
(188).
The HuNoV transmission is mainly through the fecal-oral route. Contaminated food, water, and environmental surfaces are the major vehicles of transmission. 18
Aerosolized virus particles in vomitus contribute to the transmission of NoVs as well
(189-191). The foodborne transmission was responsible for 54% (362/666) of the reported NoV outbreaks, whereas the fewest number (9%) of outbreaks was associated with environmental transmission (60/666) (191). It has been demonstrated that NoVs are the leading cause of foodborne illness in the US, followed by non-typhoidal Salmonella,
Clostridium perfringens, Campylobacter spp., and Staphylococcus aureus (192). Water contaminated with NoVs has been correlated with foodborne and waterborne transmission as well (193). Oysters and mussels are an important cause of foodborne norovirus outbreaks (194-199). In addition, waterborne transmission is also an important route causing major NoV outbreaks. In 1982, waterborne NoV transmission and an outbreak affecting 1500 persons was first reported in Georgia, US (200). In Finland from
1998 to 2003, NoVs were associated with 18 waterborne outbreaks out of 28 samples
(201). Thereafter, water contamination with NoVs has been reported more frequently
(201-204).
Although HuNoVs have been classified into GI, GII and GIV, the seroprevalence of GII HuNoVs was usually greater than those of GI and GIV HuNoVs (205-207).
Recently, a seroprevalence study on GIV NoVs in Italy showed that up to 44.8% of the population was GIV NoV antibody positive, suggesting a potential increase of GIV NoV infections in humans (208). In the US, GII.4 HuNoVs are responsible for 80% of NoV acute gastroenteritis outbreaks (207, 209).
4.2 Epidemiology of animal NoVs
Besides humans, NoVs have been detected in the feces of mice, pigs, cattle, and dogs
(11, 210-212). Based on the limited data, 22.1% of laboratory mice in North America 19
were positive to MNV by serological prevalence (213). In Europe, a serological prevalence study of canine NoVs reported that up to 70% (7/10 in Finland) of the serum samples were positive (214).
Bovine NoV prototype strain Newbury-2 was first identified in 1978 (25). Bovine
NoVs have been detected worldwide. In the Netherlands, 31.6% (77/243) of the stool samples from veal calf farms and 4.2% (13/312) of the stool samples from dairy cattle were positive for GIII bovine NoV by RT-PCR (215). In the US, bovine NoV prevalence differed among states. In Ohio, 72% (54/75) of veal calf fecal samples were positive for
GIII bovine NoV, while in Michigan and Wisconsin, 80% and 25% of dairy calf fecal samples were positive for GIII bovine NoV by RT-PCR, respectively (216, 217). In calves, Nebovirus had a high seroprevalence rate of 78-100% among 6- to 7-month-old feedlot calves in feedlots from New Mexico, Arkansas and Ohio in the USA (218). A study in France reported that Nebovirus was detected in 7% of 456 fecal samples from diarrheic calves by RT-PCR (26). A study in Tunisia reported that Nebovirus was detected in 3% of 169 fecal samples from diarrheic calves by RT-PCR (219).
Porcine NoVs have been detected worldwide as well. In Japan, the seroprevalence of GII NoV in swine was 36% (95/266), while in another study using RT-PCR, 0.35% of the fecal samples were positive for GII porcine NoVs (220, 221). In the US, the overall prevalence of porcine NoVs in North Carolina was 18.9% based on RT-PCR coupled hybridization assay using samples collected from three different production systems
(100). A similar prevalence rate (20%) was also reported in the US from three different states, Ohio, Michigan, and North Carolina, using the same detection method (34).
Additionally, porcine NoVs were reported in Europe (1.2%) (222), Brazil (8%) (223), 20
New Zealand (9%) (32), etc. The different rates could be due to different geographical distribution, different ages of tested pigs, or different detection methods.
4.3 Epidemiology of HuSaVs
HuSaVs have been detected worldwide and often ranked second to fourth among the major viral pathogens with sporadic gastroenteritis (101). Although the reported outbreak numbers of HuSaVs are fewer than those of HuNoVs (1.3% to 8.0% of the gastroenteritis outbreaks), HuSaVs are also an emerging major cause of gastroenteritis in humans (224, 225). Sapovirus infected patients show symptoms of gastroenteritis within less than 1 to 4 days, with clinical signs including diarrhea and vomiting (63). SaV shedding in feces may last 1 to 4 weeks after onset of illness. An analysis based on published data showed that in human infection, the median incubation period for SaV
(1.7 days) was close to that of NoV (1.2 days) (226). Subclinical SaV infection was also detected by RT-qPCR from human fecal samples, although the shedding level may be even comparable to the symptomatic SaV infection (227). This may be important for the transmission of SaVs among people.
The HuSaV infection occurs more frequently in young children than in adults in sporadic gastroenteritis cases (228, 229). In a study conducted in the Netherlands, 9% of tested samples collected from < 4-year old were positive for SaV, while in the samples collected from elderly people > 60 years of age, none were positive for SaV by RT-PCR
(230). SaV outbreaks occurs in various settings including facilities associated closely to children, such as day care centers, kindergartens and schools, and other public facilities such as hospitals, nursing homes, restaurants, hotels, and ships (101).
Similar to HuNoVs, the transmission of HuSaVs is through the fecal-oral route 21
via contaminated food and water or person to person contact (231-233). Foodborne SaV outbreaks were reported (234). Meanwhile, SaVs of human origin were often detected from shellfish and water, which were likely viruses of human feces discharged into environment (233, 235). Studies of SaV infection in children in Nicaragua indicated that
SaV infection is not related to HBGAs (236). Meanwhile, in vitro data did not support
SaV binding to HBGAs as well (237).
4.4 Epidemiology of animal SaVs
Besides shellfish that has been mentioned, SaVs have been detected from animals including pigs, mink, bats, sea lions, cats and dogs (18, 97-100, 238). Studies and data on mink, bats, sea lions, cats and dogs are limited. In a test of 321 bat fecal specimens, five were positive for SaV by RT-PCR (99). Canine SaVs have been classified into a distinct genogroup from the other SaVs, and had a prevalence rate of 4.1% (4/97) in tested canine diarrheic samples (238). No clues evidenced the transmission of SaVs between humans and pet animals.
Porcine sapoviruses are widespread in pigs worldwide (10, 239, 240). The prevalence of PoSaVs varied geographically. A prevalence study in Europe that tested over 1000 swine fecal samples showed ~8% PoSaV positive by RT-PCR (239). However, another study conducted in Germany using a deep sequencing method revealed that SaVs ranked the sixth (1.7%) among the most frequently detected viral pathogens in pig feces
(241). In the US, PoSaVs were also widely distributed. 28.6% of a pool of 56 fecal samples collected from finisher pigs in North Carolina were positive for PoSaV by
RT-PCR (100). Another study in Ohio, six of 139 fecal samples collected from individual nursing pigs (up to 30 days old) were positive for PoSaV by RT-PCR (242). The 22
seroprevalence of PoSaVs revealed that PoSaV infection in pigs were common (243-245).
Pigs younger than 10 weeks and older than 12 weeks showed significantly higher seroprevalence than the pigs aged 10 to 12 weeks (243).
PoSaVs are distributed in GIII, GVI, GVII, GVIII, GX and GXI genogroups based on phylogenetic analysis using VP1 sequences (100). Among the current six genogroups, GIII PoSaVs have been predominant. A prevalence study in the US reported that GIII PoSaVs were detected in 62% of pigs, with the highest prevalence rate in post weaning pigs and lowest prevalence rate in nursing pigs (34, 246). In Europe, GIII
PoSaVs were also prevalent in the countries studied (239). In conclusion, although the prevalence rate varied geographically, GIII PoSaVs were the most prevalent.
5. Animal models and pathogenesis of caliciviruses
To date, caliciviruses have been detected from a broad range of host species.
Human enteric caliciviruses, including HuNoVs and HuSaVs, are a major cause of nonbacterial enteritis in all age groups, especially children and the elderly worldwide.
Very little is known about HuNoV virulence and differences in different strains or genotypes in humans. Human volunteer studies revealed that some NoV strains exclusively infect secretor phenotype individuals who express histo-blood group antigens
(HBGAs) in the mucosa of the respiratory and digestive tracts and body fluids (247, 248).
HBGAs have been identified as a cellular receptor or co-receptor for NV and other NoVs
(249-251).
Histo-blood group antigens refer to the complex carbohydrates on the surface of various tissues including mucosal epithelia of the respiratory and digestive tracts, red 23
blood cells, and body fluids such as saliva, milk, and intestinal contents (252). Three major HBGA families, the Lewis, secretor and ABO families, are determined by the sugar moieties on the HBGA backbone. The synthesis of the HBGAs requires the involvement of the fucosyltransferase 2 (FUT2) gene, also called the “Secretor” gene, which encodes an α1,2-fucosyltransferase and leads to the expression of α1,2-linked fucose on the surface of epithelial cells in the gut and in body fluids (253, 254). An individual lacking a wild type FUT2 gene allele is considered a non-secretor. Non-secretor subjects were often resistant to GI.1 NV infection (249, 255). However, this resistance was not applicable to other genogroups or genotypes of HuNoVs (251). A recent study was done on adult volunteers orally inoculated with HuNoV GII.2 SMV, or GI.1 NV, respectively
(256). The SMV infections were symptomatic in all inoculated volunteers, showing that
100.0% of SMV subjects developed clinical symptoms including abdominal cramps, nausea, diarrhea, fever, and vomiting, and viral shedding was detected in fecal samples from inoculated volunteers (256). Both symptomatic and asymptomatic infections were observed in the NV inoculated volunteers, showing that 66.6% of NV subjects developed clinical symptoms (256). A study of a GII.4 NoV outbreak showed that GII.4 NoV infection in humans did not indicate a preference for distinct HBGAs (257). Therefore,
HBGAs may not be the major functional receptor, but the binding receptors for HuNoVs.
Besides HuNoVs, some other caliciviruses also bind to HBGAs. TV recognizes A type 3 and all B types of HBGAs on human red blood cells and in human saliva in vitro
(258). RHDV uses α1,2-fucosylated glycan, a HBGA, as the binding receptor in the small intestinal tissues of rabbits (259). Pigs also have a gene homolog to the human FUT2 gene, and thus also express porcine α1,2-fucosyltransferase leading to the expression of A 24
and H antigens on their tissues (260, 261). Cattle also have gene homologous to human
α2-fucosyltransferase gene, named as bovine α2-fucosyltransferase genes (bFUT1, bFUT2, and SEC1). Unlike humans and some primates that only FUT1 and FUT2 are fully expressed, in cattle, these three bovine α2-fucosyltransferase genes are all fully expressed (262).
Except for a few animal caliciviruses, cell culture systems for most human caliciviruses including HuNoVs and HuSaVs are not established. Therefore, animals expressing HBGA-like antigens similar to humans are good models and important tools to study calicivirus host interaction and pathogenesis.
5.1 Small animal models for NoV infection
Among all the discovered NoVs, MNV is the only NoV that is confirmed to replicate in both cell culture and a small animal model, but it causes asymptomatic infections in wild type mice and systemic infections in immunocompromised mice (11,
70). MNV was first isolated from immunocompromised laboratory mice in 2003 (11). It caused systemic and lethal disease in recombination-activating gene (RAG) 2-/-/ signal transducer and activator of transcription-1 (STAT1)-/- immunocompromised mice (11).
Thereafter, a study of MNV infection in wild-type (WT) mice showed that MNV caused subclinical infection, indicating that MNV naturally infects mice and causes no or only very mild clinical signs in WT mice (213). In WT mice infected with MNV, viral RNA was detected in liver, spleen, and proximal intestine, but not in the lung, brain, or feces
(11, 213). In STAT1-/- mice infected with MNV, high viral RNA levels were detected in organs including lung, liver, spleen, proximal intestine, and brain, and can be detected in blood and feces (11). With the immunocompromised mouse model for MNV, it was 25
demonstrated that STAT1-dependent innate immunity is required to control NoV infection (11). Studies also showed that persistent infection without mortality occurred after in MNV infection of RAG1-/- or RAG2-/- mice, while in contrast, MNV was rapidly cleared in WT mice (38). Clinical observations that HuNoV infection became debilitating and lethal in some immunocompromised patients, and experimental observations that immune status in the mouse model altered the severity of MNV infection, suggest that the tissue tropism and disease severity of HuNoV may change depending on the immune status of the host.
The MNV shows a tropism for immune cells of the mouse immune system in vivo and can replicate in a murine macrophage cell line RAW264.7 (70). The importance of
STAT1 in MNV infection was also evident in MNV infected cell cultures, in which MNV replicated better in STAT1-/- mice derived macrophages and dendritic cells (DCs) than in
WT mice derived macrophages and DCs (70). MNV antigens were also detected in B cells in the Peyer’s patches in the small intestines of MNV infected STAT1-/- or IL-10-/- mice (263, 264).
Since MNV was detected in the gut of mice during infection, it may be considered an enteric virus (265). However, MNV did not cause pronounced villous atrophy in the small intestine of infected mice, and MNV was also detected in multiple tissues other than the intestine, which is different from the typical clinical observations for human enteric calicivirus infection. In addition, MNV does not interact with HBGAs. Although mice have been widely used as models for HuNoV infection, mice do not express
HBGAs. The MNV infection varies depending on different strains, but the infection may also rely on attachment of glycolipid and glycoprotein receptors (266). It was reported 26
that sialic acids act as the receptor for MNV (267). Therefore, the pathogenesis of MNV infection in mice may not be representative of human enteric calicivirus infection in humans. The establishment of the immunocompromised mouse model for MNV is important for the calicivirus field. However, based on the differences in clinical signs and disease severity, this model does not represent the gastroenteritis (vomiting and diarrhea) seen after HuNoV infection of humans.
Recently, a BALB/c RAG-/-/γc-/- mouse model was reported as supporting the replication of a GII.4 HuNoV strain (44). In this mouse model, asymptomatic infection was detected after intraperitoneal and oral routes of inoculation, with a 1400-fold or
60-fold increase in viral genome copies in the intestinal tract over the input dose after 1 to
2 post-inoculation days (PIDs), respectively (44). A few viral antigens were detected in macrophages in spleen and liver of HuNoV GII.4 infected BALB/c RAG-/-/γc-/- mice
(268), whereas only NS proteins were detected in macrophage-like cells in the small intestine (44). These data suggest that asymptomatic HuNoV infection occurred in this
BALB/c RAG-/-/γc-/- mouse model, but with very limited viral replication during infection.
Further development of this model is required for antiviral and vaccine testing.
5.2 Large animal models for the NoVs
Besides the BALB/c RAG-/-/γc-/- mouse model for HuNoVs, several large animal models have been established to study HuNoV infection. The procurement and maintenance of Gn pigs was first described in the 1960s (269-271). Since then, Gn pigs have been used to study the pathogenesis and immune responses to various pathogens, including rotavirus (272), E. coli (273), etc. NoVs and SaVs were frequently detected in 27
pigs and cattle during epidemiologic studies (29, 33, 100, 210, 221, 274, 275). Molecular phylogenetic analysis of porcine NoVs showed that porcine NoVs were classified into the
GII NoVs, as are some HuNoVs (29, 276). On the other hand, pigs have a gene homolog to the human FUT2 gene, and express A and H antigens on their gut epithelial brush border (260, 277). It was demonstrated that GII.4 HuNoV VLPs bound extensively to duodenal and buccal tissues from pigs expressing A/H antigens (278). Therefore, Gn pigs were used to study the pathogenesis of GII HuNoV (279). Replication of GII.4 HuNoV
(Hu/NoV/GII/4/HS66/2001/US) was demonstrated in orally inoculated Gn pigs after PID
1 and lasted for up to 8 days as determined by real time reverse transcription PCR
(RT-qPCR) detection of viral RNA in fecal samples (279). Mild diarrhea for up to five days at the acute stage of infection, detection of HuNoV antigens in the enterocytes in the small intestine, as well as seroconversion, confirmed that HuNoV GII.4/HS66 replicated in Gn pigs (279). No macroscopic or microscopic lesions in the small intestines of GII.4
HuNoV infected pigs were observed (279). However, all of the HuNoV-inoculated pigs showed increased numbers of apoptotic cells compared to those of mock-inoculated control pigs, indicating that GII.4 HuNoV caused very mild lesions in the small intestines of Gn pigs (279).
In Gn calves, the same GII.4/HS66 strain caused diarrhea and intestinal lesions from the duodenum to jejunum, suggesting that the GII.4/HS66 strain also replicated in the small intestine of Gn calves (42). Similar to GII.4/HS66 HuNoV infection in Gn pigs, antigen positive signals were detected in the small intestinal enterocytes of Gn calves, suggesting that GII.4 HuNoV had a villous epithelial cell tropism restricted to the small intestine (42, 279). 28
Bovine NoV infection of Gn calves is also a good model for HuNoV infection.
Bovine NoVs comprise two genotypes in GIII, which are GIII.1 and GIII.2. Both genotypes are associated with diarrhea in calves (280, 281). Gn calves orally inoculated with GIII.1 bovine NoV Jenna strain developed severe diarrhea between 12 and 14 hpi that persisted for 40 to 50 hours, and had pasty feces thereafter (280). In contrast, Gn calves orally inoculated with a GIII.2 bovine NoV strain CV186-OH/00/US developed moderate and intermittent diarrhea at PID 1 up to PID 26 (281). An early study of the pathogenesis of a GIII.2 bovine NoV Newbury-2 strain indicated that conventional calves inoculated with GIII.2 bovine NoV Newbury-2 strain had little or no diarrhea (25, 282).
Microscopically, Gn calves inoculated with GIII.1 bovine NoV Jenna strain exhibited severe shortening and thickening of the villi, as well as antigen-positive epithelium-like cells, in the distal jejunum of calves at 18 to 21 hpi (280). Tissues from other organs or other regions in the intestine were normal in morphology and negative in antigen staining.
On the other hand, although Gn calves inoculated with the GIII.2 bovine NoV strain
CV186-OH/00/US exhibited acute but persisting diarrhea and acute moderate to severe lethargy, they did not exhibit histological changes or antigen-positive cells in the intestine, or other organs (281). Gn calves inoculated with the GIII.2 bovine NoV Newbury-2 strain, however, exhibited atrophic enteritis with degenerate enterocytes in the proximal intestine (283). Serum and fecal antibody responses to bovine NoV VLP and protection against GIII.2 bovine NoV strain CV186-OH/00/US challenge were evaluated and demonstrated that calves recovered from bovine NoV infection developed complete protection against challenge with the homologues bovine NoV, while partial protection was seen when Gn calves were intranasally vaccinated with bovine NoV VLPs 29
co-administered with mutant E.coli heat-labile toxin (284).
Based on limited data, it is likely that the pathogenicity of bovine NoV is dependent on both strain and host susceptibility. Irrespective of the variation among individuals, bovine NoV infection caused acute diarrhea, and shedding persisted for a relatively long time, which is comparable to HuNoV infection. However, since the bovine
NoVs were unculturable, and the derivation and maintenance of Gn calves was complicated, studies of bovine NoV infection in calves are limited and further investigations are required.
Another animal model for HuNoV infection is the use of non-human primates.
Under experimental conditions, virus shedding without clinical signs was observed after
HuNoV GI.1/Norwalk infection of common marmosets, cotton-top tamarins and rhesus macaques (285). A recent study using chimpanzees as a model for GII.4 HuNoV infection showed antigen-positive B cells in the small intestine (41). It should be noted that the cellular tropism of HuNoV varied in different animal models (41, 42, 44, 279).
Karst and Wobus proposed a putative model for HuNoV infection of the intestine based on the published data, in which HuNoV binds to carbohydrates on the surface of enterocytes for transcytosis across the epithelial barrier to the target immune cells (286).
HBGAs on epithelial cells are a receptor for some HuNoVs (287). A study of MNV reported that MNV was transported across polarized M-like cells in a murine intestinal epithelial cell line, mICcl2, without replication in vitro, suggesting that HuNoV may use a similar mechanism for transcytosis across the M-cells in vivo (288). Although the tissue tropism of HuNoV is not defined, viral antigens have been detected in cells located in the lamina propria and epithelial cells in humans (289-292). MNV also can replicate in 30
RAW264.7 cells, a murine macrophage cell line (70). It is unclear in humans if the
HuNoV-target cells are intestinal immune cells or epithelial cells or both. However, this proposed model for HuNoV pathogenesis did not address how NoVs cause gastroenteritis without infecting the intestinal epithelial cells. Furthermore, this model excluded the fact that HuNoV replication was observed in the enterocytes of infected Gn piglets and Gn calves and that bovine NoV infection was observed in the enterocytes of infected Gn calves (280).
In conclusion, little is known about HuNoV pathogenesis in humans. The establishment of host animal models for calicivirus infection provides an important tool to study the process and mechanisms of enteric calicivirus infection, potentially applicable to human enteric caliciviruses. A more robust and authentic animal model in terms of reproducing the pathogenesis of disease seen in humans and based on role of
HBGA in infection of humans is required.
5.3 Animal caliciviruses in their natural hosts
Since HuNoV infection in small or large animals did not comprehensively simulate HuNoV infection in humans, animal calicivirus infections of their natural hosts have been used as surrogate models to study calicivirus infection (Table 1).
FCV is a common cause of upper respiratory tract disease (URTD), oral mucosal ulceration and ocular surface disease of cats worldwide (21-23), with vesicular lesions in the oral cavity and respiratory tract (293, 294). Under experimental conditions, FCV inoculated specific-pathogen-free (SPF) cats developed typical acute FCV infection including ocular and nasal discharge, conjunctivitis, and oral ulceration, with viral shedding no longer than 28 days when tested by cell culture infectivity assay (295). 31
Under natural conditions, however, cats may shed virus for longer than 30 days after recovery (296). A more severe disease called virulent, systemic (VS) FCV disease was first described a decade ago, causing alopecia, cutaneous ulcers, subcutaneous edema, and high mortality (21). However, no direct evidence showed that the virulence of
VS-FCV and classical FCV are associated with genetic mutations of strains (297).
Microscopically, FCV antigens were detected in lesion regions by IHC staining in endothelial and epithelial cells in multiple organs including skins, nasal mucosa, tongue, buccal mucosa, pinna, paw pads, lung, and pancreas (21). Unlike human enteric calicivirus infection that may relate to the carbohydrates on the surface of enterocytes, no evidence showed that FCV infection is related to carbohydrate expression. The receptor for FCV in cell culture is the fJAM-A, while α2, 6-linked sialic acid was also reported as a receptor for FCV (298, 299). The fJAM-A is widely distributed in cats and localized at cell-cell junctions of epithelial and endothelial cells (300). Therefore, in vivo FCV may also use fJAM-A as receptor.
RHDV is a highly lethal pathogen in adult rabbits, causing systemic hemorrhagic infections and up to 100% mortality within 2 days. Hares and young rabbits are less susceptible to RHDV, likely due to the changes in tissue-specific receptors during the development from the young to adulthood (301, 302). RHDV in rabbits and hares also infects a wide range of tissues, including hepatocytes in liver and epithelial cells in the respiratory tract and the villi of the small intestine (24, 302). Additionally, endothelial cells of the blood vessels also contained RHDV antigens (303). It is established that
RHDV can agglutinate human red blood cells (304). In vitro incubation of trachea sections with virus or VLPs showed that RHDV may also bind to HBGAs (302). 32
Because FCV and RHDV predominantly cause systemic infections instead of gastroenteritis in their corresponding host, such disease models may not accurately represent human enteric calicivirus infections.
PoSaV has been repeatedly detected worldwide from pig fecal samples (100,
305-308). Although PoSaV has been detected from both asymptomatic and diarrheic pigs, the prototype of PoSaV, PoSaV Cowden strain causes mild to moderate diarrhea in Gn pigs (43). The WT PoSaV Cowden strain infected Gn pigs showed mild to severe villous atrophy and fusion from duodenum to jejunum in the small intestine (43). Furthermore, the antigens of PoSaV Cowden strain were found in the epithelial cells, based on IF staining of impression smears from the small intestine (43). Extra-intestinal or colon lesions were not observed in WT PoSaV Cowden strain infected pigs, although acute transient viremia was reported by testing viral RNA and antigen in the blood (43). The restricted growth of PoSaV Cowden strain in the small intestine may be due to the requirement of receptors and intestinal proteolytic enzymes or other undefined factors in intestinal contents, which is required for viral replication in cell culture (309). Comparing the HuNoV replicon-bearing cells with control cells by microarray, cholesterol pathways were identified as potentially crucial for the NoV replication in cells (310). This may explain the reason that HuNoV is usually restricted in the small intestine and causes mainly gastroenteritis, providing similarities to PoSaV infection in Gn pigs. These results confirmed a previous study, which showed that WT PoSaV Cowden strain infected Gn pigs and caused diarrhea, and also represents a good model to simulate HuNoV or HuSaV infection (311). However, there was no evidence for the relatedness of SaV infection to
HBGA binding. A recent study indicated that the α2,3- and α2,6-linked sialic acids on 33
O-linked glycoproteins are functional receptors for PoSaV Cowden strain in LLC-PK cells, but it is unknown if PoSaV uses the same receptors in vivo (312).
Two bovine enteric caliciviruses, one previously known as Newbury-1 virus and another, the Nebraska virus, were associated with diarrhea in calves (25, 313). Thereafter, first the Newbury-1 virus and subsequently the Nebraska virus were sequenced and characterized as a new genus Nebovirus in the Caliciviridae family (27, 79, 216).
Nebovirus is now detected worldwide and is associated with calf diarrhea. Therefore,
Nebovirus infection in Gn calves represents another potential animal host model for human enteric calicivirus infection.
Tulane virus was first detected from stool samples of asymptomatic juvenile rhesus macaques (5). To date, TV is a prototype of a putative genus Recovirus within the family Caliciviridae. Experimentally, two of three orally inoculated juvenile macaques
(<4-year old) developed clinical signs including diarrhea and fever, but not vomiting
(314). Therefore, whether clinical disease is linked to natural TV infection remains unknown. Moderate blunting and distension of the villi were observed in H&E stained duodenal tissues of TV inoculated macaques (314). Microscopically, duodenal biopsies acquired from macaques showed that TV appeared to infect some CD20+ B cells in the lamina propria instead of enterocytes in the small intestine. Additionally, a 2-log10 increase of viral RNA by PID 6 was detected in in vitro cultured peripheral blood mononuclear cells (PBMC), suggesting that TV replicated in mononuclear cells instead of epithelial cells in vivo (314).
Tulane virus recognized both HBGAs and sialic acids in vitro. However, in
LLC-MK cell cultures, the blocking or removal of either HBGAs or sialic acids alone did 34
not abolish infection, suggesting the complimentary effect of HGBA and sialic acid as TV receptors (314).
In conclusion, the pathogenesis of the distinct genera and genogroups or genotypes of caliciviruses in animal hosts differs remarkably. Either an epithelium-tropic pattern or an immune-cell-tropic pattern was observed in animal calicivirus infection in the corresponding hosts. A robust disease model for human enteric calicivirus infection has yet to be established. Further studies should be conducted to examine and compare the current or new animal disease models.
6. Reverse genetics systems for caliciviruses
6.1 The construction of reverse genetics systems for caliciviruses
The central dogma of molecular biology was first stated in 1958 and re-stated in
1970, describing the flow of genetic information from DNA to protein (315, 316). The central dogma was extended by the discovery of reverse transcriptase in RNA tumor viruses and Rous sarcoma viruses (RSV) in 1970 (317, 318). The discovery of reverse transcriptase made it possible to generate cDNA from viral genomic RNA in vitro, making reverse genetics possible. Reverse genetics is a process to conduct a genetic analysis by engineering mutations in the genes to study their functions. Reverse genetics enabled studies of the relation between modifications in the viral genome and their impact on rescued viruses. Application of reverse genetics allowed for generation of entire virus from cDNA (319).
The first reverse genetics system for a virus was generated in 1978 (320).
Genomic cDNA of bacteriophage Qβ was inserted into the plasmid pCR I. Bacteriophage 35
Qβ was rescued from Qβ DNA-pCR I-transformed E. coli HB101 cells and the plasmid
Qβ DNA-pCR I was infectious in E. coli (320). The first reverse genetics system for a mammalian virus was generated for poliovirus in 1981 (321). The cDNA of the poliovirus genome was inserted into plasmid pBR322 to construct plasmid pVR106.
CV-1 cells transfected with pVR106 generated poliovirus particles whose infectivity was confirmed by plaque assay by applying the cell lysates from transfected cells to HeLa cells (321). Thereafter, reverse genetics systems have been widely employed for most major virus families where available.
Although only a few animal caliciviruses replicate in cell culture, reverse genetics systems have been established for most culturable caliciviruses. The first reverse genetics system for calicivirus was for FCV in 1995 (322). The cDNA of the polyadenylated genome of FCV Urbana strain genome contains a T7 promoter in the 5’ end of the genome and was constructed into a pQ14 plasmid. FCV RNA transcripts were generated in vitro from linearized plasmid, and transfected into the Crandell-Rees feline kidney
(CRFK) cell line to rescue infectious viruses (322). Thereafter, a reverse genetics system for PoSaV was described using a similar approach as for FCV, which engineered the full-length genomic cDNA downstream of a T7 promoter for the generation of RNA transcripts in vitro (323). To date, besides FCV and PoSaV, reverse genetics systems for
MNV (70, 324-326), RHDV (13, 327), HuNoVs (137, 325, 328-330), and TV (331) have been established (Table 2).
Overall, two major strategies have been employed for the construction of reverse genetics systems for caliciviruses. The first strategy is to acquire RNA transcripts in vitro, and transfect them into permissive cells afterwards. Successful reverse genetics systems 36
constructed in this way include those for FCV (322), PoSaV (323), MNV (326), HuNoV
(137), TV (331), and RHDV (13). This method requires a full-length genomic cDNA, a promoter for RNA polymerase in vitro transcription, and a 3’ end poly-A tail. The poly-A tail is either engineered into the 3’ end of the genomic cDNA, or added to the RNA transcripts after in vitro transcription. A cap analogue is added to the 5’ end of the in vitro transcribed genomic RNA. Viruses are rescued from RNA transfected permissive cells.
The advantage of this method is that it provides a simple way to construct reverse genetics systems. The disadvantage of this method is the difficulty to manipulate RNA and the different transfection efficacy. Except for a few animal caliciviruses, susceptible and permissive cells are not available for most caliciviruses including HuSaVs and
HuNoVs (73, 101). Therefore, for the non-culturable caliciviruses, only one round of virus replication may occur within the transfected cells.
The second strategy is to transfect plasmid DNA directly into permissive cells.
Successful reverse genetics systems constructed in this method include those for FCV
(332, 333), MNV (334), RHDV (327), and HuNoV (325). In such a system, a full-length genomic cDNA-bearing plasmid and an appropriate promoter are required. Additionally, an appropriate helper virus expressing T7 RNA polymerase is co-transfected into the cells with the plasmid. The advantage of this method is the simplicity to manipulate DNA rather than RNA. However, the use of such reverse genetics systems for PoSaV and
MNV failed to rescue infectious virus in permissive cells co-transfected with modified vaccinia virus Ankara strain expressing T7 polymerase (MVA-T7) (323, 334). One round of MNV replication was observed when MVA-T7 was replaced with a modified fowlpox virus expressing T7 polymerase (FPV-T7) (334). 37
The recovery of infectious MNV was inhibited due to the replication of MVA-T7 in the cytoplasm (335), but retrieved with FPV-T7, because fowlpox replication is abortive in mammalian cells (334). Therefore, the disadvantage of this method is the dependence on a helper virus for the recovery of infectious viruses. To improve this method, either cell lines that are modified to express T7 RNA polymerase, or mammalian promoters instead of T7 promoter in the reverse genetics systems, have been constructed for higher efficiency of virus recovery. A reverse genetics system for MNV driven by
DNA polymerase II promoter was constructed to successfully rescue infectious MNV, thus becoming the first reverse genetics system for a NoV (336). This system required a baculovirus (BACTET-tTA) expressing a tetracycline (TET)-repressor/VP16 trans-activator to activate a CMV promoter in the absence of TET on a second baculovirus (BACTET-MNV) carrying the full-length genome of MNV to be used to transfect permissive cells for the recovery of infectious MNV (336). Recently, another reverse genetics system driven by a mammalian promoter, elongation factor-1α (EF-1α) promoter, was constructed (325). This system used a single plasmid engineered with
EF-1α promoter and two exons and one intron from the EF-1α gene that includes RNA transcription binding sites upstream of the MNV genome, to transfect permissive cells
(325). Besides the differences in the constructions, both systems required mammalian promoters, directly transfected plasmid DNA instead of RNA transcripts, and contained a hepatitis delta virus ribozyme downstream of the 3’ end poly-A tail to cleave the RNA after the 3’ end of the RNA was produced. The latter system was also successfully applied to HuNoV and FCV (325, 332). Meanwhile, reverse genetics systems were constructed with a T7-internal ribosome entry site (IRES)-T7 sequence upstream of the 5’ 38
end of MNV or FCV genomes. They were transfected into baby hamster kidney cell line,
BHK-T7 cells that express T7 RNA polymerase to rescue infectious viruses (324). The
T7-IRES-T7 sequence was engineered to use T7 RNA polymerase to generate both genomic RNA transcripts with IRES structure for the translation of NS proteins, and genomic RNA transcripts without IRES structure (324).
6.2 Applications of reverse genetics systems
The reverse genetics systems have been used to address fundamental problems such as viral replication in cells, the function of RNA structures, cell biology, viral pathogenesis, etc. As the reverse genetics system for FCV was the first to be established among caliciviruses, its first application was to introduce site-directed mutagenesis to confirm that FCV capsid protein is cleaved by the virus encoded protease-polymerase fusion protein (known as NS6-7) (337). The FCV reverse genetics system was also used to recover chimeric FCV and to confirm that the hypervariable region of the capsid played a major role in its antigenicity (338). The FCV reverse genetics system was manipulated and resulted in the generation of the first fluorescence-labeled calicivirus, when the reef coral Discosoma sp. red (DsRed) or the jellyfish Aequorea coerulescens green fluorescent proteins (GFP) were fused to the leader capsid protein of FCV (339).
The recombinant FCV expressing fluorescent proteins was an important tool for the discovery of the function of cellular polypyrimidine tract binding protein in FCV translation (340).
The establishment of the MNV reverse genetics system occurred later. However, because of the close phylogenetic relationship of MNV with HuNoVs, the MNV reverse genetics systems have been applied to study the replication and biology of NoVs in cells. 39
The FPV-T7 MNV system was used at first, as the only MNV reverse genetics system, to understand the genetic mechanism of MNV cell culture adaptation in RAW264.7 cells and virulence in mice. After serial passages in cell culture, an amino acid substitution in the capsid protein was discovered associated with virulence in vivo (70). Thereafter, more comprehensive sequence analysis revealed three amino acid substitutions during serial passage in vitro (G2151A and H2539R in ORF1, A5941G in VP1) (341). By introducing mutagenesis in the FPV-T7 MNV system, the single mutation A5941G in the VP1 of the
MNV genome was sufficient to attenuate the virulence of MNV in vivo, in STAT1-/- mice
(341). Using this FPV-T7 MNV system, Simmonds et al (342) reported that mutations in the 5’ end stem-loop structure resulted in infectivity reduction, while disruption in the subgenomic promoter region and the 3’ end aborted replication in vitro, indicating the important function of the RNA secondary structure in virus replication. With the improvement of MNV reverse genetics systems, more fundamental properties have been discovered. By introducing mutations in the protease-polymerase region of the MNV sequence driven by pol II promoter in a plasmid reverse genetics system, it was demonstrated that protease-polymerase cleavage is essential for the recovery of infectious
MNV (336). This result differed from that for FCV, in which there was no detectable effect on viral replication when the cleavage sites of protease-polymerase were mutated
(343).
Although a robust cell culture system for HuNoV has not been established, the reverse genetics systems for HuNoV have been applied to study the single cycle of virus replication in cells. The first research on HuNoV replication in cells employed a human replicon that was transcribed and capped in vitro to transfect human hepatoma Huh-7 and 40
baby hamster kidney (BHK21) cell lines (137). Since the expression of HuNoV was detected in this replicon system, it was used to examine the effects of antivirals and inhibitors such as ribavirin and interferons on NoV replication in vitro (344). Combining this replicon system with a microarray method, Chang, et al, reported that genes in the cholesterol and carbohydrate metabolic pathways were significantly changed in replicon-bearing cells, leading to the discovery that inhibition of cholesterol synthesis resulted in increased virus replication in vitro (310). This was confirmed by an epidemiologic study that statin treatments as inhibitors of cholesterol biosynthesis may contribute to higher mortality after NoV infection (345).
The newly developed reverse genetics system for HuNoV that was driven by mammalian promoter EF-1α was also employed to rescue progeny HuNoV and revealed that the HuNoV ORF1 encoded protease cleaved the polyprotein, and that non-structural proteins were distributed in the cytoplasm, suggesting viral replication in the cytoplasm
(325).
The reverse genetics system for the PoSaV Cowden strain, pCV4A, has been the only reverse genetics system reported for SaV (323). It was used as a positive control to study the interaction between VPg and the cellular translation initiation factors (eIFs)
(121) and the reduction of PoSaV replication by type I IFN in cell culture (346). However, no studies were done to determine the molecular basis for cell culture adaptation and virulence in vivo.
In conclusion, several reverse genetics systems have been established for different genera of caliciviruses. The application of reverse genetics systems revealed fundamental and functional properties of caliciviruses, and provided information on calicivirus-host 41
interactions. Therefore, reverse genetics systems are important tools to study caliciviruses.
42
Reference
1. Mikalsen AB, Nilsen P, Froystad-Saugen M, Lindmo K, Eliassen TM, Rode M, Evensen O. 2014. Characterization of a Novel Calicivirus Causing Systemic Infection in Atlantic Salmon (Salmo salar L.): Proposal for a New Genus of Caliciviridae. PLoS One 9:e107132.
2. Wolf S, Reetz J, Hoffmann K, Grundel A, Schwarz BA, Hanel I, Otto PH. 2012. Discovery and genetic characterization of novel caliciviruses in German and Dutch poultry. Arch Virol 157:1499-1507.
3. Wolf S, Reetz J, Otto P. 2011. Genetic characterization of a novel calicivirus from a chicken. Arch Virol 156:1143-1150.
4. Day JM, Ballard LL, Duke MV, Scheffler BE, Zsak L. 2010. Metagenomic analysis of the turkey gut RNA virus community. Virol J 7:313.
5. Farkas T, Sestak K, Wei C, Jiang X. 2008. Characterization of a rhesus monkey calicivirus representing a new genus of Caliciviridae. J Virol 82:5408-5416.
6. L'Homme Y, Sansregret R, Plante-Fortier E, Lamontagne AM, Ouardani M, Lacroix G, Simard C. 2009. Genomic characterization of swine caliciviruses representing a new genus of Caliciviridae. Virus Genes 39:66-75.
7. King AMQ, Adams MJ, Carstens EB, Lefkowitz EJ. 2012. Virus taxonomy: classification and nomenclature of viruses: Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier Academic Press.
8. McFadden N, Bailey D, Carrara G, Benson A, Chaudhry Y, Shortland A, Heeney J, Yarovinsky F, Simmonds P, Macdonald A, Goodfellow I. 2011. Norovirus regulation of the innate immune response and apoptosis occurs via the product of the alternative open reading frame 4. PLoS Pathog 7:e1002413.
9. Kapikian AZ, Wyatt RG, Dolin R, Thornhill TS, Kalica AR, Chanock RM. 1972. Visualization by immune electron microscopy of a 27-nm particle associated with acute infectious nonbacterial gastroenteritis. J Virol 10:1075-1081.
10. Saif LJ, Bohl EH, Theil KW, Cross RF, House JA. 1980. Rotavirus-like, calicivirus-like, and 23-nm virus-like particles associated with diarrhea in young pigs. J Clin Microbiol 12:105-111.
11. Karst SM, Wobus CE, Lay M, Davidson J, Virgin HWt. 2003. STAT1-dependent innate immunity to a Norwalk-like virus. Science 299:1575-1578.
43
12. Smith AW, Mattson DE, Skilling DE, Schmitz JA. 1983. Isolation and partial characterization of a calicivirus from calves. Am J Vet Res 44:851-855.
13. Liu G, Zhang Y, Ni Z, Yun T, Sheng Z, Liang H, Hua J, Li S, Du Q, Chen J. 2006. Recovery of infectious rabbit hemorrhagic disease virus from rabbits after direct inoculation with in vitro-transcribed RNA. J Virol 80:6597-6602.
14. Green KY, Ando T, Balayan MS, Berke T, Clarke IN, Estes MK, Matson DO, Nakata S, Neill JD, Studdert MJ, Thiel HJ. 2000. Taxonomy of the caliciviruses. J Infect Dis 181 Suppl 2:S322-330.
15. Schaffer FL, Soergel ME, Black JW, Skilling DE, Smith AW, Cubitt WD. 1985. Characterization of a new calicivirus isolated from feces of a dog. Arch Virol 84:181-195.
16. Smith AW, Akers TG, Madin SH, Vedros NA. 1973. San Miguel sea lion virus isolation, preliminary characterization and relationship to vesicular exanthema of swine virus. Nature 244:108-110.
17. Smith AW, Akers TG, Latham AB, Skilling DE, Bray HL. 1979. A new calicivirus isolated from a marine mammal. Arch Virol 61:255-259.
18. Guo M, Evermann JF, Saif LJ. 2001. Detection and molecular characterization of cultivable caliciviruses from clinically normal mink and enteric caliciviruses associated with diarrhea in mink. Arch Virol 146:479-493.
19. Sandoval-Jaime C, Parra GI, Smith AW, Green KY, Sosnovtsev SV. 2012. Genetic characterization of a reptilian calicivirus (Cro1). Virol J 9:297.
20. Smith AW, Anderson MP, Skilling DE, Barlough JE, Ensley PK. 1986. First isolation of calicivirus from reptiles and amphibians. Am J Vet Res 47:1718-1721.
21. Pesavento PA, MacLachlan NJ, Dillard-Telm L, Grant CK, Hurley KF. 2004. Pathologic, immunohistochemical, and electron microscopic findings in naturally occurring virulent systemic feline calicivirus infection in cats. Vet Pathol 41:257-263.
22. Coyne KP, Jones BR, Kipar A, Chantrey J, Porter CJ, Barber PJ, Dawson S, Gaskell RM, Radford AD. 2006. Lethal outbreak of disease associated with feline calicivirus infection in cats. Vet Rec 158:544-550.
23. Reynolds BS, Poulet H, Pingret JL, Jas D, Brunet S, Lemeter C, Etievant M, Boucraut-Baralon C. 2009. A nosocomial outbreak of feline calicivirus associated virulent systemic disease in France. J Feline Med Surg 11:633-644.
24. Dalton KP, Nicieza I, Balseiro A, Muguerza MA, Rosell JM, Casais R,
44
Alvarez AL, Parra F. 2012. Variant rabbit hemorrhagic disease virus in young rabbits, Spain. Emerg Infect Dis 18:2009-2012.
25. Woode GN, Bridger JC. 1978. Isolation of small viruses resembling astroviruses and caliciviruses from acute enteritis of calves. J Med Microbiol 11:441-452.
26. Kaplon J, Guenau E, Asdrubal P, Pothier P, Ambert-Balay K. 2011. Possible novel nebovirus genotype in cattle, France. Emerg Infect Dis 17:1120-1123.
27. Smiley JR, Chang KO, Hayes J, Vinje J, Saif LJ. 2002. Characterization of an enteropathogenic bovine calicivirus representing a potentially new calicivirus genus. J Virol 76:10089-10098.
28. Chiba S, Sakuma Y, Kogasaka R, Akihara M, Horino K, Nakao T, Fukui S. 1979. An outbreak of gastroenteritis associated with calicivirus in an infant home. J Med Virol 4:249-254.
29. Wang QH, Han MG, Cheetham S, Souza M, Funk JA, Saif LJ. 2005. Porcine noroviruses related to human noroviruses. Emerg Infect Dis 11:1874-1881.
30. Wolf S, Hewitt J, Greening GE. 2010. Viral multiplex quantitative PCR assays for tracking sources of fecal contamination. Appl Environ Microbiol 76:1388-1394.
31. Mattison K, Shukla A, Cook A, Pollari F, Friendship R, Kelton D, Bidawid S, Farber JM. 2007. Human noroviruses in swine and cattle. Emerg Infect Dis 13:1184-1188.
32. Wolf S, Williamson W, Hewitt J, Lin S, Rivera-Aban M, Ball A, Scholes P, Savill M, Greening GE. 2009. Molecular detection of norovirus in sheep and pigs in New Zealand farms. Vet Microbiol 133:184-189.
33. Deng Y, Batten CA, Liu BL, Lambden PR, Elschner M, Gunther H, Otto P, Schnurch P, Eichhorn W, Herbst W, Clarke IN. 2003. Studies of epidemiology and seroprevalence of bovine noroviruses in Germany. J Clin Microbiol 41:2300-2305.
34. Wang QH, Souza M, Funk JA, Zhang W, Saif LJ. 2006. Prevalence of noroviruses and sapoviruses in swine of various ages determined by reverse transcription-PCR and microwell hybridization assays. J Clin Microbiol 44:2057-2062.
35. Smith AW, Prato CM, Skilling DE. 1977. Characterization of two new serotypes of San Miguel sea lion virus. Intervirology 8:30-36.
36. Wilder FW. 1980. Detection of swine caliciviruses by indirect
45
immunofluorescence. Can J Comp Med 44:87-92.
37. Bidawid S, Malik N, Adegbunrin O, Sattar SA, Farber JM. 2003. A feline kidney cell line-based plaque assay for feline calicivirus, a surrogate for Norwalk virus. J Virol Methods 107:163-167.
38. Wobus CE, Thackray LB, Virgin HWt. 2006. Murine norovirus: a model system to study norovirus biology and pathogenesis. J Virol 80:5104-5112.
39. Flynn WT, Saif LJ. 1988. Serial propagation of porcine enteric calicivirus-like virus in primary porcine kidney cell cultures. J Clin Microbiol 26:206-212.
40. Parwani AV, Flynn WT, Gadfield KL, Saif LJ. 1991. Serial propagation of porcine enteric calicivirus in a continuous cell line. Effect of medium supplementation with intestinal contents or enzymes. Arch Virol 120:115-122.
41. Bok K, Parra GI, Mitra T, Abente E, Shaver CK, Boon D, Engle R, Yu C, Kapikian AZ, Sosnovtsev SV, Purcell RH, Green KY. 2011. Chimpanzees as an animal model for human norovirus infection and vaccine development. Proc Natl Acad Sci U S A 108:325-330.
42. Souza M, Azevedo MS, Jung K, Cheetham S, Saif LJ. 2008. Pathogenesis and immune responses in gnotobiotic calves after infection with the genogroup II.4-HS66 strain of human norovirus. J Virol 82:1777-1786.
43. Guo M, Hayes J, Cho KO, Parwani AV, Lucas LM, Saif LJ. 2001. Comparative pathogenesis of tissue culture-adapted and wild-type Cowden porcine enteric calicivirus (PEC) in gnotobiotic pigs and induction of diarrhea by intravenous inoculation of wild-type PEC. J Virol 75:9239-9251.
44. Taube S, Kolawole AO, Hohne M, Wilkinson JE, Handley SA, Perry JW, Thackray LB, Akkina R, Wobus CE. 2013. A mouse model for human norovirus. MBio 4.
45. Smith AW, Skilling DE, Cherry N, Mead JH, Matson DO. 1998. Calicivirus emergence from ocean reservoirs: zoonotic and interspecies movements. Emerg Infect Dis 4:13-20.
46. Fastier LB. 1957. A new feline virus isolated in tissue culture. Am J Vet Res 18:382-389.
47. Smith AW, Skilling DE, Latham AB. 1981. Isolation and identification of five new serotypes of calicivirus from marine mammals. Am J Vet Res 42:693-694.
48. Neill JD. 2014. The Complete Genome Sequence of the San Miguel Sea Lion Virus-8 Reveals that It Is Not a Member of the Vesicular Exanthema of Swine
46
Virus/San Miguel Sea Lion Virus Species of the Caliciviridae. Genome Announc 2.
49. O'Hara TM, House C, House JA, Suydam RS, George JC. 1998. Viral serologic survey of bowhead whales in Alaska. J Wildl Dis 34:39-46.
50. Neill JD, Meyer RF, Seal BS. 1995. Genetic relatedness of the caliciviruses: San Miguel sea lion and vesicular exanthema of swine viruses constitute a single genotype within the Caliciviridae. J Virol 69:4484-4488.
51. Liu SJ, Xue HP, Pu BQ, Qian SH. 1987. A new viral disease in rabbits. Anim Husb Vet Med Anim. Husb. Vet. Med.:253-255.
52. Cancellotti FM, Renzi M. 1991. Epidemiology and current situation of viral haemorrhagic disease of rabbits and the European brown hare syndrome in Italy. Rev Sci Tech 10:409-422.
53. Morisse JP, Le Gall G, Boilletot E. 1991. Hepatitis of viral origin in Leporidae: introduction and aetiological hypotheses. Rev Sci Tech 10:269-310.
54. Cooke BD. 2002. Rabbit haemorrhagic disease: field epidemiology and the management of wild rabbit populations. Rev Sci Tech 21:347-358.
55. Gregg DA, House C, Meyer R, Berninger M. 1991. Viral haemorrhagic disease of rabbits in Mexico: epidemiology and viral characterization. Rev Sci Tech 10:435-451.
56. Thornhill TS, Wyatt RG, Kalica AR, Dolin R, Chanock RM, Kapikian AZ. 1977. Detection by immune electron microscopy of 26- to 27-nm viruslike particles associated with two family outbreaks of gastroenteritis. J Infect Dis 135:20-27.
57. Dolin R, Reichman RC, Roessner KD, Tralka TS, Schooley RT, Gary W, Morens D. 1982. Detection by immune electron microscopy of the Snow Mountain agent of acute viral gastroenteritis. J Infect Dis 146:184-189.
58. Kapikian AZ. 1993. Viral gastroenteritis. JAMA 269:627-630.
59. Madeley CR, Cosgrove BP. 1976. Letter: Caliciviruses in man. Lancet 1:199-200.
60. Flewett TH, Davies H. 1976. Letter: Caliciviruses in man. Lancet 1:311.
61. Numata K, Hardy ME, Nakata S, Chiba S, Estes MK. 1997. Molecular characterization of morphologically typical human calicivirus Sapporo. Arch Virol 142:1537-1552.
47
62. McSwiggan DA, Cubitt D, Moore W. 1978. Calicivirus associated with winter vomiting disease. Lancet 1:1215.
63. Cubitt WD, McSwiggan DA, Moore W. 1979. Winter vomiting disease caused by calicivirus. J Clin Pathol 32:786-793.
64. Cubitt WD, Pead PJ, Saeed AA. 1981. A new serotype of calicivirus associated with an outbreak of gastroenteritis in a residential home for the elderly. J Clin Pathol 34:924-926.
65. Chiba S, Nakata S, Numata-Kinoshita K, Honma S. 2000. Sapporo virus: history and recent findings. J Infect Dis 181 Suppl 2:S303-308.
66. Guo M, Chang KO, Hardy ME, Zhang Q, Parwani AV, Saif LJ. 1999. Molecular characterization of a porcine enteric calicivirus genetically related to Sapporo-like human caliciviruses. J Virol 73:9625-9631.
67. Mayo MA. 2002. A summary of taxonomic changes recently approved by ICTV. Arch Virol 147:1655-1663.
68. Liu BL, Clarke IN, Caul EO, Lambden PR. 1995. Human enteric caliciviruses have a unique genome structure and are distinct from the Norwalk-like viruses. Arch Virol 140:1345-1356.
69. Kalunda M, Lee KM, Holmes DF, Gillespie JH. 1975. Serologic classification of feline caliciviruses by plaque-reduction neutralization and immunodiffusion. Am J Vet Res 36:353-356.
70. Wobus CE, Karst SM, Thackray LB, Chang KO, Sosnovtsev SV, Belliot G, Krug A, Mackenzie JM, Green KY, Virgin HW. 2004. Replication of Norovirus in cell culture reveals a tropism for dendritic cells and macrophages. PLoS Biol 2:e432.
71. Cubitt WD, Barrett AD. 1984. Propagation of human candidate calicivirus in cell culture. J Gen Virol 65 ( Pt 6):1123-1126.
72. Papafragkou E, Hewitt J, Park GW, Greening G, Vinje J. 2014. Challenges of culturing human norovirus in three-dimensional organoid intestinal cell culture models. PLoS One 8:e63485.
73. Duizer E, Schwab KJ, Neill FH, Atmar RL, Koopmans MP, Estes MK. 2004. Laboratory efforts to cultivate noroviruses. J Gen Virol 85:79-87.
74. Takanashi S, Saif LJ, Hughes JH, Meulia T, Jung K, Scheuer KA, Wang Q. 2014. Failure of propagation of human norovirus in intestinal epithelial cells with microvilli grown in three-dimensional cultures. Arch Virol 159:257-266.
48
75. Straub TM, Bartholomew RA, Valdez CO, Valentine NB, Dohnalkova A, Ozanich RM, Bruckner-Lea CJ, Call DR. 2011. Human norovirus infection of caco-2 cells grown as a three-dimensional tissue structure. J Water Health 9:225-240.
76. Jones MK, Watanabe M, Zhu S, Graves CL, Keyes LR, Grau KR, Gonzalez-Hernandez MB, Iovine NM, Wobus CE, Vinje J, Tibbetts SA, Wallet SM, Karst SM. 2014. Enteric bacteria promote human and mouse norovirus infection of B cells. Science 346:755-759.
77. Matthews RE. 1979. Third report of the International Committee on Taxonomy of Viruses. Classification and nomenclature of viruses. Intervirology 12:129-296.
78. Pringle CR. 1998. The universal system of virus taxonomy of the International Committee on Virus Taxonomy (ICTV), including new proposals ratified since publication of the Sixth ICTV Report in 1995. Arch Virol 143:203-210.
79. Oliver SL, Asobayire E, Dastjerdi AM, Bridger JC. 2006. Genomic characterization of the unclassified bovine enteric virus Newbury agent-1 (Newbury1) endorses a new genus in the family Caliciviridae. Virology 350:240-250.
80. Wang Q, Scheuer K, Ahang Z, Gebreyes WA, Molla BZ, Hoet AE, Saif LJ. 2011. Characterization and prevalence of a new porcine Calicivirus in Swine, United States. Emerg Infect Dis 17:1103-1106.
81. Liao Q, Wang X, Wang D, Zhang D. 2014. Complete genome sequence of a novel calicivirus from a goose. Arch Virol doi:10.1007/s00705-014-2083-6.
82. Lew JF, Kapikian AZ, Valdesuso J, Green KY. 1994. Molecular characterization of Hawaii virus and other Norwalk-like viruses: evidence for genetic polymorphism among human caliciviruses. J Infect Dis 170:535-542.
83. Wang J, Jiang X, Madore HP, Gray J, Desselberger U, Ando T, Seto Y, Oishi I, Lew JF, Green KY, et al. 1994. Sequence diversity of small, round-structured viruses in the Norwalk virus group. J Virol 68:5982-5990.
84. Kroneman A, Vega E, Vennema H, Vinje J, White PA, Hansman G, Green K, Martella V, Katayama K, Koopmans M. 2013. Proposal for a unified norovirus nomenclature and genotyping. Arch Virol 158:2059-2068.
85. White PA. 2014. Evolution of Norovirus. Clin Microbiol Infect doi:10.1111/1469-0691.12746.
86. Vinje J. 2015. Advances in Laboratory Methods for Detection and Typing of Norovirus. J Clin Microbiol 53:373-381.
49
87. Zheng DP, Ando T, Fankhauser RL, Beard RS, Glass RI, Monroe SS. 2006. Norovirus classification and proposed strain nomenclature. Virology 346:312-323.
88. Hoa Tran TN, Trainor E, Nakagomi T, Cunliffe NA, Nakagomi O. 2013. Molecular epidemiology of noroviruses associated with acute sporadic gastroenteritis in children: global distribution of genogroups, genotypes and GII.4 variants. J Clin Virol 56:185-193.
89. Takano T, Kusuhara H, Kuroishi A, Takashina M, Doki T, Nishinaka T, Hohdatsu T. 2015. Molecular characterization and pathogenicity of a genogroup GVI feline norovirus. Vet Microbiol doi:10.1016/j.vetmic.2015.05.018.
90. Mesquita JR, Barclay L, Nascimento MS, Vinje J. 2010. Novel norovirus in dogs with diarrhea. Emerg Infect Dis 16:980-982.
91. Tse H, Lau SK, Chan WM, Choi GK, Woo PC, Yuen KY. 2012. Complete genome sequences of novel canine noroviruses in Hong Kong. J Virol 86:9531-9532.
92. Lizasoain A, Tort LF, Garcia M, Gomez MM, Leite JP, Miagostovich MP, Cristina J, Berois M, Colina R, Victoria M. 2015. Sewage surveillance reveals the presence of canine GVII norovirus and canine astrovirus in Uruguay. Arch Virol doi:10.1007/s00705-015-2571-3.
93. Schuffenecker I, Ando T, Thouvenot D, Lina B, Aymard M. 2001. Genetic classification of "Sapporo-like viruses". Arch Virol 146:2115-2132.
94. Okada M, Shinozaki K, Ogawa T, Kaiho I. 2002. Molecular epidemiology and phylogenetic analysis of Sapporo-like viruses. Arch Virol 147:1445-1451.
95. Farkas T, Zhong WM, Jing Y, Huang PW, Espinosa SM, Martinez N, Morrow AL, Ruiz-Palacios GM, Pickering LK, Jiang X. 2004. Genetic diversity among sapoviruses. Arch Virol 149:1309-1323.
96. Oka T, Mori K, Iritani N, Harada S, Ueki Y, Iizuka S, Mise K, Murakami K, Wakita T, Katayama K. 2012. Human sapovirus classification based on complete capsid nucleotide sequences. Arch Virol 157:349-352.
97. Li L, Pesavento PA, Shan T, Leutenegger CM, Wang C, Delwart E. 2011. Viruses in diarrhoeic dogs include novel kobuviruses and sapoviruses. J Gen Virol 92:2534-2541.
98. Li L, Shan T, Wang C, Cote C, Kolman J, Onions D, Gulland FM, Delwart E. 2011. The fecal viral flora of California sea lions. J Virol 85:9909-9917.
50
99. Tse H, Chan WM, Li KS, Lau SK, Woo PC, Yuen KY. 2012. Discovery and genomic characterization of a novel bat sapovirus with unusual genomic features and phylogenetic position. PLoS One 7:e34987.
100. Scheuer KA, Oka T, Hoet AE, Gebreyes WA, Molla BZ, Saif LJ, Wang Q. 2013. Prevalence of porcine noroviruses, molecular characterization of emerging porcine sapoviruses from finisher swine in the United States, and unified classification scheme for sapoviruses. J Clin Microbiol 51:2344-2353.
101. Oka T, Wang Q, Katayama K, Saif LJ. 2015. Comprehensive Review of Human Sapoviruses. Clin Microbiol Rev 28:32-53.
102. Nakamura K, Saga Y, Iwai M, Obara M, Horimoto E, Hasegawa S, Kurata T, Okumura H, Nagoshi M, Takizawa T. 2010. Frequent detection of noroviruses and sapoviruses in swine and high genetic diversity of porcine sapovirus in Japan during Fiscal Year 2008. J Clin Microbiol 48:1215-1222.
103. Martella V, Lorusso E, Banyai K, Decaro N, Corrente M, Elia G, Cavalli A, Radogna A, Costantini V, Saif LJ, Lavazza A, Di Trani L, Buonavoglia C. 2008. Identification of a porcine calicivirus related genetically to human sapoviruses. J Clin Microbiol 46:1907-1913.
104. Wang QH, Han MG, Funk JA, Bowman G, Janies DA, Saif LJ. 2005. Genetic diversity and recombination of porcine sapoviruses. J Clin Microbiol 43:5963-5972.
105. Berry ES, Skilling DE, Barlough JE, Vedros NA, Gage LJ, Smith AW. 1990. New marine calicivirus serotype infective for swine. Am J Vet Res 51:1184-1187.
106. Smith AW, Madin SH, Vedros NA, Bankowski RA. 1977. Host range comparisons of five serotypes of caliciviruses. Am J Vet Res 38:101-105.
107. Posada D, Crandall KA, Holmes EC. 2002. Recombination in evolutionary genomics. Annu Rev Genet 36:75-97.
108. Katayama K, Shirato-Horikoshi H, Kojima S, Kageyama T, Oka T, Hoshino F, Fukushi S, Shinohara M, Uchida K, Suzuki Y, Gojobori T, Takeda N. 2002. Phylogenetic analysis of the complete genome of 18 Norwalk-like viruses. Virology 299:225-239.
109. Jiang X, Espul C, Zhong WM, Cuello H, Matson DO. 1999. Characterization of a novel human calicivirus that may be a naturally occurring recombinant. Arch Virol 144:2377-2387.
110. Vinje J, Green J, Lewis DC, Gallimore CI, Brown DW, Koopmans MP. 2000. Genetic polymorphism across regions of the three open reading frames of
51
"Norwalk-like viruses". Arch Virol 145:223-241.
111. Zhirakovskaia EV, Tikunov AY, Bodnev SA, Klemesheva VV, Netesov SV, Tikunova NV. 2015. Molecular epidemiology of noroviruses associated with sporadic gastroenteritis in children in Novosibirsk, Russia, 2003-2012. J Med Virol doi:10.1002/jmv.24068.
112. Sang S, Zhao Z, Suo J, Xing Y, Jia N, Gao Y, Xie L, Du M, Liu B, Ren S, Liu Y. 2014. Report of Recombinant Norovirus GII.g/GII.12 in Beijing, China. PLoS One 9:e88210.
113. Medici MC, Tummolo F, Martella V, Giammanco GM, De Grazia S, Arcangeletti MC, De Conto F, Chezzi C, Calderaro A. 2014. Novel recombinant GII.P16_GII.13 and GII.P16_GII.3 norovirus strains in Italy. Virus Res doi:10.1016/j.virusres.2014.04.005.
114. Katayama K, Miyoshi T, Uchino K, Oka T, Tanaka T, Takeda N, Hansman GS. 2004. Novel recombinant sapovirus. Emerg Infect Dis 10:1874-1876.
115. Dey SK, Mizuguchi M, Okitsu S, Ushijima H. 2011. Novel recombinant sapovirus in Bangladesh. Clin Lab 57:91-94.
116. Jeong C, Park SI, Park SH, Kim HH, Park SJ, Jeong JH, Choy HE, Saif LJ, Kim SK, Kang MI, Hyun BH, Cho KO. 2007. Genetic diversity of porcine sapoviruses. Vet Microbiol 122:246-257.
117. Phan TG, Khamrin P, Quang TD, Dey SK, Takanashi S, Okitsu S, Maneekarn N, Ushijima H. 2007. Emergence of intragenotype recombinant sapovirus in Japan. Infect Genet Evol 7:542-546.
118. Phan TG, Yan H, Khamrin P, Quang TD, Dey SK, Yagyu F, Okitsu S, Muller WE, Ushijima H. 2006. Novel intragenotype recombination in sapovirus. Clin Lab 52:363-366.
119. Hansman GS, Takeda N, Oka T, Oseto M, Hedlund KO, Katayama K. 2005. Intergenogroup recombination in sapoviruses. Emerg Infect Dis 11:1916-1920.
120. Chanit W, Thongprachum A, Khamrin P, Okitsu S, Mizuguchi M, Ushijima H. 2009. Intergenogroup recombinant sapovirus in Japan, 2007-2008. Emerg Infect Dis 15:1084-1087.
121. Hosmillo M, Chaudhry Y, Kim DS, Goodfellow I, Cho KO. 2014. Sapovirus Translation Requires an Interaction between VPg and the Cap Binding Protein eIF4E. J Virol 88:12213-12221.
122. Hansman GS, Oka T, Katayama K, Takeda N. 2007. Human sapoviruses:
52
genetic diversity, recombination, and classification. Rev Med Virol 17:133-141.
123. Oka T, Yamamoto M, Katayama K, Hansman GS, Ogawa S, Miyamura T, Takeda N. 2006. Identification of the cleavage sites of sapovirus open reading frame 1 polyprotein. J Gen Virol 87:3329-3338.
124. Oka T, Yokoyama M, Katayama K, Tsunemitsu H, Yamamoto M, Miyashita K, Ogawa S, Motomura K, Mori H, Nakamura H, Wakita T, Takeda N, Sato H. 2009. Structural and biological constraints on diversity of regions immediately upstream of cleavage sites in calicivirus precursor proteins. Virology 394:119-129.
125. Hansman GS, Oka T, Takeda N. 2008. Sapovirus-like particles derived from polyprotein. Virus Res 137:261-265.
126. Oka T, Katayama K, Ogawa S, Hansman GS, Kageyama T, Ushijima H, Miyamura T, Takeda N. 2005. Proteolytic processing of sapovirus ORF1 polyprotein. J Virol 79:7283-7290.
127. Robel I, Gebhardt J, Mesters JR, Gorbalenya A, Coutard B, Canard B, Hilgenfeld R, Rohayem J. 2008. Functional characterization of the cleavage specificity of the sapovirus chymotrypsin-like protease. J Virol 82:8085-8093.
128. Fullerton SW, Blaschke M, Coutard B, Gebhardt J, Gorbalenya A, Canard B, Tucker PA, Rohayem J. 2007. Structural and functional characterization of sapovirus RNA-dependent RNA polymerase. J Virol 81:1858-1871.
129. Chang KO, Sosnovtsev SV, Belliot G, Wang Q, Saif LJ, Green KY. 2005. Reverse genetics system for porcine enteric calicivirus, a prototype sapovirus in the Caliciviridae. J Virol 79:1409-1416.
130. Sosnovtsev SV, Belliot G, Chang KO, Prikhodko VG, Thackray LB, Wobus CE, Karst SM, Virgin HW, Green KY. 2006. Cleavage map and proteolytic processing of the murine norovirus nonstructural polyprotein in infected cells. J Virol 80:7816-7831.
131. Hillenbrand B, Gunzel D, Richter JF, Hohne M, Schreier E, Schulzke JD, Mankertz J. 2010. Norovirus non-structural protein p20 leads to impaired restitution of epithelial defects by inhibition of actin cytoskeleton remodelling. Scand J Gastroenterol 45:1307-1319.
132. Neill JD, Mengeling WL. 1988. Further characterization of the virus-specific RNAs in feline calicivirus infected cells. Virus Res 11:59-72.
133. Meyers G, Wirblich C, Thiel HJ. 1991. Genomic and subgenomic RNAs of rabbit hemorrhagic disease virus are both protein-linked and packaged into
53
particles. Virology 184:677-686.
134. Herbert TP, Brierley I, Brown TD. 1996. Detection of the ORF3 polypeptide of feline calicivirus in infected cells and evidence for its expression from a single, functionally bicistronic, subgenomic mRNA. J Gen Virol 77 ( Pt 1):123-127.
135. Yunus MA, Lin X, Bailey D, Karakasiliotis I, Chaudhry Y, Vashist S, Zhang G, Thorne L, Kao CC, Goodfellow I. 2014. The murine norovirus (MNV) core subgenomic RNA promoter consists of a stable stem-loop that can direct accurate initiation of RNA synthesis. J Virol doi:10.1128/JVI.02432-14.
136. Green KY, Mory A, Fogg MH, Weisberg A, Belliot G, Wagner M, Mitra T, Ehrenfeld E, Cameron CE, Sosnovtsev SV. 2002. Isolation of enzymatically active replication complexes from feline calicivirus-infected cells. J Virol 76:8582-8595.
137. Chang KO, Sosnovtsev SV, Belliot G, King AD, Green KY. 2006. Stable expression of a Norwalk virus RNA replicon in a human hepatoma cell line. Virology 353:463-473.
138. Sosnovtsev SV, Belliot G, Chang KO, Onwudiwe O, Green KY. 2005. Feline calicivirus VP2 is essential for the production of infectious virions. J Virol 79:4012-4024.
139. Vongpunsawad S, Venkataram Prasad BV, Estes MK. 2013. Norwalk Virus Minor Capsid Protein VP2 Associates within the VP1 Shell Domain. J Virol 87:4818-4825.
140. Herbert TP, Brierley I, Brown TD. 1997. Identification of a protein linked to the genomic and subgenomic mRNAs of feline calicivirus and its role in translation. J Gen Virol 78 ( Pt 5):1033-1040.
141. Karst SM. 2010. Pathogenesis of noroviruses, emerging RNA viruses. Viruses 2:748-781.
142. Meyers G. 2003. Translation of the minor capsid protein of a calicivirus is initiated by a novel termination-dependent reinitiation mechanism. J Biol Chem 278:34051-34060.
143. Meyers G. 2007. Characterization of the sequence element directing translation reinitiation in RNA of the calicivirus rabbit hemorrhagic disease virus. J Virol 81:9623-9632.
144. Napthine S, Lever RA, Powell ML, Jackson RJ, Brown TD, Brierley I. 2009. Expression of the VP2 protein of murine norovirus by a translation termination-reinitiation strategy. PLoS One 4:e8390.
54
145. Luttermann C, Meyers G. 2007. A bipartite sequence motif induces translation reinitiation in feline calicivirus RNA. J Biol Chem 282:7056-7065.
146. Di Martino B, Marsilio F. 2010. Feline calicivirus VP2 is involved in the self-assembly of the capsid protein into virus-like particles. Res Vet Sci 89:279-281.
147. Guo M, Qian Y, Chang KO, Saif LJ. 2001. Expression and self-assembly in baculovirus of porcine enteric calicivirus capsids into virus-like particles and their use in an enzyme-linked immunosorbent assay for antibody detection in swine. J Clin Microbiol 39:1487-1493.
148. Zhu S, Regev D, Watanabe M, Hickman D, Moussatche N, Jesus DM, Kahan SM, Napthine S, Brierley I, Hunter RN, 3rd, Devabhaktuni D, Jones MK, Karst SM. 2013. Identification of Immune and Viral Correlates of Norovirus Protective Immunity through Comparative Study of Intra-Cluster Norovirus Strains. PLoS Pathog 9:e1003592.
149. Studdert MJ. 1978. Caliciviruses. Brief review. Arch Virol 58:157-191.
150. Johnson JE. 1996. Functional implications of protein-protein interactions in icosahedral viruses. Proc Natl Acad Sci U S A 93:27-33.
151. Prasad BV, Matson DO, Smith AW. 1994. Three-dimensional structure of calicivirus. J Mol Biol 240:256-264.
152. Smith AW, Skilling DE, Anderson MP, Benirschke K. 1985. Isolation of primate calicivirus Pan paniscus type 1 from a douc langur (Pygathrix nemaeus l.). J Wildl Dis 21:426-428.
153. Prasad BV, Rothnagel R, Jiang X, Estes MK. 1994. Three-dimensional structure of baculovirus-expressed Norwalk virus capsids. J Virol 68:5117-5125.
154. Prasad BV, Hardy ME, Dokland T, Bella J, Rossmann MG, Estes MK. 1999. X-ray crystallographic structure of the Norwalk virus capsid. Science 286:287-290.
155. Chen R, Neill JD, Estes MK, Prasad BV. 2006. X-ray structure of a native calicivirus: structural insights into antigenic diversity and host specificity. Proc Natl Acad Sci U S A 103:8048-8053.
156. Zhou L, Luo M. 1995. Crystallization and preliminary X-ray analysis of two density populations of feline calicivirus. Acta Crystallogr D Biol Crystallogr 51:850-852.
157. Bhella D, Gatherer D, Chaudhry Y, Pink R, Goodfellow IG. 2008. Structural
55
insights into calicivirus attachment and uncoating. J Virol 82:8051-8058.
158. Ossiboff RJ, Zhou Y, Lightfoot PJ, Prasad BV, Parker JS. 2010. Conformational changes in the capsid of a calicivirus upon interaction with its functional receptor. J Virol 84:5550-5564.
159. Wang X, Xu F, Liu J, Gao B, Liu Y, Zhai Y, Ma J, Zhang K, Baker TS, Schulten K, Zheng D, Pang H, Sun F. 2013. Atomic model of rabbit hemorrhagic disease virus by cryo-electron microscopy and crystallography. PLoS Pathog 9:e1003132.
160. Yu G, Zhang D, Guo F, Tan M, Jiang X, Jiang W. 2013. Cryo-EM structure of a novel calicivirus, Tulane virus. PLoS One 8:e59817.
161. Oka T, Yamamoto M, Miyashita K, Ogawa S, Katayama K, Wakita T, Takeda N. 2009. Self-assembly of sapovirus recombinant virus-like particles from polyprotein in mammalian cells. Microbiol Immunol 53:49-52.
162. Jiang X, Zhong W, Kaplan M, Pickering LK, Matson DO. 1999. Expression and characterization of Sapporo-like human calicivirus capsid proteins in baculovirus. J Virol Methods 78:81-91.
163. Oka T, Hansman GS, Katayama K, Ogawa S, Nagata N, Miyamura T, Takeda N. 2006. Expression of sapovirus virus-like particles in mammalian cells. Arch Virol 151:399-404.
164. Ryu MS, Jung EH, Cho KO, Kang SY. 2012. Expression of porcine sapovirus VP1 gene and VP1 specific monoclonal antibody production. Hybridoma (Larchmt) 31:155-162.
165. Okada M, Yamashita Y, Oseto M, Ogawa T, Kaiho I, Shinozaki K. 2006. Genetic variability in the sapovirus capsid protein. Virus Genes 33:157-161.
166. Takahashi H, Ohuchi A, Miya S, Izawa Y, Kimura B. 2011. Effect of food residues on norovirus survival on stainless steel surfaces. PLoS One 6:e21951.
167. Bozkurt H, D'Souza DH, Davidson PM. 2013. Determination of the thermal inactivation kinetics of the human norovirus surrogates, murine norovirus and feline calicivirus. J Food Prot 76:79-84.
168. Duizer E, Bijkerk P, Rockx B, De Groot A, Twisk F, Koopmans M. 2004. Inactivation of caliciviruses. Appl Environ Microbiol 70:4538-4543.
169. Sattar SA, Ali M, Tetro JA. 2011. In vivo comparison of two human norovirus surrogates for testing ethanol-based handrubs: the mouse chasing the cat! PLoS One 6:e17340.
56
170. Gehrke C, Steinmann J, Goroncy-Bermes P. 2004. Inactivation of feline calicivirus, a surrogate of norovirus (formerly Norwalk-like viruses), by different types of alcohol in vitro and in vivo. J Hosp Infect 56:49-55.
171. Magulski T, Paulmann D, Bischoff B, Becker B, Steinmann E, Steinmann J, Goroncy-Bermes P, Steinmann J. 2009. Inactivation of murine norovirus by chemical biocides on stainless steel. BMC Infect Dis 9:107.
172. Liu P, Yuen Y, Hsiao HM, Jaykus LA, Moe C. 2010. Effectiveness of liquid soap and hand sanitizer against Norwalk virus on contaminated hands. Appl Environ Microbiol 76:394-399.
173. Cannon JL, Papafragkou E, Park GW, Osborne J, Jaykus LA, Vinje J. 2006. Surrogates for the study of norovirus stability and inactivation in the environment: aA comparison of murine norovirus and feline calicivirus. J Food Prot 69:2761-2765.
174. Buckow R, Isbarn S, Knorr D, Heinz V, Lehmacher A. 2008. Predictive model for inactivation of feline calicivirus, a norovirus surrogate, by heat and high hydrostatic pressure. Appl Environ Microbiol 74:1030-1038.
175. Chen H, Hoover DG, Kingsley DH. 2005. Temperature and treatment time influence high hydrostatic pressure inactivation of feline calicivirus, a norovirus surrogate. J Food Prot 68:2389-2394.
176. Sickbert-Bennett EE, Weber DJ, Gergen-Teague MF, Sobsey MD, Samsa GP, Rutala WA. 2005. Comparative efficacy of hand hygiene agents in the reduction of bacteria and viruses. Am J Infect Control 33:67-77.
177. Division of Viral Diseases NCfI, Respiratory Diseases CfDC, Prevention. 2011. Updated norovirus outbreak management and disease prevention guidelines. MMWR Recomm Rep 60:1-18.
178. Rha B, Burrer S, Park S, Trivedi T, Parashar UD, Lopman BA. 2013. Emergency department visit data for rapid detection and monitoring of norovirus activity, United States. Emerg Infect Dis 19:1214-1221.
179. Gastanaduy PA, Hall AJ, Curns AT, Parashar UD, Lopman BA. 2013. Burden of norovirus gastroenteritis in the ambulatory setting--United States, 2001-2009. J Infect Dis 207:1058-1065.
180. Simmons K, Gambhir M, Leon J, Lopman B. 2013. Duration of immunity to norovirus gastroenteritis. Emerg Infect Dis 19:1260-1267.
181. Espul C, Martinez N, Noel JS, Cuello H, Abrile C, Grucci S, Glass R, Berke T, Matson DO. 2004. Prevalence and characterization of astroviruses in Argentinean
57
children with acute gastroenteritis. J Med Virol 72:75-82.
182. Zintz C, Bok K, Parada E, Barnes-Eley M, Berke T, Staat MA, Azimi P, Jiang X, Matson DO. 2005. Prevalence and genetic characterization of caliciviruses among children hospitalized for acute gastroenteritis in the United States. Infect Genet Evol 5:281-290.
183. Patel MM, Widdowson MA, Glass RI, Akazawa K, Vinje J, Parashar UD. 2008. Systematic literature review of role of noroviruses in sporadic gastroenteritis. Emerg Infect Dis 14:1224-1231.
184. Naing Z, Rayner B, Killikulangara A, Vunnam K, Leach S, McIver CJ, Scott GM, Craig ME, Lui K, Rawlinson WD. 2013. Prevalence of viruses in stool of premature neonates at a neonatal intensive care unit. J Paediatr Child Health 49:E221-226.
185. Armbrust S, Kramer A, Olbertz D, Zimmermann K, Fusch C. 2009. Norovirus infections in preterm infants: wide variety of clinical courses. BMC Res Notes 2:96.
186. van Asten L, Siebenga J, van den Wijngaard C, Verheij R, van Vliet H, Kretzschmar M, Boshuizen H, van Pelt W, Koopmans M. 2011. Unspecified gastroenteritis illness and deaths in the elderly associated with norovirus epidemics. Epidemiology 22:336-343.
187. Ruzante JM, Majowicz SE, Fazil A, Davidson VJ. 2011. Hospitalization and deaths for select enteric illnesses and associated sequelae in Canada, 2001-2004. Epidemiol Infect 139:937-945.
188. Calderon-Margalit R, Sheffer R, Halperin T, Orr N, Cohen D, Shohat T. 2005. A large-scale gastroenteritis outbreak associated with Norovirus in nursing homes. Epidemiol Infect 133:35-40.
189. Kirking HL, Cortes J, Burrer S, Hall AJ, Cohen NJ, Lipman H, Kim C, Daly ER, Fishbein DB. 2010. Likely transmission of norovirus on an airplane, October 2008. Clin Infect Dis 50:1216-1221.
190. Wikswo ME, Cortes J, Hall AJ, Vaughan G, Howard C, Gregoricus N, Cramer EH. 2011. Disease transmission and passenger behaviors during a high morbidity Norovirus outbreak on a cruise ship, January 2009. Clin Infect Dis 52:1116-1122.
191. Matthews JE, Dickey BW, Miller RD, Felzer JR, Dawson BP, Lee AS, Rocks JJ, Kiel J, Montes JS, Moe CL, Eisenberg JN, Leon JS. 2012. The epidemiology of published norovirus outbreaks: a review of risk factors associated with attack rate and genogroup. Epidemiol Infect 140:1161-1172.
58
192. Scallan E, Hoekstra RM, Angulo FJ, Tauxe RV, Widdowson MA, Roy SL, Jones JL, Griffin PM. 2011. Foodborne illness acquired in the United States--major pathogens. Emerg Infect Dis 17:7-15.
193. Brugha R, Vipond IB, Evans MR, Sandifer QD, Roberts RJ, Salmon RL, Caul EO, Mukerjee AK. 1999. A community outbreak of food-borne small round-structured virus gastroenteritis caused by a contaminated water supply. Epidemiol Infect 122:145-154.
194. Loury P, FS LEG, JC LES, Ambert-Balay K, Parrot P, Hubert B. 2015. A norovirus oyster-related outbreak in a nursing home in France, January 2012. Epidemiol Infect doi:10.1017/S0950268814003628:1-8.
195. Lodo KL, Veitch MG, Green ML. 2014. An outbreak of norovirus linked to oysters in Tasmania. Commun Dis Intell Q Rep 38:E16-19.
196. Brake F, Ross T, Holds G, Kiermeier A, McLeod C. 2014. A survey of Australian oysters for the presence of human noroviruses. Food Microbiol 44:264-270.
197. Pavoni E, Consoli M, Suffredini E, Arcangeli G, Serracca L, Battistini R, Rossini I, Croci L, Losio MN. 2013. Noroviruses in seafood: a 9-year monitoring in Italy. Foodborne Pathog Dis 10:533-539.
198. Terio V, Martella V, Moschidou P, Di Pinto P, Tantillo G, Buonavoglia C. 2010. Norovirus in retail shellfish. Food Microbiol 27:29-32.
199. Nenonen NP, Hannoun C, Olsson MB, Bergstrom T. 2009. Molecular analysis of an oyster-related norovirus outbreak. J Clin Virol 45:105-108.
200. Kaplan JE, Goodman RA, Schonberger LB, Lippy EC, Gary GW. 1982. Gastroenteritis due to Norwalk virus: an outbreak associated with a municipal water system. J Infect Dis 146:190-197.
201. Maunula L, Miettinen IT, von Bonsdorff CH. 2005. Norovirus outbreaks from drinking water. Emerg Infect Dis 11:1716-1721.
202. Di Bartolo I, Pavoni E, Tofani S, Consoli M, Galuppini E, Losio MN, Ruggeri FM, Varisco G. 2015. Waterborne norovirus outbreak during a summer excursion in Northern Italy. New Microbiol 38:109-112.
203. Blackburn BG, Craun GF, Yoder JS, Hill V, Calderon RL, Chen N, Lee SH, Levy DA, Beach MJ. 2004. Surveillance for waterborne-disease outbreaks associated with drinking water--United States, 2001-2002. MMWR Surveill Summ 53:23-45.
59
204. Nygard K, Torven M, Ancker C, Knauth SB, Hedlund KO, Giesecke J, Andersson Y, Svensson L. 2003. Emerging genotype (GGIIb) of norovirus in drinking water, Sweden. Emerg Infect Dis 9:1548-1552.
205. Nurminen K, Blazevic V, Huhti L, Rasanen S, Koho T, Hytonen VP, Vesikari T. 2011. Prevalence of norovirus GII-4 antibodies in Finnish children. J Med Virol 83:525-531.
206. Mesquita JR, Nascimento MS. 2014. Norovirus GII.4 antibodies in the Portuguese population. J Infect Dev Ctries 8:1201-1204.
207. Donaldson EF, Lindesmith LC, Lobue AD, Baric RS. 2008. Norovirus pathogenesis: mechanisms of persistence and immune evasion in human populations. Immunol Rev 225:190-211.
208. Di Martino B, Di Profio F, Ceci C, Di Felice E, Green KY, Bok K, De Grazia S, Giammanco GM, Massirio I, Lorusso E, Buonavoglia C, Marsilio F, Martella V. 2014. Seroprevalence of Norovirus Genogroup IV Antibodies among Humans, Italy, 2010-2011. Emerg Infect Dis 20:1828-1832.
209. Fankhauser RL, Monroe SS, Noel JS, Humphrey CD, Bresee JS, Parashar UD, Ando T, Glass RI. 2002. Epidemiologic and molecular trends of "Norwalk-like viruses" associated with outbreaks of gastroenteritis in the United States. J Infect Dis 186:1-7.
210. Sugieda M, Nagaoka H, Kakishima Y, Ohshita T, Nakamura S, Nakajima S. 1998. Detection of Norwalk-like virus genes in the caecum contents of pigs. Arch Virol 143:1215-1221.
211. Liu BL, Lambden PR, Gunther H, Otto P, Elschner M, Clarke IN. 1999. Molecular characterization of a bovine enteric calicivirus: relationship to the Norwalk-like viruses. J Virol 73:819-825.
212. Martella V, Lorusso E, Decaro N, Elia G, Radogna A, D'Abramo M, Desario C, Cavalli A, Corrente M, Camero M, Germinario CA, Banyai K, Di Martino B, Marsilio F, Carmichael LE, Buonavoglia C. 2008. Detection and molecular characterization of a canine norovirus. Emerg Infect Dis 14:1306-1308.
213. Hsu CC, Wobus CE, Steffen EK, Riley LK, Livingston RS. 2005. Development of a microsphere-based serologic multiplexed fluorescent immunoassay and a reverse transcriptase PCR assay to detect murine norovirus 1 infection in mice. Clin Diagn Lab Immunol 12:1145-1151.
214. Mesquita JR, Delgado I, Costantini V, Heenemann K, Vahlenkamp TW, Vinje J, Nascimento MS. 2014. Seroprevalence of canine norovirus in 14 European countries. Clin Vaccine Immunol doi:10.1128/CVI.00048-14.
60
215. van der Poel WH, van der Heide R, Verschoor F, Gelderblom H, Vinje J, Koopmans MP. 2003. Epidemiology of Norwalk-like virus infections in cattle in The Netherlands. Vet Microbiol 92:297-309.
216. Smiley JR, Hoet AE, Traven M, Tsunemitsu H, Saif LJ. 2003. Reverse transcription-PCR assays for detection of bovine enteric caliciviruses (BEC) and analysis of the genetic relationships among BEC and human caliciviruses. J Clin Microbiol 41:3089-3099.
217. Wise AG, Monroe SS, Hanson LE, Grooms DL, Sockett D, Maes RK. 2004. Molecular characterization of noroviruses detected in diarrheic stools of Michigan and Wisconsin dairy calves: circulation of two distinct subgroups. Virus Res 100:165-177.
218. Thomas C, Jung K, Han MG, Hoet A, Scheuer K, Wang Q, Saif LJ. 2014. Retrospective serosurveillance of bovine norovirus (GIII.2) and nebovirus in cattle from selected feedlots and a veal calf farm in 1999 to 2001 in the United States. Arch Virol 159:83-90.
219. Hassine-Zaafrane M, Kaplon J, Sdiri-Loulizi K, Aouni Z, Pothier P, Aouni M, Ambert-Balay K. 2012. Molecular prevalence of bovine noroviruses and neboviruses detected in central-eastern Tunisia. Arch Virol 157:1599-1604.
220. Farkas T, Nakajima S, Sugieda M, Deng X, Zhong W, Jiang X. 2005. Seroprevalence of noroviruses in swine. J Clin Microbiol 43:657-661.
221. van Der Poel WH, Vinje J, van Der Heide R, Herrera MI, Vivo A, Koopmans MP. 2000. Norwalk-like calicivirus genes in farm animals. Emerg Infect Dis 6:36-41.
222. Mijovski JZ, Poljsak-Prijatelj M, Steyer A, Barlic-Maganja D, Koren S. 2010. Detection and molecular characterisation of noroviruses and sapoviruses in asymptomatic swine and cattle in Slovenian farms. Infect Genet Evol 10:413-420.
223. Cunha JB, de Mendonca MC, Miagostovich MP, Leite JP. 2010. Genetic diversity of porcine enteric caliciviruses in pigs raised in Rio de Janeiro State, Brazil. Arch Virol 155:1301-1305.
224. Svraka S, Vennema H, van der Veer B, Hedlund KO, Thorhagen M, Siebenga J, Duizer E, Koopmans M. 2010. Epidemiology and genotype analysis of emerging sapovirus-associated infections across Europe. J Clin Microbiol 48:2191-2198.
225. Hedlund KO, Rubilar-Abreu E, Svensson L. 2000. Epidemiology of calicivirus infections in Sweden, 1994-1998. J Infect Dis 181 Suppl 2:S275-280.
61
226. Lee RM, Lessler J, Lee RA, Rudolph KE, Reich NG, Perl TM, Cummings DA. 2013. Incubation periods of viral gastroenteritis: a systematic review. BMC Infect Dis 13:446.
227. Yoshida T, Kasuo S, Azegami Y, Uchiyama Y, Satsumabayashi K, Shiraishi T, Katayama K, Wakita T, Takeda N, Oka T. 2009. Characterization of sapoviruses detected in gastroenteritis outbreaks and identification of asymptomatic adults with high viral load. J Clin Virol 45:67-71.
228. Pang XL, Preiksaitis JK, Lee BE. 2014. Enhanced enteric virus detection in sporadic gastroenteritis using a multi-target real-time PCR panel: A one-year study. J Med Virol 86:1594-1601.
229. de Wit MA, Koopmans MP, Kortbeek LM, Wannet WJ, Vinje J, van Leusden F, Bartelds AI, van Duynhoven YT. 2001. Sensor, a population-based cohort study on gastroenteritis in the Netherlands: incidence and etiology. Am J Epidemiol 154:666-674.
230. de Wit MA, Koopmans MP, Kortbeek LM, van Leeuwen NJ, Vinje J, van Duynhoven YT. 2001. Etiology of gastroenteritis in sentinel general practices in the netherlands. Clin Infect Dis 33:280-288.
231. Lee LE, Cebelinski EA, Fuller C, Keene WE, Smith K, Vinje J, Besser JM. 2012. Sapovirus outbreaks in long-term care facilities, Oregon and Minnesota, USA, 2002-2009. Emerg Infect Dis 18:873-876.
232. Yamashita Y, Ootsuka Y, Kondo R, Oseto M, Doi M, Miyamoto T, Ueda T, Kondo H, Tanaka T, Wakita T, Katayama K, Takeda N, Oka T. 2010. Molecular characterization of Sapovirus detected in a gastroenteritis outbreak at a wedding hall. J Med Virol 82:720-726.
233. Iizuka S, Takai-Todaka R, Ohshiro H, Kitajima M, Wang Q, Saif LJ, Wakita T, Noda M, Katayama K, Oka T. 2013. Detection of multiple human sapoviruses from imported frozen individual clams. Food Environ Virol 5:119-125.
234. Kobayashi S, Fujiwara N, Yasui Y, Yamashita T, Hiramatsu R, Minagawa H. 2012. A foodborne outbreak of sapovirus linked to catered box lunches in Japan. Arch Virol 157:1995-1997.
235. Kitajima M, Haramoto E, Phanuwan C, Katayama H. 2011. Genotype distribution of human sapoviruses in wastewater in Japan. Appl Environ Microbiol 77:4226-4229.
236. Bucardo F, Carlsson B, Nordgren J, Larson G, Blandon P, Vilchez S, Svensson L. 2012. Susceptibility of children to sapovirus infections, Nicaragua,
62
2005-2006. Emerg Infect Dis 18:1875-1878.
237. Shirato-Horikoshi H, Ogawa S, Wakita T, Takeda N, Hansman GS. 2007. Binding activity of norovirus and sapovirus to histo-blood group antigens. Arch Virol 152:457-461.
238. Soma T, Nakagomi O, Nakagomi T, Mochizuki M. 2015. Detection of Norovirus and Sapovirus from diarrheic dogs and cats in Japan. Microbiol Immunol 59:123-128.
239. Reuter G, Zimsek-Mijovski J, Poljsak-Prijatelj M, Di Bartolo I, Ruggeri FM, Kantala T, Maunula L, Kiss I, Kecskemeti S, Halaihel N, Buesa J, Johnsen C, Hjulsager CK, Larsen LE, Koopmans M, Bottiger B. 2010. Incidence, diversity, and molecular epidemiology of sapoviruses in swine across Europe. J Clin Microbiol 48:363-368.
240. Song YJ, Yu JN, Nam HM, Bak HR, Lee JB, Park SY, Song CS, Seo KH, Choi IS. 2011. Identification of genetic diversity of porcine Norovirus and Sapovirus in Korea. Virus Genes 42:394-401.
241. Sachsenroder J, Twardziok S, Hammerl JA, Janczyk P, Wrede P, Hertwig S, Johne R. 2012. Simultaneous identification of DNA and RNA viruses present in pig faeces using process-controlled deep sequencing. PLoS One 7:e34631.
242. Sisay Z, Wang Q, Oka T, Saif L. 2013. Prevalence and molecular characterization of porcine enteric caliciviruses and first detection of porcine kobuviruses in US swine. Arch Virol 158:1583-1588.
243. Alcala AC, Rodriguez-Diaz J, de Rolo M, Vizzi E, Buesa J, Liprandi F, Ludert JE. 2010. Seroepidemiology of porcine enteric sapovirus in pig farms in Venezuela. Vet Immunol Immunopathol 137:269-274.
244. Liu GH, Li RC, Li J, Huang ZB, Xiao CT, Luo W, Ge M, Jiang DL, Yu XL. 2012. Seroprevalence of porcine cytomegalovirus and sapovirus infection in pigs in Hunan province, China. Arch Virol 157:521-524.
245. Liu ZK, Li JY, Pan H. 2014. Seroprevalence and molecular detection of porcine sapovirus in symptomatic suckling piglets in Guangdong Province, China. Trop Anim Health Prod doi:10.1007/s11250-013-0531-z.
246. Wang QH, Chang KO, Han MG, Sreevatsan S, Saif LJ. 2006. Development of a new microwell hybridization assay and an internal control RNA for the detection of porcine noroviruses and sapoviruses by reverse transcription-PCR. J Virol Methods 132:135-145.
247. Tan M, Jiang X. 2010. Norovirus gastroenteritis, carbohydrate receptors, and
63
animal models. PLoS Pathog 6:e1000983.
248. Rydell GE, Kindberg E, Larson G, Svensson L. 2011. Susceptibility to winter vomiting disease: a sweet matter. Rev Med Virol 21:370-382.
249. Lindesmith L, Moe C, Marionneau S, Ruvoen N, Jiang X, Lindblad L, Stewart P, LePendu J, Baric R. 2003. Human susceptibility and resistance to Norwalk virus infection. Nat Med 9:548-553.
250. Huang P, Farkas T, Marionneau S, Zhong W, Ruvoen-Clouet N, Morrow AL, Altaye M, Pickering LK, Newburg DS, LePendu J, Jiang X. 2003. Noroviruses bind to human ABO, Lewis, and secretor histo-blood group antigens: identification of 4 distinct strain-specific patterns. J Infect Dis 188:19-31.
251. Rockx BH, Vennema H, Hoebe CJ, Duizer E, Koopmans MP. 2005. Association of histo-blood group antigens and susceptibility to norovirus infections. J Infect Dis 191:749-754.
252. Ravn V, Dabelsteen E. 2000. Tissue distribution of histo-blood group antigens. APMIS 108:1-28.
253. Weston BW, Nair RP, Larsen RD, Lowe JB. 1992. Isolation of a novel human alpha (1,3)fucosyltransferase gene and molecular comparison to the human Lewis blood group alpha (1,3/1,4)fucosyltransferase gene. Syntenic, homologous, nonallelic genes encoding enzymes with distinct acceptor substrate specificities. J Biol Chem 267:4152-4160.
254. Ball SP, Tongue N, Gibaud A, Le Pendu J, Mollicone R, Gerard G, Oriol R. 1991. The human chromosome 19 linkage group FUT1 (H), FUT2 (SE), LE, LU, PEPD, C3, APOC2, D19S7 and D19S9. Ann Hum Genet 55:225-233.
255. Le Pendu J, Ruvoen-Clouet N, Kindberg E, Svensson L. 2006. Mendelian resistance to human norovirus infections. Semin Immunol 18:375-386.
256. Kirby AE, Shi J, Montes J, Lichtenstein M, Moe CL. 2014. Disease course and viral shedding in experimental Norwalk virus and Snow Mountain virus infection. J Med Virol doi:10.1002/jmv.23905.
257. Jin M, He Y, Li H, Huang P, Zhong W, Yang H, Zhang H, Tan M, Duan ZJ. 2013. Two gastroenteritis outbreaks caused by GII Noroviruses: host susceptibility and HBGA phenotypes. PLoS One 8:e58605.
258. Zhang D, Huang P, Zou L, Lowary TL, Tan M, Jiang X. 2015. Tulane Virus Recognizes the A Type 3 and B Histo-Blood Group Antigens. J Virol 89:1419-1427.
64
259. Nystrom K, Abrantes J, Lopes AM, Le Moullac-Vaidye B, Marchandeau S, Rocher J, Ruvoen-Clouet N, Esteves PJ, Le Pendu J. 2015. Neofunctionalization of the Sec1 alpha1,2fucosyltransferase paralogue in leporids contributes to glycan polymorphism and resistance to rabbit hemorrhagic disease virus. PLoS Pathog 11:e1004759.
260. Rydberg L, Molne J, Strokan V, Svalander CT, Breimer ME. 2001. Histo-blood group A antigen expression in pig kidneys--implication for ABO incompatible pig-to-human xenotransplantation. Scand J Urol Nephrol 35:54-62.
261. Thurin J, Blaszczyk-Thurin M. 1995. Porcine submaxillary gland GDP-L-fucose: beta-D-galactoside alpha-2-L-fucosyltransferase is likely a counterpart of the human Secretor gene-encoded blood group transferase. J Biol Chem 270:26577-26580.
262. Barreaud JP, Saunier K, Souchaire J, Delourme D, Oulmouden A, Oriol R, Leveziel H, Julien R, Petit JM. 2000. Three bovine alpha2-fucosyltransferase genes encode enzymes that preferentially transfer fucose on Galbeta1-3GalNAc acceptor substrates. Glycobiology 10:611-621.
263. Basic M, Keubler LM, Buettner M, Achard M, Breves G, Schroder B, Smoczek A, Jorns A, Wedekind D, Zschemisch NH, Gunther C, Neumann D, Lienenklaus S, Weiss S, Hornef MW, Mahler M, Bleich A. 2014. Norovirus Triggered Microbiota-driven Mucosal Inflammation in Interleukin 10-deficient Mice. Inflamm Bowel Dis doi:10.1097/01.MIB.0000441346.86827.ed.
264. Mumphrey SM, Changotra H, Moore TN, Heimann-Nichols ER, Wobus CE, Reilly MJ, Moghadamfalahi M, Shukla D, Karst SM. 2007. Murine norovirus 1 infection is associated with histopathological changes in immunocompetent hosts, but clinical disease is prevented by STAT1-dependent interferon responses. J Virol 81:3251-3263.
265. Kernbauer E, Ding Y, Cadwell K. 2014. An enteric virus can replace the beneficial function of commensal bacteria. Nature 516:94-98.
266. Taube S, Perry JW, McGreevy E, Yetming K, Perkins C, Henderson K, Wobus CE. 2012. Murine noroviruses bind glycolipid and glycoprotein attachment receptors in a strain-dependent manner. J Virol 86:5584-5593.
267. Taube S, Perry JW, Yetming K, Patel SP, Auble H, Shu L, Nawar HF, Lee CH, Connell TD, Shayman JA, Wobus CE. 2009. Ganglioside-linked terminal sialic acid moieties on murine macrophages function as attachment receptors for murine noroviruses. J Virol 83:4092-4101.
268. Karst SM, Wobus CE, Goodfellow IG, Green KY, Virgin HW. 2014. Advances in Norovirus Biology. Cell Host Microbe 15:668-680. 65
269. Weide KD, Waxler GL, Whitehair CK, Morill CC. 1962. Hog cholera in gnotobiotic pigs. Clinical signs and gross pathologic findings in germfree and monocontaminated pigs. J Am Vet Med Assoc 140:1056-1061.
270. Meyer RC, Bohl EH, Kohler EM. 1964. Procurement and Maintenance of Germ-Free Seine for Microbiological Investigations. Appl Microbiol 12:295-300.
271. Miniats OP, Jol D. 1978. Gnotobiotic pigs-derivation and rearing. Can J Comp Med 42:428-437.
272. Yuan L, Ward LA, Rosen BI, To TL, Saif LJ. 1996. Systematic and intestinal antibody-secreting cell responses and correlates of protective immunity to human rotavirus in a gnotobiotic pig model of disease. J Virol 70:3075-3083.
273. Francis DH, Collins JE, Duimstra JR. 1986. Infection of gnotobiotic pigs with an Escherichia coli O157:H7 strain associated with an outbreak of hemorrhagic colitis. Infect Immun 51:953-956.
274. Ando T, Noel JS, Fankhauser RL. 2000. Genetic classification of "Norwalk-like viruses. J Infect Dis 181 Suppl 2:S336-348.
275. Li X, Harwood VJ, Nayak B, Staley C, Sadowsky MJ, Weidhaas J. 2015. A Novel Microbial Source Tracking Microarray for Pathogen Detection and Fecal Source Identification in Environmental Systems. Environ Sci Technol doi:10.1021/acs.est.5b00980.
276. Oliver SL, Dastjerdi AM, Wong S, El-Attar L, Gallimore C, Brown DW, Green J, Bridger JC. 2003. Molecular characterization of bovine enteric caliciviruses: a distinct third genogroup of noroviruses (Norwalk-like viruses) unlikely to be of risk to humans. J Virol 77:2789-2798.
277. Balanzino LE, Barra JL, Monferran CG, Cumar FA. 1994. Differential interaction of Escherichia coli heat-labile toxin and cholera toxin with pig intestinal brush border glycoproteins depending on their ABH and related blood group antigenic determinants. Infect Immun 62:1460-1464.
278. Cheetham S, Souza M, McGregor R, Meulia T, Wang Q, Saif LJ. 2007. Binding patterns of human norovirus-like particles to buccal and intestinal tissues of gnotobiotic pigs in relation to A/H histo-blood group antigen expression. J Virol 81:3535-3544.
279. Cheetham S, Souza M, Meulia T, Grimes S, Han MG, Saif LJ. 2006. Pathogenesis of a genogroup II human norovirus in gnotobiotic pigs. J Virol 80:10372-10381.
280. Otto PH, Clarke IN, Lambden PR, Salim O, Reetz J, Liebler-Tenorio EM.
66
2011. Infection of calves with bovine norovirus GIII.1 strain Jena virus: an experimental model to study the pathogenesis of norovirus infection. J Virol 85:12013-12021.
281. Jung K, Scheuer KA, Zhang Z, Wang Q, Saif LJ. 2014. Pathogenesis of GIII.2 bovine norovirus, CV186-OH/00/US strain in gnotobiotic calves. Vet Microbiol 168:202-207.
282. Dastjerdi AM, Snodgrass DR, Bridger JC. 2000. Characterisation of the bovine enteric calici-like virus, Newbury agent 1. FEMS Microbiol Lett 192:125-131.
283. Hall GA, Bridger JC, Brooker BE, Parsons KR, Ormerod E. 1984. Lesions of gnotobiotic calves experimentally infected with a calicivirus-like (Newbury) agent. Vet Pathol 21:208-215.
284. Han MG, Cheetham S, Azevedo M, Thomas C, Saif LJ. 2006. Immune responses to bovine norovirus-like particles with various adjuvants and analysis of protection in gnotobiotic calves. Vaccine 24:317-326.
285. Rockx BH, Bogers WM, Heeney JL, van Amerongen G, Koopmans MP. 2005. Experimental norovirus infections in non-human primates. J Med Virol 75:313-320.
286. Karst SM, Wobus CE. 2015. A working model of how noroviruses infect the intestine. PLoS Pathog 11:e1004626.
287. Marionneau S, Ruvoen N, Le Moullac-Vaidye B, Clement M, Cailleau-Thomas A, Ruiz-Palacois G, Huang P, Jiang X, Le Pendu J. 2002. Norwalk virus binds to histo-blood group antigens present on gastroduodenal epithelial cells of secretor individuals. Gastroenterology 122:1967-1977.
288. Gonzalez-Hernandez MB, Liu T, Blanco LP, Auble H, Payne HC, Wobus CE. 2013. Murine Norovirus Transcytosis Across an In Vitro Polarized Murine Intestinal Epithelial Monolayer is Mediated by M-like Cells. J Virol doi:10.1128/JVI.02378-13.
289. Lay MK, Atmar RL, Guix S, Bharadwaj U, He H, Neill FH, Sastry KJ, Yao Q, Estes MK. 2010. Norwalk virus does not replicate in human macrophages or dendritic cells derived from the peripheral blood of susceptible humans. Virology 406:1-11.
290. Dolin R, Levy AG, Wyatt RG, Thornhill TS, Gardner JD. 1975. Viral gastroenteritis induced by the Hawaii agent. Jejunal histopathology and serologic response. Am J Med 59:761-768.
291. Schreiber DS, Blacklow NR, Trier JS. 1973. The mucosal lesion of the proximal
67
small intestine in acute infectious nonbacterial gastroenteritis. N Engl J Med 288:1318-1323.
292. Schreiber DS, Blacklow NR, Trier JS. 1974. The small intestinal lesion induced by Hawaii agent acute infectious nonbacterial gastroenteritis. J Infect Dis 129:705-708.
293. Hoover EA, Kahn DE. 1975. Experimentally induced feline calicivirus infection: clinical signs and lesions. J Am Vet Med Assoc 166:463-468.
294. Tenorio AP, Franti CE, Madewell BR, Pedersen NC. 1991. Chronic oral infections of cats and their relationship to persistent oral carriage of feline calici-, immunodeficiency, or leukemia viruses. Vet Immunol Immunopathol 29:1-14.
295. Knowles JO, McArdle F, Dawson S, Carter SD, Gaskell CJ, Gaskell RM. 1991. Studies on the role of feline calicivirus in chronic stomatitis in cats. Vet Microbiol 27:205-219.
296. Thiry E, Addie D, Belak S, Boucraut-Baralon C, Egberink H, Frymus T, Gruffydd-Jones T, Hartmann K, Hosie MJ, Lloret A, Lutz H, Marsilio F, Pennisi MG, Radford AD, Truyen U, Horzinek MC. 2009. Feline herpesvirus infection. ABCD guidelines on prevention and management. J Feline Med Surg 11:547-555.
297. Abd-Eldaim M, Potgieter L, Kennedy M. 2005. Genetic analysis of feline caliciviruses associated with a hemorrhagic-like disease. J Vet Diagn Invest 17:420-429.
298. Makino A, Shimojima M, Miyazawa T, Kato K, Tohya Y, Akashi H. 2006. Junctional adhesion molecule 1 is a functional receptor for feline calicivirus. J Virol 80:4482-4490.
299. Stuart AD, Brown TD. 2007. Alpha2,6-linked sialic acid acts as a receptor for Feline calicivirus. J Gen Virol 88:177-186.
300. Pesavento PA, Stokol T, Liu H, van der List DA, Gaffney PM, Parker JS. 2011. Distribution of the feline calicivirus receptor junctional adhesion molecule a in feline tissues. Vet Pathol 48:361-368.
301. Mikami O, Park JH, Kimura T, Ochiai K, Itakura C. 1999. Hepatic lesions in young rabbits experimentally infected with rabbit haemorrhagic disease virus. Res Vet Sci 66:237-242.
302. Ruvoen-Clouet N, Ganiere JP, Andre-Fontaine G, Blanchard D, Le Pendu J. 2000. Binding of rabbit hemorrhagic disease virus to antigens of the ABH histo-blood group family. J Virol 74:11950-11954.
68
303. Alonso C, Oviedo JM, Martin-Alonso JM, Diaz E, Boga JA, Parra F. 1998. Programmed cell death in the pathogenesis of rabbit hemorrhagic disease. Arch Virol 143:321-332.
304. Capucci L, Scicluna MT, Lavazza A. 1991. Diagnosis of viral haemorrhagic disease of rabbits and the European brown hare syndrome. Rev Sci Tech 10:347-370.
305. Martinez MA, Alcala AC, Carruyo G, Botero L, Liprandi F, Ludert JE. 2006. Molecular detection of porcine enteric caliciviruses in Venezuelan farms. Vet Microbiol 116:77-84.
306. Zhang B, Tang C, Yue H, Ren Y, Song Z. 2014. Viral metagenomics analysis demonstrates the diversity of viral flora in piglet diarrhoeic faeces in China. J Gen Virol 95:1603-1611.
307. Di Bartolo I, Tofani S, Angeloni G, Ponterio E, Ostanello F, Ruggeri FM. 2014. Detection and characterization of porcine caliciviruses in Italy. Arch Virol doi:10.1007/s00705-014-2076-5.
308. Kim HJ, Cho HS, Cho KO, Park NY. 2006. Detection and molecular characterization of porcine enteric calicivirus in Korea, genetically related to sapoviruses. J Vet Med B Infect Dis Vet Public Health 53:155-159.
309. Chang KO, Sosnovtsev SV, Belliot G, Kim Y, Saif LJ, Green KY. 2004. Bile acids are essential for porcine enteric calicivirus replication in association with down-regulation of signal transducer and activator of transcription 1. Proc Natl Acad Sci U S A 101:8733-8738.
310. Chang KO. 2009. Role of cholesterol pathways in norovirus replication. J Virol 83:8587-8595.
311. Flynn WT, Saif LJ, Moorhead PD. 1988. Pathogenesis of porcine enteric calicivirus-like virus in four-day-old gnotobiotic pigs. Am J Vet Res 49:819-825.
312. Kim DS, Hosmillo M, Alfajaro MM, Kim JY, Park JG, Son KY, Ryu EH, Sorgeloos F, Kwon HJ, Park SJ, Lee WS, Cho D, Kwon J, Choi JS, Kang MI, Goodfellow I, Cho KO. 2014. Both alpha2,3- and alpha2,6-linked sialic acids on O-linked glycoproteins act as functional receptors for porcine Sapovirus. PLoS Pathog 10:e1004172.
313. Bridger JC, Hall GA, Brown JF. 1984. Characterization of a calici-like virus (Newbury agent) found in association with astrovirus in bovine diarrhea. Infect Immun 43:133-138.
314. Sestak K, Feely S, Fey B, Dufour J, Hargitt E, Alvarez X, Pahar B,
69
Gregoricus N, Vinje J, Farkas T. 2012. Experimental inoculation of juvenile rhesus macaques with primate enteric caliciviruses. PLoS One 7:e37973.
315. Crick FH. 1958. On protein synthesis. Symp Soc Exp Biol 12:138-163.
316. Crick F. 1970. Central dogma of molecular biology. Nature 227:561-563.
317. Temin HM, Mizutani S. 1970. RNA-dependent DNA polymerase in virions of Rous sarcoma virus. Nature 226:1211-1213.
318. Baltimore D. 1970. RNA-dependent DNA polymerase in virions of RNA tumour viruses. Nature 226:1209-1211.
319. Neumann G, Kawaoka Y. 2004. Reverse genetics systems for the generation of segmented negative-sense RNA viruses entirely from cloned cDNA. Curr Top Microbiol Immunol 283:43-60.
320. Taniguchi T, Palmieri M, Weissmann C. 1978. QB DNA-containing hybrid plasmids giving rise to QB phage formation in the bacterial host. Nature 274:223-228.
321. Racaniello VR, Baltimore D. 1981. Cloned poliovirus complementary DNA is infectious in mammalian cells. Science 214:916-919.
322. Sosnovtsev S, Green KY. 1995. RNA transcripts derived from a cloned full-length copy of the feline calicivirus genome do not require VpG for infectivity. Virology 210:383-390.
323. Chang KO, Sosnovtsev SS, Belliot G, Wang Q, Saif LJ, Green KY. 2005. Reverse genetics system for porcine enteric calicivirus, a prototype sapovirus in the Caliciviridae. J Virol 79:1409-1416.
324. Sandoval-Jaime C, Green KY, Sosnovtsev SV. 2015. Recovery of murine norovirus and feline calicivirus from plasmids encoding EMCV IRES in stable cell lines expressing T7 polymerase. J Virol Methods doi:10.1016/j.jviromet.2015.02.003.
325. Katayama K, Murakami K, Sharp TM, Guix S, Oka T, Takai-Todaka R, Nakanishi A, Crawford SE, Atmar RL, Estes MK. 2014. Plasmid-based human norovirus reverse genetics system produces reporter-tagged progeny virus containing infectious genomic RNA. Proc Natl Acad Sci U S A doi:10.1073/pnas.1415096111.
326. Arias A, Urena L, Thorne L, Yunus MA, Goodfellow I. 2012. Reverse genetics mediated recovery of infectious murine norovirus. J Vis Exp doi:10.3791/4145.
327. Liu G, Ni Z, Yun T, Yu B, Chen L, Zhao W, Hua J, Chen J. 2008. A 70
DNA-launched reverse genetics system for rabbit hemorrhagic disease virus reveals that the VP2 protein is not essential for virus infectivity. J Gen Virol 89:3080-3085.
328. Asanaka M, Atmar RL, Ruvolo V, Crawford SE, Neill FH, Estes MK. 2005. Replication and packaging of Norwalk virus RNA in cultured mammalian cells. Proc Natl Acad Sci U S A 102:10327-10332.
329. Katayama K, Hansman GS, Oka T, Ogawa S, Takeda N. 2006. Investigation of norovirus replication in a human cell line. Arch Virol 151:1291-1308.
330. Taube S, Wobus CE. 2014. A novel reverse genetics system for human norovirus. Trends Microbiol 22:604-606.
331. Wei C, Farkas T, Sestak K, Jiang X. 2008. Recovery of infectious virus by transfection of in vitro-generated RNA from tulane calicivirus cDNA. J Virol 82:11429-11436.
332. Oka T, Takagi H, Tohya Y. 2014. Development of a novel single step reverse genetics system for feline calicivirus. J Virol Methods 207C:178-181.
333. Mitra T, Sosnovtsev SV, Green KY. 2004. Mutagenesis of tyrosine 24 in the VPg protein is lethal for feline calicivirus. J Virol 78:4931-4935.
334. Chaudhry Y, Skinner MA, Goodfellow IG. 2007. Recovery of genetically defined murine norovirus in tissue culture by using a fowlpox virus expressing T7 RNA polymerase. J Gen Virol 88:2091-2100.
335. Katsafanas GC, Moss B. 2007. Colocalization of transcription and translation within cytoplasmic poxvirus factories coordinates viral expression and subjugates host functions. Cell Host Microbe 2:221-228.
336. Ward VK, McCormick CJ, Clarke IN, Salim O, Wobus CE, Thackray LB, Virgin HWt, Lambden PR. 2007. Recovery of infectious murine norovirus using pol II-driven expression of full-length cDNA. Proc Natl Acad Sci U S A 104:11050-11055.
337. Sosnovtsev SV, Sosnovtseva SA, Green KY. 1998. Cleavage of the feline calicivirus capsid precursor is mediated by a virus-encoded proteinase. J Virol 72:3051-3059.
338. Neill JD, Sosnovtsev SV, Green KY. 2000. Recovery and altered neutralization specificities of chimeric viruses containing capsid protein domain exchanges from antigenically distinct strains of feline calicivirus. J Virol 74:1079-1084.
339. Abente EJ, Sosnovtsev SV, Bok K, Green KY. 2010. Visualization of feline
71
calicivirus replication in real-time with recombinant viruses engineered to express fluorescent reporter proteins. Virology 400:18-31.
340. Karakasiliotis I, Vashist S, Bailey D, Abente EJ, Green KY, Roberts LO, Sosnovtsev SV, Goodfellow IG. 2010. Polypyrimidine tract binding protein functions as a negative regulator of feline calicivirus translation. PLoS One 5:e9562.
341. Bailey D, Thackray LB, Goodfellow IG. 2008. A single amino acid substitution in the murine norovirus capsid protein is sufficient for attenuation in vivo. J Virol 82:7725-7728.
342. Simmonds P, Karakasiliotis I, Bailey D, Chaudhry Y, Evans DJ, Goodfellow IG. 2008. Bioinformatic and functional analysis of RNA secondary structure elements among different genera of human and animal caliciviruses. Nucleic Acids Res 36:2530-2546.
343. Sosnovtsev SV, Garfield M, Green KY. 2002. Processing map and essential cleavage sites of the nonstructural polyprotein encoded by ORF1 of the feline calicivirus genome. J Virol 76:7060-7072.
344. Chang KO, George DW. 2007. Interferons and ribavirin effectively inhibit Norwalk virus replication in replicon-bearing cells. J Virol 81:12111-12118.
345. Rondy M, Koopmans M, Rotsaert C, Van Loon T, Beljaars B, Van Dijk G, Siebenga J, Svraka S, Rossen JW, Teunis P, Van Pelt W, Verhoef L. 2011. Norovirus disease associated with excess mortality and use of statins: a retrospective cohort study of an outbreak following a pilgrimage to Lourdes. Epidemiol Infect 139:453-463.
346. Hosmillo M, Sorgeloos F, Hiraide R, Lu J, Goodfellow I, Cho KO. 2015. Porcine sapovirus replication is restricted by the type I interferon response in cell culture. J Gen Virol 96:74-84.
72
A B
Figure 1. Electron microscope graphs of porcine sapovirus Cowden strain.
(A) Transmission electron microscope graph of porcine sapovirus
Cowden strain VLPs. (B) Immune electron microscope graph of WT porcine sapovirus Cowden strain using pig hyperimmune antiserum to WT PoSaV. The bars represent 100 nm.
73
Figure 2. The genomic organization of caliciviruses.
(A) The genomic organization of sapo-, lago-, and neboviruses, which consists of two ORFs. (B) The genomic organization of noro- and vesiviruses, which consists of three ORFs. Subgenomic RNA was also observed during the calicivirus replication in cells. Both genomic and subgenomic RNA are linked with the VPg at their 5’ ends and polyadenylated at their 3’ ends.
74
B
C C
’
Figure 3. Quasiequivalent arrangement of a T = 3 icosahedral surface.
Red, green and blue colors represent three quasiequivalent positions, in the case of caliciviruses, are all VP1. Each rectangle represents an A/B dimer or a C/C dimer, respectively (adapted from Fields Virology, 6th Edition Chapter
3).
75
Genus Calicivirus strain/type Host Site of Receptor Pathogenesis Ref replication Norovirus GI.1 Human Norwalk virus Human Enteric HBGAs Gastroenteritis Kirby, et al, 2014; GII.2 Snow Mountain virus Human Enteric HBGAs Gastroenteritis Lindesmith, et al, 2003 GV Murine norovirus-1 Mouse Enteric, Sialic Lethal, Karst, et al, 2003 lymphoid acids organ cells dysfunction GIII.1 Bovine norovirus Jenna strain Cattle Enteric Unknown Gastroenteritis Otto, et al, 2011 GIII.2 Bovine norovirus Cattle Enteric Unknown Gastroenteritis Jung, et al, 2014 CV186-OH/00/US strain Sapovirus GI Human Sapporo virus Human Enteric Unknown Gastroenteritis Chiba, et al, 1979 GIII Porcine sapovirus Cowden Pig Enteric Sialic Gastroenteritis Guo, et al, 1999; strain acids Kim, et al, 2014 Lagovirus Rabbit hemorrhagic disease virus Rabbit Liver, HBGAs Organ Dalton, et al, 2014
7
6
systemic dysfunction, pulmonary hemorrhage European brown hare syndrome Hare Liver, Unknown Organ Morisse, et al, virus systemic dysfunction, 1991 pulmonary hemorrhage Continued Table 1. Pathogenesis of representative calicivirus strains
76
Table 1 continued Genus Calicivirus strain/type Host Site of Receptor Pathogenesis Ref replication Vesivirus Feline calicivirus Cat Mouth, Sialic Pneumonia Knowles, et al, 1991; upper acids, Stuart, et al, 2007 respiratory fJAM-A Feline calicivirus-VS Cat Systemic Lethal, Hurley, et al, 2004 organ dysfunction San Miguel sea lion Sea lion Systemic Unknown Skin lesions Gage, et al, 1990 virus Nebovirus Nebovirus Newbury-1 Cattle Enteric Unknown Gastroenteritis Woode, et al, 1978 strain Nebovirus Nebraska Cattle Enteric Gastroenteritis Smiley, et al, 2002 strain
Recovirus Tulane virus Monkey Enteric HBGAs, Gastroenteritis Farkas, et al, 2008 77
(proposed) sialic acids
77
Virus Cell line Promoter Helper virus Intermediate Ref Feline calicivirus CRFK T7 RNA polymerase No RNA Sosnovtsev, et al, 1995 promoter CRFK T7 RNA polymerase MVA-T7 DNA Mitra, et al, 2004 promoter HEK293T EF-1α No DNA Oka, et al, 2014 BHK-T7 T7-IRES-T7 No DNA Sandoval-Jaime, et al, 2015 Murine norovirus RAW T7 RNA polymerase No RNA Arias, et al, 2012 264.7 promoter RAW T7 RNA polymerase FPV-T7 DNA Chaudhry, et al, 2007 264.7 promoter HEK293T EF-1α No DNA Katayama, et al, 2014 BHK-T7 T7-IRES-T7 No DNA Sandoval-Jaime, et al,
2015 78
Porcine sapovirus Cowden LLC-PK T7 RNA polymerase No RNA Chang, et al, 2005 strain promoter Rabbit hemorrhagic disease RK-13 T7 RNA polymerase No RNA Liu, et al, 2006 virus promoter Human norovirus HEK293T T7 RNA polymerase No RNA Chang, et al, 2006 promoter HEK293T EF-1α No DNA Katayama, et al, 2014 Tulane virus LLC-MK T7 RNA polymerase No RNA Wei, et al, 2008 promoter Table 2. Summary of reverse genetics systems for caliciviruses.
78
Objectives and Hypothesis
1. Introduction
Currently, no robust cell culture system for human sapoviruses (HuSaVs) and human noroviruses (HuNoVs) has been established. Therefore, research on the pathogenesis of and immunity to HuSaVs and HuNoVs and the development of antivirals is hampered. Porcine SaV (PoSaV) Cowden strain is one of only a few culturable enteric caliciviruses. Compared to wild-type (WT) PoSaV Cowden strain, the tissue culture-adapted (TC) PoSaV has two conserved amino acid substitutions in the
RNA-dependent RNA polymerase (RdRp) and six in the capsid protein (VP1). Whether these amino acid substitutions influence PoSaV adaptation to a porcine kidney cell line,
LLC-PK, is unknown.
2. Objective 1 and Hypothesis
In Chapter 2 (Objective 1), the aim was to study the genetic mechanism of PoSaV
Cowden adaptation to LLC-PK cells. This study provides insights into the genetic basis for cell culture adaptation of the PoSaV Cowden strain, and may be applicable to adapt
79
other SaVs to cell culture. The hypothesis is that the amino acid substitutions in the VP1 and RdRp of the Cowden strain are critical for its adaption to LLC-PK cells. To test this hypothesis, the objectives were:
1. To identify the critical region and amino acids for TC Cowden PoSaV adaptation to
LLC-PK cells
2. To compare replication of the VP1 and RdRp mutants with the parental TC and WT
Cowden PoSaVs in vitro in both LLC-PK cells and in vivo in gnotobiotic pigs
3. To predict the location of the critical amino acids that contribute to TC adaptation of
Cowden PoSaV to LLC-PK cells in a 3D structural modeling
3. Objective 2 and Hypothesis
In Objective 1, the cell culture adaptation of PoSaV Cowden strain was shown to be related to amino acid substitutions in the VP1, but not the RdRp region. Four amino acid substitutions (178, 289, 324, and 328) in VP1 were critical for the cell culture adaptation of PoSaV Cowden strain. Another GIII PoSaV, the TC LL14 strain, has been adapted to the LLC-PK cells, although its replication in the LLC-PK cells was much less efficient than that of TC Cowden. However, amino acids at positions 178, 289, 291, 295, and 324 of TC LL14 VP1 (GenBank accession no. AY425671) were like the WT Cowden
80
strain. Whether the entire VP1 or only the four amino acids in VP1 affects the cell culture adaptation of other Cowden-like PoSaVs is unknown.
In Chapter 3 (Objective 2), the aim was to construct chimeric PoSaV WT LL14 and WT JJ259 containing the VP1 from TC Cowden strain and test their replication in
LLC-PK cells. The hypothesis is that the complete VP1 of TC Cowden enables unculturable GIII WT PoSaVs (WT LL14 and WT JJ259) to grow in LLC-PK cells in the presence of bile acids GCDCA. The specific objectives were:
1. To sequence the genomes of GIII PoSaVs WT LL14 and WT JJ259 strains
2. To generate a reverse genetics system for WT LL14 and JJ259 strains using the TC
Cowden pCV4A template
3. To replace the VP1 of WT LL14 and JJ259 strains with that of the TC Cowden strain
4. To test whether the chimeric PoSaVs grow in LLC-PK cells
81
Chapter 2: Mechanism of cell culture adaptation of an enteric calicivirus, porcine sapovirus Cowden strain
Summary
Porcine sapovirus (PoSaV) Cowden strain is one of only a few culturable enteric caliciviruses. Compared to wild-type (WT) PoSaV Cowden strain, the tissue culture-adapted (TC) PoSaV has two conserved amino acid substitutions in the
RNA-dependent RNA polymerase (RdRp) and six in the capsid protein (VP1). By using the reverse genetics system, four (178, 289, 324, and 328) amino acid substitutions in
VP1, but not the substitutions in the RdRp region, were identified to be critical for the cell culture adaptation of PoSaV Cowden strain. The other two substitutions in VP1 (291 and 295) reduced virus replication in vitro. Three dimensional (3D) structural analysis of
VP1 showed that residue 178 was located near the dimer-dimer interface, which may affect VP1 assembly and oligomerization; residues 289, 291, 324, and 328 were located at the protruding subdomain 2 (P2) of VP1, which may influence virus binding to the cellular receptors; and residue 295 was located at the interface of two monomeric VP1 proteins, which may influence VP1 dimerization. Although reversion of the mutations at 82
residues 291 or 295 from that of TC to WT reduced virus replication in vitro, it enhanced viral replication in vivo, and the revertants induced higher serum and mucosal antibody responses compared to TC PoSaV Cowden strain. These findings have revealed the molecular basis for PoSaV adaptation to cell culture. They may provide new, critical information for the cell culture adaptation of other PoSaV strains and human SaVs or noroviruses.
83
1. Introduction
Caliciviruses, in the family Caliciviridae, are small, icosahedral, and non-enveloped viruses of 27 to 35 nm in diameter, which have a positive sense, single-stranded RNA genome of 6.5 to 8.3 kb (1, 2). Caliciviruses have been classified into five genera (Norovirus, Sapovirus, Vesivirus, Lagovirus and Nebovirus) and several proposed genera (3, 4). Among them, noroviruses (NoVs) and sapoviruses (SaVs) are the leading causes of gastroenteritis in humans of all ages. SaVs are often associated with sporadic, self-limiting gastroenteritis, of which the severity is reportedly milder than
NoVs (5, 6). However, SaVs also cause outbreaks worldwide (7-10) and deaths associated with SaV infection have been reported in long-term care facilities (11).
Because most enteric caliciviruses are unculturable, research on pathogenesis and immunity, as well as the development of antivirals, has been hampered. Porcine SaV
(PoSaV) Cowden strain, previously known as porcine enteric calicivirus (PEC), belongs to genogroup III (GIII) SaV, and is one of only a few culturable enteric caliciviruses (2,
12, 13). PoSaV Cowden strain was adapted to a porcine kidney cell line (LLC-PK) after passage of the virus in gnotobiotic (Gn) pigs, followed by 20 passages in primary porcine kidney cells in the presence of an intestinal content preparation from uninfected Gn pigs
(12, 14).
84
Gn pigs have been established as a relevant animal model, because of the similarity of anatomy, genetics, physiology, and immunity with humans (15-17). PoSaV naturally infects pigs and causes mild to moderate gastroenteritis in Gn pigs (14, 18, 19), thus mimicking the SaV diarrhea reported in humans and providing an animal model suitable for studies of replication and pathogenesis of enteric caliciviruses.
The genome of PoSaV is composed of two open reading frames (ORFs). The
ORF1 encodes a polyprotein that is processed into several nonstructural proteins (NSs) and the major structural protein VP1 by a viral protease. The ORF2 encodes a small structural protein VP2 (20). The VP1 is divided into two domains: a shell (S) domain
(amino acid positions 3-216) and a protruding (P) domain (amino acid positions 217-544)
(21). The P domain is further divided into P1 (amino acid positions 217-272 and 425-544) and P2 (amino acid positions 273-424) subdomains (21, 22).
Reverse genetics systems are an important tool to rescue unculturable viruses and to study virus replication mechanisms. A reverse genetics system pCV4A that was constructed for PoSaV Cowden strain contained the full-length genomic cDNA of the tissue culture-adapted (TC) PoSaV Cowden strain, directly downstream from the T7
RNA polymerase promoter (20). Infectious TC PoSaV particles were rescued after transfection of LLC-PK cells with the in vitro transcribed and capped PoSaV genomic
RNA (20).
85
In this study, genetic basis of cell culture adaptation of PoSaV Cowden strain was investigated by comparative sequence analyses of the genomes of different passages of wild-type (WT) and TC PoSaVs, and generation of a series of PoSaV mutants using the reverse genetics system. The differences in replication both in vivo and in vitro, as well as their putative structural differences were further investigated. These studies are the first to identify which amino acid residues are critical for the cell culture adaptation of a SaV. This study provides new information on cell culture adaptation of SaVs that may be applicable to other human SaVs or to NoVs.
2. Materials and Methods
2.1 Cells and viruses
The LLC-PK cell line (#CL-101) and a human embryonic kidney cell line, HEK
293T/17 (#CRL-11268), were obtained from the American Type Culture Collection
(ATCC). The LLC-PK cells were passaged and maintained as previously described (20,
23). The HEK 293T/17 cells and a baby hamster kidney cell line (BHK-T7) stably expressing T7 RNA polymerase were cultured in Dulbecco’s modified Eagle’s medium
(DMEM, Life Technologies, NY, USA) with 10% fetal bovine serum (FBS, Thermo
Scientific, MA, USA), 1% nonessential amino acids (NEAA, Invitrogen, NY, USA), and
1% Antibiotic-Antimycotic (Invitrogen, NY, USA).
86
Two passage levels of WT PoSaV Cowden strain (Gn pig passage level 5,
I-1113, and 13, R418) from the small or large intestinal contents (SICs/LICs) of Gn pigs were used for sequencing. The TC PoSaV was propagated in LLC-PK cells (TC
PoSaV-2010, cell culture passage level 30) with 50 µM glycochenodeoxycholic acid
(GCDCA) (Sigma-Aldrich, MO, USA) as previously described (24).
2.2 Sequence analyses
The genomes of TC PoSaV-2010 (passage level 30, GenBank accession no.
KT922088) and WT PoSaV I-1113 (Gn pig passage level 5, GenBank accession no.
KT922087), and the VP1 region of WT PoSaV R418 (Gn pig passage level 13, GenBank accession no. KT945132) were sequenced by the primer walking method based on the TC
PoSaV genome (GenBank accession no. AF182760) as previously described (25). The
5’- and 3’-ends were determined using 5’-rapid amplification of cDNA ends (RACE) and
3’-RACE methods. Sequence editing and assembly were performed using the Lasergene software package (v10) (DNASTAR Inc., WI, USA). Multiple sequence alignment was done by ClustalW using DNA Data Bank of Japan (DDBJ) (http://www.ddbj.nig.ac.jp).
2.3 Generation of full length cDNA clones of PoSaV WT and TC chimeric genomes,
mutants, and revertant mutant strains
The plasmid pCV4A containing the full-length cDNA of TC PoSaV (TC
PoSaV-2005, cell culture passage level 27) was provided by Dr. Kyeong-Ok Chang at
87
Kansas State University (20). The primers for the generation of these chimeric clones are listed in the Table 1. The genomic organization and mapping of the mutations are
illustrated (Figure 4). The TC-WTVP1 was generated by replacing partial VP1 fragment
(nucleotide position 5227-6060, amino acid position 30-308) of pCV4A with the corresponding sequence fragment of WT PoSaV Cowden strain. Briefly, the WT PoSaV
Cowden VP1 fragment containing two ApaI restriction enzyme sites (nucleotide position
5227-5232 and 6055-6060) was reverse transcribed using SuperScript III reverse transcriptase (Life Technologies, NY, USA), and amplified by PCR with primers ApaI-F and ApaI-R using PrimeStar HS high-fidelity DNA polymerase (Clontech Laboratories,
Inc., CA, USA). The amplicons were digested by ApaI restriction enzyme and cloned into
ApaI-digested pCV4A plasmid.
Full-length cDNA clones of TC-WTRdRp, TCVP1-S178C, TCVP1-H289Y,
TCVP1-D291N, TCVP1-R295K, TCVP1-I324MM324I and TCVP1-G328EE328G were generated based on the pCV4A backbone by using QuikChange II XL site-directed mutagenesis kit (Agilent Technologies, TX, USA) following the manufacturer’s
instructions (Figure 4). For example, TC-WTRdRp was generated when the two
RNA-dependent RNA polymerase (RdRp) amino acid residues at 1252 and 1379 of pCV4A were mutated from TC to WT (H1252Y and K1379R). Three full-length cDNA
clones of chimeric genomes (TC-WTVP1-C178S, TC-WTVP1-Y289H, and
88
TC-WTVP1-C178S&Y289H) were generated based on the backbone TC-WTVP1, whose amino acid positions 324 and 328 in VP1 were TC type. Full-length cDNA clones of
TCVP1-I324M and TCVP1-G328E were generated by digesting the pCV4A with EcoRI restriction enzyme (nucleotide position 4582-6877) and replacing with I324M or G328E
engineered PCR products. Using TCVP1-I324M as an example, two fragments were PCR amplified with primers EcoRI-F and 6111-R, and 6111-F and EcoRI-R using pCV4A as template, respectively. PCR product containing the I324M mutation site was assembled by overlap PCR with primers EcoRI-F and EcoRI-R using the two fragments as templates.
The overlap PCR products containing I324M mutation site were EcoRI restriction enzyme digested and inserted into EcoRI restriction enzyme digested pCV4A. The recombinant plasmid was transformed and amplified in competent 10-beta E.coli (New
England BioLabs Inc., MA, USA).
2.4 In vitro transcription and capping of viral genomic RNA
In vitro transcription and capping of viral genomic RNA were performed following the manufacturer’s instructions. Briefly, the reverse genetics plasmid DNA was extracted from E.coli, linearized by NotI restriction enzyme digestion, and purified by phenol-chloroform extraction twice. Subsequently, genomic RNA was transcribed in vitro from the linearized plasmid by using MEGAscript T7 transcription kit (Life
Technologies, NY, USA). The reaction mixture was treated with DNase and the RNA
89
was purified with an RNeasy mini kit (QIAGEN, CA, USA) and analyzed by agarose gel
(1%) electrophoresis under denaturing conditions with formaldehyde. The transcribed
RNA was capped using ScriptCap m7G capping system (Cellscript, WI, USA) followed by RNA purification using the RNeasy mini kit. The RNA transcripts were suspended in
RNase-free water to a final concentration of 500ng/µl for transfection.
2.5 Transfection of BHK-T7 cells or HEK 293T/17 cells to rescue infectious viruses
The purified RNA transcripts were transfected into one-day-old HEK 293T/17 or
BHK-T7 cells (~50-70% confluent) in 24-well cell culture plates with Lipofectamine
2000 (Invitrogen, NY, USA). Briefly, one-day-old HEK 293T/17 or BHK-T7 cells were washed with OPTI-MEM I (Invitrogen, NY, USA). ~1.5µg capped RNA and 4µl
Lipofectamine 2000 were diluted in 50µl OPTI-MEM I separately, and incubated at room temperature for 5 min. Then the RNA and Lipofectamine 2000 solution were mixed (total volume of 100µl) and incubated at room temperature for 20 min before adding to HEK
293T/17 or BHK-T7 cell monolayers. After 6 hours of incubation at 37 ℃, the supernatant was replaced with DMEM growth medium (10% FBS, 1% NEAA, and 1%
Antibiotic-Antimycotic). After 1 day of incubation at 37℃, HEK 293T/17 or BHK-T7 cell lysates were harvested by freezing and thawing once followed by centrifugation at
2095 × g for 5 min to remove cell debris. The cell lysates were used to inoculate LLC-PK cells to generate virus pools.
90
2.6 Recovery of progeny virus in LLC-PK cells
The LLC-PK cell monolayers in 6-well plates were washed with MEM and inoculated with the HEK 293T/17 or BHK-T7 cell lysates in the presence of 50 μM
GCDCA. Cytopathic effects (CPEs) were monitored daily. The infected cells were incubated for up to 6 days post-inoculation, before harvesting the first passage of each mutant. Each mutation was confirmed by reverse transcription (RT) PCR with primer sets covering the mutated region followed by sequence analysis.
2.7 Plaque assays
10-fold serial-diluted samples were inoculated into wells of 6-well cell culture plates. After incubation at 37°C for 1.5 hrs with rocking, the inoculum was removed and the cell monolayer was overlaid with 0.85% low-melting temperature agarose
(Sigma-Aldrich, MO, USA) in MEM supplemented with 50 µM GCDCA (20). After plaques formed (5 days post-inoculation), cell monolayers were stained with 1 ml of 0.03% neutral red-PBS solution for 30 min at 37°C. The solution was removed and the plaques were counted and observed under a microscope. The plaque sizes were quantified using
Icy bioimage program (26).
2.8 Growth kinetics test for progeny mutants in LLC-PK cells
A growth kinetics curve of each mutant was determined by collecting cell lysates at different post-inoculation time points. LLC-PK cells in 6-well plates were incubated
91
with each mutant virus at 0.01 multiplicity of infection (MOI) for 1 hr. The inoculum was removed and the plate was washed once before adding maintenance MEM in the presence of 50 μM GCDCA. Supernatants and cell lysates were collected at 24, 48, 72, and 96 hours post-inoculation (hpi) after three cycles of freezing and thawing. Virus infectivity titers were determined in LLC-PK cells as 50% tissue culture infectious dose
(TCID50) by immunohistochemistry (IHC) staining using 96-well plates as described below (23).
2.9 IF and IHC staining for the detection of VP1 proteins in cell culture
IF staining was performed for the detection of VP1 protein in mutant infected cells (20), while IHC staining was performed for virus infectivity titration (23). Briefly, cell monolayers were fixed with 10% neutral formalin buffer at room temperature for 30 min, then the fixed cells were permeabilized with 1% Triton X-100 in PBS at room temperature for 10 min. Gn pig hyperimmune antiserum to WT PoSaV Cowden strain was used as primary antibody (18). Fluorescein isothiocyanate (FITC) -conjugated goat anti-swine IgG (H+L) serum (KPL, MD, USA) or horseradish peroxidase
(HRP)-conjugated goat anti-swine IgG (H+L) serum (KPL, MD, USA) were used as secondary antibodies. The IF signal was observed using fluorescent microscopy IX70
(Olympus, PA, USA). For IHC, cells were stained with substrate
92
3-amino-9-ethylcarbazole (AEC) (Sigma-Aldrich, MO, USA) at room temperature for at least 2 hrs and observed using light microscopy.
2.10 Three dimensional (3D) structural analyses of the VP1 proteins of WT and TC
PoSaV
The 3D structure of a SaV VP1 protein is not available in the database. The VP1 protein of WT PoSaV shares higher sequence identity (38%) with that of FCV (PDB code
3M8L) than those of San Miguel sea lion virus (SMSV, 34%, PDB code 2GH8) and the recombinant Norwalk virus (rNV, 29%, PDB code 1IHM). When the sequence identity is
30-50%, the obtained model tends to have about 90% of the main chain modeled with 1.5
Å root means square error (27). Therefore, the VP1 dimer structural models of WT and
TC PoSaV were constructed based on the crystal structure of the FCV VP1 protein at a resolution of 3.40Å by homology modeling method using ‘MOE-Align’ and
‘MOE-Homology’ in the Molecular Operating Environment (MOE, ver. 2014-09,
Chemical Computing Group Inc., Quebec, Canada). Twenty-five intermediate models were obtained from one homology modeling in the MOE, among which the intermediate models with the best scores were selected according to the scoring function Generalized
Born/Volume Integral (GB/VI). The final 3D models were thermodynamically simulated by energy minimization using AMBER10: EHT force field combined with the GB model of aqueous solvation implemented in the MOE (28-30). Physically unacceptable local
93
structures of the optimized 3D models were further refined on the basis of evaluation using the Ramachandran plot in the MOE. The structures of WT PoSaV VP1 dimers were generated from the monomeric structures by MOE on the basis of the assembly information of the FCV VP1 crystal structures. The quality of the models was assessed using the 3D-structure evaluation program Verify3D (31).
2.11 Prediction of the effects of point mutations on the stability of PoSaV
The change in the stability of WT PoSaV VP1 protein by each mutation was analyzed using the Protein Design application in the Molecular Operating Environment
(MOE, 2014-09). The structure of the WT PoSaV VP1 was constructed as described earlier. The single point mutations on the VP1 were generated individually, and ensembles of protein conformations were generated using the LowMode MD module with Boltzmann distribution in the MOE to calculate average stability. The stability scores in the structures refined by energy minimization were obtained using the stability scoring function of the Protein Design application in the MOE.
2.12 Gn pigs and experimental design
Gn pigs were derived and maintained as previously described (18, 32). A total of
36 Gn pigs were assigned to five groups (Table 4) and inoculated orally with: 1) TC
PoSaV (cell culture passage level 30, n=9), 2) TCVP1-R295K (n=7), 3) TCVP1-D291N
(n=9), 4) WT PoSaV (PS799, Gn pig passage level 13, n=7), or 5) MEM (n=4),
94
respectively. The TC PoSaV and TCVP1-D291N, TCVP1-R295K mutants were harvested
from cell culture and concentrated to ~7.0 log10 TCID50/ml (equivalent to real-time
quantitative RT-PCR (RT-qPCR) titer ~11.5 log10 genome equivalents (GE)/ml) by ultracentrifugation at 126,000 × g, for 1.5 hrs at 4℃. The WT PoSaV Cowden strain inoculated in Gn pigs was filtered through 0.22 μm-pore size filters prior to inoculation.
Each pig was inoculated orally with 5 ml inoculum containing the TC PoSaV or mutant
PoSaVs (~7.0 log10 TCID50/ml), or with 5ml ~11.5 log10 GE/ml RT-qPCR titer of WT
PoSaV.
All inoculated Gn pigs were observed daily for clinical signs. Their feces were scored as follows: 0, normal; 1, pasty; 2, semi-liquid; and 3, liquid, with fecal scores ≥2 indicating diarrhea (18). Rectal swabs were collected daily for virus shedding titration.
Blood was collected for serum from each Gn pig before inoculation, and at post-inoculation day (PID) 1, 3, 6, 9, 16, 23, 27, and at euthanasia. Two to three Gn pigs of each group were euthanized at acute phase infection: on the next day after an increase of fecal viral RNA titer, or on the day following the onset of clinical signs. The remaining pigs were euthanized after fecal viral shedding was no longer detected at termination of the experiment. Animal care and use for these studies was approved by the Institutional
Animal Care and Use Committee (IACUC) at The OSU. Mucosal antibody samples were
95
collected at necropsy by scraping the mucosa from the ileum and centrifuging at 4℃,
2095 × g for 20 min.
2.13 Histopathologic examination
At necropsy, blood, SIC and LIC were collected from each Gn pig. Fresh duodenum, proximal-, mid-, and distal-jejunum, ileum, colon, cecum, liver, spleen, lung, and kidney specimens were collected and immersed immediately in 10% neutral buffered formalin (NBF). 10% NBF fixed tissues were trimmed, embedded in paraffin, sectioned at 4 μm, stained with Harris’s hematoxylin and alcoholic eosin Y solution (H&E,
Sigma-Aldrich, MO, USA), and examined for histopathology microscopically.
Duodenum, proximal-, mid-, and distal-jejunum, ileum, colon and cecum
specimens were collected in duplicate, immersed in sucrose solution [130mM Na2HPO4,
30mM KH2PO4, 10% (w/v) sucrose, and 0.01% sodium azide, pH 7.2] on ice, embedded in Optimum Cutting Temperature (O.C.T.) compound (Sakura, PA, USA) and stored at
-20℃ overnight, then sectioned at 4-7 μm in a cryostat microtome. To detect the PoSaV antigen in tissues, frozen sections were fixed with acetone for 20 min at -20℃ followed by washing with PBS twice for 5 min each. Tissue sections were then blocked with 5% normal goat serum in 0.01M PBS-0.05% Tween 20 (PBST, pH 7.2) for 20 min. After blocking, the tissue sections were incubated with hyperimmune guinea pig antiserum to
PoSaV VLPs (33) at 4℃ overnight, followed by incubating with Alexa Fluor 488
96
conjugate goat anti-guinea pig IgG (H+L) serum (Life Technologies, NY, USA) at room temperature for 1 hr. Thereafter, tissue sections were counterstained with DAPI for nuclei and examined using fluorescent microscopy.
2.14 Detection of PoSaV RNA in rectal swabs (RSs)
RSs were collected, suspended into 4 ml of MEM, and centrifuged at 2095 × g for 30 min. The supernatant was collected as 10% fecal suspension and stored at -20℃ until RNA extraction. The total RNA was extracted from 50 μl RS suspensions using
MagMax RNA extraction kit (Life Technologies, NY, USA) following manufacturer’s instructions. Virus titer was determined using One-step TaqMan SaV specific RT-qPCR as described (23).
2.15 Detection of PoSaV-specific antibodies in serum and mucosal samples by
enzyme-linked immunosorbent assay (ELISA)
A recombinant baculovirus expressing PoSaV VP1 was generated as previously described and used to infect Sf9 cells for VLP production (33). Briefly, the purified
PoSaV VLPs were used as antigens to coat NUNC 96-well plates (MaxSorp surface,
Thermo Scientific, MA, USA) at 4℃ overnight at a final concentration of 2 μg/ml (100 ng/well) in 0.05M carbonate buffer, pH 9.6. The plates were blocked with 2% non-fat dry milk (NFDM) in PBST at 37℃ for 1 hr. After washing three times with PBST, serum samples were four-fold serially diluted in PBST containing 2% NFDM and added to the
97
wells. The plates were incubated at 37℃ for 1 hr and washed with PBST three times.
HRP-conjugated goat anti-swine IgG (H+L) serum (KPL, MD, USA) diluted 1: 3000, or
HRP-conjugated goat anti-swine IgA serum (AbD Serotec, NC, USA) diluted 1:5000 in
PBST containing 2% NFDM were added to wells followed by incubation at 37℃ for 1 hr. After washing the plates three times with PBST, the substrate 3, 3’, 5,
5’-tetramethylbenzidine (TMB, KPL, MD, USA) was added to each well for color development at room temperature. An equal volume of 1M phosphoric acid was added to terminate the reactions after 5 min incubation at room temperature. The absorbance at
450 nm were measured using a spectrometer (SpectraMax 430 PC, Molecular Devices,
LLC., CA, USA). The antibody titer was determined as the reciprocal of the highest serum dilution with an absorbance value greater than or equal to the mean absorbance of a series of negative control serum samples plus 3 times of standard deviation (SD) of the negative controls (33).
2.16 Virus neutralization (VN) test
Serum samples were tested for VN antibodies to PoSaV by a 50% cell culture
infectivity reduction test. 100 TCID50/well TC PoSaV was incubated with an equivalent volume of 4-fold serially diluted serum samples at 37℃ for 1 hr before applying to cell monolayers. Quadruplicate wells were used for each serum dilution. The non-neutralized
PoSaV was detected on the LLC-PK cells by IHC staining as described above. The VN
98
antibody titers were determined using Reed–Muench method (34) and expressed as the reciprocal of the highest serum dilution that inhibited PoSaV infection in 50% wells.
2.17 Statistical analysis
One-way analysis of variance (ANOVA) followed by Duncan’s multiple-range test was used to assess differences in plaque size, mean duration of virus shedding and log-transformed titers (including antibody titer, VN antibody titer, viral RNA titer) among groups. One-way ANOVA was used to assess villus height to crypt depth ratios
(VH:CD) and the mean numbers of antigen-positive cells per villus. A significance level of P < 0.05 was used for all comparisons.
3. Results
3.1 Consistent mutations occurred in the RdRp and VP1 regions at different passages of
TC PoSaV compared to WT PoSaV.
To investigate which genes were critical for PoSaV adaptation to cell culture, the genome of the TC PoSaV at passage level 30 in LLC-PK cells was sequenced in this study, and compared with those of WT PoSaV at pig passage levels 5 and 13, TC PoSaV at cell culture passage level 20 (25) and the infectious clone pCV4A carrying the cDNA of TC PoSaV-2005 (cell culture passage level 27) (20). Two and six conserved amino
99
acid mutations were observed in the RdRp (1252 and 1379) and VP1 (178, 289, 291, 295,
324 and 328) regions of TC PoSaV (Figure 4 and Table 3), respectively.
3.2 The VP1 region was critical for cell culture-adaptation of PoSaV.
To examine whether the RdRp or the VP1 region was critical for PoSaV adaptation to cells, two chimeric genomes were engineered (Figure 4) based on the
previously established PoSaV reverse genetics system, pCV4A: 1) TC-WTRdRp, whose
1252 and 1379 amino acid residues of the polyprotein (RdRp region) were mutated from
TC to WT phenotype (H1252Y and K1379R); 2) TC-WTVP1, whose partial VP1 region
(5227-6060 nt, 30-308 amino acids excluding amino acid residues 324 and 328) was replaced with the corresponding WT fragment. The capped genomic RNA transcripts were transfected into BHK-T7. After infecting LLC-PK cells with BHK-T7 cell lysates, the PoSaV VP1 proteins were detected exclusively by immunofluorescent assay (IFA) in
the LLC-PK cells inoculated with TC-WTRdRp but not TC-WTVP1 transfected products.
The growth kinetics and plaque sizes of TC-WTRdRp virus to those of TC-pCV4A virus in
LLC-PK cells were further compared (Figure 5). TC-WTRdRp had similar plaque sizes
(0.168±0.052 mm2) as TC-pCV4A (0.146±0.066 mm2) and similar growth kinetics as
TC-pCV4A in LLC-PK cells, showing increasing titers between 0-72 hpi with similar
peak titers (7.1±0.2 log10 TCID50/ml for TC-pCV4A and 7.0±0.0 log10 TCID50/ml for
100
TC-WTRdRp). These results suggested that the VP1 region, but not the RdRp region, was critical for cell culture-adaptation of PoSaV.
3.3 Four (178, 289, 324 and 328) of the six amino acid residues in the VP1 region were
essential for PoSaV adaptation to LLC-PK cells.
To address which of the individual mutations in the VP1 region was essential for
PoSaV adaptation, each of the sites was mutated to WT sequence individually (Figure 4):
TCVP1-S178C, TCVP1-H289Y, TCVP1-D291N, and TCVP1-R295K, TCVP1-I324M and
TCVP1-G328E. Mutants TCVP1-D291N and TCVP1-R295K replicated in LLC-PK cells. No infectious virus was rescued from LLC-PK cells infected with the transfection lysates of
TCVP1-S178C, TCVP1-H289Y, TCVP1-I324M or TCVP1-G328E infectious clones.
Furthermore, when the point mutations of TC-WTVP1 were mutated back to TC sequences,
the double mutant (TC-WTVP1-C178S&Y289H carrying TC amino acids at 324 and 328
residues) instead of the individual point mutants (TC-WTVP1-C178S, TC-WTVP1-Y289H), was rescued in the LLC-PK cells. Infectious virus was rescued from back mutations
TCVP1-I324MM324I and TCVP1-G328EE328G infectious clones. These results indicate that the four amino acid residues at sites 178, 289, 324 and 328 in the VP1 region are essential for PoSaV adaptation to LLC-PK cells.
101
3.4 Single amino acid substitutions in the VP1 region altered PoSaV growth kinetics in
vitro.
To examine whether amino acid substitutions D291N, R295K and
TC-WTVP1-C178S&Y289H can alter viral replication in LLC-PK cell cultures, the
growth kinetics and plaque sizes of TCVP1-D291N, TCVP1-R295K and
TC-WTVP1-C178S&Y289H to those of TC-pCV4A in LLC-PK cells were compared
2 (Figure 5). The TCVP1-D291N (0.041±0.011 mm ) and TCVP1-R295K (0.047±0.016
2 2 mm ) viruses, especially the TC-WTVP1-C178S&Y289H (0.018±0.003 mm ) virus, formed significantly smaller (P < 0.05) plaques than the TC-pCV4A (0.146±0.066 mm2)
2 and TC-WTRdRp (0.168±0.052 mm ) (Figure 5A). The infectious titers of TCVP1-D291N,
TCVP1-R295K and TC-WTVP1-C178S&Y289H increased post-inoculation. However, the
peak titers of TC-pCV4A (7.1±0.2 log10 TCID50/ml) and TC-WTRdRp (7.0±0.0 log10
TCID50/ml) were the highest, followed by TCVP1-R295K (6.6±0.0 log10 TCID50/ml),
TCVP1-D291N (6.4±0.0 log10 TCID50/ml), and TC-WTVP1-C178S&Y289H (4.9±0.1
log10 TCID50/ml) (Figure 5B). This data led us to conclude that the amino acid substitutions D291N and R295K in the VP1 region reduced PoSaV replication in
LLC-PK cells.
102
3.5 Comparative structural analyses of the VP1 proteins of TC and WT PoSaV predicted
the location and potential function of amino acid residues.
The 3D structural models of both TC and WT PoSaV Cowden matched the template structure (FCV VP1, PDB code 3M8L) (Figure 6A). Subsequently, 3D structural analysis was performed to examine whether the residue changes in VP1 between WT and TC PoSaVs resulted in structural changes. Amino acid residue 178 was located in the S domain near the dimer-dimer interface (Figure 6B). C178 of WT was exposed, but S178 of TC was hidden. The amino acid residues 289, 291, 324 and 328 in the WT PoSaV were located at the P2 subdomain region, while the amino acid 295 residue was located at the interface of two monomeric VP1 proteins forming a dimer at the P2 subdomain (Figure 6B).
To investigate whether the mutations at residues 178, 289, 291, 295, 324 and
328 influenced the stability of WT PoSaV, the changes in thermodynamic stability were analyzed by the mutations using the Protein Design application in the MOE. The positive number indicated decreased stability, while the negative number indicated increased stability. The changes in △G by each point mutation C178S, Y289H, N291D, K295R,
M324I, and E328G were 0.54±0.04, 4.51±0.02, 1.80±0.24, -1.43±0.31, -0.42±0.15 and
1.86±0.37 kcal/mol, respectively (Figure 7). Mutations C178S, Y289H, N291D and
103
E328G decreased the stability, whereas K295R and M324I, especially K295R, compensated the changes.
3.6 Single amino acid substitutions in the VP1 region altered PoSaV replication in pigs.
To investigate whether the amino acid substitutions from TC to WT in the VP1 could restore the virulence of the WT PoSaV in vivo, pathogenesis studies in Gn pigs were performed. Among the experimental groups, the WT PoSaV inoculated Gn pigs had significantly longer viral RNA shedding duration (30.3±3.8 days) and higher peak viral
RNA titer (10.8±0.4 log10 GE/g) than the other three inoculated Gn pig groups. Relative
to the mutants, the TCVP1-D291N inoculated Gn pigs had longer virus RNA shedding
duration (23.2±3.4 days) and higher peak RNA titer (8.6±0.8 log10 GE/g) than those of
TCVP1-R295K or TC PoSaV Cowden strain inoculated Gn pigs as shown (Figure 8 and
Table 6).
3.7 Clinical signs and histopathological lesions were observed exclusively in the WT
PoSaV infected Gn pigs.
Moderate diarrhea (fecal score=2) was observed in three of seven (43%) WT
PoSaV inoculated Gn pigs. Diarrhea developed by PID 3 to 12 and persisted for 2 to 16 days. No diarrhea or other clinical signs were observed in TC PoSaV Cowden,
TCVP1-D291N, TCVP1-R295K, or mock inoculated Gn pigs.
104
Microscopically, histopathological lesions were not observed in organs from the
TC PoSaV-, TCVP1-D291N-, TCVP1-R295K-inoculated or control Gn pigs. WT
PoSaV-inoculated Gn pigs euthanized at acute phase infection exhibited moderate to severe, diffuse, and atrophic enteritis, demonstrating shortened and blunt villi from duodenum to mid-jejunum of the small intestine (Figure 9A, 9B and 9C). Duodenal, proximal and mid-jejunal tissues showed a moderate, diffuse villous atrophy (Figure 9A,
9B and 9C). VH:CD of duodenal and mid-jejunal tissues were 3.54±1.06 and 3.98±
1.84, respectively, significantly lower than those (5.42 ± 2.26 and 5.95 ± 2.25, respectively) of control pigs (Table 7). Interestingly, the VH:CD ratio of jejunal tissues of
the TCVP1-D291N inoculated Gn pigs was statistically lower than those of for the
TCVP1-R295K, TC PoSaV Cowden inoculated, and control Gn pigs (Table 7), indicating
more severe villous atrophy in the jejunum of TCVP1-D291N-inoculated Gn pigs
compared with TCVP1-R295K-, TC PoSaV-inoculated and control Gn pigs.
Virus VP1 antigens were detected in the frozen tissues of WT PoSaV-inoculated
Gn pigs by immunofluorescent (IF). Most of antigen-positive cells were distributed in the mature enterocytes lining the intestinal villi of mid-jejunum, and to a lesser extent, in duodenum and proximal jejunum (Figure 9). Antigen-positive cells were rarely detected in distal jejunum and ileum. The mean numbers of antigen-positive cells per villus differed significantly among different regions of the small intestine with most of the
105
positive epithelial cells observed in duodenum to mid-jejunum with an increasing trend from duodenum (1.18±0.55) to proximal jejunum (2.45±0.42) and to mid jejunum
(3.78±1.30) (Figure 10). Antigen-positive cells were not observed in any tissue sections
of TC PoSaV-, TCVP1-D291N-, or TCVP1-R295K-inoculated Gn pigs.
IgG, IgA, and VN antibody titers in pig serum samples were titrated (Figure 11A,
11B and 11C). From PIDs 6 to 27, the Gn pigs inoculated with WT had the highest IgG,
IgA and VN serum antibody titers. The Gn pigs inoculated with TCVP1-D291N had higher serum IgG, IgA and VN antibody titers than those inoculated with TC or
TCVP1-R295K PoSaV at PIDs 6 to 27. The Gn pigs inoculated with WT also had the highest IgA mucosal antibody titers at PID 27 (Figure 11D). The Gn pigs inoculated with
TCVP1-D291N and TC PoSaV had significantly higher IgA mucosal antibody titers than
those inoculated with TCVP1-R295K (One-way ANOVA followed by Duncan’s multiple
range test on log4 transferred titers, P < 0.05).
4. Discussion
The genomes of WT (Gn pig passage level 5) and TC PoSaV Cowden strain
(cell culture passage level 20) were reported in 1999 (25). It was also reported that WT
PoSaV Cowden strain grew in porcine primary kidney cell culture after thirteen passages in Gn pigs, but only with mock Gn pig intestinal contents in the medium (14). Therefore,
106
one Gn pig intestinal sample was selected from both the fifth and the thirteenth passage levels of WT PoSaV for genomic sequence analysis. Besides the reported six amino acid substitutions between WT and TC PoSaVs (25), two additional substitutions at amino acid residues 324 and 328 of VP1 were identified. Seven genomes of different passages of WT and TC PoSaV Cowden strain were compared (Table 5). Compared to WT PoSaV
Cowden strain, eight of 19 amino acid mutations were conserved among all TC PoSaV genomes. The differences between the published WT PoSaV Cowden genome and these results are likely due to the intestinal content samples from different pigs and the different passage levels tested. Because the two newly identified sites (324 and 328 in the
VP1 region) were conserved in the newly sequenced fifth and thirteenth Gn pig passages of WT PoSaV, both sites were also included in this study. The establishment of the reverse genetics system pCV4A for PoSaV Cowden strain provided an important tool to study the molecular mechanisms for PoSaV cell culture adaptation (20). In this study, a series of PoSaV mutants was generated to test which of the eight amino acids were critical for cell culture adaptation. In the previous report, one-step in vitro transcription and capping was used to generate infectious PoSaV genomic RNA for transfection (20).
Infectious PoSaV Cowden virions were successfully rescued from LLC-PK cells using the one-step method (20, 35). However, for unknown reasons, infectious virus was failed to be rescued. Because infectious MNV was rescued from RAW 264.7 cells using a
107
two-step in vitro transcription followed by capping (36), the two-step method was tried and rescued infectious PoSaV from LLC-PK cells. The genome-linked virus protein (VPg) is encoded by NS5 gene, and is covalently linked to the 5’ end of the SaV genomic RNA
(20, 37, 38). In the system used in this study, the cap structure analog, m7G(5’)ppp(5’)G, was added to the 5’ end of the SaV genomic RNA transcripts to simulate SaV VPg (36,
39).
Among the mutants, TCVP1-S178C, TCVP1-H289Y, TCVP1-I324M, and
TCVP1-G328E could not be recovered in 4-5 repeats in the experiment. Whether viral particles were formed was unknown. However, the HEK293T/17 cells transfected with in
vitro transcribed and capped RNA of TCVP1-S178C, TCVP1-H289Y, TCVP1-I324M, and
TCVP1-G328E showed several VP1-positive cells by IHC staining using hyperimmune antiserum against the VLPs of PoSaV Cowden strain (data not shown). This suggests that the defect may occur at any step post VP1 expression, such as virion assembly and binding
to the receptors on LLC-PK cells or entry into the LLC-PK cells. TCVP1-D291N,
TCVP1-R295K and TC-WTVP1-C178S&Y289H were culturable in the LLC-PK cell line,
although the titer of TC-WTVP1-C178S&Y289H strain was 2 log10 lower compared with
the other culturable strains. In the in vitro study, both TCVP1-D291N and TCVP1-R295K mutants showed reduced replication compared with the TC PoSaV. Replication of the mutants in the LLC-PK cells was dependent on the existence of bile acids GCDCA, like
108
TC Cowden strain. However, in the Gn pig study, both TCVP1-D291N and TCVP1-R295K mutants had relatively higher peak viral RNA titers, longer fecal viral RNA shedding duration, and higher serum and mucosal antibody responses than TC PoSaV, but lower than those of WT PoSaV. No other amino acid substitutions due to replication in vivo or in vitro were observed. This indicates that the replication efficiency of PoSaV mutants were discordant in vitro and in vivo. In vitro, peak viral infectivity titers (highest to
lowest) were TC PoSaV > TCVP1-R295K > TCVP1-D291N > TC-WTVP1-C178S&Y289H;
in vivo, peak viral RNA titers (highest to lowest) were WT PoSaV > TCVP1-D291N >
TCVP1-R295K > TC PoSaV. Because the critical mutation sites are all located in VP1, probably different receptors were used by PoSaV Cowden strain in vivo to infect small intestinal epithelial cells in pigs and in vitro to infect porcine kidney LLC-PK cells.
Three passages of MNV1 in the macrophage cell line RAW 264.7 resulted in a total of three amino acid substitutions, which included V716I and H845R in the 3A-like protease (NS4) region and E296K in the P2 subdomain of VP1. Only V716I and E296K were suspected to be related to decreased virulence in mice and increased titer in RAW
264.7 cells (40, 41). Using reverse genetics, the K296E but not I716V back mutation restored the virulence of the MNV1 revertant in mice (41). Therefore, a single amino acid substitution in the P2 subdomain of VP1 of a norovirus may affect its virulence in the host and the replication efficacy in cell culture. A previous study concluded that TC
109
PoSaV Cowden strain was attenuated in vivo compared with the WT PoSaV Cowden strain after oral inoculation of Gn pigs with TC PoSaV Cowden strain cell culture supernatant (cell culture passage #20) or a filtrate of WT PoSaV Cowden strain (18). In
this study, the TC PoSaV Cowden strain, TCVP1-D291N and TCVP1-R295K were
concentrated, which were 1 log10 higher doses than in the previous study. However, clinical signs were observed exclusively in the WT PoSaV-infected pigs, but not in the
TC PoSaV Cowden strain, TCVP1-D291N or TCVP1-R295K infected Gn pigs. These
results indicated that even at 1 log10 higher inoculation dose, TC PoSaV Cowden strain
did not cause diarrhea in Gn pigs. Although revertants TCVP1-D291N and TCVP1-R295K did not cause diarrhea in Gn pigs, they replicated more efficiently and induced relatively higher immune responses compared with TC PoSaV, suggesting that the two amino acid substitutions in the P2 subdomain of VP1 affected PoSaV virulence in the host and could be better candidates than TC PoSaV Cowden strain for PoSaV vaccine development.
The first calicivirus structure was reported in 1994 for a primate calicivirus (42).
Currently, structures of virus-like particles (VLPs) or virion particles of caliciviruses have been determined for human NoV GI.1 and GII.10 (43, 44), GV MNV (45, 46), San
Miguel sea lion virus (47), Tulane virus (48), rabbit hemorrhagic disease virus (49), and feline calicivirus (FCV) (50). Therefore, structures are available in all classified genera of the family Caliciviridae, except for the genera Sapovirus and Nebovirus. Chen, et al,
110
reported that sapovirus showed more structural similarity to vesivirus (22). FCV VP1 protein has the closest phylogenetic relatedness (37% amino acid identity) to PoSaV
Cowden strain among the existing calicivirus VP1 structures. To understand the location of the mutation sites based on structural predictions, 3D structure modelling and analysis of the VP1 protein of PoSaV Cowden strain using FCV VP1 as template were performed.
In a previous study, the complete removal of the P domain of recombinant Norwalk virus-like particles resulted in the formation of smooth particles, which demonstrated that
S domain is sufficient for assembly of the capsid (51). Since the P2 subdomain of caliciviruses is the most protruding part of VP1 and is highly variable, it has been considered responsible for binding to the host receptors (52). A recent study indicated that the α2,3- and α2,6-linked sialic acids on O-linked glycoproteins are receptors on
LLC-PK cells for PoSaV Cowden strain (53). In this study, based on their locations in the structural model, amino acid position 178 was located in S domain, which may influence
VP1 oligomerization, virion assembly, and stability. Amino acid positions 289, 291, 324, and 328 were located in the P2 subdomain, which affect the binding to the receptors on
LLC-PK cells and may impair virus replication. Amino acid position 295 was located in the P2 subdomain at the interface of two monomeric VP1 proteins, which may influence
VP1 dimerization.
111
The changes in thermodynamic stability by the mutations indicate whether or not the protein structure can be maintained. The overall change in thermodynamic stability is the sum of each estimated value. Decreasing the stability is a disadvantage to maintain the structure, whereas increasing the stability is an advantage. Therefore, the mutations that decrease the stability are critical for the function, e.g., a cell culture adaptation, rather than the structure. Then, the mutations that increase the stability play a role in the compensation for the decreasing stability. In this study, the thermodynamic stability analysis indicated that C178S, Y289H, N291D and E328G decrease the stability, while
K295R and M324I increase the stability. These results suggest that C178S, Y289H,
N291D and E328G would provide essential functions for cell culture adaptation, whereas
K295R and M324I would compensate for decreased stability of C178S, Y289H, N291D and E328G.
12 WT GIII PoSaV VP1 protein sequences available in GenBank
(http://www.ncbi.nlm.nih.gov/nucleotide/) were compared and found that C178 in the S domain is conserved among all the 12 WT GIII PoSaVs [WT PoSaV Cowden (GenBank accession no. KT922087), SaV1-CHN (ACP43737), HW20-KOR (ADN84680),
ID3-HUN (ABD38714), LL14-US (AAR37376), MM280-US (AAX32888), JJ259-US
(AAX37311), QW270-US (AAX37314), PES-VENEZ (AAY88248), PoS6-HUN
(ACS68238), PoS9-HUN (ACS68240), s20-JAP (BAE94661)], suggesting that C178S
112
may be the most a critical mutation during PoSaV Cowden strain tissue culture-adaptation.
In this study, WT PoSaV antigen was observed in the epithelial cells of Gn pig small intestine from duodenum to mid-jejunum, but rarely in distal jejunum or ileum, which confirmed the region of PoSaV infection in Gn pigs as reported previously (18).
Also, as previously reported, morphologic alterations in duodenal and jejunal villi were observed in WT PoSaV Cowden infected Gn pigs (18, 54). IF staining of small and large intestinal impression smears, as well as villus length measurement also confirmed that the small intestine was the major infection site (18, 54). This data supports previous studies of the pathogenesis of WT PoSaV Cowden strain in Gn pigs.
This study demonstrated that cell culture adaptation of PoSaV Cowden strain is due to the amino acid substitutions in the VP1 region. The single revertant mutation (TC to WT) at certain positions 291 and 295 in the VP1 region reduced virus replication in vitro, but partially regained PoSaV replication efficiency in vivo. The genetic basis delineated for cell culture adaptation of PoSaV may provide new critical information for the rescue of other uncultivable PoSaVs and human SaVs. In future studies, reverse genetics systems for selected PoSaV and human SaV strains will be constructed by introducing site-directed mutations at structurally corresponding positions in the VP1 protein to rescue such unculturable SaVs.
113
References
1. Clarke IN, Lambden PR. 1997. The molecular biology of caliciviruses. J Gen Virol 78 ( Pt 2):291-301.
2. Farkas T, Sestak K, Wei C, Jiang X. 2008. Characterization of a rhesus monkey calicivirus representing a new genus of Caliciviridae. J Virol 82:5408-5416.
3. King AMQ, Adams MJ, Carstens EB, Lefkowitz EJ. 2012. Virus taxonomy: classification and nomenclature of viruses: Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier Academic Press.
4. Oka T, Wang Q, Katayama K, Saif LJ. 2015. Comprehensive Review of Human Sapoviruses. Clin Microbiol Rev 28:32-53.
5. Pang XL, Honma S, Nakata S, Vesikari T. 2000. Human caliciviruses in acute gastroenteritis of young children in the community. J Infect Dis 181 Suppl 2:S288-294.
6. Sakai Y, Nakata S, Honma S, Tatsumi M, Numata-Kinoshita K, Chiba S. 2001. Clinical severity of Norwalk virus and Sapporo virus gastroenteritis in children in Hokkaido, Japan. Pediatr Infect Dis J 20:849-853.
7. Hansman GS, Saito H, Shibata C, Ishizuka S, Oseto M, Oka T, Takeda N. 2007. Outbreak of gastroenteritis due to sapovirus. J Clin Microbiol 45:1347-1349.
8. Cubitt WD, Pead PJ, Saeed AA. 1981. A new serotype of calicivirus associated with an outbreak of gastroenteritis in a residential home for the elderly. J Clin Pathol 34:924-926.
9. Svraka S, Vennema H, van der Veer B, Hedlund KO, Thorhagen M, Siebenga J, Duizer E, Koopmans M. 2010. Epidemiology and genotype analysis of emerging sapovirus-associated infections across Europe. J Clin Microbiol 48:2191-2198.
10. Kobayashi S, Fujiwara N, Yasui Y, Yamashita T, Hiramatsu R, Minagawa H. 2012. A foodborne outbreak of sapovirus linked to catered box lunches in Japan. Arch Virol 157:1995-1997.
11. Lee LE, Cebelinski EA, Fuller C, Keene WE, Smith K, Vinje J, Besser JM. 114
2012. Sapovirus outbreaks in long-term care facilities, Oregon and Minnesota, USA, 2002-2009. Emerg Infect Dis 18:873-876.
12. Parwani AV, Flynn WT, Gadfield KL, Saif LJ. 1991. Serial propagation of porcine enteric calicivirus in a continuous cell line. Effect of medium supplementation with intestinal contents or enzymes. Arch Virol 120:115-122.
13. Karst SM, Wobus CE, Lay M, Davidson J, Virgin HWt. 2003. STAT1-dependent innate immunity to a Norwalk-like virus. Science 299:1575-1578.
14. Flynn WT, Saif LJ. 1988. Serial propagation of porcine enteric calicivirus-like virus in primary porcine kidney cell cultures. J Clin Microbiol 26:206-212.
15. Saif LJ, Ward LA, Yuan L, Rosen BI, To TL. 1996. The gnotobiotic piglet as a model for studies of disease pathogenesis and immunity to human rotaviruses. Arch Virol Suppl 12:153-161.
16. Meurens F, Summerfield A, Nauwynck H, Saif L, Gerdts V. 2012. The pig: a model for human infectious diseases. Trends Microbiol 20:50-57.
17. Hart EA, Caccamo M, Harrow JL, Humphray SJ, Gilbert JG, Trevanion S, Hubbard T, Rogers J, Rothschild MF. 2007. Lessons learned from the initial sequencing of the pig genome: comparative analysis of an 8 Mb region of pig chromosome 17. Genome Biol 8:R168.
18. Guo M, Hayes J, Cho KO, Parwani AV, Lucas LM, Saif LJ. 2001. Comparative pathogenesis of tissue culture-adapted and wild-type Cowden porcine enteric calicivirus (PEC) in gnotobiotic pigs and induction of diarrhea by intravenous inoculation of wild-type PEC. J Virol 75:9239-9251.
19. Saif LJ, Bohl EH, Theil KW, Cross RF, House JA. 1980. Rotavirus-like, calicivirus-like, and 23-nm virus-like particles associated with diarrhea in young pigs. J Clin Microbiol 12:105-111.
20. Chang KO, Sosnovtsev SV, Belliot G, Wang Q, Saif LJ, Green KY. 2005. Reverse genetics system for porcine enteric calicivirus, a prototype sapovirus in the Caliciviridae. J Virol 79:1409-1416.
21. Ryu MS, Jung EH, Cho KO, Kang SY. 2012. Expression of porcine sapovirus VP1 gene and VP1 specific monoclonal antibody production. Hybridoma 115
(Larchmt) 31:155-162.
22. Chen R, Neill JD, Noel JS, Hutson AM, Glass RI, Estes MK, Prasad BV. 2004. Inter- and intragenus structural variations in caliciviruses and their functional implications. J Virol 78:6469-6479.
23. Wang Q, Zhang Z, Saif LJ. 2012. Stability of and attachment to lettuce by a culturable porcine sapovirus surrogate for human caliciviruses. Appl Environ Microbiol 78:3932-3940.
24. Chang KO, Sosnovtsev SV, Belliot G, Kim Y, Saif LJ, Green KY. 2004. Bile acids are essential for porcine enteric calicivirus replication in association with down-regulation of signal transducer and activator of transcription 1. Proc Natl Acad Sci U S A 101:8733-8738.
25. Guo M, Chang KO, Hardy ME, Zhang Q, Parwani AV, Saif LJ. 1999. Molecular characterization of a porcine enteric calicivirus genetically related to Sapporo-like human caliciviruses. J Virol 73:9625-9631.
26. de Chaumont F, Dallongeville S, Chenouard N, Herve N, Pop S, Provoost T, Meas-Yedid V, Pankajakshan P, Lecomte T, Le Montagner Y, Lagache T, Dufour A, Olivo-Marin JC. 2012. Icy: an open bioimage informatics platform for extended reproducible research. Nat Methods 9:690-696.
27. Baker D, Sali A. 2001. Protein structure prediction and structural genomics. Science 294:93-96.
28. D.A. Case, T.A. Darden, T.E. Cheatham I, C.L. Simmerling, J. Wang, R.E. Duke, R. Luo, M. Crowley, R.C. Walker, W. Zhang, K.M. Merz, B. Wang, S. Hayik, A. Roitberg, G. Seabra, I. Kolossváry, K.F. Wong, F. Paesani, J. Vanicek, X. Wu, S.R. Brozell, T. Steinbrecher, H. Gohlke, L. Yang, C. Tan, J. Mongan, V. Hornak, G. Cui, D.H. Mathews, M.G. Seetin, C. Sagui, V. Babin, Kollman PA. 2008. AMBER 10, University of California, San Francisco.
29. Gerber PR, Muller K. 1995. MAB, a generally applicable molecular force field for structure modelling in medicinal chemistry. J Comput Aided Mol Des 9:251-268.
30. Summa CM, Levitt M. 2007. Near-native structure refinement using in vacuo energy minimization. Proc Natl Acad Sci U S A 104:3177-3182.
116
31. Eisenberg D, Luthy R, Bowie JU. 1997. VERIFY3D: assessment of protein models with three-dimensional profiles. Methods Enzymol 277:396-404.
32. Meyer RC, Bohl EH, Kohler EM. 1964. Procurement and Maintenance of Germ-Free Seine for Microbiological Investigations. Appl Microbiol 12:295-300.
33. Guo M, Qian Y, Chang KO, Saif LJ. 2001. Expression and self-assembly in baculovirus of porcine enteric calicivirus capsids into virus-like particles and their use in an enzyme-linked immunosorbent assay for antibody detection in swine. J Clin Microbiol 39:1487-1493.
34. Reed LJ, Muench H. 1938. A simple method of estimating fifty per cent endpoints. American Journal of Epidemiology 27:5.
35. Shivanna V, Kim Y, Chang KO. 2014. The crucial role of bile acids in the entry of porcine enteric calicivirus. Virology 456-457:268-278.
36. Yunus MA, Chung LM, Chaudhry Y, Bailey D, Goodfellow I. 2010. Development of an optimized RNA-based murine norovirus reverse genetics system. J Virol Methods 169:112-118.
37. Chaudhry Y, Nayak A, Bordeleau ME, Tanaka J, Pelletier J, Belsham GJ, Roberts LO, Goodfellow IG. 2006. Caliciviruses differ in their functional requirements for eIF4F components. J Biol Chem 281:25315-25325.
38. Hosmillo M, Chaudhry Y, Kim DS, Goodfellow I, Cho KO. 2014. Sapovirus Translation Requires an Interaction between VPg and the Cap Binding Protein eIF4E. J Virol 88:12213-12221.
39. Hinnebusch AG. 2014. The scanning mechanism of eukaryotic translation initiation. Annu Rev Biochem 83:779-812.
40. Wobus CE, Karst SM, Thackray LB, Chang KO, Sosnovtsev SV, Belliot G, Krug A, Mackenzie JM, Green KY, Virgin HW. 2004. Replication of Norovirus in cell culture reveals a tropism for dendritic cells and macrophages. PLoS Biol 2:e432.
41. Bailey D, Thackray LB, Goodfellow IG. 2008. A single amino acid substitution in the murine norovirus capsid protein is sufficient for attenuation in vivo. J Virol 82:7725-7728.
117
42. Prasad BV, Matson DO, Smith AW. 1994. Three-dimensional structure of calicivirus. J Mol Biol 240:256-264.
43. Prasad BV, Hardy ME, Dokland T, Bella J, Rossmann MG, Estes MK. 1999. X-ray crystallographic structure of the Norwalk virus capsid. Science 286:287-290.
44. Hansman GS, Taylor DW, McLellan JS, Smith TJ, Georgiev I, Tame JR, Park SY, Yamazaki M, Gondaira F, Miki M, Katayama K, Murata K, Kwong PD. 2012. Structural basis for broad detection of genogroup II noroviruses by a monoclonal antibody that binds to a site occluded in the viral particle. J Virol 86:3635-3646.
45. Katpally U, Voss NR, Cavazza T, Taube S, Rubin JR, Young VL, Stuckey J, Ward VK, Virgin HWt, Wobus CE, Smith TJ. 2010. High-resolution cryo-electron microscopy structures of murine norovirus 1 and rabbit hemorrhagic disease virus reveal marked flexibility in the receptor binding domains. J Virol 84:5836-5841.
46. Katpally U, Wobus CE, Dryden K, Virgin HWt, Smith TJ. 2008. Structure of antibody-neutralized murine norovirus and unexpected differences from viruslike particles. J Virol 82:2079-2088.
47. Chen R, Neill JD, Estes MK, Prasad BV. 2006. X-ray structure of a native calicivirus: structural insights into antigenic diversity and host specificity. Proc Natl Acad Sci U S A 103:8048-8053.
48. Yu G, Zhang D, Guo F, Tan M, Jiang X, Jiang W. 2013. Cryo-EM structure of a novel calicivirus, Tulane virus. PLoS One 8:e59817.
49. Hu Z, Tian X, Zhai Y, Xu W, Zheng D, Sun F. 2010. Cryo-electron microscopy reconstructions of two types of wild rabbit hemorrhagic disease viruses characterized the structural features of Lagovirus. Protein Cell 1:48-58.
50. Ossiboff RJ, Zhou Y, Lightfoot PJ, Prasad BV, Parker JS. 2010. Conformational changes in the capsid of a calicivirus upon interaction with its functional receptor. J Virol 84:5550-5564.
51. Bertolotti-Ciarlet A, White LJ, Chen R, Prasad BV, Estes MK. 2002. Structural requirements for the assembly of Norwalk virus-like particles. J Virol
118
76:4044-4055.
52. Bu W, Mamedova A, Tan M, Xia M, Jiang X, Hegde RS. 2008. Structural basis for the receptor binding specificity of Norwalk virus. J Virol 82:5340-5347.
53. Kim DS, Hosmillo M, Alfajaro MM, Kim JY, Park JG, Son KY, Ryu EH, Sorgeloos F, Kwon HJ, Park SJ, Lee WS, Cho D, Kwon J, Choi JS, Kang MI, Goodfellow I, Cho KO. 2014. Both alpha2,3- and alpha2,6-linked sialic acids on O-linked glycoproteins act as functional receptors for porcine Sapovirus. PLoS Pathog 10:e1004172.
54. Flynn WT, Saif LJ, Moorhead PD. 1988. Pathogenesis of porcine enteric calicivirus-like virus in four-day-old gnotobiotic pigs. Am J Vet Res 49:819-825.
119
Figure 4. Diagrams of the constructions of the TC and WT PoSaV and the mutants derived from the pCV4A backbone.
The eight amino acid residues at positions 1252 and 1379 in the ORF1 polyprotein and at positions 178, 289, 291, 295, 324 and 328 in the VP1 that differed between WT (red) and TC (green) PoSaV are indicated in bold and italic in each mutant.
The mutants TCVP1-D291N and TCVP1-R295K were tested in Gn pigs with WT and TC as
controls. The mutant TC-WTVP1-C178S&Y289H was not tested (NT) due to the 2 log10 lower virus infectivity titer that could not be equalized by further concentration.
Replication of the mutants in cell culture or in Gn pigs is noted.
120
Figure 4.
121
Figure 5. Growth kinetics and representative plaques of TC-pCV4A (TC) and the
culturable mutants, TC-WTRdRp, TCVP1-D291N (291), TCVP1-R295K (295) and
TC-WTVP1-C178S&Y289H (Double) in LLC-PK cells.
(A) The plaque sizes of mutants TCVP1-D291N, TCVP1-R295K, and
TC-WTVP1-C178S&Y289H were smaller than those of TC-pCV4A and TC-WTRdRp in
LLC-PK cells. (B) LLC-PK cells were inoculated with each virus at 0.01 multiplicity of infection (MOI). Cell lysates were collected at 24, 48, 72 and 96 hours post-inoculation
(hpi) for the titration of infectious virus. TC-pCV4A and TC-WTRdRp replicated in
LLC-PK cells to significantly higher titers (72 hpi) than the culturable mutants (One-way
analysis of variance (ANOVA) followed by Duncan’s multiple range test on log10 transferred titers, P < 0.05).
122
Figure 5.
A.
B.
123
Figure 6. Superimposition of the modeled structures of PoSaV Cowden and the template FCV structure and the 3D models of WT and TC PoSaV VP1.
(A) Superimposition of the modeled structures (WT PoSaV Cowden on the left and TC PoSaV Cowden on the right) and the template structure (FCV VP1, PDB code
3M8L) by homology modeling. The blue ribbon structure denotes WT PoSaV Cowden
VP1, the cyan ribbon structure denotes TC PoSaV Cowden, and the magenta ribbon structure denotes the template structure FCV VP1. (B) Amino acid residue 178 was located at the dimer-dimer interface in the S domain; residues 289, 291, 324 and 328 were located in the P2 subdomain; residue 295 was located on the interface of two monomeric VP1 proteins in P2 subdomain.
124
Figure 6.
A.
B.
125
Figure 7. The changes in △G for each point mutation C178S, Y289H, N291D,
K295R, M324I, and E328G.
Mutations C178S, Y289H, N291D and E328G decreased the thermodynamic stability, whereas K295R and M324I compensated the changes.
126
Figure 8. The viral RNA shedding in geometric mean titer (GMT) at various
post-inoculation days (PIDs) of TCVP1-D291N and TCVP1-R295K compared with
TC-pCV4A and WT PoSaV Cowden strain in Gn pigs.
Gn pigs were inoculated with the corresponding virus inoculum. Rectal swabs
(RSs) were collected daily for viral RNA shedding titration. The WT PoSaV Cowden strain had the highest peak titer and longest duration of viral RNA shedding among the experimental groups. The TC PoSaV Cowden strain had the lowest peak titer and shortest shedding duration among the experimental groups. Viral RNA shedding peak titers and
durations of TCVP1-D291N and TCVP1-R295K inoculated Gn pigs were intermediate between WT and TC groups.
127
Figure 9. Histopathological examination of small intestinal samples of WT PoSaV
Cowden or mock (NC) infected Gn pigs.
Hematoxylin and eosin (H&E) (left) and immunofluorescent (IF) (right) staining for samples collected from different regions in the small intestine. (A) to (C) WT PoSaV
Cowden inoculated Gn pigs at PID 5, showing fusion, shortening (arrows), or blunting
(arrowhead) of villi in duodenum, proximal jejunum, and mid-jejunum, respectively. (D) to (F) mock inoculated Gn pigs at PID 5, showing normal villi in duodenum, proximal jejunum, and mid-jejunum. Intestinal samples were collected in duplicate for IF staining and for H&E staining. Bar, 50 μm.
128
Figure 10. The distribution of antigen positive cells per villus in different regions of the small intestine of WT PoSaV-inoculated pigs.
Mean antigen positive cells per villus were significantly different among duodenum, proximal jejunum, and mid-jejunum of small intestine (One-way ANOVA, P
< 0.05).
129
Figure 11. Serum and mucosal antibody responses in Gn pigs.
(A) GMT of IgG antibodies to corresponding PoSaV strains or mock (NC) in serum samples of Gn pigs. (B) GMT of IgA antibodies to corresponding PoSaV strains or mock (NC) in serum samples of Gn pigs. (C) GMT of viral neutralizing antibodies to corresponding PoSaV strains or mock (NC) in serum samples of Gn pigs. (D) GMT of
IgA antibodies to corresponding PoSaV strains in ileal mucosal samples of Gn pigs.
Serum samples were collected from each Gn pig before inoculation and at PID 1, 3, 6, 9,
16, 23, 27. Ileal mucosal samples were collected at PID 5 and PID 27. Data points marked with different letters at each day differed significantly (One-way ANOVA
followed by Duncan’s multiple range test on log10 transferred titers, P < 0.05).
130
Location in PEC Primer name Sequence a Orientation genome ApaI-F 5′- GAGTCCAGACCAGTCCAGCCAGC 5203-5225 Forward ApaI-R 5′- TGGGTAGTGGTTGATGATGTTG 6090-6069 Reverse TC-3763-CTF 5′-CGTGAATGACCCAAGGTACCCCTTCTCACAACA Forward 3747-3779 TC-3763-CTR 5′-TGTTGTGAGAAGGGGTACCTTGGGTCATTCACG Reverse TC-4145-AGF 5′-AGAAAAGAATGACCAAGGCAAAAGACGCCTGCTGTG Forward 4122-4157 TC-4145-AGR 5′-CACAGCAGGCGTCTTTTGCCTTGGTCATTCTTTTCT Reverse TC-5671-ATF 5′-TTGGTGGGGCTATAGCATGTTTGGCACTTTACGTG Forward 5654-5688 TC-5671-ATR 5′-CACGTAAAGTGCCAAACATGCTATAGCCCCACCAA Reverse TC-6004-CTF 5′-CCCGTGTCAATGGAAAGTACACTGACAACACAGGT Forward 5987-6021 TC-6004-CTR 5′-ACCTGTGTTGTCAGTGTACTTTCCATTGACACGGG Reverse TC-6010-GAF 5′-CCCGTGTCAATGGAAAGCACACTAACAACACAGGTA Forward 5987-6022 TC-6010-GAR 5′-TACCTGTGTTGTTAGTGTGCTTTCCATTGACACGGG Reverse
131 TC-6023-GAF 5′-AGCACACTGACAACACAGGTAAGGCAGTGTTTCA Forward 6002-6035
TC-6023-GAR 5′-TGAAACACTGCCTTACCTGTGTTGTCAGTGTGCT Reverse
WT-5671-TAF 5′-TTGGTGGGGCTATAGCAAGTTTGGCACTTTACGTG Forward 5654-5688 WT-5671-TAR 5′-CACGTAAAGTGCCAAACTTGCTATAGCCCCACCAA Reverse WT-6004-TCF 5′-CCCGTGTCAATGGAAAGCACACTAACAACACAGGT Forward 5987-6021 WT-6004-TCR 5′-ACCTGTGTTGTTAGTGTGCTTTCCATTGACACGGG Reverse EcoRI-F 5’-GAGGCCTACGAGGAATTCAAG 4570-4590 Forward EcoRI-R 5’-GAGCCTGATTAAAAGAATTCATAATA 6891-6866 Reverse 6111-F 5’-CAACAATGTTCAACACAGGAAC 6104-6125 Forward Continued Table 3. Primers for the generation of the chimeric PoSaV clones.
131
Table 3 continued Location in PEC Primer name Sequence a Orientation genome 6111-R 5’- GTTGAACATTGTTGATGCAGC 6117-6097 Reverse 6122-F 5’-CAACACAGAAACTGCCGTAAATG 6114-6138 Forward 6122-R 5’- GGCAGTTTCTGTGTTGAATATTG 6129-6107 Reverse 6111-6122-F 5’- CAATGTTCAACACAGAAACTGCC 6107-6129 Forward 6111-6122-R 5’- CAGTTTCTGTGTTGAACATTGTTG 6127-6104 Reverse QCback-F 5’- GGCTGCATCAACAATATTCAACACAGGAACTGCC Forward 6096-6129 QCback-R 5’- GGCAGTTCCTGTGTTGAATATTGTTGATGCAGCC Reverse
132
132
No. of Gn pigs euthanized at Group No. a Inoculum (orally) No. of Gn pigs Titer (GE/ml) b acute infection phase (PID 5-7) 11.5 log GE/ml in MEM, 1 TC Cowden strain 9 10 3 5ml/pig 11.5 log GE/ml in MEM, 2 mutant TC -R295K 7 10 2 VP1 5ml/pig 11.5 log GE/ml in MEM, 3 mutant TC -D291N 9 10 3 VP1 5ml/pig WT Cowden strain 11.5 log GE/ml in MEM, 4 7 10 3 PS799 5ml/pig 5 MEM 4 MEM, 5 ml/pig, 2 Table 4. Experimental design for inoculation of Gn pigs with PoSaV Cowden TC, WT, or mutants.
a
13 All pigs were 4 to 7 days of age at inoculation. 3
b RT-qPCR titer 11.5 log10 GE/ml is equivalent to ~7.0 log10 TCID50/ml by infectivity assay.
133
WT-PoSaV in Gn pigs TC-PoSaV in LLC-PK cells Amino acid Nucleotide Gene Passage 5 Passage 5 Passage 13 Passage 13 Passage 20 position position Passage 27 Passage 30 (25) (I-1113a) (R418a) (PS499a) (25) TCT 17 59 TTT TTT TTT TTT TTT TTT (S17F) 18 62 GAC GGC(G18D) GGC GGC GAC GGC GGC NS1 24 80 CCA CCA CCA CCA CCA CCA CTA (L24P) ACG 29 94 GCG GCG GCG GCG GCG GCG (T29A) GTT 356 1075 ATT ATT ATT ATT ATT ATT (V356I) NS3 AGG 367 1109 AAG AAG AAG AAG AAG AAG (R367K) NS4 733 2207 GGC GAC /GGC GGC GGC GGC(D733G) GGC GGC
13 1252 3763 TAC TAC TAC TAC CAC(Y1252H) CAC CAC 4
NS7 1379 4145 AGA AGA AGA AGA AAA(R1379K) AAA AAA 1392 4185 ATA ATA ATG /ATA ATA ATA(M1392I) ATA ATA Continued Table 5. Summary of amino acid substitutions in the genomes of different passages of WT or TC PoSaV
Cowden strain.
134
Table 5 continued WT-PoSaV in Gn pigs TC-PoSaV in LLC-PK cells Amino acid Nucleotide Gene Passage 5 Passage 5 Passage 13 Passage 13 Passage 20 position position Passage 27 Passage 30 (25) (I-1113a) (R418a) (PS499a) (25) GCA 75 5362 ACA ACA ACA ACA ACA ACA (A1785T) 178 5671 TGT TGT TGT TGT AGT (C178S) AGT AGT 289 6004 TAC TAC TAC TAC CAC (Y289H) CAC CAC VP1 291 6010 AAC AAC AAC AAC GAC (N291D) GAC GAC 295 6023 AAG AAG AAG AAG AGG (K295R) AGG AGG 324 6111 ATA ATG ATG ATG ATA (M324I) ATA ATA 328 6122 GGA GAA GAA GAA GGA (E328G) GGA GGA CAA 27 6851 CAT CAT CAT CAT CAT CAT (E27H) ORF2 13 GAT 35 6873 AAT AAT AAT AAT AAT AAT
5 (D35N)
a Sample ID based on labeling system in the lab.
135
a b Duration days (SD) Peak titer log10 f Groups No. Gn pigs Onset (PID) δ δ PID of peak titer (SD) GE/ml TC 6 1-4 19.8 (2.6)c 7.7 (0.4)c 3-14 295 5 1-4 20.8 (3.4)c 7.9 (1.0)c 5-15 291 6 1-6 23.2 (3.4)d 8.6 (0.8)d 3-19 WT 4 1-3 30.3 (3.8)e 10.8 (0.4)e 6-10 NC 2 NA e NA NA NA Table 6. Comparative viral RNA shedding parameters of PoSaV Cowden TC, WT, and mutants.
a TC, 295, 291, WT and NC refer to TC PoSaV Cowden strain, TCVP1-R295K, TCVP1-D291N, WT PoSaV Cowden strain,
and negative control, respectively.
bThe onset of RNA shedding [post-inoculation days (PIDs)] refers to the PIDs that fecal viral RNA was first detected by
13 6
RT-qPCR.
δSuperscript denotes significant differences among the groups (One-way ANOVA followed by Duncan's multiple-range
test).
eNA, not applicable.
fThe PID of peak titer refers to the PID that has the highest viral RNA titer by RT-qPCR.
136
Groups a Regions in the small intestine [Avg. (SD)]δ Duodenum Jejunum Ileum TC 5.21(0.86)b 5.93 (1.60)b 4.68 (0.52) 295 5.97 (1.15)b 6.44 (0.78)b 5.26 (0.66) 291 5.32 (0.94)b 5.09 (1.47)c 5.20 (0.76) WT 3.54 (1.06)c 3.98 (1.84)d 5.23 (1.20) NC 5.42 (2.26)b 5.95 (2.25)b 6.57 (0.33) Table 7. Ratios of villus length/crypt depth in different regions of small intestines of Gn pigs.
a TC, 295, 291, WT and NC refer to TC PoSaV Cowden strain, TCVP1-R295K, TCVP1-D291N, WT PoSaV Cowden strain,
and negative control, respectively. 13
δ 7
Superscripts denote significant differences among the groups not sharing the same superscript (One-way ANOVA).
137
Chapter 3: The adaptation of genotype III porcine sapovirus to cell culture relies on the VP1 protein
Summary
In our prior studies, the tissue culture (TC) adaptation of porcine sapovirus (PoSaV)
Cowden strain to a porcine LLC-PK cell line was related to the amino acid substitutions in the VP1, but not the RNA-dependent RNA polymerase region. Four amino acid substitutions
(178, 289, 324, and 328) in VP1 were critical for the cell culture adaptation of PoSaV
Cowden strain. In this study, the complete genomes of two Cowden-like SaVs, wild type
(WT) JJ259 and WT LL14 strains were sequenced and compared with those of TC Cowden and TC LL14. Sequence alignment showed that three (178, 289, and 324) of the four critical amino acids in the VP1 of TC LL14 remained the same as Cowden-wild type. This result suggested that the amino acid substitutions critical for cell culture adaptation are likely strain- and structure-dependent. The hypothesis is that the complete VP1 of TC Cowden may enable unculturable porcine SaVs, which are genetically closely related to Cowden strain, to grow in LLC-PK cells. First, a reverse genetics system for WT LL14 (pLL14) and JJ259
(pJJ259), was established based on the infectious clone of TC Cowden strain, pCV4A. The
138
VP1 of WT LL14 was replaced with that of TC Cowden to generate a chimera
LL14-pCV4AVP1. It replicated in the LLC-PK cells, but to a 2 log10-lower infectious titer than pCV4A. These findings confirmed that VP1 is critical for the adaptation of Cowden-like
PoSaVs in LLC-PK cells.
139
1. Introduction
Caliciviruses are small, icosahedral, non-enveloped viruses of 27 to 40 nm in diameter. They have been classified into at least five genera, Norovirus, Sapovirus, Vesivirus,
Lagovirus and Nebovirus, within the family Caliciviridae (1, 2). Noroviruses (NoVs) and sapoviruses (SaVs) are the leading causes of human gastroenteritis worldwide (3-8). The calicivirus genome consists of a 6.5-8.3 kb positive sense, single stranded RNA, which is covalently linked to a viral genome-linked protein (VPg) at the 5’ end, and is polyadenylated at the 3’ end (9, 10). The genomic RNA of SaVs contains two ORFs: ORF1 encodes a polyprotein that is further processed into several non-structural (NS) proteins and the major capsid protein VP1. ORF2 encodes a minor structural protein VP2. VP1 is divided into an
N-terminal arm, a shell (S) domain and a protruding (P) domain, which is subdivided into P1 and P2 subdomains (11, 12). The P2 subdomain is the most protruding region of the capsid and is responsible for receptor binding activity and antigenicity (13).
To date, research on human enteric caliciviruses has been hampered due to the lack of a robust cell culture system. Only a few animal caliciviruses grow efficiently in cell cultures, including murine NoV (MNV), Tulane virus, several vesiviruses, and porcine SaV (PoSaV)
Cowden strain (10, 14-19). The PoSaV Cowden strain was adapted to a porcine kidney cell line, LLC-PK, in the presence of bile acids, such as glycochenodeoxycholic acid (GCDCA)
(18-20). Compared with the wild type (WT), the tissue culture adapted (TC) Cowden strain
140
has eight consensus amino acid substitutions, among which two were located in the
RNA-dependent RNA polymerase (RdRp) region and six were located in the VP1 region
(21). Our previous studies concluded that the amino acid substitutions in VP1, instead of those of the RdRp region were critical for the adaptation of the Cowden strain to LLC-PK cells. In this study, the hypothesis that the VP1 was critical to render the unculturable WT
SaVs to grow in LLC-PK cells was tested using additional PoSaV strains that are genetically closely related to Cowden strain. The unculturable PoSaV WT LL14
(Po/SaV/OH-LL14/02/US) and JJ259 (Po/SaV/OH-JJ259/00/US) strains were selected because both strains belong to the same genogroup III (GIII) SaVs as Cowden strain based on the published VP1 sequences (20, 22). The LL14 strain is closely related to the Cowden strain, and has been adapted to LLC-PK cells, but grew inefficiently compared with the
Cowden strain (20). JJ259 remains unculturable.
In this study, the full-length genomes of the WT LL14 and WT JJ259 strains were sequenced. Reverse genetics systems, pLL14 and pJJ259 for the WT LL14 and WT JJ259 strains were established, respectively, based on the previously reported reverse genetics system pCV4A for TC Cowden strain (23). Next, the VP1 of WT LL14 was replaced with
that of TC Cowden to generate a chimera LL14-pCV4AVP1. It became culturable in the
LLC-PK cells. This study is the first to artificially generate a culturable SaV from a WT strain.
141
2. Materials and methods
2.1 Viruses and cell lines
The WT LL14 (GenBank accession no. KT945133) and WT JJ259 (GenBank accession no. KT922089) strains were from the diluted and filtered pig fecal suspensions (22).
WT LL14 was a field strain detected in 2002, while WT JJ259 was detected from diarrheic pigs in 2000 (20, 22).
The LLC-PK cell line (#CL-101) and a human embryonic kidney cell line, HEK
293T/17 (#CRL-11268), were obtained from the American Type Culture Collection (ATCC).
The LLC-PK cells were cultured in minimum essential medium (MEM, Thermo Fisher, MA,
USA) with 5% fetal bovine serum (FBS, HyClone, GE Healthcare, UT, USA), 1% non-essential amino acids (NEAA, Thermo Fisher, MA, USA), 1% Antibiotic-Antimycotic
(Thermo Fisher, MA, USA), and 1% N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid
(HEPES, Thermo Fisher, MA, USA), as described previously (23, 24). The HEK293T/17 cells were cultured in Dulbecco's modified eagle medium (DMEM, Thermo Fisher, MA,
USA) with 10% FBS, 1% NEAA, and 1% Antibiotic-Antimycotic.
2.2 Genomic sequence analyses of WT LL14 and WT JJ259 strains
The viral RNA was extracted from the fecal suspensions using the RNeasy mini kit
(QIAGEN, CA, USA) and reverse transcribed using Superscript III reverse transcriptase
(Thermo Fisher, MA, USA). cDNA amplification was performed using PrimeSTAR HS
142
DNA polymerase (Clontech Laboratories, CA, USA) and primers oligo (dT) and WT-SaV-F.
The PCR was performed for 30 cycles of denaturation at 98℃ for 10 s, annealing at 60℃ for 5 s, and extension at 72℃ for 8 min. The full-length genomes of WT LL14 and WT
JJ259 were sequenced using the primer walking method using primers designed based on the reported sequences of TC LL14 (GenBank accession no. AY425671) and JJ259 (GenBank accession no. AY826423). Sequence assembly, multiple sequence alignment, and sequence analyses were performed using Lasergene software (DNASTAR, WI, USA).
2.3 Generation of a reverse genetics system for WT LL14 and WT JJ259 strains
The reverse genetics system pCV4A for PoSaV Cowden strain was provided by Dr.
Kyeong-Ok Chang at Kansas State University. The ~4.5 kb pCV4A backbone was obtained by double digestion with NheI and NotI restriction enzymes (NEB, MA, USA). The genomes of WT LL14 and WT JJ259 strains were engineered with restriction enzyme digestion sites using primers NheI-T7-5-LL14/LL14-NotI-dT (Table 8). The modified WT LL14 and WT
JJ259 genomes were digested with NheI and NotI restriction enzymes and purified with a
PCR purification kit (QIAGEN, CA, USA). The purified genomic fragment was linked to the pCV4A backbone using T4 DNA ligase (Thermo Fisher, MA, USA) at room temperature for
1 hr. The recombinant plasmids pLL14 (Figure 13) and WT pJJ259 (Figure 13) were transformed and amplified in competent E.coli cells, respectively. The clones were confirmed by genomic sequencing using the primer walking method.
143
2.4 Generation of the chimeras, LL14-pCV4AVP1 and JJ259- pCV4AVP1
To generate the reverse genetics system for the chimeras LL14-pCV4AVP1 and
JJ259- pCV4AVP1, the complete VP1 of TC Cowden strain was cloned from the plasmid pCV4A using primers pCV4A-cap-5-infusion and pCV4A-cap-3-infusion (for
LL14-pCV4AVP1) or primers pCV4A-cap-5-infusion-J and pCV4A-cap-3-infusion (for
JJ259- pCV4AVP1) (Table 8), and PrimeSTAR HS DNA polymerase. The 5’ upstream and 3’ downstream fragments of WT LL14 were amplified from pLL14 using primer pairs
LL14-5-infusion-NheI/LL14-backbone-3-5124,LL14-backbone-5-6772/LL14-3-infusion-Not
I, respectively (Table 8). The 5’ upstream and 3’ downstream fragments of WT JJ259 were amplified from pJJ259 using primer pairs LL14-5-infusion-NheI/JJ259-5-frag-R and
JJ259-3-frag-F/LL14-3-infusion-NotI, respectively (Table 8). The reverse genetics systems
for chimeras LL14-pCV4AVP1 and JJ259-pCV4AVP1, pLL14-pCV4AVP1 and
pJJ259-pCV4AVP1, were constructed using In-Fusion cloning (Clontech Laboratories, CA,
USA) method that recognizes 15 bp overlaps and links the 5’ upstream fragment, the complete VP1 of TC PoSaV Cowden strain, and the 3’ downstream to the pCV4A backbone
(Figure 13). The reverse genetic system plasmids were amplified in competent E.coli cells.
The clone was confirmed by genomic sequencing using the primer walking method.
144
2.5 In vitro transcription and capping of viral genomic RNA
The plasmids pJJ259, pLL14, pLL14-pCV4AVP1, and pCV4A (positive control) were extracted from E.coli, linearized by NotI restriction enzyme digestion, and purified by PCR purification kit. Genomic RNA was transcribed in vitro from the linearized plasmid using
MEGAscript T7 transcription kit (Thermo Fisher, MA, USA). Subsequently, the reaction mixture was treated with DNase. The RNA was purified with an RNeasy mini kit (QIAGEN,
CA, USA). The in vitro transcribed genomic RNA was denatured at 65℃ for 10 min and capped using ScriptCap m7G capping system (Cellscript, WI, USA) followed by RNA purification using the RNeasy mini kit. The capped RNA transcripts were suspended in
RNase-free water to a final concentration of 500 ng/µl for transfection.
2.6 Recovery of progeny viruses in LLC-PK cells.
At day -1, the HEK 293T/17 cells were seeded into a 12-well cell culture plate. At day 0, one-day-old HEK 293T/17 cells (~50-70% confluent) were washed with OPTI-MEM I
(Thermo Fisher, MA, USA) once. 1.5 µg capped RNA and 4 µl Lipofectamine 2000 (Thermo
Fisher, MA, USA) were diluted in 50 µl OPTI-MEM I separately, and incubated at room temperature for 5 min. Then the RNA and Lipofectamine 2000 solution were mixed (total volume of 100 µl) and incubated at room temperature for 5 min before adding to HEK
293T/17 cell monolayer. After 4 hrs of incubation at 37℃, 500 μL OPTI-MEM I was added
145
to each well. At day 1, cell lysates were harvested by freezing and thawing once followed by centrifugation at 2,095 × g for 5 min to remove cell debris.
The cell lysates were used to inoculate LLC-PK cells to generate progeny viruses in the presence of 100 μM bile acid GCDCA. LLC-PK cells were observed daily for cytopathogenic effects (CPE). If no CPE was observed, cell lysates were harvested at post-inoculation day (PID) 4 - 5 and used to passage in LLC-PK cells.
2.7 Growth kinetics test for progeny viruses in LLC-PK cells
The growth kinetics curves of TC Cowden and the chimera LL14-pCV4AVP1 were determined by collecting cell lysates at different PIDs. LLC-PK cells in 24-well plates were incubated with each progeny virus at 0.005 multiplicity of infection (MOI) for 1 hr. The inoculum was removed before adding maintenance MEM in the presence of 100 μM bile acid
GCDCA. Cell lysates were collected at PIDs 0, 1, 2, 3, and 4 by freezing and thawing for three times followed by centrifugation at 2,095 g for 5 min.
Viral infectivity titers were determined in LLC-PK cells as 50% tissue culture
infectious dose (TCID50) by immunohistochemistry (IHC) staining using 96-well plates (24).
Briefly, 10-fold serial diluted supernatants containing 100 μM bile acid GCDCA were inoculated onto LLC-PK cell monolayers in 96-well plates. After three days of incubation at
37℃, LLC-PK cell monolayers were fixed with 10% neutral formalin buffer at room temperature for 30 min, and permeabilized with 1% Triton X-100 in PBS at room
146
temperature for 10 min. Gnotobiotic (Gn) pig hyperimmune antiserum to WT PoSaV
Cowden strain, followed by horseradish peroxidase (HRP)-conjugated goat anti-swine IgG
(H+L) serum (KPL, MD, USA), was applied for IHC staining followed by the substrate
3-amino-9-ethylcarbazole (AEC) (Sigma-Aldrich, MO, USA). The cells were observed for positive signals by light microscopy.
2.8 Detection of viral RNA titers in the LLC-PK cells
Viral RNA titers of WT LL14, WT JJ259, LL14-pCV4AVP1 and pCV4A were determined by SaV specific TaqMan real-time RT-PCR (RT-qPCR) as described (24).
Briefly, 50 µl cell lysate supernatant was collected to extract RNA using a 5×MagMAX-96 kit and a MagMAX Express magnetic particle processor RNA/DNA extraction robot
(Applied Biosystems, CA, USA). 1.6 µl RNA was used in a 20 µl reaction mixture, followed by 95°C for 15 min, and the PCR was performed for 45 cycles (95°C for 15 s and 57.5°C for
60 s) on an Eppendorf Mastercycler RealPlex instrument (Eppendorf, Germany).
2.9 Plaque assays for PoSaV LL14-pCV4AVP1 and TCpCV4A
Each culturable progeny virus was 10-fold serially diluted and inoculated into 6-well cell culture plates seeded with LLC-PK cells. After incubation on the LLC-PK cells at 37°C for 1.5 hrs in the presence of 100 μM bile acid GCDCA, the inoculum was removed and the cell monolayer was overlaid with 0.85% low-melting temperature agarose (Sigma-Aldrich,
MO, USA) in MEM supplemented with 100 μM bile acid GCDCA (20). After plaques
147
formed (4 days post-inoculation), cell monolayers were stained with 1 mL of 0.03% neutral red-PBS solution for 30 min at 37°C. The solution was removed and the plaques were observed by light microscopy.
Ten typical and well-formed plaques were selected using MetaMorph for Olympus image acquisition system (Olympus, PA, USA) at 200× magnification. Plaque sizes were quantified using Icy bioimage program (Institut Pasteur, Paris, France) (25).
2.10 Immunofluorescent (IF) staining for the detection of VP1 proteins in cell culture
After passages of LL14-pCV4AVP1, TCpCV4A and WT LL14 and WT JJ259 in the
LLC-PK cells, the LLC-PK cell monolayers were fixed with 10% neutral formalin buffer
(NFB) at room temperature for 30 min. The fixed cells were permeabilized with 1% Triton
X-100 in PBS at room temperature for 10 min. Guinea pig hyperimmune antiserum to WT
PoSaV Cowden strain was used as primary antibody. AlexaFluor 488-conjugated goat anti-swine IgG (H+L) antibody (Thermo Fisher, MA, USA) was used as the secondary antibody. The cells were observed for fluorescent signals using a fluorescent microscope
IX70 (Olympus, PA, USA).
2.11 Statistical analysis
Student’s t-test was used to compare plaque sizes and viral infectious titers between different groups of culturable viruses. A significance level of P < 0.05 was used throughout the manuscript.
148
3. Results
3.1 PoSaV LL14 strain was genetically more similar than JJ259 strain to Cowden strain at
the genomic level.
Based on sequence analysis of the complete VP1 regions, both WT LL14 and WT
JJ259 strains were closely related to TC Cowden strain (Figure 12. ). However, three (178,
289, and 324) of the four amino acids in the VP1 that rendered WT Cowden strain to grow in
LLC-PK cells remained the same as Cowden-WT in TC LL14 (Table 10, Figure 13). Except for the amino acid residue 178C of WT JJ259 that was the same as WT Cowden, the other three residues (289F, 324A, and 328S) were different from those of TC (289H, 324I, and
328G) or WT (289Y, 324M, and 328E) Cowden. The WT JJ259 genome had a 27-nucleotide insertion in the VP2 region, and thus had an overall lower amino acid identity of 83.9% to the TC PoSaV Cowden strain at the genomic level. Comparing the ORF1 of TC Cowden with that of WT JJ259, WT JJ259 showed 94.0% amino acid identity. More specifically, the
VP1 region of WT JJ259 had 89.9% amino acid identity to TC Cowden strain, within which the S domain shared 96.7% identity and the P domain shared 91.4% identity (Table 9). The
WT LL14 genome had an overall amino acid identity of 97.6% to TC PoSaV Cowden strain.
Specifically, compared with TC PoSaV Cowden strain, the ORF1 and ORF2 of WT LL14 strain had 97.7% (2201/2254) and 97.6% (160/164) amino acid identities, respectively. The
VP1 of WT LL14 strain had 96.0% (522/544) amino acid identity to that of the TC PoSaV
149
Cowden strain. Furthermore, WT LL14 strain had 95.8% (205/214) amino acid identity in the
S domain (1-214 amino acids) and 96.1% (317/330) amino acid identity in the P domain
(215-544 amino acids) to the TC PoSaV Cowden strain. Among the 13 amino acid differences in the P domain between WT LL14 and TC Cowden, 12 were located in the P2 subdomain (273-424 amino acids) (Table 10). The VP1 amino acid sequences of WT and TC
LL14 were also compared (Table 10). Six of 544 amino acids were different between them: three (amino acid positions 75, 151, and 193) were located in the S domain, one (amino acid position 258) was located in the P1 subdomain and two (amino acid position 334 and 415) were located in the P2 subdomain. The six amino acids at positions 178, 289, 291, 295, 324, and 328 remained LL14-WT.
3.2 A reverse genetics system for WT PoSaV LL14 and JJ259 strains were established, but no
virus was rescued from LLC-PK cells.
The reverse genetics systems of PoSaV WT LL14 and WT JJ259 strains were confirmed by sequencing of the insertion including the viral genomes and the 5’- and 3’-end elements for cloning. By IF staining using the guinea pig hyperimmune antiserum to PoSaV
Cowden VLPs, no infectious WT LL14 or WT JJ259 virus was rescued from LLC-PK cells in the presence of 100 μM bile acid GCDCA (Figure 14A and 14D). Positive IF staining signals, CPE and increased viral RNA and infectious titers were observed exclusively for the positive control, pCV4A-inoculated LLC-PK cells (Figure 14C).
150
3.3 The chimera LL14-pCV4AVP1 replicated in LLC-PK cells.
The VP1 sequence of WT LL14 was replaced with that of TC Cowden strain to
generate pLL14-pCV4AVP1. Antigens of chimera LL14-pCV4AVP1 were detected by IF staining using the guinea pig hyperimmune antiserum to PoSaV Cowden VLPs (Figure 14B).
An increase of LL14-pCV4AVP1 infectious titer was detected by infectivity assay starting at
PID 2 (Figure 15). At PID 4 when both LL14-pCV4AVP1 and TCpCV4A reached the peak titers,
the LL14-pCV4AVP1 had an infectious titer (4.97±0.11 log10 TCID50/mL) that was
significantly lower than that of TCpCV4A (6.80±0.00 log10 TCID50/mL). The plaque size of
2 LL14-pCV4AVP1 (0.019±0.004 mm ) at PID 4 was significantly smaller than that
2 (0.037±0.01 mm ) of TCpCV4A (P < 0.05) (Figure 16).
4. Discussion
The prototype of PoSaV, the Cowden strain, was detected in the intestinal contents of a 27-day-old diarrheic nursing pig in 1980 by electron microscopy (EM) (26). The TC
Cowden that grows in LLC-PK cells had various amino acid substitutions after serially passaging in Gn pigs and in primary porcine kidney cell cultures in the presence of an intestinal content preparation (IC) collected from uninfected Gn pigs (18, 19, 21, 27). The comparison of WT and TC Cowden sequences provided important information on the genetic basis for the cell culture adaptation of this strain.
151
In this study, whether VP1 is critical for other unculturable Cowden-like PoSaVs to grow in LLC-PK cells was investigated. First, four GIII PoSaVs (WT LL14, WT JJ259, WT
MM280, and WT QW270) that were detected in our laboratory were selected to obtain the complete genomes for the construction of infectious clones, among which two strains, WT
LL14 and WT JJ259, were succeeded. The infectious clone LL14-pCV4AVP1, but not WT
LL14 grew in LLC-PK cells. This data suggests that the VP1 of Cowden strain enables WT
LL14 to grow in LLC-PK cells. Six amino acid substitutions (75, 151, 193, 258, 334, and 415) in VP1 were observed between WT and TC LL14. However, because the six amino acids
(178, 289, 291, 295, 324, and 328) that are critical for the cell culture adaptation of Cowden strain remained WT in both WT and TC LL14, the overall VP1 structure may play a critical role in the cell culture adaptation, and that each strain has its own specific sites for cell culture adaptation.
A calicivirus virion consists of 90 dimers of the VP1 capsid protein. For most reported caliciviruses, VP1 is sufficient to self-assemble into virus-like particles (VLPs) without VP2 or viral RNA (28-35). The S domain of Norwalk virus VP1 itself was sufficient to assemble smooth particles (36). Expression of the P domain of Norwalk virus in E. coli forms P particles, which share similar antigenicity as Norwalk virus VLPs (37, 38). The S and P domains of the capsid protein VP1 may be responsible for the shell assembly and for
VP1 dimerization, respectively. By analyzing reported GIII SaV sequences (GenBank
152
accession no. AAR37376, AAX32888, AAX37311, AAX37314, AAY88248, ABD38714,
ABY87465, ACP43737, ACS68238, ACS68240, ADN84678, ADN84680, AFX61394,
BAE94661 and AF182760), the P2 subdomain of PoSaV is identified to be hypervariable
(Figure 17). In caliciviruses, the P2 subdomain is on the outermost surface (11). Based on the crystal structural analysis, GI NoV histo-blood group antigen (HBGA) binding site involved only the P2 subdomain and had no contact with the P1 subdomain (39). This suggests that for human NoVs, the P2 subdomain is mainly responsible for HBGA recognition. In another study of feline calicivirus (FCV), a culturable calicivirus, it was also demonstrated that the
FCV receptor, feline junctional adhesion molecule 1 (fJAM-1), bound to the P2 subdomain of FCV VP1, including conformational changes in the viral capsid protein (40). These studies suggest that the P2 subdomain in the calicivirus capsid may affect receptor binding by conformational changes.
In conclusion, this study confirmed that VP1 is critical for GIII SaV cell culture adaptation. However, which domain or subdomain is critical for the virus adaptation needs further investigation. The S domain or P2 subdomain of each WT GIII PoSaV can be replaced with that of TC Cowden to test their function in cell culture. Also, a chimera
JJ259-pCV4AVP1 will be constructed to test whether the TC Cowden VP1 enables a more distant unculturable GIII SaV to be adapted to cell culture. Such studies may provide more information which can be used to adapt other enteric caliciviruses to cell culture.
153
References
1. Green KY, Ando T, Balayan MS, Berke T, Clarke IN, Estes MK, Matson DO, Nakata S, Neill JD, Studdert MJ, Thiel HJ. 2000. Taxonomy of the caliciviruses. J Infect Dis 181 Suppl 2:S322-330.
2. King AMQ, Adams MJ, Carstens EB, Lefkowitz EJ. 2012. Virus taxonomy: classification and nomenclature of viruses: Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier Academic Press.
3. Kim M, Lee H, Chang KO, Ko G. 2010. Molecular characterization of murine norovirus isolates from South Korea. Virus Res 147:1-6.
4. Tu ET, Bull RA, Greening GE, Hewitt J, Lyon MJ, Marshall JA, McIver CJ, Rawlinson WD, White PA. 2008. Epidemics of gastroenteritis during 2006 were associated with the spread of norovirus GII.4 variants 2006a and 2006b. Clin Infect Dis 46:413-420.
5. Ji L, Wu X, Yao W, Chen L, Xu D, Shen Y, Shen J, Han J. 2013. Rapid emergence of novel GII.4 sub-lineages noroviruses associated with outbreaks in Huzhou, China, 2008-2012. PLoS One 8:e82627.
6. Wang G, Shen Z, Qian F, Li Y, Yuan Z, Zhang J. 2014. Genetic diversity of sapovirus in non-hospitalized adults with sporadic cases of acute gastroenteritis in Shanghai, China. J Clin Virol doi:10.1016/j.jcv.2014.01.007.
7. Kobayashi S, Fujiwara N, Yasui Y, Yamashita T, Hiramatsu R, Minagawa H. 2012. A foodborne outbreak of sapovirus linked to catered box lunches in Japan. Arch Virol 157:1995-1997.
8. Dey SK, Mizuguchi M, Okitsu S, Ushijima H. 2011. Novel recombinant sapovirus in Bangladesh. Clin Lab 57:91-94.
9. Clarke IN, Lambden PR. 1997. The molecular biology of caliciviruses. J Gen Virol 78 ( Pt 2):291-301.
10. Farkas T, Sestak K, Wei C, Jiang X. 2008. Characterization of a rhesus monkey calicivirus representing a new genus of Caliciviridae. J Virol 82:5408-5416.
11. Prasad BV, Hardy ME, Dokland T, Bella J, Rossmann MG, Estes MK. 1999. X-ray crystallographic structure of the Norwalk virus capsid. Science 286:287-290. 154
12. Ryu MS, Jung EH, Cho KO, Kang SY. 2012. Expression of porcine sapovirus VP1 gene and VP1 specific monoclonal antibody production. Hybridoma (Larchmt) 31:155-162.
13. Ossiboff RJ, Zhou Y, Lightfoot PJ, Prasad BV, Parker JS. 2010. Conformational changes in the capsid of a calicivirus upon interaction with its functional receptor. J Virol 84:5550-5564.
14. Smith AW, Prato CM, Skilling DE. 1977. Characterization of two new serotypes of San Miguel sea lion virus. Intervirology 8:30-36.
15. Wilder FW. 1980. Detection of swine caliciviruses by indirect immunofluorescence. Can J Comp Med 44:87-92.
16. Bidawid S, Malik N, Adegbunrin O, Sattar SA, Farber JM. 2003. A feline kidney cell line-based plaque assay for feline calicivirus, a surrogate for Norwalk virus. J Virol Methods 107:163-167.
17. Wobus CE, Karst SM, Thackray LB, Chang KO, Sosnovtsev SV, Belliot G, Krug A, Mackenzie JM, Green KY, Virgin HW. 2004. Replication of Norovirus in cell culture reveals a tropism for dendritic cells and macrophages. PLoS Biol 2:e432.
18. Flynn WT, Saif LJ. 1988. Serial propagation of porcine enteric calicivirus-like virus in primary porcine kidney cell cultures. J Clin Microbiol 26:206-212.
19. Parwani AV, Flynn WT, Gadfield KL, Saif LJ. 1991. Serial propagation of porcine enteric calicivirus in a continuous cell line. Effect of medium supplementation with intestinal contents or enzymes. Arch Virol 120:115-122.
20. Chang KO, Sosnovtsev SV, Belliot G, Kim Y, Saif LJ, Green KY. 2004. Bile acids are essential for porcine enteric calicivirus replication in association with down-regulation of signal transducer and activator of transcription 1. Proc Natl Acad Sci U S A 101:8733-8738.
21. Guo M, Chang KO, Hardy ME, Zhang Q, Parwani AV, Saif LJ. 1999. Molecular characterization of a porcine enteric calicivirus genetically related to Sapporo-like human caliciviruses. J Virol 73:9625-9631.
22. Wang QH, Han MG, Funk JA, Bowman G, Janies DA, Saif LJ. 2005. Genetic diversity and recombination of porcine sapoviruses. J Clin Microbiol 43:5963-5972.
155
23. Chang KO, Sosnovtsev SV, Belliot G, Wang Q, Saif LJ, Green KY. 2005. Reverse genetics system for porcine enteric calicivirus, a prototype sapovirus in the Caliciviridae. J Virol 79:1409-1416.
24. Wang Q, Zhang Z, Saif LJ. 2012. Stability of and attachment to lettuce by a culturable porcine sapovirus surrogate for human caliciviruses. Appl Environ Microbiol 78:3932-3940.
25. de Chaumont F, Dallongeville S, Chenouard N, Herve N, Pop S, Provoost T, Meas-Yedid V, Pankajakshan P, Lecomte T, Le Montagner Y, Lagache T, Dufour A, Olivo-Marin JC. 2012. Icy: an open bioimage informatics platform for extended reproducible research. Nat Methods 9:690-696.
26. Saif LJ, Bohl EH, Theil KW, Cross RF, House JA. 1980. Rotavirus-like, calicivirus-like, and 23-nm virus-like particles associated with diarrhea in young pigs. J Clin Microbiol 12:105-111.
27. Guo M, Hayes J, Cho KO, Parwani AV, Lucas LM, Saif LJ. 2001. Comparative pathogenesis of tissue culture-adapted and wild-type Cowden porcine enteric calicivirus (PEC) in gnotobiotic pigs and induction of diarrhea by intravenous inoculation of wild-type PEC. J Virol 75:9239-9251.
28. Almanza H, Cubillos C, Angulo I, Mateos F, Caston JR, van der Poel WH, Vinje J, Barcena J, Mena I. 2008. Self-assembly of the recombinant capsid protein of a swine norovirus into virus-like particles and evaluation of monoclonal antibodies cross-reactive with a human strain from genogroup II. J Clin Microbiol 46:3971-3979.
29. Han MG, Wang Q, Smiley JR, Chang KO, Saif LJ. 2005. Self-assembly of the recombinant capsid protein of a bovine norovirus (BoNV) into virus-like particles and evaluation of cross-reactivity of BoNV with human noroviruses. J Clin Microbiol 43:778-785.
30. Guo M, Qian Y, Chang KO, Saif LJ. 2001. Expression and self-assembly in baculovirus of porcine enteric calicivirus capsids into virus-like particles and their use in an enzyme-linked immunosorbent assay for antibody detection in swine. J Clin Microbiol 39:1487-1493.
31. Hale AD, Crawford SE, Ciarlet M, Green J, Gallimore C, Brown DW, Jiang X, Estes MK. 1999. Expression and self-assembly of Grimsby virus: antigenic
156
distinction from Norwalk and Mexico viruses. Clin Diagn Lab Immunol 6:142-145.
32. Geissler K, Parrish CR, Schneider K, Truyen U. 1999. Feline calicivirus capsid protein expression and self-assembly in cultured feline cells. Vet Microbiol 69:63-66.
33. Green KY, Kapikian AZ, Valdesuso J, Sosnovtsev S, Treanor JJ, Lew JF. 1997. Expression and self-assembly of recombinant capsid protein from the antigenically distinct Hawaii human calicivirus. J Clin Microbiol 35:1909-1914.
34. Ball JM, Estes MK, Hardy ME, Conner ME, Opekun AR, Graham DY. 1996. Recombinant Norwalk virus-like particles as an oral vaccine. Arch Virol Suppl 12:243-249.
35. Laurent S, Vautherot JF, Madelaine MF, Le Gall G, Rasschaert D. 1994. Recombinant rabbit hemorrhagic disease virus capsid protein expressed in baculovirus self-assembles into viruslike particles and induces protection. J Virol 68:6794-6798.
36. Bertolotti-Ciarlet A, White LJ, Chen R, Prasad BV, Estes MK. 2002. Structural requirements for the assembly of Norwalk virus-like particles. J Virol 76:4044-4055.
37. Tan M, Hegde RS, Jiang X. 2004. The P domain of norovirus capsid protein forms dimer and binds to histo-blood group antigen receptors. J Virol 78:6233-6242.
38. Bu W, Mamedova A, Tan M, Xia M, Jiang X, Hegde RS. 2008. Structural basis for the receptor binding specificity of Norwalk virus. J Virol 82:5340-5347.
39. Hansman GS, Biertumpfel C, Georgiev I, McLellan JS, Chen L, Zhou T, Katayama K, Kwong PD. 2011. Crystal structures of GII.10 and GII.12 norovirus protruding domains in complex with histo-blood group antigens reveal details for a potential site of vulnerability. J Virol 85:6687-6701.
40. Bhella D, Gatherer D, Chaudhry Y, Pink R, Goodfellow IG. 2008. Structural insights into calicivirus attachment and uncoating. J Virol 82:8051-8058.
157
Figure 12. The phylogenic tree of GIII PoSaVs based on the VP1 sequences.
Among these PoSaVs, WT LL14 strain was genetically more related to the TC
Cowden strain than the WT JJ259 strain.
158
Figure 13. The genomic organizations of WT LL14, WT JJ259,
LL14-pCV4AVP1, and JJ259-pCV4AVP1.
Both TC and WT LL14 strains had wild type amino acids at positions 178, 289, 291,
295 and 324 like the WT Cowden strain. WT JJ259 strain had a Cowden WT amino acid at position 178, whereas the other positions were also different from TC Cowden. A
27-nucleotide insertion (light grey) was located in the VP2 region compared with WT LL14
and Cowden strains. The chimera LL14-pCV4AVP1 was constructed using pLL14 backbone
(white) that was engineered to contain the VP1 of pCV4A (grey). The chimera
JJ259-pCV4AVP1 was constructed using pJJ259 backbone (white) that was engineered to contain the VP1 of pCV4A (grey).
159
Figure 14. The IF staining of the LLC-PK cells infected with the transfection lysates
of WT LL14, chimera LL14-pCV4AVP1, pCV4A (as a positive control), and JJ259, using hyperimmune antiserum to PoSaV Cowden VLPs.
The VP1 proteins of LL14-pCV4AVP1 (B), pCV4A (C), but not of WT LL14 (A) and
WT JJ259 (D) are shown as green fluorescence.
160
Figure 15. Viral infectivity titers of Cowden TCpCV4A and LL14-pCV4AVP1 from PID 0 to 5.
The infectivity titers of both viruses showed an increasing trend. The peak infectivity
titer (6.80±0.00 log10 TCID50/mL) of Cowden TCpCV4A was significantly higher than that
(4.97±0.11 log10 TCID50/mL) of LL14-pCV4AVP1 (Student’s t-test, P < 0.05).
161
Figure 16. A representative plaque of LL14-pCV4AVP1 and Cowden TCpCV4A at PID 4, respectively.
(A). A plaque of LL14-pCV4AVP1; (B). A plaque of Cowden TCpCV4A. (C).
Mock-infected LLC-PK cells. The bars represent 0.2 mm (200×).
162
Figure 17. The consensus strength of the P2 domain (amino acid position 273 to 424) of the GIII PoSaV strains.
The taller bars with warmer colors (red to orange) refer to higher consensus, while the shorter bars with colder colors (green to blue) refer to lower consensus.
163
Primer Sequence a Direction Location in LL14 LL14-5-infusion-NheI ATCGGGAGATGCTAGCCTGGT Forward 5' end LL14-3-infusion-NotI CCTCTAGAGCGGCCGCCCTTTTT Reverse 3' end WT-SaV-F GTGATCGTGATGGCTAATTGC Forward 1-21 NheI-T7-5-LL14 TCACTGCTAGCCTGGTAATACGACTCACTATAGTGATCGTG Forward 5' end ATCGTGATGGG LL14-NotI-dT GAGTGACCGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT Reverse 3' end TTTTTTTTTTGCCCCACAGCCGCCACACTG pCV4A-cap-5-infusion GTTCGTGATGGAGGCGCCTGCCCC Forward 5133-5158 pCV4A-cap-3-infusion CAACTCATCGTGAGCTGTGAATGGAC Reverse 6753-6778 pCV4A-cap-5-infusion-J CCAGAAGTGTTCGTGATGGAGGC Forward 5125-5149 JJ259-5-frag-R CACGAACACTTCTGGCTCTTCATCTTC Reverse 5113-5139 JJ259-3-frag-F GCTCACGATGAGTTGGGTCGCAG Forward 6764-6786 LL14-backbone-3-5124 GCCTCCATCACGAACACTTCTGGC Reverse 5124-5147
1 LL14-backbone-5-6772 GCTCACGATGAGTTGGATTGCAGGAGC Forward 6764-6790 64 LL14-F-5671 GAGTTGGAGGGACTGTAGCGAGTTTGGCACTTTACGTG Forward 5671 LL14-R-5671 CACGTAAAGTGCCAAACTCGCTACAGTCCCTCCAACTC Reverse 5671 LL14-F-6004 CCGTGTCAATGGAAAGCACACCAACAATACGGGC Forward 6004 LL14-R-6004 GCCCGTATTGTTGGTGTGCTTTCCATTGACACGG Reverse 6004 LL14-F-6010-6023 CAATGGAAAGCACACCGACAATACGGGCAGGGCAGTGT Forward 6010 and 6023 TTC LL14-R-6010-6023 CAACTGAAACACTGCCCTGCCCGTATTGTCGGTGTGCTT Reverse 6010 and 6023 TC LL14-F-6111-6122 CAATGTTCAACACAGAAACTGCC Forward 6111 and 6122 LL14-R-6111-6122 CAGTTTCTGTGTTGAACATTGTTG Reverse 6111 and 6122 Table 8. Primers used to construct full-length clone and chimera of WT PoSaV LL14 strain in this study.
a The underline refers to restriction sites. The italic sequence in primer NheI-T7-5-LL14 refers to the T7 promoter. The
italic sequence in primer LL14-NotI-dT refers to an oligo-(dT)35 that is complementary to the poly (A) tail.
164
S P1 P2 Strain Genome ORF1 VP1 VP2 domain subdomain subdomain WT LL14 97.6% 97.65% 96.0% 95.3% 99.4% 92.8% 97.56% WT JJ259 83.9% 94.0% 89.9% 96.3% 91.6% 78.9% 84.2% Table 9. The amino acid identities between WT LL14 or WT JJ259 strain and TC
Cowden strain.
165
WT TC WT TC LL14 Sites a JJ259 Cowden Cowden LL14 (AY425671) Domain (amino Lu, Lu, Lu, 2015 Guo, 1999 Chang, 2004 acid) 2015b 2015 7 T T A A T 9 S S S S P 23 S S T T S 50 N N S S N 75 A A T A A 117 M M M M L 129 P P P P H 135 A A A A T S 151 I I T I I 153 D D E E E 172 V V V V T 175 A A T T A 176 I I V V I 178 C S C C C 193 T T T A T 195 V V V V L 208 P P Q Q P 221 A A A A T 226 F F F F L P1 256 V V V V M 258 Q Q Q R H 283 A A A A G 287 G G G G T 289 Y H Y Y F 291 N D N N G P2 292 N N N N T 293 T T T T S 295 K R K K M 299 Q Q Q Q S Continued Table 10. A summary of the different amino acids in the VP1 regions of PoSaV
WT/TC Cowden, WT/TC LL14, and WT JJ259.
166
Table 10 continued WT TC WT TC LL14 Sites a JJ259 Cowden Cowden LL14 (AY425671) Domain (amino Lu, Lu, Lu, 2015 Guo, 1999 Chang, 2004 acid) 2015b 2015 301 G G G G Q 323 T T T T R 324 M I M M A 327 T T T T S 323 T T T T R 324 M I M M A 327 T T T T S 328 E G A A S 330 A A A A S 332 N N D D S 334 N N N D S 335 T T T T M 337 G G G G C 344 I I I I V 346 N N N N D P2 348 V V V V R 352 V V V V N 354 D D G G N 356 A A A A S 365 H H H H Q 370 S S S S Q 374 I I I I V 376 Q Q Q Q Y 384 V V I I V 395 N N N N T 397 N N S S S 398 Q Q P P Q 411 N N T T N 412 T T K K T 415 N N N D N Continued
167
Table 10 continued WT TC WT TC LL14 Sites a JJ259 Cowden Cowden LL14 (AY425671) Domain (amino Lu, Lu, Lu, 2015 Guo, 1999 Chang, 2004 acid) 2015b 2015 416 G G G G E P2 420 S S S S T 430 P P P P A 435 N N N N H 452 T T A A S 474 D D D D E 486 S S S S T P1 502 N N N N S 505 I I I I V 518 S S S S T 519 F F F F Y 522 M M M M I 536 S S S S T a The critical amino acid positions that enabled unculturable PoSaV Cowden to adapt to the LLC-PK cells are listed in frame and bolded.
b The amino acid differences between the WT- and TC-LL14 are bolded in red.
The 12 amino acid differences in the P2 subdomain between the LL14 and the TC
Cowden are highlighted in grey.
168
Conclusions and perspectives
1. Conclusions
The goal of this dissertation research was to use the reverse genetics system for porcine sapovirus (PoSaV) Cowden strain to generate a series of mutants to study the genetic basis for Cowden and other PoSaV strains to adapt to a porcine kidney cell line,
LLC-PK cells. The virulence and immune responses among the culturable mutants, the tissue culture-adapted (TC) and the wild type (WT) Cowden strain were also compared in a gnotobiotic (Gn) pig model. The conclusions were as follows:
First, VP1 but not the RNA-dependent RNA polymerase (RdRp) region is critical for Cowden strain adaptation to cell culture. Second, four (178, 289, 324 and 328) of the six amino acid substitutions in the VP1 region were essential for the adaptation of
Cowden strain to LLC-PK cells. Third, the amino acid substitutions at 291 and 295 in the
VP1 altered the growth kinetics of PoSaV Cowden strain both in vitro and in vivo. The mutants TCVP1-D291N and TCVP1-R295K replicated less efficiently in LLC-PK cells, but more efficiently in Gn pigs and induced higher serum and mucosal antibody responses than the TC Cowden strain. Finally, the VP1 region of the Cowden strain enabled another unculturable genogroup III (GIII) PoSaV, LL14 strain, to grow in LLC-PK cells.
169
In summary, the VP1 is critical for the adaptation of not only the Cowden strain, but also other Cowden-like PoSaVs, to LLC-PK cells. The amino acid substitutions during adaptation of GIII PoSaVs to LLC-PK cells may be strain- and structure-dependent.
2. Perspectives
Future research objectives include the construction of a series of chimeric GIII
PoSaVs containing each domain or subdomain of TC Cowden VP1 to delineate the critical region for cell culture adaptation. The establishment of an atomic structure of TC
Cowden VP1 and mutants, alone and in complex with α2,3- and α2,6-linked sialic acids, which are the proposed receptors for TC Cowden PoSaV on LLC-PK cells. Determine whether the amino acid substitutions in the VP1 affect receptor binding, which in turn affects virus entry and replication in LLC-PK cells. Such knowledge can be applied to propagate human SaVs and human NoVs in cell cultures.
170
Bibliography
Abd-Eldaim M, Potgieter L, Kennedy M. 2005. Genetic analysis of feline caliciviruses associated with a hemorrhagic-like disease. J Vet Diagn Invest 17:420-429.
Abente EJ, Sosnovtsev SV, Bok K, Green KY. 2010. Visualization of feline calicivirus replication in real-time with recombinant viruses engineered to express fluorescent reporter proteins. Virology 400:18-31.
Alcala AC, Rodriguez-Diaz J, de Rolo M, Vizzi E, Buesa J, Liprandi F, Ludert JE. 2010. Seroepidemiology of porcine enteric sapovirus in pig farms in Venezuela. Vet Immunol Immunopathol 137:269-274.
Almanza H, Cubillos C, Angulo I, Mateos F, Caston JR, van der Poel WH, Vinje J, Barcena J, Mena I. 2008. Self-assembly of the recombinant capsid protein of a swine norovirus into virus-like particles and evaluation of monoclonal antibodies cross-reactive with a human strain from genogroup II. J Clin Microbiol 46:3971-3979.
Alonso C, Oviedo JM, Martin-Alonso JM, Diaz E, Boga JA, Parra F. 1998. Programmed cell death in the pathogenesis of rabbit hemorrhagic disease. Arch Virol 143:321-332.
Ando T, Noel JS, Fankhauser RL. 2000. Genetic classification of "Norwalk-like viruses. J Infect Dis 181 Suppl 2:S336-348.
Arias A, Urena L, Thorne L, Yunus MA, Goodfellow I. 2012. Reverse genetics mediated recovery of infectious murine norovirus. J Vis Exp doi:10.3791/4145.
Armbrust S, Kramer A, Olbertz D, Zimmermann K, Fusch C. 2009. Norovirus infections in preterm infants: wide variety of clinical courses. BMC Res Notes 2:96.
Asanaka M, Atmar RL, Ruvolo V, Crawford SE, Neill FH, Estes MK. 2005. Replication and packaging of Norwalk virus RNA in cultured mammalian cells. Proc Natl Acad Sci U S A 102:10327-10332.
Bailey D, Thackray LB, Goodfellow IG. 2008. A single amino acid substitution in the murine norovirus capsid protein is sufficient for attenuation in vivo. J Virol 82:7725-7728.
Baker D, Sali A. 2001. Protein structure prediction and structural genomics. Science
171
294:93-96.
Balanzino LE, Barra JL, Monferran CG, Cumar FA. 1994. Differential interaction of Escherichia coli heat-labile toxin and cholera toxin with pig intestinal brush border glycoproteins depending on their ABH and related blood group antigenic determinants. Infect Immun 62:1460-1464.
Ball JM, Estes MK, Hardy ME, Conner ME, Opekun AR, Graham DY. 1996. Recombinant Norwalk virus-like particles as an oral vaccine. Arch Virol Suppl 12:243-249.
Ball SP, Tongue N, Gibaud A, Le Pendu J, Mollicone R, Gerard G, Oriol R. 1991. The human chromosome 19 linkage group FUT1 (H), FUT2 (SE), LE, LU, PEPD, C3, APOC2, D19S7 and D19S9. Ann Hum Genet 55:225-233.
Baltimore D. 1970. RNA-dependent DNA polymerase in virions of RNA tumour viruses. Nature 226:1209-1211.
Barreaud JP, Saunier K, Souchaire J, Delourme D, Oulmouden A, Oriol R, Leveziel H, Julien R, Petit JM. 2000. Three bovine alpha2-fucosyltransferase genes encode enzymes that preferentially transfer fucose on Galbeta1-3GalNAc acceptor substrates. Glycobiology 10:611-621.
Basic M, Keubler LM, Buettner M, Achard M, Breves G, Schroder B, Smoczek A, Jorns A, Wedekind D, Zschemisch NH, Gunther C, Neumann D, Lienenklaus S, Weiss S, Hornef MW, Mahler M, Bleich A. 2014. Norovirus Triggered Microbiota-driven Mucosal Inflammation in Interleukin 10-deficient Mice. Inflamm Bowel Dis doi:10.1097/01.MIB.0000441346.86827.ed.
Berry ES, Skilling DE, Barlough JE, Vedros NA, Gage LJ, Smith AW. 1990. New marine calicivirus serotype infective for swine. Am J Vet Res 51:1184-1187.
Bertolotti-Ciarlet A, White LJ, Chen R, Prasad BV, Estes MK. 2002. Structural requirements for the assembly of Norwalk virus-like particles. J Virol 76:4044-4055.
Bhella D, Gatherer D, Chaudhry Y, Pink R, Goodfellow IG. 2008. Structural insights into calicivirus attachment and uncoating. J Virol 82:8051-8058.
Bidawid S, Malik N, Adegbunrin O, Sattar SA, Farber JM. 2003. A feline kidney cell line-based plaque assay for feline calicivirus, a surrogate for Norwalk virus. J Virol Methods 107:163-167.
Blackburn BG, Craun GF, Yoder JS, Hill V, Calderon RL, Chen N, Lee SH, Levy DA, Beach MJ. 2004. Surveillance for waterborne-disease outbreaks associated with drinking water--United States, 2001-2002. MMWR Surveill Summ 53:23-45.
172
Bok K, Parra GI, Mitra T, Abente E, Shaver CK, Boon D, Engle R, Yu C, Kapikian AZ, Sosnovtsev SV, Purcell RH, Green KY. 2011. Chimpanzees as an animal model for human norovirus infection and vaccine development. Proc Natl Acad Sci U S A 108:325-330.
Bozkurt H, D'Souza DH, Davidson PM. 2013. Determination of the thermal inactivation kinetics of the human norovirus surrogates, murine norovirus and feline calicivirus. J Food Prot 76:79-84.
Brake F, Ross T, Holds G, Kiermeier A, McLeod C. 2014. A survey of Australian oysters for the presence of human noroviruses. Food Microbiol 44:264-270.
Bridger JC, Hall GA, Brown JF. 1984. Characterization of a calici-like virus (Newbury agent) found in association with astrovirus in bovine diarrhea. Infect Immun 43:133-138.
Brugha R, Vipond IB, Evans MR, Sandifer QD, Roberts RJ, Salmon RL, Caul EO, Mukerjee AK. 1999. A community outbreak of food-borne small round-structured virus gastroenteritis caused by a contaminated water supply. Epidemiol Infect 122:145-154.
Bu W, Mamedova A, Tan M, Xia M, Jiang X, Hegde RS. 2008. Structural basis for the receptor binding specificity of Norwalk virus. J Virol 82:5340-5347.
Bucardo F, Carlsson B, Nordgren J, Larson G, Blandon P, Vilchez S, Svensson L. 2012. Susceptibility of children to sapovirus infections, Nicaragua, 2005-2006. Emerg Infect Dis 18:1875-1878.
Buckow R, Isbarn S, Knorr D, Heinz V, Lehmacher A. 2008. Predictive model for inactivation of feline calicivirus, a norovirus surrogate, by heat and high hydrostatic pressure. Appl Environ Microbiol 74:1030-1038.
Calderon-Margalit R, Sheffer R, Halperin T, Orr N, Cohen D, Shohat T. 2005. A large-scale gastroenteritis outbreak associated with Norovirus in nursing homes. Epidemiol Infect 133:35-40.
Cancellotti FM, Renzi M. 1991. Epidemiology and current situation of viral haemorrhagic disease of rabbits and the European brown hare syndrome in Italy. Rev Sci Tech 10:409-422.
Cannon JL, Papafragkou E, Park GW, Osborne J, Jaykus LA, Vinje J. 2006. Surrogates for the study of norovirus stability and inactivation in the environment: aA comparison of murine norovirus and feline calicivirus. J Food Prot 69:2761-2765.
Capucci L, Scicluna MT, Lavazza A. 1991. Diagnosis of viral haemorrhagic disease of rabbits and the European brown hare syndrome. Rev Sci Tech 10:347-370.
Chang KO. 2009. Role of cholesterol pathways in norovirus replication. J Virol
173
83:8587-8595.
Chang KO, George DW. 2007. Interferons and ribavirin effectively inhibit Norwalk virus replication in replicon-bearing cells. J Virol 81:12111-12118.
Chang KO, Sosnovtsev SV, Belliot G, Kim Y, Saif LJ, Green KY. 2004. Bile acids are essential for porcine enteric calicivirus replication in association with down-regulation of signal transducer and activator of transcription 1. Proc Natl Acad Sci U S A 101:8733-8738.
Chang KO, Sosnovtsev SV, Belliot G, King AD, Green KY. 2006. Stable expression of a Norwalk virus RNA replicon in a human hepatoma cell line. Virology 353:463-473.
Chang KO, Sosnovtsev SV, Belliot G, Wang Q, Saif LJ, Green KY. 2005. Reverse genetics system for porcine enteric calicivirus, a prototype sapovirus in the Caliciviridae. J Virol 79:1409-1416.
Chanit W, Thongprachum A, Khamrin P, Okitsu S, Mizuguchi M, Ushijima H. 2009. Intergenogroup recombinant sapovirus in Japan, 2007-2008. Emerg Infect Dis 15:1084-1087.
Chaudhry Y, Nayak A, Bordeleau ME, Tanaka J, Pelletier J, Belsham GJ, Roberts LO, Goodfellow IG. 2006. Caliciviruses differ in their functional requirements for eIF4F components. J Biol Chem 281:25315-25325.
Chaudhry Y, Skinner MA, Goodfellow IG. 2007. Recovery of genetically defined murine norovirus in tissue culture by using a fowlpox virus expressing T7 RNA polymerase. J Gen Virol 88:2091-2100.
Cheetham S, Souza M, McGregor R, Meulia T, Wang Q, Saif LJ. 2007. Binding patterns of human norovirus-like particles to buccal and intestinal tissues of gnotobiotic pigs in relation to A/H histo-blood group antigen expression. J Virol 81:3535-3544.
Cheetham S, Souza M, Meulia T, Grimes S, Han MG, Saif LJ. 2006. Pathogenesis of a genogroup II human norovirus in gnotobiotic pigs. J Virol 80:10372-10381.
Chen H, Hoover DG, Kingsley DH. 2005. Temperature and treatment time influence high hydrostatic pressure inactivation of feline calicivirus, a norovirus surrogate. J Food Prot 68:2389-2394.
Chen R, Neill JD, Estes MK, Prasad BV. 2006. X-ray structure of a native calicivirus: structural insights into antigenic diversity and host specificity. Proc Natl Acad Sci U S A 103:8048-8053.
Chen R, Neill JD, Noel JS, Hutson AM, Glass RI, Estes MK, Prasad BV. 2004. Inter- and intragenus structural variations in caliciviruses and their functional implications. J
174
Virol 78:6469-6479.
Chiba S, Nakata S, Numata-Kinoshita K, Honma S. 2000. Sapporo virus: history and recent findings. J Infect Dis 181 Suppl 2:S303-308.
Chiba S, Sakuma Y, Kogasaka R, Akihara M, Horino K, Nakao T, Fukui S. 1979. An outbreak of gastroenteritis associated with calicivirus in an infant home. J Med Virol 4:249-254.
Clarke IN, Lambden PR. 1997. The molecular biology of caliciviruses. J Gen Virol 78 ( Pt 2):291-301.
Cooke BD. 2002. Rabbit haemorrhagic disease: field epidemiology and the management of wild rabbit populations. Rev Sci Tech 21:347-358.
Coyne KP, Jones BR, Kipar A, Chantrey J, Porter CJ, Barber PJ, Dawson S, Gaskell RM, Radford AD. 2006. Lethal outbreak of disease associated with feline calicivirus infection in cats. Vet Rec 158:544-550.
Crick F. 1970. Central dogma of molecular biology. Nature 227:561-563.
Cubitt WD, Barrett AD. 1984. Propagation of human candidate calicivirus in cell culture. J Gen Virol 65 ( Pt 6):1123-1126.
Cubitt WD, McSwiggan DA, Moore W. 1979. Winter vomiting disease caused by calicivirus. J Clin Pathol 32:786-793.
Cubitt WD, Pead PJ, Saeed AA. 1981. A new serotype of calicivirus associated with an outbreak of gastroenteritis in a residential home for the elderly. J Clin Pathol 34:924-926.
Cunha JB, de Mendonca MC, Miagostovich MP, Leite JP. 2010. Genetic diversity of porcine enteric caliciviruses in pigs raised in Rio de Janeiro State, Brazil. Arch Virol 155:1301-1305.
Dalton KP, Nicieza I, Balseiro A, Muguerza MA, Rosell JM, Casais R, Alvarez AL, Parra F. 2012. Variant rabbit hemorrhagic disease virus in young rabbits, Spain. Emerg Infect Dis 18:2009-2012.
Dastjerdi AM, Snodgrass DR, Bridger JC. 2000. Characterisation of the bovine enteric calici-like virus, Newbury agent 1. FEMS Microbiol Lett 192:125-131.
Day JM, Ballard LL, Duke MV, Scheffler BE, Zsak L. 2010. Metagenomic analysis of the turkey gut RNA virus community. Virol J 7:313. de Chaumont F, Dallongeville S, Chenouard N, Herve N, Pop S, Provoost T, Meas-Yedid V, Pankajakshan P, Lecomte T, Le Montagner Y, Lagache T, Dufour A, Olivo-Marin JC. 2012. Icy: an open bioimage informatics platform for extended 175
reproducible research. Nat Methods 9:690-696. de Wit MA, Koopmans MP, Kortbeek LM, van Leeuwen NJ, Vinje J, van Duynhoven YT. 2001. Etiology of gastroenteritis in sentinel general practices in the netherlands. Clin Infect Dis 33:280-288. de Wit MA, Koopmans MP, Kortbeek LM, Wannet WJ, Vinje J, van Leusden F, Bartelds AI, van Duynhoven YT. 2001. Sensor, a population-based cohort study on gastroenteritis in the Netherlands: incidence and etiology. Am J Epidemiol 154:666-674.
Deng Y, Batten CA, Liu BL, Lambden PR, Elschner M, Gunther H, Otto P, Schnurch P, Eichhorn W, Herbst W, Clarke IN. 2003. Studies of epidemiology and seroprevalence of bovine noroviruses in Germany. J Clin Microbiol 41:2300-2305.
Dey SK, Mizuguchi M, Okitsu S, Ushijima H. 2011. Novel recombinant sapovirus in Bangladesh. Clin Lab 57:91-94.
Di Bartolo I, Pavoni E, Tofani S, Consoli M, Galuppini E, Losio MN, Ruggeri FM, Varisco G. 2015. Waterborne norovirus outbreak during a summer excursion in Northern Italy. New Microbiol 38:109-112.
Di Bartolo I, Tofani S, Angeloni G, Ponterio E, Ostanello F, Ruggeri FM. 2014. Detection and characterization of porcine caliciviruses in Italy. Arch Virol doi:10.1007/s00705-014-2076-5.
Di Martino B, Di Profio F, Ceci C, Di Felice E, Green KY, Bok K, De Grazia S, Giammanco GM, Massirio I, Lorusso E, Buonavoglia C, Marsilio F, Martella V. 2014. Seroprevalence of Norovirus Genogroup IV Antibodies among Humans, Italy, 2010-2011. Emerg Infect Dis 20:1828-1832.
Di Martino B, Marsilio F. 2010. Feline calicivirus VP2 is involved in the self-assembly of the capsid protein into virus-like particles. Res Vet Sci 89:279-281.
Division of Viral Diseases NCfI, Respiratory Diseases CfDC, Prevention. 2011. Updated norovirus outbreak management and disease prevention guidelines. MMWR Recomm Rep 60:1-18.
Dolin R, Levy AG, Wyatt RG, Thornhill TS, Gardner JD. 1975. Viral gastroenteritis induced by the Hawaii agent. Jejunal histopathology and serologic response. Am J Med 59:761-768.
Dolin R, Reichman RC, Roessner KD, Tralka TS, Schooley RT, Gary W, Morens D. 1982. Detection by immune electron microscopy of the Snow Mountain agent of acute viral gastroenteritis. J Infect Dis 146:184-189.
Donaldson EF, Lindesmith LC, Lobue AD, Baric RS. 2008. Norovirus pathogenesis:
176
mechanisms of persistence and immune evasion in human populations. Immunol Rev 225:190-211.
Duizer E, Bijkerk P, Rockx B, De Groot A, Twisk F, Koopmans M. 2004. Inactivation of caliciviruses. Appl Environ Microbiol 70:4538-4543.
Duizer E, Schwab KJ, Neill FH, Atmar RL, Koopmans MP, Estes MK. 2004. Laboratory efforts to cultivate noroviruses. J Gen Virol 85:79-87.
Espul C, Martinez N, Noel JS, Cuello H, Abrile C, Grucci S, Glass R, Berke T, Matson DO. 2004. Prevalence and characterization of astroviruses in Argentinean children with acute gastroenteritis. J Med Virol 72:75-82.
Fankhauser RL, Monroe SS, Noel JS, Humphrey CD, Bresee JS, Parashar UD, Ando T, Glass RI. 2002. Epidemiologic and molecular trends of "Norwalk-like viruses" associated with outbreaks of gastroenteritis in the United States. J Infect Dis 186:1-7.
Farkas T, Nakajima S, Sugieda M, Deng X, Zhong W, Jiang X. 2005. Seroprevalence of noroviruses in swine. J Clin Microbiol 43:657-661.
Farkas T, Sestak K, Wei C, Jiang X. 2008. Characterization of a rhesus monkey calicivirus representing a new genus of Caliciviridae. J Virol 82:5408-5416.
Farkas T, Zhong WM, Jing Y, Huang PW, Espinosa SM, Martinez N, Morrow AL, Ruiz-Palacios GM, Pickering LK, Jiang X. 2004. Genetic diversity among sapoviruses. Arch Virol 149:1309-1323.
Fastier LB. 1957. A new feline virus isolated in tissue culture. Am J Vet Res 18:382-389.
Flynn WT, Saif LJ. 1988. Serial propagation of porcine enteric calicivirus-like virus in primary porcine kidney cell cultures. J Clin Microbiol 26:206-212.
Flynn WT, Saif LJ, Moorhead PD. 1988. Pathogenesis of porcine enteric calicivirus-like virus in four-day-old gnotobiotic pigs. Am J Vet Res 49:819-825.
Francis DH, Collins JE, Duimstra JR. 1986. Infection of gnotobiotic pigs with an Escherichia coli O157:H7 strain associated with an outbreak of hemorrhagic colitis. Infect Immun 51:953-956.
Fullerton SW, Blaschke M, Coutard B, Gebhardt J, Gorbalenya A, Canard B, Tucker PA, Rohayem J. 2007. Structural and functional characterization of sapovirus RNA-dependent RNA polymerase. J Virol 81:1858-1871.
Gastanaduy PA, Hall AJ, Curns AT, Parashar UD, Lopman BA. 2013. Burden of norovirus gastroenteritis in the ambulatory setting--United States, 2001-2009. J Infect Dis 207:1058-1065.
177
Gehrke C, Steinmann J, Goroncy-Bermes P. 2004. Inactivation of feline calicivirus, a surrogate of norovirus (formerly Norwalk-like viruses), by different types of alcohol in vitro and in vivo. J Hosp Infect 56:49-55.
Geissler K, Parrish CR, Schneider K, Truyen U. 1999. Feline calicivirus capsid protein expression and self-assembly in cultured feline cells. Vet Microbiol 69:63-66.
Gonzalez-Hernandez MB, Liu T, Blanco LP, Auble H, Payne HC, Wobus CE. 2013. Murine Norovirus Transcytosis Across an In Vitro Polarized Murine Intestinal Epithelial Monolayer is Mediated by M-like Cells. J Virol doi:10.1128/JVI.02378-13.
Green KY, Ando T, Balayan MS, Berke T, Clarke IN, Estes MK, Matson DO, Nakata S, Neill JD, Studdert MJ, Thiel HJ. 2000. Taxonomy of the caliciviruses. J Infect Dis 181 Suppl 2:S322-330.
Green KY, Kapikian AZ, Valdesuso J, Sosnovtsev S, Treanor JJ, Lew JF. 1997. Expression and self-assembly of recombinant capsid protein from the antigenically distinct Hawaii human calicivirus. J Clin Microbiol 35:1909-1914.
Green KY, Mory A, Fogg MH, Weisberg A, Belliot G, Wagner M, Mitra T, Ehrenfeld E, Cameron CE, Sosnovtsev SV. 2002. Isolation of enzymatically active replication complexes from feline calicivirus-infected cells. J Virol 76:8582-8595.
Gregg DA, House C, Meyer R, Berninger M. 1991. Viral haemorrhagic disease of rabbits in Mexico: epidemiology and viral characterization. Rev Sci Tech 10:435-451.
Guo M, Chang KO, Hardy ME, Zhang Q, Parwani AV, Saif LJ. 1999. Molecular characterization of a porcine enteric calicivirus genetically related to Sapporo-like human caliciviruses. J Virol 73:9625-9631.
Guo M, Evermann JF, Saif LJ. 2001. Detection and molecular characterization of cultivable caliciviruses from clinically normal mink and enteric caliciviruses associated with diarrhea in mink. Arch Virol 146:479-493.
Guo M, Hayes J, Cho KO, Parwani AV, Lucas LM, Saif LJ. 2001. Comparative pathogenesis of tissue culture-adapted and wild-type Cowden porcine enteric calicivirus (PEC) in gnotobiotic pigs and induction of diarrhea by intravenous inoculation of wild-type PEC. J Virol 75:9239-9251.
Guo M, Qian Y, Chang KO, Saif LJ. 2001. Expression and self-assembly in baculovirus of porcine enteric calicivirus capsids into virus-like particles and their use in an enzyme-linked immunosorbent assay for antibody detection in swine. J Clin Microbiol 39:1487-1493.
Hale AD, Crawford SE, Ciarlet M, Green J, Gallimore C, Brown DW, Jiang X, Estes MK. 1999. Expression and self-assembly of Grimsby virus: antigenic distinction from
178
Norwalk and Mexico viruses. Clin Diagn Lab Immunol 6:142-145.
Hall GA, Bridger JC, Brooker BE, Parsons KR, Ormerod E. 1984. Lesions of gnotobiotic calves experimentally infected with a calicivirus-like (Newbury) agent. Vet Pathol 21:208-215.
Han MG, Cheetham S, Azevedo M, Thomas C, Saif LJ. 2006. Immune responses to bovine norovirus-like particles with various adjuvants and analysis of protection in gnotobiotic calves. Vaccine 24:317-326.
Han MG, Wang Q, Smiley JR, Chang KO, Saif LJ. 2005. Self-assembly of the recombinant capsid protein of a bovine norovirus (BoNV) into virus-like particles and evaluation of cross-reactivity of BoNV with human noroviruses. J Clin Microbiol 43:778-785.
Hansman GS, Biertumpfel C, Georgiev I, McLellan JS, Chen L, Zhou T, Katayama K, Kwong PD. 2011. Crystal structures of GII.10 and GII.12 norovirus protruding domains in complex with histo-blood group antigens reveal details for a potential site of vulnerability. J Virol 85:6687-6701.
Hansman GS, Oka T, Katayama K, Takeda N. 2007. Human sapoviruses: genetic diversity, recombination, and classification. Rev Med Virol 17:133-141.
Hansman GS, Oka T, Takeda N. 2008. Sapovirus-like particles derived from polyprotein. Virus Res 137:261-265.
Hansman GS, Saito H, Shibata C, Ishizuka S, Oseto M, Oka T, Takeda N. 2007. Outbreak of gastroenteritis due to sapovirus. J Clin Microbiol 45:1347-1349.
Hansman GS, Takeda N, Oka T, Oseto M, Hedlund KO, Katayama K. 2005. Intergenogroup recombination in sapoviruses. Emerg Infect Dis 11:1916-1920.
Hansman GS, Taylor DW, McLellan JS, Smith TJ, Georgiev I, Tame JR, Park SY, Yamazaki M, Gondaira F, Miki M, Katayama K, Murata K, Kwong PD. 2012. Structural basis for broad detection of genogroup II noroviruses by a monoclonal antibody that binds to a site occluded in the viral particle. J Virol 86:3635-3646.
Hart EA, Caccamo M, Harrow JL, Humphray SJ, Gilbert JG, Trevanion S, Hubbard T, Rogers J, Rothschild MF. 2007. Lessons learned from the initial sequencing of the pig genome: comparative analysis of an 8 Mb region of pig chromosome 17. Genome Biol 8:R168.
Hassine-Zaafrane M, Kaplon J, Sdiri-Loulizi K, Aouni Z, Pothier P, Aouni M, Ambert-Balay K. 2012. Molecular prevalence of bovine noroviruses and neboviruses detected in central-eastern Tunisia. Arch Virol 157:1599-1604.
179
Hedlund KO, Rubilar-Abreu E, Svensson L. 2000. Epidemiology of calicivirus infections in Sweden, 1994-1998. J Infect Dis 181 Suppl 2:S275-280.
Herbert TP, Brierley I, Brown TD. 1996. Detection of the ORF3 polypeptide of feline calicivirus in infected cells and evidence for its expression from a single, functionally bicistronic, subgenomic mRNA. J Gen Virol 77 ( Pt 1):123-127.
Herbert TP, Brierley I, Brown TD. 1997. Identification of a protein linked to the genomic and subgenomic mRNAs of feline calicivirus and its role in translation. J Gen Virol 78 ( Pt 5):1033-1040.
Hillenbrand B, Gunzel D, Richter JF, Hohne M, Schreier E, Schulzke JD, Mankertz J. 2010. Norovirus non-structural protein p20 leads to impaired restitution of epithelial defects by inhibition of actin cytoskeleton remodelling. Scand J Gastroenterol 45:1307-1319.
Hinnebusch AG. 2014. The scanning mechanism of eukaryotic translation initiation. Annu Rev Biochem 83:779-812.
Hoa Tran TN, Trainor E, Nakagomi T, Cunliffe NA, Nakagomi O. 2013. Molecular epidemiology of noroviruses associated with acute sporadic gastroenteritis in children: global distribution of genogroups, genotypes and GII.4 variants. J Clin Virol 56:185-193.
Hoover EA, Kahn DE. 1975. Experimentally induced feline calicivirus infection: clinical signs and lesions. J Am Vet Med Assoc 166:463-468.
Hosmillo M, Chaudhry Y, Kim DS, Goodfellow I, Cho KO. 2014. Sapovirus Translation Requires an Interaction between VPg and the Cap Binding Protein eIF4E. J Virol 88:12213-12221.
Hosmillo M, Sorgeloos F, Hiraide R, Lu J, Goodfellow I, Cho KO. 2015. Porcine sapovirus replication is restricted by the type I interferon response in cell culture. J Gen Virol 96:74-84.
Hsu CC, Wobus CE, Steffen EK, Riley LK, Livingston RS. 2005. Development of a microsphere-based serologic multiplexed fluorescent immunoassay and a reverse transcriptase PCR assay to detect murine norovirus 1 infection in mice. Clin Diagn Lab Immunol 12:1145-1151.
Hu Z, Tian X, Zhai Y, Xu W, Zheng D, Sun F. 2010. Cryo-electron microscopy reconstructions of two types of wild rabbit hemorrhagic disease viruses characterized the structural features of Lagovirus. Protein Cell 1:48-58.
Huang P, Farkas T, Marionneau S, Zhong W, Ruvoen-Clouet N, Morrow AL, Altaye M, Pickering LK, Newburg DS, LePendu J, Jiang X. 2003. Noroviruses bind to human ABO, Lewis, and secretor histo-blood group antigens: identification of 4 distinct
180
strain-specific patterns. J Infect Dis 188:19-31.
Iizuka S, Takai-Todaka R, Ohshiro H, Kitajima M, Wang Q, Saif LJ, Wakita T, Noda M, Katayama K, Oka T. 2013. Detection of multiple human sapoviruses from imported frozen individual clams. Food Environ Virol 5:119-125.
Jeong C, Park SI, Park SH, Kim HH, Park SJ, Jeong JH, Choy HE, Saif LJ, Kim SK, Kang MI, Hyun BH, Cho KO. 2007. Genetic diversity of porcine sapoviruses. Vet Microbiol 122:246-257.
Ji L, Wu X, Yao W, Chen L, Xu D, Shen Y, Shen J, Han J. 2013. Rapid emergence of novel GII.4 sub-lineages noroviruses associated with outbreaks in Huzhou, China, 2008-2012. PLoS One 8:e82627.
Jiang X, Espul C, Zhong WM, Cuello H, Matson DO. 1999. Characterization of a novel human calicivirus that may be a naturally occurring recombinant. Arch Virol 144:2377-2387.
Jiang X, Zhong W, Kaplan M, Pickering LK, Matson DO. 1999. Expression and characterization of Sapporo-like human calicivirus capsid proteins in baculovirus. J Virol Methods 78:81-91.
Jin M, He Y, Li H, Huang P, Zhong W, Yang H, Zhang H, Tan M, Duan ZJ. 2013. Two gastroenteritis outbreaks caused by GII Noroviruses: host susceptibility and HBGA phenotypes. PLoS One 8:e58605.
Johnson JE. 1996. Functional implications of protein-protein interactions in icosahedral viruses. Proc Natl Acad Sci U S A 93:27-33.
Jones MK, Watanabe M, Zhu S, Graves CL, Keyes LR, Grau KR, Gonzalez-Hernandez MB, Iovine NM, Wobus CE, Vinje J, Tibbetts SA, Wallet SM, Karst SM. 2014. Enteric bacteria promote human and mouse norovirus infection of B cells. Science 346:755-759.
Jung K, Scheuer KA, Zhang Z, Wang Q, Saif LJ. 2014. Pathogenesis of GIII.2 bovine norovirus, CV186-OH/00/US strain in gnotobiotic calves. Vet Microbiol 168:202-207.
Kapikian AZ. 1993. Viral gastroenteritis. JAMA 269:627-630.
Kapikian AZ, Wyatt RG, Dolin R, Thornhill TS, Kalica AR, Chanock RM. 1972. Visualization by immune electron microscopy of a 27-nm particle associated with acute infectious nonbacterial gastroenteritis. J Virol 10:1075-1081.
Kaplan JE, Goodman RA, Schonberger LB, Lippy EC, Gary GW. 1982. Gastroenteritis due to Norwalk virus: an outbreak associated with a municipal water system. J Infect Dis 146:190-197.
181
Kaplon J, Guenau E, Asdrubal P, Pothier P, Ambert-Balay K. 2011. Possible novel nebovirus genotype in cattle, France. Emerg Infect Dis 17:1120-1123.
Karakasiliotis I, Vashist S, Bailey D, Abente EJ, Green KY, Roberts LO, Sosnovtsev SV, Goodfellow IG. 2010. Polypyrimidine tract binding protein functions as a negative regulator of feline calicivirus translation. PLoS One 5:e9562.
Karst SM. 2010. Pathogenesis of noroviruses, emerging RNA viruses. Viruses 2:748-781.
Karst SM, Wobus CE, Goodfellow IG, Green KY, Virgin HW. 2014. Advances in Norovirus Biology. Cell Host Microbe 15:668-680.
Karst SM, Wobus CE, Lay M, Davidson J, Virgin HWt. 2003. STAT1-dependent innate immunity to a Norwalk-like virus. Science 299:1575-1578.
Katayama K, Hansman GS, Oka T, Ogawa S, Takeda N. 2006. Investigation of norovirus replication in a human cell line. Arch Virol 151:1291-1308.
Katayama K, Miyoshi T, Uchino K, Oka T, Tanaka T, Takeda N, Hansman GS. 2004. Novel recombinant sapovirus. Emerg Infect Dis 10:1874-1876.
Katayama K, Murakami K, Sharp TM, Guix S, Oka T, Takai-Todaka R, Nakanishi A, Crawford SE, Atmar RL, Estes MK. 2014. Plasmid-based human norovirus reverse genetics system produces reporter-tagged progeny virus containing infectious genomic RNA. Proc Natl Acad Sci U S A doi:10.1073/pnas.1415096111.
Katayama K, Shirato-Horikoshi H, Kojima S, Kageyama T, Oka T, Hoshino F, Fukushi S, Shinohara M, Uchida K, Suzuki Y, Gojobori T, Takeda N. 2002. Phylogenetic analysis of the complete genome of 18 Norwalk-like viruses. Virology 299:225-239.
Katpally U, Voss NR, Cavazza T, Taube S, Rubin JR, Young VL, Stuckey J, Ward VK, Virgin HWt, Wobus CE, Smith TJ. 2010. High-resolution cryo-electron microscopy structures of murine norovirus 1 and rabbit hemorrhagic disease virus reveal marked flexibility in the receptor binding domains. J Virol 84:5836-5841.
Katpally U, Wobus CE, Dryden K, Virgin HWt, Smith TJ. 2008. Structure of antibody-neutralized murine norovirus and unexpected differences from viruslike particles. J Virol 82:2079-2088.
Katsafanas GC, Moss B. 2007. Colocalization of transcription and translation within cytoplasmic poxvirus factories coordinates viral expression and subjugates host functions. Cell Host Microbe 2:221-228.
Kernbauer E, Ding Y, Cadwell K. 2014. An enteric virus can replace the beneficial
182
function of commensal bacteria. Nature 516:94-98.
Kim DS, Hosmillo M, Alfajaro MM, Kim JY, Park JG, Son KY, Ryu EH, Sorgeloos F, Kwon HJ, Park SJ, Lee WS, Cho D, Kwon J, Choi JS, Kang MI, Goodfellow I, Cho KO. 2014. Both alpha2,3- and alpha2,6-linked sialic acids on O-linked glycoproteins act as functional receptors for porcine Sapovirus. PLoS Pathog 10:e1004172.
Kim HJ, Cho HS, Cho KO, Park NY. 2006. Detection and molecular characterization of porcine enteric calicivirus in Korea, genetically related to sapoviruses. J Vet Med B Infect Dis Vet Public Health 53:155-159.
Kim M, Lee H, Chang KO, Ko G. 2010. Molecular characterization of murine norovirus isolates from South Korea. Virus Res 147:1-6.
King AMQ, Adams MJ, Carstens EB, Lefkowitz EJ. 2012. Virus taxonomy: classification and nomenclature of viruses: Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier Academic Press.
Kirby AE, Shi J, Montes J, Lichtenstein M, Moe CL. 2014. Disease course and viral shedding in experimental Norwalk virus and Snow Mountain virus infection. J Med Virol doi:10.1002/jmv.23905.
Kirking HL, Cortes J, Burrer S, Hall AJ, Cohen NJ, Lipman H, Kim C, Daly ER, Fishbein DB. 2010. Likely transmission of norovirus on an airplane, October 2008. Clin Infect Dis 50:1216-1221.
Kitajima M, Haramoto E, Phanuwan C, Katayama H. 2011. Genotype distribution of human sapoviruses in wastewater in Japan. Appl Environ Microbiol 77:4226-4229.
Knowles JO, McArdle F, Dawson S, Carter SD, Gaskell CJ, Gaskell RM. 1991. Studies on the role of feline calicivirus in chronic stomatitis in cats. Vet Microbiol 27:205-219.
Kobayashi S, Fujiwara N, Yasui Y, Yamashita T, Hiramatsu R, Minagawa H. 2012. A foodborne outbreak of sapovirus linked to catered box lunches in Japan. Arch Virol 157:1995-1997.
Kroneman A, Vega E, Vennema H, Vinje J, White PA, Hansman G, Green K, Martella V, Katayama K, Koopmans M. 2013. Proposal for a unified norovirus nomenclature and genotyping. Arch Virol 158:2059-2068.
Laurent S, Vautherot JF, Madelaine MF, Le Gall G, Rasschaert D. 1994. Recombinant rabbit hemorrhagic disease virus capsid protein expressed in baculovirus self-assembles into viruslike particles and induces protection. J Virol 68:6794-6798.
183
Lay MK, Atmar RL, Guix S, Bharadwaj U, He H, Neill FH, Sastry KJ, Yao Q, Estes MK. 2010. Norwalk virus does not replicate in human macrophages or dendritic cells derived from the peripheral blood of susceptible humans. Virology 406:1-11.
Le Pendu J, Ruvoen-Clouet N, Kindberg E, Svensson L. 2006. Mendelian resistance to human norovirus infections. Semin Immunol 18:375-386.
Lee LE, Cebelinski EA, Fuller C, Keene WE, Smith K, Vinje J, Besser JM. 2012. Sapovirus outbreaks in long-term care facilities, Oregon and Minnesota, USA, 2002-2009. Emerg Infect Dis 18:873-876.
Lee RM, Lessler J, Lee RA, Rudolph KE, Reich NG, Perl TM, Cummings DA. 2013. Incubation periods of viral gastroenteritis: a systematic review. BMC Infect Dis 13:446.
Lew JF, Kapikian AZ, Valdesuso J, Green KY. 1994. Molecular characterization of Hawaii virus and other Norwalk-like viruses: evidence for genetic polymorphism among human caliciviruses. J Infect Dis 170:535-542.
L'Homme Y, Sansregret R, Plante-Fortier E, Lamontagne AM, Ouardani M, Lacroix G, Simard C. 2009. Genomic characterization of swine caliciviruses representing a new genus of Caliciviridae. Virus Genes 39:66-75.
Li L, Pesavento PA, Shan T, Leutenegger CM, Wang C, Delwart E. 2011. Viruses in diarrhoeic dogs include novel kobuviruses and sapoviruses. J Gen Virol 92:2534-2541.
Li L, Shan T, Wang C, Cote C, Kolman J, Onions D, Gulland FM, Delwart E. 2011. The fecal viral flora of California sea lions. J Virol 85:9909-9917.
Li X, Harwood VJ, Nayak B, Staley C, Sadowsky MJ, Weidhaas J. 2015. A Novel Microbial Source Tracking Microarray for Pathogen Detection and Fecal Source Identification in Environmental Systems. Environ Sci Technol doi:10.1021/acs.est.5b00980.
Liao Q, Wang X, Wang D, Zhang D. 2014. Complete genome sequence of a novel calicivirus from a goose. Arch Virol doi:10.1007/s00705-014-2083-6.
Lindesmith L, Moe C, Marionneau S, Ruvoen N, Jiang X, Lindblad L, Stewart P, LePendu J, Baric R. 2003. Human susceptibility and resistance to Norwalk virus infection. Nat Med 9:548-553.
Liu BL, Clarke IN, Caul EO, Lambden PR. 1995. Human enteric caliciviruses have a unique genome structure and are distinct from the Norwalk-like viruses. Arch Virol 140:1345-1356.
Liu BL, Lambden PR, Gunther H, Otto P, Elschner M, Clarke IN. 1999. Molecular characterization of a bovine enteric calicivirus: relationship to the Norwalk-like viruses. J
184
Virol 73:819-825.
Liu G, Ni Z, Yun T, Yu B, Chen L, Zhao W, Hua J, Chen J. 2008. A DNA-launched reverse genetics system for rabbit hemorrhagic disease virus reveals that the VP2 protein is not essential for virus infectivity. J Gen Virol 89:3080-3085.
Liu G, Zhang Y, Ni Z, Yun T, Sheng Z, Liang H, Hua J, Li S, Du Q, Chen J. 2006. Recovery of infectious rabbit hemorrhagic disease virus from rabbits after direct inoculation with in vitro-transcribed RNA. J Virol 80:6597-6602.
Liu GH, Li RC, Li J, Huang ZB, Xiao CT, Luo W, Ge M, Jiang DL, Yu XL. 2012. Seroprevalence of porcine cytomegalovirus and sapovirus infection in pigs in Hunan province, China. Arch Virol 157:521-524.
Liu P, Yuen Y, Hsiao HM, Jaykus LA, Moe C. 2010. Effectiveness of liquid soap and hand sanitizer against Norwalk virus on contaminated hands. Appl Environ Microbiol 76:394-399.
Liu SJ, Xue HP, Pu BQ, Qian SH. 1987. A new viral disease in rabbits. Anim Husb Vet Med Anim. Husb. Vet. Med.:253-255.
Liu ZK, Li JY, Pan H. 2014. Seroprevalence and molecular detection of porcine sapovirus in symptomatic suckling piglets in Guangdong Province, China. Trop Anim Health Prod doi:10.1007/s11250-013-0531-z.
Lizasoain A, Tort LF, Garcia M, Gomez MM, Leite JP, Miagostovich MP, Cristina J, Berois M, Colina R, Victoria M. 2015. Sewage surveillance reveals the presence of canine GVII norovirus and canine astrovirus in Uruguay. Arch Virol doi:10.1007/s00705-015-2571-3.
Lodo KL, Veitch MG, Green ML. 2014. An outbreak of norovirus linked to oysters in Tasmania. Commun Dis Intell Q Rep 38:E16-19.
Loury P, FS LEG, JC LES, Ambert-Balay K, Parrot P, Hubert B. 2015. A norovirus oyster-related outbreak in a nursing home in France, January 2012. Epidemiol Infect doi:10.1017/S0950268814003628:1-8.
Luttermann C, Meyers G. 2007. A bipartite sequence motif induces translation reinitiation in feline calicivirus RNA. J Biol Chem 282:7056-7065.
Magulski T, Paulmann D, Bischoff B, Becker B, Steinmann E, Steinmann J, Goroncy-Bermes P, Steinmann J. 2009. Inactivation of murine norovirus by chemical biocides on stainless steel. BMC Infect Dis 9:107.
Makino A, Shimojima M, Miyazawa T, Kato K, Tohya Y, Akashi H. 2006. Junctional adhesion molecule 1 is a functional receptor for feline calicivirus. J Virol 80:4482-4490.
185
Marionneau S, Ruvoen N, Le Moullac-Vaidye B, Clement M, Cailleau-Thomas A, Ruiz-Palacois G, Huang P, Jiang X, Le Pendu J. 2002. Norwalk virus binds to histo-blood group antigens present on gastroduodenal epithelial cells of secretor individuals. Gastroenterology 122:1967-1977.
Martella V, Lorusso E, Banyai K, Decaro N, Corrente M, Elia G, Cavalli A, Radogna A, Costantini V, Saif LJ, Lavazza A, Di Trani L, Buonavoglia C. 2008. Identification of a porcine calicivirus related genetically to human sapoviruses. J Clin Microbiol 46:1907-1913.
Martella V, Lorusso E, Decaro N, Elia G, Radogna A, D'Abramo M, Desario C, Cavalli A, Corrente M, Camero M, Germinario CA, Banyai K, Di Martino B, Marsilio F, Carmichael LE, Buonavoglia C. 2008. Detection and molecular characterization of a canine norovirus. Emerg Infect Dis 14:1306-1308.
Martinez MA, Alcala AC, Carruyo G, Botero L, Liprandi F, Ludert JE. 2006. Molecular detection of porcine enteric caliciviruses in Venezuelan farms. Vet Microbiol 116:77-84.
Matthews JE, Dickey BW, Miller RD, Felzer JR, Dawson BP, Lee AS, Rocks JJ, Kiel J, Montes JS, Moe CL, Eisenberg JN, Leon JS. 2012. The epidemiology of published norovirus outbreaks: a review of risk factors associated with attack rate and genogroup. Epidemiol Infect 140:1161-1172.
Matthews RE. 1979. Third report of the International Committee on Taxonomy of Viruses. Classification and nomenclature of viruses. Intervirology 12:129-296.
Mattison K, Shukla A, Cook A, Pollari F, Friendship R, Kelton D, Bidawid S, Farber JM. 2007. Human noroviruses in swine and cattle. Emerg Infect Dis 13:1184-1188.
Maunula L, Miettinen IT, von Bonsdorff CH. 2005. Norovirus outbreaks from drinking water. Emerg Infect Dis 11:1716-1721.
Mayo MA. 2002. A summary of taxonomic changes recently approved by ICTV. Arch Virol 147:1655-1663.
McFadden N, Bailey D, Carrara G, Benson A, Chaudhry Y, Shortland A, Heeney J, Yarovinsky F, Simmonds P, Macdonald A, Goodfellow I. 2011. Norovirus regulation of the innate immune response and apoptosis occurs via the product of the alternative open reading frame 4. PLoS Pathog 7:e1002413.
McSwiggan DA, Cubitt D, Moore W. 1978. Calicivirus associated with winter vomiting disease. Lancet 1:1215.
Medici MC, Tummolo F, Martella V, Giammanco GM, De Grazia S, Arcangeletti MC, De Conto F, Chezzi C, Calderaro A. 2014. Novel recombinant GII.P16_GII.13
186
and GII.P16_GII.3 norovirus strains in Italy. Virus Res doi:10.1016/j.virusres.2014.04.005.
Mesquita JR, Barclay L, Nascimento MS, Vinje J. 2010. Novel norovirus in dogs with diarrhea. Emerg Infect Dis 16:980-982.
Mesquita JR, Delgado I, Costantini V, Heenemann K, Vahlenkamp TW, Vinje J, Nascimento MS. 2014. Seroprevalence of canine norovirus in 14 European countries. Clin Vaccine Immunol doi:10.1128/CVI.00048-14.
Mesquita JR, Nascimento MS. 2014. Norovirus GII.4 antibodies in the Portuguese population. J Infect Dev Ctries 8:1201-1204.
Meurens F, Summerfield A, Nauwynck H, Saif L, Gerdts V. 2012. The pig: a model for human infectious diseases. Trends Microbiol 20:50-57.
Meyer RC, Bohl EH, Kohler EM. 1964. Procurement and Maintenance of Germ-Free Seine for Microbiological Investigations. Appl Microbiol 12:295-300.
Meyers G. 2003. Translation of the minor capsid protein of a calicivirus is initiated by a novel termination-dependent reinitiation mechanism. J Biol Chem 278:34051-34060.
Meyers G. 2007. Characterization of the sequence element directing translation reinitiation in RNA of the calicivirus rabbit hemorrhagic disease virus. J Virol 81:9623-9632.
Meyers G, Wirblich C, Thiel HJ. 1991. Genomic and subgenomic RNAs of rabbit hemorrhagic disease virus are both protein-linked and packaged into particles. Virology 184:677-686.
Mijovski JZ, Poljsak-Prijatelj M, Steyer A, Barlic-Maganja D, Koren S. 2010. Detection and molecular characterisation of noroviruses and sapoviruses in asymptomatic swine and cattle in Slovenian farms. Infect Genet Evol 10:413-420.
Mikalsen AB, Nilsen P, Froystad-Saugen M, Lindmo K, Eliassen TM, Rode M, Evensen O. 2014. Characterization of a Novel Calicivirus Causing Systemic Infection in Atlantic Salmon (Salmo salar L.): Proposal for a New Genus of Caliciviridae. PLoS One 9:e107132.
Mikami O, Park JH, Kimura T, Ochiai K, Itakura C. 1999. Hepatic lesions in young rabbits experimentally infected with rabbit haemorrhagic disease virus. Res Vet Sci 66:237-242.
Miniats OP, Jol D. 1978. Gnotobiotic pigs-derivation and rearing. Can J Comp Med 42:428-437.
Mitra T, Sosnovtsev SV, Green KY. 2004. Mutagenesis of tyrosine 24 in the VPg 187
protein is lethal for feline calicivirus. J Virol 78:4931-4935.
Morisse JP, Le Gall G, Boilletot E. 1991. Hepatitis of viral origin in Leporidae: introduction and aetiological hypotheses. Rev Sci Tech 10:269-310.
Mumphrey SM, Changotra H, Moore TN, Heimann-Nichols ER, Wobus CE, Reilly MJ, Moghadamfalahi M, Shukla D, Karst SM. 2007. Murine norovirus 1 infection is associated with histopathological changes in immunocompetent hosts, but clinical disease is prevented by STAT1-dependent interferon responses. J Virol 81:3251-3263.
Naing Z, Rayner B, Killikulangara A, Vunnam K, Leach S, McIver CJ, Scott GM, Craig ME, Lui K, Rawlinson WD. 2013. Prevalence of viruses in stool of premature neonates at a neonatal intensive care unit. J Paediatr Child Health 49:E221-226.
Nakamura K, Saga Y, Iwai M, Obara M, Horimoto E, Hasegawa S, Kurata T, Okumura H, Nagoshi M, Takizawa T. 2010. Frequent detection of noroviruses and sapoviruses in swine and high genetic diversity of porcine sapovirus in Japan during Fiscal Year 2008. J Clin Microbiol 48:1215-1222.
Napthine S, Lever RA, Powell ML, Jackson RJ, Brown TD, Brierley I. 2009. Expression of the VP2 protein of murine norovirus by a translation termination-reinitiation strategy. PLoS One 4:e8390.
Neill JD. 2014. The Complete Genome Sequence of the San Miguel Sea Lion Virus-8 Reveals that It Is Not a Member of the Vesicular Exanthema of Swine Virus/San Miguel Sea Lion Virus Species of the Caliciviridae. Genome Announc 2.
Neill JD, Mengeling WL. 1988. Further characterization of the virus-specific RNAs in feline calicivirus infected cells. Virus Res 11:59-72.
Neill JD, Meyer RF, Seal BS. 1995. Genetic relatedness of the caliciviruses: San Miguel sea lion and vesicular exanthema of swine viruses constitute a single genotype within the Caliciviridae. J Virol 69:4484-4488.
Neill JD, Sosnovtsev SV, Green KY. 2000. Recovery and altered neutralization specificities of chimeric viruses containing capsid protein domain exchanges from antigenically distinct strains of feline calicivirus. J Virol 74:1079-1084.
Nenonen NP, Hannoun C, Olsson MB, Bergstrom T. 2009. Molecular analysis of an oyster-related norovirus outbreak. J Clin Virol 45:105-108.
Numata K, Hardy ME, Nakata S, Chiba S, Estes MK. 1997. Molecular characterization of morphologically typical human calicivirus Sapporo. Arch Virol 142:1537-1552.
Nurminen K, Blazevic V, Huhti L, Rasanen S, Koho T, Hytonen VP, Vesikari T. 2011.
188
Prevalence of norovirus GII-4 antibodies in Finnish children. J Med Virol 83:525-531.
Nygard K, Torven M, Ancker C, Knauth SB, Hedlund KO, Giesecke J, Andersson Y, Svensson L. 2003. Emerging genotype (GGIIb) of norovirus in drinking water, Sweden. Emerg Infect Dis 9:1548-1552.
Nystrom K, Abrantes J, Lopes AM, Le Moullac-Vaidye B, Marchandeau S, Rocher J, Ruvoen-Clouet N, Esteves PJ, Le Pendu J. 2015. Neofunctionalization of the Sec1 alpha1,2fucosyltransferase paralogue in leporids contributes to glycan polymorphism and resistance to rabbit hemorrhagic disease virus. PLoS Pathog 11:e1004759.
O'Hara TM, House C, House JA, Suydam RS, George JC. 1998. Viral serologic survey of bowhead whales in Alaska. J Wildl Dis 34:39-46.
Oka T, Hansman GS, Katayama K, Ogawa S, Nagata N, Miyamura T, Takeda N. 2006. Expression of sapovirus virus-like particles in mammalian cells. Arch Virol 151:399-404.
Oka T, Katayama K, Ogawa S, Hansman GS, Kageyama T, Ushijima H, Miyamura T, Takeda N. 2005. Proteolytic processing of sapovirus ORF1 polyprotein. J Virol 79:7283-7290.
Oka T, Mori K, Iritani N, Harada S, Ueki Y, Iizuka S, Mise K, Murakami K, Wakita T, Katayama K. 2012. Human sapovirus classification based on complete capsid nucleotide sequences. Arch Virol 157:349-352.
Oka T, Takagi H, Tohya Y. 2014. Development of a novel single step reverse genetics system for feline calicivirus. J Virol Methods 207C:178-181.
Oka T, Wang Q, Katayama K, Saif LJ. 2015. Comprehensive Review of Human Sapoviruses. Clin Microbiol Rev 28:32-53.
Oka T, Yamamoto M, Katayama K, Hansman GS, Ogawa S, Miyamura T, Takeda N. 2006. Identification of the cleavage sites of sapovirus open reading frame 1 polyprotein. J Gen Virol 87:3329-3338.
Oka T, Yamamoto M, Miyashita K, Ogawa S, Katayama K, Wakita T, Takeda N. 2009. Self-assembly of sapovirus recombinant virus-like particles from polyprotein in mammalian cells. Microbiol Immunol 53:49-52.
Oka T, Yokoyama M, Katayama K, Tsunemitsu H, Yamamoto M, Miyashita K, Ogawa S, Motomura K, Mori H, Nakamura H, Wakita T, Takeda N, Sato H. 2009. Structural and biological constraints on diversity of regions immediately upstream of cleavage sites in calicivirus precursor proteins. Virology 394:119-129.
Okada M, Shinozaki K, Ogawa T, Kaiho I. 2002. Molecular epidemiology and
189
phylogenetic analysis of Sapporo-like viruses. Arch Virol 147:1445-1451.
Okada M, Yamashita Y, Oseto M, Ogawa T, Kaiho I, Shinozaki K. 2006. Genetic variability in the sapovirus capsid protein. Virus Genes 33:157-161.
Oliver SL, Asobayire E, Dastjerdi AM, Bridger JC. 2006. Genomic characterization of the unclassified bovine enteric virus Newbury agent-1 (Newbury1) endorses a new genus in the family Caliciviridae. Virology 350:240-250.
Oliver SL, Dastjerdi AM, Wong S, El-Attar L, Gallimore C, Brown DW, Green J, Bridger JC. 2003. Molecular characterization of bovine enteric caliciviruses: a distinct third genogroup of noroviruses (Norwalk-like viruses) unlikely to be of risk to humans. J Virol 77:2789-2798.
Ossiboff RJ, Zhou Y, Lightfoot PJ, Prasad BV, Parker JS. 2010. Conformational changes in the capsid of a calicivirus upon interaction with its functional receptor. J Virol 84:5550-5564.
Otto PH, Clarke IN, Lambden PR, Salim O, Reetz J, Liebler-Tenorio EM. 2011. Infection of calves with bovine norovirus GIII.1 strain Jena virus: an experimental model to study the pathogenesis of norovirus infection. J Virol 85:12013-12021.
Pang XL, Honma S, Nakata S, Vesikari T. 2000. Human caliciviruses in acute gastroenteritis of young children in the community. J Infect Dis 181 Suppl 2:S288-294.
Pang XL, Preiksaitis JK, Lee BE. 2014. Enhanced enteric virus detection in sporadic gastroenteritis using a multi-target real-time PCR panel: A one-year study. J Med Virol 86:1594-1601.
Papafragkou E, Hewitt J, Park GW, Greening G, Vinje J. 2014. Challenges of culturing human norovirus in three-dimensional organoid intestinal cell culture models. PLoS One 8:e63485.
Parwani AV, Flynn WT, Gadfield KL, Saif LJ. 1991. Serial propagation of porcine enteric calicivirus in a continuous cell line. Effect of medium supplementation with intestinal contents or enzymes. Arch Virol 120:115-122.
Patel MM, Widdowson MA, Glass RI, Akazawa K, Vinje J, Parashar UD. 2008. Systematic literature review of role of noroviruses in sporadic gastroenteritis. Emerg Infect Dis 14:1224-1231.
Pavoni E, Consoli M, Suffredini E, Arcangeli G, Serracca L, Battistini R, Rossini I, Croci L, Losio MN. 2013. Noroviruses in seafood: a 9-year monitoring in Italy. Foodborne Pathog Dis 10:533-539.
Pesavento PA, MacLachlan NJ, Dillard-Telm L, Grant CK, Hurley KF. 2004.
190
Pathologic, immunohistochemical, and electron microscopic findings in naturally occurring virulent systemic feline calicivirus infection in cats. Vet Pathol 41:257-263.
Pesavento PA, Stokol T, Liu H, van der List DA, Gaffney PM, Parker JS. 2011. Distribution of the feline calicivirus receptor junctional adhesion molecule a in feline tissues. Vet Pathol 48:361-368.
Phan TG, Khamrin P, Quang TD, Dey SK, Takanashi S, Okitsu S, Maneekarn N, Ushijima H. 2007. Emergence of intragenotype recombinant sapovirus in Japan. Infect Genet Evol 7:542-546.
Phan TG, Yan H, Khamrin P, Quang TD, Dey SK, Yagyu F, Okitsu S, Muller WE, Ushijima H. 2006. Novel intragenotype recombination in sapovirus. Clin Lab 52:363-366.
Posada D, Crandall KA, Holmes EC. 2002. Recombination in evolutionary genomics. Annu Rev Genet 36:75-97.
Prasad BV, Hardy ME, Dokland T, Bella J, Rossmann MG, Estes MK. 1999. X-ray crystallographic structure of the Norwalk virus capsid. Science 286:287-290.
Prasad BV, Matson DO, Smith AW. 1994. Three-dimensional structure of calicivirus. J Mol Biol 240:256-264.
Prasad BV, Rothnagel R, Jiang X, Estes MK. 1994. Three-dimensional structure of baculovirus-expressed Norwalk virus capsids. J Virol 68:5117-5125.
Pringle CR. 1998. The universal system of virus taxonomy of the International Committee on Virus Taxonomy (ICTV), including new proposals ratified since publication of the Sixth ICTV Report in 1995. Arch Virol 143:203-210.
Ravn V, Dabelsteen E. 2000. Tissue distribution of histo-blood group antigens. APMIS 108:1-28.
Reed LJ, Muench H. 1938. A simple method of estimating fifty per cent endpoints. American Journal of Epidemiology 27:5.
Reuter G, Zimsek-Mijovski J, Poljsak-Prijatelj M, Di Bartolo I, Ruggeri FM, Kantala T, Maunula L, Kiss I, Kecskemeti S, Halaihel N, Buesa J, Johnsen C, Hjulsager CK, Larsen LE, Koopmans M, Bottiger B. 2010. Incidence, diversity, and molecular epidemiology of sapoviruses in swine across Europe. J Clin Microbiol 48:363-368.
Reynolds BS, Poulet H, Pingret JL, Jas D, Brunet S, Lemeter C, Etievant M, Boucraut-Baralon C. 2009. A nosocomial outbreak of feline calicivirus associated virulent systemic disease in France. J Feline Med Surg 11:633-644.
191
Rha B, Burrer S, Park S, Trivedi T, Parashar UD, Lopman BA. 2013. Emergency department visit data for rapid detection and monitoring of norovirus activity, United States. Emerg Infect Dis 19:1214-1221.
Robel I, Gebhardt J, Mesters JR, Gorbalenya A, Coutard B, Canard B, Hilgenfeld R, Rohayem J. 2008. Functional characterization of the cleavage specificity of the sapovirus chymotrypsin-like protease. J Virol 82:8085-8093.
Rockx BH, Bogers WM, Heeney JL, van Amerongen G, Koopmans MP. 2005. Experimental norovirus infections in non-human primates. J Med Virol 75:313-320.
Rockx BH, Vennema H, Hoebe CJ, Duizer E, Koopmans MP. 2005. Association of histo-blood group antigens and susceptibility to norovirus infections. J Infect Dis 191:749-754.
Rondy M, Koopmans M, Rotsaert C, Van Loon T, Beljaars B, Van Dijk G, Siebenga J, Svraka S, Rossen JW, Teunis P, Van Pelt W, Verhoef L. 2011. Norovirus disease associated with excess mortality and use of statins: a retrospective cohort study of an outbreak following a pilgrimage to Lourdes. Epidemiol Infect 139:453-463.
Ruvoen-Clouet N, Ganiere JP, Andre-Fontaine G, Blanchard D, Le Pendu J. 2000. Binding of rabbit hemorrhagic disease virus to antigens of the ABH histo-blood group family. J Virol 74:11950-11954.
Ruzante JM, Majowicz SE, Fazil A, Davidson VJ. 2011. Hospitalization and deaths for select enteric illnesses and associated sequelae in Canada, 2001-2004. Epidemiol Infect 139:937-945.
Rydberg L, Molne J, Strokan V, Svalander CT, Breimer ME. 2001. Histo-blood group A antigen expression in pig kidneys--implication for ABO incompatible pig-to-human xenotransplantation. Scand J Urol Nephrol 35:54-62.
Rydell GE, Kindberg E, Larson G, Svensson L. 2011. Susceptibility to winter vomiting disease: a sweet matter. Rev Med Virol 21:370-382.
Ryu MS, Jung EH, Cho KO, Kang SY. 2012. Expression of porcine sapovirus VP1 gene and VP1 specific monoclonal antibody production. Hybridoma (Larchmt) 31:155-162.
Sachsenroder J, Twardziok S, Hammerl JA, Janczyk P, Wrede P, Hertwig S, Johne R. 2012. Simultaneous identification of DNA and RNA viruses present in pig faeces using process-controlled deep sequencing. PLoS One 7:e34631.
Saif LJ, Bohl EH, Theil KW, Cross RF, House JA. 1980. Rotavirus-like, calicivirus-like, and 23-nm virus-like particles associated with diarrhea in young pigs. J Clin Microbiol 12:105-111.
192
Sakai Y, Nakata S, Honma S, Tatsumi M, Numata-Kinoshita K, Chiba S. 2001. Clinical severity of Norwalk virus and Sapporo virus gastroenteritis in children in Hokkaido, Japan. Pediatr Infect Dis J 20:849-853.
Sandoval-Jaime C, Green KY, Sosnovtsev SV. 2015. Recovery of murine norovirus and feline calicivirus from plasmids encoding EMCV IRES in stable cell lines expressing T7 polymerase. J Virol Methods doi:10.1016/j.jviromet.2015.02.003.
Sandoval-Jaime C, Parra GI, Smith AW, Green KY, Sosnovtsev SV. 2012. Genetic characterization of a reptilian calicivirus (Cro1). Virol J 9:297.
Sang S, Zhao Z, Suo J, Xing Y, Jia N, Gao Y, Xie L, Du M, Liu B, Ren S, Liu Y. 2014. Report of Recombinant Norovirus GII.g/GII.12 in Beijing, China. PLoS One 9:e88210.
Sattar SA, Ali M, Tetro JA. 2011. In vivo comparison of two human norovirus surrogates for testing ethanol-based handrubs: the mouse chasing the cat! PLoS One 6:e17340.
Scallan E, Hoekstra RM, Angulo FJ, Tauxe RV, Widdowson MA, Roy SL, Jones JL, Griffin PM. 2011. Foodborne illness acquired in the United States--major pathogens. Emerg Infect Dis 17:7-15.
Schaffer FL, Soergel ME, Black JW, Skilling DE, Smith AW, Cubitt WD. 1985. Characterization of a new calicivirus isolated from feces of a dog. Arch Virol 84:181-195.
Scheuer KA, Oka T, Hoet AE, Gebreyes WA, Molla BZ, Saif LJ, Wang Q. 2013. Prevalence of porcine noroviruses, molecular characterization of emerging porcine sapoviruses from finisher swine in the United States, and unified classification scheme for sapoviruses. J Clin Microbiol 51:2344-2353.
Schreiber DS, Blacklow NR, Trier JS. 1973. The mucosal lesion of the proximal small intestine in acute infectious nonbacterial gastroenteritis. N Engl J Med 288:1318-1323.
Schreiber DS, Blacklow NR, Trier JS. 1974. The small intestinal lesion induced by Hawaii agent acute infectious nonbacterial gastroenteritis. J Infect Dis 129:705-708.
Schuffenecker I, Ando T, Thouvenot D, Lina B, Aymard M. 2001. Genetic classification of "Sapporo-like viruses". Arch Virol 146:2115-2132.
Sestak K, Feely S, Fey B, Dufour J, Hargitt E, Alvarez X, Pahar B, Gregoricus N, Vinje J, Farkas T. 2012. Experimental inoculation of juvenile rhesus macaques with primate enteric caliciviruses. PLoS One 7:e37973.
Shirato-Horikoshi H, Ogawa S, Wakita T, Takeda N, Hansman GS. 2007. Binding activity of norovirus and sapovirus to histo-blood group antigens. Arch Virol 152:457-461.
193
Shivanna V, Kim Y, Chang KO. 2014. The crucial role of bile acids in the entry of porcine enteric calicivirus. Virology 456-457:268-278.
Sickbert-Bennett EE, Weber DJ, Gergen-Teague MF, Sobsey MD, Samsa GP, Rutala WA. 2005. Comparative efficacy of hand hygiene agents in the reduction of bacteria and viruses. Am J Infect Control 33:67-77.
Simmonds P, Karakasiliotis I, Bailey D, Chaudhry Y, Evans DJ, Goodfellow IG. 2008. Bioinformatic and functional analysis of RNA secondary structure elements among different genera of human and animal caliciviruses. Nucleic Acids Res 36:2530-2546.
Simmons K, Gambhir M, Leon J, Lopman B. 2013. Duration of immunity to norovirus gastroenteritis. Emerg Infect Dis 19:1260-1267.
Sisay Z, Wang Q, Oka T, Saif L. 2013. Prevalence and molecular characterization of porcine enteric caliciviruses and first detection of porcine kobuviruses in US swine. Arch Virol 158:1583-1588.
Smiley JR, Chang KO, Hayes J, Vinje J, Saif LJ. 2002. Characterization of an enteropathogenic bovine calicivirus representing a potentially new calicivirus genus. J Virol 76:10089-10098.
Smiley JR, Hoet AE, Traven M, Tsunemitsu H, Saif LJ. 2003. Reverse transcription-PCR assays for detection of bovine enteric caliciviruses (BEC) and analysis of the genetic relationships among BEC and human caliciviruses. J Clin Microbiol 41:3089-3099.
Smith AW, Akers TG, Latham AB, Skilling DE, Bray HL. 1979. A new calicivirus isolated from a marine mammal. Arch Virol 61:255-259.
Smith AW, Akers TG, Madin SH, Vedros NA. 1973. San Miguel sea lion virus isolation, preliminary characterization and relationship to vesicular exanthema of swine virus. Nature 244:108-110.
Smith AW, Anderson MP, Skilling DE, Barlough JE, Ensley PK. 1986. First isolation of calicivirus from reptiles and amphibians. Am J Vet Res 47:1718-1721.
Smith AW, Madin SH, Vedros NA, Bankowski RA. 1977. Host range comparisons of five serotypes of caliciviruses. Am J Vet Res 38:101-105.
Smith AW, Mattson DE, Skilling DE, Schmitz JA. 1983. Isolation and partial characterization of a calicivirus from calves. Am J Vet Res 44:851-855.
Smith AW, Prato CM, Skilling DE. 1977. Characterization of two new serotypes of San Miguel sea lion virus. Intervirology 8:30-36.
Smith AW, Skilling DE, Anderson MP, Benirschke K. 1985. Isolation of primate 194
calicivirus Pan paniscus type 1 from a douc langur (Pygathrix nemaeus l.). J Wildl Dis 21:426-428.
Smith AW, Skilling DE, Cherry N, Mead JH, Matson DO. 1998. Calicivirus emergence from ocean reservoirs: zoonotic and interspecies movements. Emerg Infect Dis 4:13-20.
Smith AW, Skilling DE, Latham AB. 1981. Isolation and identification of five new serotypes of calicivirus from marine mammals. Am J Vet Res 42:693-694.
Soma T, Nakagomi O, Nakagomi T, Mochizuki M. 2015. Detection of Norovirus and Sapovirus from diarrheic dogs and cats in Japan. Microbiol Immunol 59:123-128.
Song YJ, Yu JN, Nam HM, Bak HR, Lee JB, Park SY, Song CS, Seo KH, Choi IS. 2011. Identification of genetic diversity of porcine Norovirus and Sapovirus in Korea. Virus Genes 42:394-401.
Sosnovtsev S, Green KY. 1995. RNA transcripts derived from a cloned full-length copy of the feline calicivirus genome do not require VpG for infectivity. Virology 210:383-390.
Sosnovtsev SV, Belliot G, Chang KO, Onwudiwe O, Green KY. 2005. Feline calicivirus VP2 is essential for the production of infectious virions. J Virol 79:4012-4024.
Sosnovtsev SV, Belliot G, Chang KO, Prikhodko VG, Thackray LB, Wobus CE, Karst SM, Virgin HW, Green KY. 2006. Cleavage map and proteolytic processing of the murine norovirus nonstructural polyprotein in infected cells. J Virol 80:7816-7831.
Sosnovtsev SV, Garfield M, Green KY. 2002. Processing map and essential cleavage sites of the nonstructural polyprotein encoded by ORF1 of the feline calicivirus genome. J Virol 76:7060-7072.
Sosnovtsev SV, Sosnovtseva SA, Green KY. 1998. Cleavage of the feline calicivirus capsid precursor is mediated by a virus-encoded proteinase. J Virol 72:3051-3059.
Souza M, Azevedo MS, Jung K, Cheetham S, Saif LJ. 2008. Pathogenesis and immune responses in gnotobiotic calves after infection with the genogroup II.4-HS66 strain of human norovirus. J Virol 82:1777-1786.
Straub TM, Bartholomew RA, Valdez CO, Valentine NB, Dohnalkova A, Ozanich RM, Bruckner-Lea CJ, Call DR. 2011. Human norovirus infection of caco-2 cells grown as a three-dimensional tissue structure. J Water Health 9:225-240.
Stuart AD, Brown TD. 2007. Alpha2,6-linked sialic acid acts as a receptor for Feline calicivirus. J Gen Virol 88:177-186.
Studdert MJ. 1978. Caliciviruses. Brief review. Arch Virol 58:157-191. 195
Sugieda M, Nagaoka H, Kakishima Y, Ohshita T, Nakamura S, Nakajima S. 1998. Detection of Norwalk-like virus genes in the caecum contents of pigs. Arch Virol 143:1215-1221.
Summa CM, Levitt M. 2007. Near-native structure refinement using in vacuo energy minimization. Proc Natl Acad Sci U S A 104:3177-3182.
Svraka S, Vennema H, van der Veer B, Hedlund KO, Thorhagen M, Siebenga J, Duizer E, Koopmans M. 2010. Epidemiology and genotype analysis of emerging sapovirus-associated infections across Europe. J Clin Microbiol 48:2191-2198.
Takahashi H, Ohuchi A, Miya S, Izawa Y, Kimura B. 2011. Effect of food residues on norovirus survival on stainless steel surfaces. PLoS One 6:e21951.
Takanashi S, Saif LJ, Hughes JH, Meulia T, Jung K, Scheuer KA, Wang Q. 2014. Failure of propagation of human norovirus in intestinal epithelial cells with microvilli grown in three-dimensional cultures. Arch Virol 159:257-266.
Takano T, Kusuhara H, Kuroishi A, Takashina M, Doki T, Nishinaka T, Hohdatsu T. 2015. Molecular characterization and pathogenicity of a genogroup GVI feline norovirus. Vet Microbiol doi:10.1016/j.vetmic.2015.05.018.
Tan M, Hegde RS, Jiang X. 2004. The P domain of norovirus capsid protein forms dimer and binds to histo-blood group antigen receptors. J Virol 78:6233-6242.
Tan M, Jiang X. 2010. Norovirus gastroenteritis, carbohydrate receptors, and animal models. PLoS Pathog 6:e1000983.
Taniguchi T, Palmieri M, Weissmann C. 1978. QB DNA-containing hybrid plasmids giving rise to QB phage formation in the bacterial host. Nature 274:223-228.
Taube S, Kolawole AO, Hohne M, Wilkinson JE, Handley SA, Perry JW, Thackray LB, Akkina R, Wobus CE. 2013. A mouse model for human norovirus. MBio 4.
Taube S, Perry JW, McGreevy E, Yetming K, Perkins C, Henderson K, Wobus CE. 2012. Murine noroviruses bind glycolipid and glycoprotein attachment receptors in a strain-dependent manner. J Virol 86:5584-5593.
Taube S, Perry JW, Yetming K, Patel SP, Auble H, Shu L, Nawar HF, Lee CH, Connell TD, Shayman JA, Wobus CE. 2009. Ganglioside-linked terminal sialic acid moieties on murine macrophages function as attachment receptors for murine noroviruses. J Virol 83:4092-4101.
Taube S, Wobus CE. 2014. A novel reverse genetics system for human norovirus. Trends Microbiol 22:604-606.
Temin HM, Mizutani S. 1970. RNA-dependent DNA polymerase in virions of Rous 196
sarcoma virus. Nature 226:1211-1213.
Tenorio AP, Franti CE, Madewell BR, Pedersen NC. 1991. Chronic oral infections of cats and their relationship to persistent oral carriage of feline calici-, immunodeficiency, or leukemia viruses. Vet Immunol Immunopathol 29:1-14.
Terio V, Martella V, Moschidou P, Di Pinto P, Tantillo G, Buonavoglia C. 2010. Norovirus in retail shellfish. Food Microbiol 27:29-32.
Thiry E, Addie D, Belak S, Boucraut-Baralon C, Egberink H, Frymus T, Gruffydd-Jones T, Hartmann K, Hosie MJ, Lloret A, Lutz H, Marsilio F, Pennisi MG, Radford AD, Truyen U, Horzinek MC. 2009. Feline herpesvirus infection. ABCD guidelines on prevention and management. J Feline Med Surg 11:547-555.
Thomas C, Jung K, Han MG, Hoet A, Scheuer K, Wang Q, Saif LJ. 2014. Retrospective serosurveillance of bovine norovirus (GIII.2) and nebovirus in cattle from selected feedlots and a veal calf farm in 1999 to 2001 in the United States. Arch Virol 159:83-90.
Thornhill TS, Wyatt RG, Kalica AR, Dolin R, Chanock RM, Kapikian AZ. 1977. Detection by immune electron microscopy of 26- to 27-nm viruslike particles associated with two family outbreaks of gastroenteritis. J Infect Dis 135:20-27.
Thurin J, Blaszczyk-Thurin M. 1995. Porcine submaxillary gland GDP-L-fucose: beta-D-galactoside alpha-2-L-fucosyltransferase is likely a counterpart of the human Secretor gene-encoded blood group transferase. J Biol Chem 270:26577-26580.
Tse H, Chan WM, Li KS, Lau SK, Woo PC, Yuen KY. 2012. Discovery and genomic characterization of a novel bat sapovirus with unusual genomic features and phylogenetic position. PLoS One 7:e34987.
Tse H, Lau SK, Chan WM, Choi GK, Woo PC, Yuen KY. 2012. Complete genome sequences of novel canine noroviruses in Hong Kong. J Virol 86:9531-9532.
Tu ET, Bull RA, Greening GE, Hewitt J, Lyon MJ, Marshall JA, McIver CJ, Rawlinson WD, White PA. 2008. Epidemics of gastroenteritis during 2006 were associated with the spread of norovirus GII.4 variants 2006a and 2006b. Clin Infect Dis 46:413-420. van Asten L, Siebenga J, van den Wijngaard C, Verheij R, van Vliet H, Kretzschmar M, Boshuizen H, van Pelt W, Koopmans M. 2011. Unspecified gastroenteritis illness and deaths in the elderly associated with norovirus epidemics. Epidemiology 22:336-343. van der Poel WH, van der Heide R, Verschoor F, Gelderblom H, Vinje J, Koopmans MP. 2003. Epidemiology of Norwalk-like virus infections in cattle in The Netherlands. Vet Microbiol 92:297-309.
197
van Der Poel WH, Vinje J, van Der Heide R, Herrera MI, Vivo A, Koopmans MP. 2000. Norwalk-like calicivirus genes in farm animals. Emerg Infect Dis 6:36-41.
Vinje J. 2015. Advances in Laboratory Methods for Detection and Typing of Norovirus. J Clin Microbiol 53:373-381.
Vinje J, Green J, Lewis DC, Gallimore CI, Brown DW, Koopmans MP. 2000. Genetic polymorphism across regions of the three open reading frames of "Norwalk-like viruses". Arch Virol 145:223-241.
Vongpunsawad S, Venkataram Prasad BV, Estes MK. 2013. Norwalk Virus Minor Capsid Protein VP2 Associates within the VP1 Shell Domain. J Virol 87:4818-4825.
Wang G, Shen Z, Qian F, Li Y, Yuan Z, Zhang J. 2014. Genetic diversity of sapovirus in non-hospitalized adults with sporadic cases of acute gastroenteritis in Shanghai, China. J Clin Virol doi:10.1016/j.jcv.2014.01.007.
Wang J, Jiang X, Madore HP, Gray J, Desselberger U, Ando T, Seto Y, Oishi I, Lew JF, Green KY, et al. 1994. Sequence diversity of small, round-structured viruses in the Norwalk virus group. J Virol 68:5982-5990.
Wang Q, Scheuer K, Ahang Z, Gebreyes WA, Molla BZ, Hoet AE, Saif LJ. 2011. Characterization and prevalence of a new porcine Calicivirus in Swine, United States. Emerg Infect Dis 17:1103-1106.
Wang Q, Zhang Z, Saif LJ. 2012. Stability of and attachment to lettuce by a culturable porcine sapovirus surrogate for human caliciviruses. Appl Environ Microbiol 78:3932-3940.
Wang QH, Chang KO, Han MG, Sreevatsan S, Saif LJ. 2006. Development of a new microwell hybridization assay and an internal control RNA for the detection of porcine noroviruses and sapoviruses by reverse transcription-PCR. J Virol Methods 132:135-145.
Wang QH, Han MG, Cheetham S, Souza M, Funk JA, Saif LJ. 2005. Porcine noroviruses related to human noroviruses. Emerg Infect Dis 11:1874-1881.
Wang QH, Han MG, Funk JA, Bowman G, Janies DA, Saif LJ. 2005. Genetic diversity and recombination of porcine sapoviruses. J Clin Microbiol 43:5963-5972.
Wang QH, Souza M, Funk JA, Zhang W, Saif LJ. 2006. Prevalence of noroviruses and sapoviruses in swine of various ages determined by reverse transcription-PCR and microwell hybridization assays. J Clin Microbiol 44:2057-2062.
Ward VK, McCormick CJ, Clarke IN, Salim O, Wobus CE, Thackray LB, Virgin HWt, Lambden PR. 2007. Recovery of infectious murine norovirus using pol II-driven expression of full-length cDNA. Proc Natl Acad Sci U S A 104:11050-11055.
198
Wei C, Farkas T, Sestak K, Jiang X. 2008. Recovery of infectious virus by transfection of in vitro-generated RNA from tulane calicivirus cDNA. J Virol 82:11429-11436.
Weide KD, Waxler GL, Whitehair CK, Morill CC. 1962. Hog cholera in gnotobiotic pigs. Clinical signs and gross pathologic findings in germfree and monocontaminated pigs. J Am Vet Med Assoc 140:1056-1061.
Weston BW, Nair RP, Larsen RD, Lowe JB. 1992. Isolation of a novel human alpha (1,3)fucosyltransferase gene and molecular comparison to the human Lewis blood group alpha (1,3/1,4)fucosyltransferase gene. Syntenic, homologous, nonallelic genes encoding enzymes with distinct acceptor substrate specificities. J Biol Chem 267:4152-4160.
White PA. 2014. Evolution of Norovirus. Clin Microbiol Infect doi:10.1111/1469-0691.12746.
Wikswo ME, Cortes J, Hall AJ, Vaughan G, Howard C, Gregoricus N, Cramer EH. 2011. Disease transmission and passenger behaviors during a high morbidity Norovirus outbreak on a cruise ship, January 2009. Clin Infect Dis 52:1116-1122.
Wilder FW. 1980. Detection of swine caliciviruses by indirect immunofluorescence. Can J Comp Med 44:87-92.
Wise AG, Monroe SS, Hanson LE, Grooms DL, Sockett D, Maes RK. 2004. Molecular characterization of noroviruses detected in diarrheic stools of Michigan and Wisconsin dairy calves: circulation of two distinct subgroups. Virus Res 100:165-177.
Wobus CE, Karst SM, Thackray LB, Chang KO, Sosnovtsev SV, Belliot G, Krug A, Mackenzie JM, Green KY, Virgin HW. 2004. Replication of Norovirus in cell culture reveals a tropism for dendritic cells and macrophages. PLoS Biol 2:e432.
Wobus CE, Thackray LB, Virgin HWt. 2006. Murine norovirus: a model system to study norovirus biology and pathogenesis. J Virol 80:5104-5112.
Wolf S, Hewitt J, Greening GE. 2010. Viral multiplex quantitative PCR assays for tracking sources of fecal contamination. Appl Environ Microbiol 76:1388-1394.
Wolf S, Reetz J, Hoffmann K, Grundel A, Schwarz BA, Hanel I, Otto PH. 2012. Discovery and genetic characterization of novel caliciviruses in German and Dutch poultry. Arch Virol 157:1499-1507.
Wolf S, Reetz J, Otto P. 2011. Genetic characterization of a novel calicivirus from a chicken. Arch Virol 156:1143-1150.
Wolf S, Williamson W, Hewitt J, Lin S, Rivera-Aban M, Ball A, Scholes P, Savill M, Greening GE. 2009. Molecular detection of norovirus in sheep and pigs in New Zealand farms. Vet Microbiol 133:184-189.
199
Woode GN, Bridger JC. 1978. Isolation of small viruses resembling astroviruses and caliciviruses from acute enteritis of calves. J Med Microbiol 11:441-452.
Yamashita Y, Ootsuka Y, Kondo R, Oseto M, Doi M, Miyamoto T, Ueda T, Kondo H, Tanaka T, Wakita T, Katayama K, Takeda N, Oka T. 2010. Molecular characterization of Sapovirus detected in a gastroenteritis outbreak at a wedding hall. J Med Virol 82:720-726.
Yoshida T, Kasuo S, Azegami Y, Uchiyama Y, Satsumabayashi K, Shiraishi T, Katayama K, Wakita T, Takeda N, Oka T. 2009. Characterization of sapoviruses detected in gastroenteritis outbreaks and identification of asymptomatic adults with high viral load. J Clin Virol 45:67-71.
Yu G, Zhang D, Guo F, Tan M, Jiang X, Jiang W. 2013. Cryo-EM structure of a novel calicivirus, Tulane virus. PLoS One 8:e59817.
Yuan L, Ward LA, Rosen BI, To TL, Saif LJ. 1996. Systematic and intestinal antibody-secreting cell responses and correlates of protective immunity to human rotavirus in a gnotobiotic pig model of disease. J Virol 70:3075-3083.
Yunus MA, Chung LM, Chaudhry Y, Bailey D, Goodfellow I. 2010. Development of an optimized RNA-based murine norovirus reverse genetics system. J Virol Methods 169:112-118.
Yunus MA, Lin X, Bailey D, Karakasiliotis I, Chaudhry Y, Vashist S, Zhang G, Thorne L, Kao CC, Goodfellow I. 2014. The murine norovirus (MNV) core subgenomic RNA promoter consists of a stable stem-loop that can direct accurate initiation of RNA synthesis. J Virol doi:10.1128/JVI.02432-14.
Zhang B, Tang C, Yue H, Ren Y, Song Z. 2014. Viral metagenomics analysis demonstrates the diversity of viral flora in piglet diarrhoeic faeces in China. J Gen Virol 95:1603-1611.
Zhang D, Huang P, Zou L, Lowary TL, Tan M, Jiang X. 2015. Tulane Virus Recognizes the A Type 3 and B Histo-Blood Group Antigens. J Virol 89:1419-1427.
Zheng DP, Ando T, Fankhauser RL, Beard RS, Glass RI, Monroe SS. 2006. Norovirus classification and proposed strain nomenclature. Virology 346:312-323.
Zhirakovskaia EV, Tikunov AY, Bodnev SA, Klemesheva VV, Netesov SV, Tikunova NV. 2015. Molecular epidemiology of noroviruses associated with sporadic gastroenteritis in children in Novosibirsk, Russia, 2003-2012. J Med Virol doi:10.1002/jmv.24068.
Zhou L, Luo M. 1995. Crystallization and preliminary X-ray analysis of two density populations of feline calicivirus. Acta Crystallogr D Biol Crystallogr 51:850-852.
200
Zhu S, Regev D, Watanabe M, Hickman D, Moussatche N, Jesus DM, Kahan SM, Napthine S, Brierley I, Hunter RN, 3rd, Devabhaktuni D, Jones MK, Karst SM. 2013. Identification of Immune and Viral Correlates of Norovirus Protective Immunity through Comparative Study of Intra-Cluster Norovirus Strains. PLoS Pathog 9:e1003592.
Zintz C, Bok K, Parada E, Barnes-Eley M, Berke T, Staat MA, Azimi P, Jiang X, Matson DO. 2005. Prevalence and genetic characterization of caliciviruses among children hospitalized for acute gastroenteritis in the United States. Infect Genet Evol 5:281-290.
201