Dna Barcoding of Echinoderms: Species

DNA BARCODING OF ECHINODERMS:

SPECIES DIVERSITY AND PATTERNS OF MOLECULAR EVOLUTION

A Thesis

Presented to

The Faculty of Graduate Studies

The University of Guelph

ERIN A. CORSTORPHINE

In partial fulfillment of requirements

for the degree of

Master of Science

April, 2010

395 Wellington Street 395, rue Wellington Ottawa ON K1A 0N4 Ottawa ON K1A 0N4 Canada Canada

Your file Votre reference ISBN: 978-0-494-64608-3 Our Trie Notre reference ISBN: 978-0-494-64608-3

NOTICE: AVIS:

The author has granted a non L'auteur a accorde une licence non exclusive exclusive license allowing Library and permettant a la Bibliotheque et Archives Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par I'lnternet, preter, telecommunication or on the Internet, distribuer et vendre des theses partout dans le loan, distribute and sell theses monde, a des fins commerciales ou autres, sur worldwide, for commercial or non support microforme, papier, electronique et/ou commercial purposes, in microform, autres formats. paper, electronic and/or any other formats.

The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in this et des droits moraux qui protege cette these. Ni thesis. Neither the thesis nor la these ni des extraits substantiels de celle-ci substantial extracts from it may be ne doivent etre imprimes ou autrement printed or otherwise reproduced reproduits sans son autorisation. without the author's permission.

In compliance with the Canadian Conformement a la loi canadienne sur la Privacy Act some supporting forms protection de la vie privee, quelques may have been removed from this formulaires secondaires ont ete enleves de thesis. cette these.

While these forms may be included Bien que ces formulaires aient inclus dans in the document page count, their la pagination, il n'y aura aucun contenu removal does not represent any loss manquant. of content from the thesis.

••I Canada ABSTRACT

DNA BARCODING OF ECHINODERMS:

SPECIES DIVERSITY AND PATTERNS OF MOLECULAR EVOLUTION

Erin A. Corstorphine Advisor: University of Guelph, 2010 Professor P.D.N. Hebert

This thesis investigates species diversity and patterns of molecular evolution in the phylum Echinodermata. The first chapter tests and confirms the utility of DNA barcoding for species identification in 131 species of echinoderms. The impact of larval development and dispersal on intraspecific divergence is examined for trans-oceanic and putative cryptic species. The second chapter investigates the association between rates of molecular evolution and developmental mode by employing phylogenetically independent comparisons between species with contrasting modes of larval development

(e.g., planktotrophy vs. maternal brood-protection). The results show that species with nonpelagic development have accelerated rates of evolution when compared to those with pelagic development. However, further investigation is required to determine the factors responsible for this trend. These results suggest that reproductive mode is an important factor in the establishment and maintenance of patterns and rates of genetic divergence in echinoderms. ACKNOWLEDGEMENTS

This research was supported by a Natural Sciences and Engineering Research

Council of Canada (NSERC) graduate student scholarship to myself, and a NSERC research grant to my advisor Paul Hebert.

I would like to thank members of my advisory committee (Teri Crease, Andreas

Heyland and Paul Hebert) for their guidance and support. In particular I am deeply grateful to Paul Hebert for providing me with the opportunity to pursue my academic goals and for providing encouragement throughout my degree. My time in the field at

Churchill, St. Andrews and Bamfield, provided me with greater perspective on my work and equipped me with valuable field experience. For that, I am also thankful.

I would also like to acknowledge by defense committee (Teri Crease, Elizabeth

Boulding, Paul Hebert and Pat Wright) for providing thoughtful comments and revisions for the finished thesis.

I would like to thank everyone who made this research possible by either contributing specimens or aiding in field collections including: Christina Carr, Sandra

McCubbin, Robert Frank, Victoria Frank, Jeremy deWaard, Tanya Brown, Tom Sheldon,

Jim Boutillier, Claudia Hand, Katy Hind, and Bridgette Clarkston. In particular, I would like to thank Christy, for being my partner in the field. Learning to drive boats, fishing for dogfish, scouring the barren intertidal in Churchill, digging for critters while up to our knees in mud, not to mention, the countless hours processing, photographing and organizing specimens; none of this would have been the same without you. To Bob and

Victoria, thank you for teaching me the art of drysuit diving, for providing me with equipment, great company, lobster dinners and of course, comic relief.

i I am particularly grateful to Kelly Sendall for providing access to the extensive echinoderm collection at the Royal British Columbia Museum and to Phil Lambert for his taxonomic advice. I would also like to thank my external collaborators: Peter Smith,

Doug Eernisse, Megumi Strathmann and Chris Mah for including me in their work and providing me with opportunities to further my knowledge and involvement in echinoderm research.

A heartfelt thanks to my labmates: Beth, Christy, John, Kevin, Taika and Vazrick, for providing advice on all aspects of the graduate student experience and for keeping things interesting. In particular, thank you to Beth and Christy for helping me with lab techniques, clarifying concepts and providing helpful comments on early renditions of this thesis. Thank you to the many staff at the Biodiversity Institute of Ontario, for providing support at all stages of the process. A special thank you to Natalia Ivanova for aid with laboratory protocols, Luiqiong Lu for speedy processing, Dirk Steinke for helpful advice, Alex Borisenko and Jayme Sones for support with specimen collections and Susan Mannhardt for her support in all aspects of the administrative process.

I thank all my friends, near and far, for their encouragement and friendship. I would especially like to thank Mike for helping me take the leap and for providing unwavering encouragement and support - you were always there when I needed you most, whether I needed to ramble off ideas, vent my frustrations, cry in despair or celebrate even the smallest of achievements. Thank you.

Finally I would like to thank my mom (Norma), dad (Wayne), sister (Lindsay), brother (Jamie), grandfather (Ed) and extended family, including all the Fitz's, for their love and support.

ii TABLE OF CONTENTS

LIST OF TABLES vi

LIST OF FIGURES vii

LIST OF APPENDICES viii

GENERAL INTRODUCTION 1

Marine biodiversity and consequences of larval dispersal 1

Present study 2

CHAPTER 1: Exploring Canadian echinoderm biodiversity through DNA barcoding 4

Abstract 4

Introduction 5

Methods 9

Specimen collection and taxonomy 9

DNA extraction, COI amplification and sequencing 10

Sequence analysis 12

Species delineation 12

Results 13

Sequence recovery 13

Taxonomic issues 14

Genetic distances within and among taxa 16

Divergence across oceans 18

Discussion 18 Species delineation 19

in Intraspecific divergence between allopatric populations 19

Intraspecific divergence in sympatry 21

Patterns of divergence in a species-rich genus 22

Effects of distribution on interpretation of barcode data 23

Future work 25

Conclusion 27

CHAPTER 2: Patterns of molecular evolution in the COI gene in the Echinodermata 43

Abstract 43

Introduction 44

Methods 48

Taxon choice, developmental mode and independent comparisons 48

Sequence acquisition 49

Nucleotide diversity 49

Relative rate tests 50

Tests for lineage-specific selection 50

Meta-analysis 52

Results 52

Nucleotide diversity 52

Relative rate tests 52

Lineage-specific selection 53

Discussion 53

Possible explanations for elevated rates in nonpelagic lineages 54

IV Study design 57

Future work 58

Conclusion 59

GENERAL DISCUSSION 68

Summary of results 68

DNA barcoding: applications and patterns of diversity 69

Implications of rate heterogeneity 71

REFERENCES 72

APPENDICES 93

v LIST OF TABLES

CHAPTER 1

Table 1: Primer combinations, length and location of amplicon and primer

references 28

Table 2: Echinoderm species with maximum intraspecific distance > 2% 29

Table 3: Echinoderm species sampled from at least two of Canada's

three oceans 30

CHAPTER 2

Table 1: List of phylogenetically independent comparisons for pelagic and

nonpelagic lineages 61

Table 2: Nucleotide diversity estimates 62

Table 3: Results of relative rate tests 63

Table 4: Ratios of rates of nonsynonymous (dN) to synonymous (dS)

substitutions 64

VI LIST OF FIGURES

CHAPTER 1

Figure 1: Map of Canada indicating collection locations and sample sizes 31

Figure 2: Class-level neighbour-joining trees indicating number of species

and sample sizes 32

Figure 3: Frequency distribution for intra- and interspecific pairwise

comparisons 37

Figure 4: Neighbour-joining tree for Henricia 38

Figure 5: Neighbour-joining trees and collection maps for three species with

variable intraspecific divergence associated with geographic separation 40

Figure 6: Neighbour-joining trees and collection maps for Lophaster 42

CHATPER 2

Figure 1: Relationships between larval development and various life history

characters 65

Figure 2: Branch lengths for nonpelagic and pelagic lineages 66

Figure 3: Estimated dN/dS values for single and two-omega models for Fequal

and F3x4 codon substitution models 67

vn LIST OF APPENDICES

APPENDIX 1: Cycle-sequencing reactions 93

APPENDIX 2: Sample and collection information for 809 sequences analyzed in Chapter 1 94

APPENDIX 3: Class-level neighbour-joining trees (uncompressed) 125

APPENDIX 4: Sample and collection information for sequences included in nucleotide diversity estimates in Chapter 2 142

vin GENERAL INTRODUCTION:

Marine biodiversity and consequences of larval dispersal

Increasing threats to biodiversity over the last century have spurred the development of more rapid and accurate methods for species identification. Molecular techniques are now accelerating biodiversity assessments by revealing phylogenetic relationships, quantifying intraspecific genetic variation, defining species boundaries and identifying poorly documented or morphologically cryptic species (Feral 2002). DNA barcoding, a process which uses a 650 bp region of the mitochondrial cytochrome c oxidase subunit I (COI) gene to identify species (Hebert et al. 2003), has shown considerable promise with diverse taxa and life stages (see Chapter 1). The diversity of higher taxonomic groups in the world's oceans is unparalleled on land; over 30 animal phyla inhabit the marine environment, 14 of which are endemic (Pechenik 1999). Yet for many of these taxa, our knowledge of their life histories, ecology and phylogenetic relationships is limited. The launch of the Census of Marine Life (COML) nearly a decade ago has placed additional focus on marine biodiversity and since the project began over 5600 previously unknown species have been described

(http://www.coml.org/about). The rate of species discovery by COML is not surprising given that much of the ocean is unexplored and even familiar marine groups contain undiagnosed species (Knowlton 2000). Morphologically cryptic species, assumptions of high gene flow over large geographic ranges and general lack of taxonomic knowledge are responsible (Knowlton 1993).

Adults of many species of marine benthic invertebrates are relatively sessile, and their principal means of dispersal occurs during a pelagic larval phase. The capacity for

1 dispersal via pelagic larvae and the absence of obvious barriers to gene flow, have led to the assumption that many marine species are cosmopolitan. However, recent studies employing molecular techniques have shown that several putative cosmopolitan species are actually species complexes (Bleidorn et al. 2006, Boissin et al. 2008, Scroth et al.

2002), likely undiagnosed due to conservative taxonomy and/or cryptic or static morphology (Klautau et al. 1999, Knowlton 2000). Variation in dispersal capacity has genetic, ecological and evolutionary consequences with the potential to impact competition, inbreeding, gene flow, range expansion and rates and modes of speciation and extinction (reviewed in Pechenik 1999), and as a result plays an important role in the creation and maintenance of biodiversity (Young et al. 1997).

Present Study

This thesis explores the influence of reproductive mode on patterns of species diversity and rates of molecular evolution in the phylum Echinodermata. In Chapter 1,1 expanded on an earlier study to test the utility of DNA barcoding for species identification in echinoderms. Existing DNA barcode protocols were modified for echinoderms leading to improved sequence recovery for a greater number of species.

Additional molecular and taxonomic work was suggested for putative species with maximum intraspecific divergence > 2% to verify taxonomic status. Results indicate that

DNA barcoding is an effective tool for species identification for echinoderms in

Canadian waters and suggest that comprehensive sampling is of particular importance in species with nonpelagic development due to their reduced dispersal potential.

In Chapter 2,1 used phylogenetic independent comparisons to test for an association between mode of larval development and rates of molecular evolution.

2 Results from six independent comparisons, between species with contrasting modes of development, indicated that lineages with nonpelagic larval stages have accelerated rates of molecular evolution. Limits of the current dataset made it difficult to determine the factors responsible for this trend, however, potential explanations are discussed and suggestions for future work are provided.

Finally, the results of the thesis are compared to those from other barcoding studies of marine benthic invertebrates and briefly discussed with reference to their implications for future studies and the application of molecular clocks in phylogenetic and dating studies.

3 CHAPTER 1: Exploring Canadian echinoderm diversity through DNA barcoding

ABSTRACT:

DNA barcoding has proven to be an effective tool for species identification in a variety of marine invertebrates including gastropods, crustaceans, polychaetes and echinoderms. In this study, I further test the utility of DNA barcoding in the

Echinodermata by surveying approximately one third of the 300 species in Canada's coastal waters. COI sequences for 809 specimens formed 131 clusters with high bootstrap support that effectively separated morphological species. In most cases, species discrimination was straightforward due to the large difference (34-fold) between mean intra- (0.41%) and inter- (13.8%) specific divergence. Species characterized by multiple genetic clusters with high bootstrap support and possible isolating mechanisms were flagged for further taxonomic investigation. The potential influence of larval development and geological events on patterns of genetic diversity was discussed for 14 trans-oceanic species. Although additional sampling across broad geographic ranges is needed to clarify biogeographic patterns and resolve taxonomic questions, this study confirms the utility of DNA barcoding for species identification in the Echinodermata.

4 INTRODUCTION:

Since 2003, DNA barcoding (Hebert et al. 2003) has gained increasing usage as a tool for species identification and discovery. It has been particularly useful because of its potential to rapidly advance efforts to catalogue biodiversity. This approach utilizes sequence variation in a 650bp region near the 5' end of the mitochondrial cytochrome c oxidase subunit 1 (COI) gene to identify species (Hebert et al. 2003). Its effectiveness in this regard has been shown in birds (Kerr et al. 2007, 2009), bats (Clare et al. 2007), fishes (Steinke et al. 2009, Ward et al. 2005, Zemlak et al. 2009), insects (Robinson et al.

2009, Smith et al. 2005) and several marine invertebrate groups, such as stomatopods

(Barber and Boyce 2006), bivalves (Mikkelson et al. 2007), crustaceans (Radulovici et al.

2009) and echinoderms (Ward et al. 2008). In these studies the prevalence of a barcode gap, the situation where interspecific divergence is much greater than maximum intraspecific divergence, underpins the utility of barcoding for differentiating species.

A survey of marine studies between 1960 and 2004, representing 15 phyla, reported that one third of specimens were not identified to a species level (Schander and

Willasen 2005) because of the loss of diagnostic morphological characters during collection or due to the difficulty in linking various life stages with adult forms. Larval stages are notoriously challenging to identify beyond family using traditional morphological techniques, making it difficult to estimate reproductive success, timing and duration of larval dispersal (Webb et al. 2006). The use of sequence data for species identification provides a solution to both these problems. Fixed divergence thresholds are generally effective in the delineation and identification of species, although they do fail to differentiate young species (Barber and Boyce 2006, Meyer and Paulay 2005). DNA

5 barcoding has successfully identified larvae of fishes (Pegg et al. 2006), and a variety of marine invertebrates, (Webb et al. 2006) including stomatopods (Barber and Boyce 2006) and gastropods (Puillandre et al. 2009). It is particularly effective when a comprehensive barcode reference database based on adults is available.

The phylum Echinodermata includes at least 7000 species that occupy habitats from the intertidal zone to the abyss (Brusca and Brusca 2003). These benthic organisms constitute a significant fraction of invertebrate biomass, particularly in the deep sea

(Bluhm et al. 2005, Brandt et al. 2007). Several echinoid and holothurian species are targeted by commercial fisheries, while others are exploited for aquarium and souvenir trades, and biomedical industries (Michael et al. 2009). Echinoderms, like other marine invertebrate groups, have evolved a diversity of reproductive modes, ranging from taxa with highly dispersive planktotrophic larvae to those with maternal brood-protection.

Larval dispersal has the potential to greatly influence gene flow between populations leading to varied levels of population structure within species, and possibly affecting rates of speciation and extinction (Bohonak 1999, Jablonski and Lutz 1983, Jeffrey and

Emlet 2003, Pechenik 1999). Generally, species with low dispersal rates show significant genetic structure over small spatial scales (1-200 km) while those with high dispersal rates have little population structure, though exceptions do exist (see Kelly and Palumbi

2010, Palumbi 1992 and references therein).

Although a substantial amount of work has examined the phylogenetic relationships, developmental and reproductive biology of echinoderms, few studies have examined molecular diversity for species in Canadian waters (Asterias, Harper and Hart

2007, Harper et al. 2007, Wares 2001; Cucumaridae, Arndt et al. 1996; Leptasterias,

6 Hrincevich et al. 2000; Strongylocentrotus, Addison and Hart 2005, Harper et al. 2007,

Palumbi and Kessing 1991, Palumbi and Wilson 1990). These studies focused on introgression along secondary contact zones (Harper and Hart 2007, Harper et al. 2007,

Wares 2001), a cryptic species complex (Hrincevich et al. 2000), phylogenetics of northeastern Pacific sea cucumbers (Arndt et al. 1996) and divergence in trans-Arctic species (Palumbi and Kessing 1991), but provided limited information on levels of sequence divergence in Canadian species. Most studies report substantial interspecific divergences (2.5 - 24.2%) for COI, while intraspecific distances are much lower, <1%

(Arndt et al. 1996, Hart et al. 1997, Ward et al. 2008). Although these values are similar to those observed in other marine invertebrates (Radulovici et al. 2009) and fishes (Ward et al. 2005), low levels of mitochondrial divergence have been observed between some sibling species of echinoderms. For example, Hart et al. (2003) reported interspecific divergence levels as low as 1.1-1.2% for COI between sister taxa of sea stars, while

Palumbi et al. (1997) found interspecific divergences of 2-3% for closely related echinoid species.

Faunal assemblages in Canadian marine waters have been heavily impacted by the unstable climatic and hydrographic conditions during the Late Cenozoic (Svitoch and

Taldenkova 1994). The opening of the Bering Strait during the mid-Pliocene (~3.5 Mya) coupled with ice-free Arctic waters (Dunton 1992), allowed extensive migration between the northern Pacific and Arctic-Atlantic ocean basins (Durham and MacNeil 1967,

Vermeij 1991). Subsequent Pleistocene glaciations eradicated much of the fauna in the

Arctic and northwest Atlantic where conditions were more severe and glacial refugia were lacking. Re-colonization from both Pacific and Atlantic populations following

7 deglaciation approximately 14,000 years ago (Dunton 1992) has resulted in varied levels of population structure, ranging from closely related species complexes (Macoma, Nikula

2007; Mallotus, Dodson et al. 2007) to widespread species with very low levels of genetic divergence (Strongylocentrotus, Palumbi and Kessing 1991, Palumbi and Wilson,

1990).

This study builds on a previous DNA barcoding study of echinoderms (Ward et al. 2008), by surveying over 100 species in Canada's coastal waters. Ward et al. (2008) focused primarily on Australian species and incorporated GenBank records, many of which consisted of a single record per species and/or represented tropical species.

Although this study focuses on species in Canadian waters, several of the species surveyed have broad distributions that extend across polar and temperate regions of the northern hemisphere. Approximately 300 species of echinoderms occur in Canada's oceans, with two-thirds (217) of these taxa inhabiting the NE Pacific (Lambert 1997,

2000, Lambert and Austin 2007). By contrast, Smirnov (1994) estimated that only 79 species of echinoderms inhabit the high Arctic and just 43 of these species have been recorded from Canadian waters (P. Archambault pers. comm.). Diversity is higher in the

Atlantic; 109 species of echinoderms have been collected from Canadian waters (Van

Geulpen et al. 2005, L.Van Guelpen pers. comm.). A large-scale study such as this provides the opportunity to test the efficacy of DNA barcoding, particularly in the well- studied west coast fauna, and may begin to illuminate phylogeographic patterns resulting from the region's geological and glacial history. Furthermore, the circumpolar and/or circumboreal distributions of several of these species makes them excellent candidates for investigating levels of barcode divergence across broad geographic ranges.

8 The present study sought to test the use of DNA barcoding for the identification of echinoderm species in Canadian waters by examining the prevalence of a 'barcode gap', the case when interspecific divergences are clearly higher than intraspecific variation. Furthermore, this study explores patterns of intraspecific divergence in trans oceanic species.

METHODS:

Specimen collection and taxonomy:

Tissue samples were obtained from 1170 specimens held in invertebrate collections at the University of Guelph (UofG) and the Royal British Columbia Museum

(RBCM). Samples from 316 specimens representing 78 species were gathered in trawl collections by the RBCM between 2000 and 2006 from depths > 200m at various localities along the west coast of British Columbia. All RBCM specimens were identified by Philip Lambert, the museum's echinoderm taxonomist during that time. Another 252 specimens, collected by scuba and dredging between 1995 and 2002 from the Queen

Charlotte Sound and sites in Nunavut (Fig. 1), were held in collections at the Biodiversity

Institute of Ontario (BIO). Another 554 specimens were collected by scuba, dredging and by hand from locations along the coasts of British Columbia, Manitoba, Labrador and

New Brunswick between 2007 and 2009. Forty-eight specimens were gathered in trawl collections from depths < 700m from locations in the Beaufort Sea, Baffin Bay and

Labrador Sea as part of the Canadian Healthy Oceans Network (CHONe) 2010 biodiversity project. All specimens were identified using taxonomic keys for the regions

(British Columbia: Kozloff 1987, Lambert 1997, 2000, Lambert and Austin 2007;

9 Atlantic and Arctic Canada: Pollock 1998). Scientific names follow the World Register of Marine Species (WoRMS, http://www.marinespecies.org). When species-level identifications could not be made, interim names were assigned based on family or genus level identifications (eg. Solaster sp. EAC01). Provisional identifications are denoted by the abbreviation "cf." between genus and species descriptors. For taxa that were difficult to discriminate based on morphology (eg. Henricia), interim names were assigned to clusters on the NJ tree that showed low intra-cluster divergence and nearest neighbour divergences >2%. All specimens were stored as morphological vouchers in 95% ethanol or were frozen at -20°C. Specimen and collection data, including latitude and longitude co-ordinates, sampling depth, date of collection and specimen photographs are publicly available in seven projects on the Barcode of Life Data Systems (BOLD, Ratnasingham and Hebert 2007), including the Echinoderms of Canada (DSPEC), Echinoderms of

Churchill (ECCH), Echinoderms of the Queen Charlotte Sound (EQCS), Echinoderms of

Nunavut (ECNN), Benthic Invertebrates of Labrador (LABBI), CHONe 2010 (CHONE) and the Royal BC Museum Echinoderms (RBCM).

DNA extraction, COI amplification and sequencing:

DNA extracts were prepared from tube feet or gonadal tissue from each specimen.

Tissue was placed directly into 96-well plates containing modified CTAB lysis buffer

(Ivanova et al. 2008) and proteinase K (20mg/mL). Samples were incubated at 56°C for

18-24 hours before extraction using a 3fim filter plate following the manual protocol described by Ivanova et al. (2008). Extracts were re-suspended in 40 pih of molecular grade water. COI sequences were amplified using a variety of primer combinations

10 (Table 1). Amplicons were either 652,658 or 841bp in length depending on the primer combination used (Table 1). Universal mitochondrial 16S rRNA gene (16S) primers

(16Sar/16Sbr, Palumbi 1996) were used to test for the presence of DNA template when

COI primers generated no amplicon. Polymerase chain reactions (PCRs) were carried out in 12.5 /

94 °C for 40 s, 51 °C for 40 s and 72 °C for 1 min, and a further extension period of 72 °C for 5 min. PCR products were visualized on pre-cast 2% agarose gels (E-gel 96,

Invitrogen) and PCR products with single, bright bands were selected for bidirectional sequencing using BigDye version 3.1 on a 3730XL DNA Analyser (Applied

Biosystems). Cycle-sequencing reactions incorporated the same primers as those used to generate the selected PCR product and were dependent on the sequencing clean-up method used (Appendix 1). Sequences for unidentified specimens were analyzed with the

BOLD identification engine and BLAST functions in GenBank (Benson et al. 1999) to determine if sequence matches existed. Congruence between identifications based on sequence data and morphological characters was confirmed prior to assigning names to unidentified specimens.

11 Sequence analysis:

All sequences were edited manually using Sequencher 4.8 and aligned using

ClustalW in MEGA 4.0 (Tamura et al. 2007). Only sequences greater than 500 bp

(minimum barcode length) were included in subsequent analysis. Pairwise estimates of intra- and interspecific sequence divergence were calculated using the Kimura two- parameter (K2P) distance model (Kimura 1980) in the BOLD Management & Analysis

System (Ratnasingham and Hebert 2007). Class-level neighbour-joining (NJ) trees were subsequently constructed using K2P distance estimates and pairwise deletion in MEGA

4.0 for all classes except the Crinoidea where only one species (Florometra serratissimd) was analyzed. Bootstrap support for terminal nodes was calculated using 1000 replicates during the tree-building process. Sequences associated with internal branches corresponding to morphospecies were compressed using the MEGA Tree Explorer

Compress/Uncompress function and replaced with triangular graphical vectors where the width of the triangle represents variation among the compressed sequences and height represents sample size.

Species delineation:

Several methods have been proposed to identify species that may require further taxonomic investigation including hard thresholds (2 -3% divergence between barcode lineages), and the lOx rule (Hebert et al. 2004), where a value ten times the mean intraspecific divergence is used to identify putative species. Kerr et al. (2009) also proposed flagging species that have two or more distinct clusters with high bootstrap support (>98%) on a NJ tree. For the purpose of this study, species with any intraspecific

12 divergence in excess of 2% were flagged for further investigation. Species characterized by multiple clusters with high bootstrap support, and possible isolating mechanisms, such as limited larval dispersal or obvious barriers to gene flow (geographic distance and depth), were also flagged as putative species in need of more comprehensive sampling and taxonomic scrutiny.

RESULTS:

Sequence recovery:

COI sequences were recovered from 131 species, representing 71 genera and 43 families with a success rate of 69% (809/1170) (Appendix 2). Recovery rates were higher

(84%) among freshly collected specimens than for preserved specimens (56%). COI sequences from 18 species of deep-sea echinoderms from the RBCM collection could not be recovered regardless of age (2-10 years). Of these, 55% yielded 16S sequences, suggesting that DNA was not severely degraded. Two additional species, Ophiura robusta (collected in 1995) and Synallactes challengeri (collected in 2002) yielded no

COI sequences. A 16S sequence was recovered from O. robusta while 5. challengeri failed to produce a 16S amplicon.

Nuclear pseudogenes of mitochondrial origin (NUMTs, Bensasson et al. 2001) were occasionally sequenced along with the COI amplicon producing multiple peaks where the two sequences overlapped. Most were <180bp in length and occurred at the beginning of the sequence, allowing for the generation of full sequences following deletion of the NUMT region in the initial segment of each forward and reverse read, and formation of bidirectional contigs. Four highly divergent full-length sequences from an

13 unidentified Arctic Leptosynapta sp. (data not included) were translated and compared to an amino acid consensus sequence for the remainder of the dataset. No stop codons were identified, but five substitutions were observed in 16 amino acid residues that are thought to perform important functions in this segment of COI (Ward and Holmes 2007). These five substitutions were not observed in any other echinoderm taxa in this dataset, so the four Leptosynapta sequences were excluded from the analyses as potential pseudogenes.

All 16 of the important amino acid residues are conserved in the final dataset (809 sequences) and all sequences are free of indels and stop codons, suggesting they represent authentic mtDNA sequences rather than pseudogenes.

Taxonomic issues:

In the class-level NJ trees, one echinoid and one asteroid cluster potentially represent new species or species previously undocumented in Canadian waters (Fig. 2 for compressed trees, Appendix 3 for uncompressed trees). Two Arctic echinoid specimens

(ECNN007-08 and ECNN008-08) belonging to the genus Strongylocentrotus (S. sp.

EAC01) did not match any existing description for species in this region. Several diagnostic characters used for sea urchin identifications, such as number of pore pairs and spine wedges, overlap in S. droebachiensis and S.pallidus and were similarly undiagnostic in the unknown specimens. The most obvious difference in the unknown specimens was the deep purple colour of their test, tube feet and spines. In addition, spine density and size appeared reduced when compared to all other Strongylocentrotus specimens in this collection. The COI sequences from these specimens were very similar to a single S. droebachiensis record in GenBank (AM900391) and one S.pallidus

14 sequence from BOLD (data not shown). However, these four sequences formed a cluster that was separate from the larger S. droebachiensis and S. pallidas clusters in this study.

The second unknown species consisted of three specimens from the family Solasteridae

(Solaster sp. EAC01) from the Pacific (n=2) and Arctic (n=l), which formed a cluster in the asteroid NJ tree that was 7.59-11.65% divergent from other solasterids in the tree. No matches were found when sequences were compared to those in GenBank and BOLD.

Two unidentified specimens of Asteriidae (LABBI083-09 and ECNN042-08) had barcode sequences similar to a single GenBank record (DQ077932) for Stephanasterias albula. This species is not included in existing Arctic-Atlantic taxonomic keys, but has a circumboreal distribution (Clark and Downey 1992) and is included in the Canadian

Atlantic Register of Marine Species (Van Guelpen et al. 2005). Based on morphological descriptions (Clark and Downey 1992) and the high sequence similarity (99%) to

GenBank records, these specimens were identified as S. albula. High sequence similarity with existing GenBank records for COI and 16S was also used to guide identifications for

Henricia cf. oculata and Henricia sanguinolenta respectively.

Discrepancies between species names and sequence data led to the discovery of several mis-identifications within this dataset. For example, DSPEC140-08 and

DSPEC141-08 were originally identified as Crossaster borealis, but showed 6.55% sequence divergence from one another. Re-examination of morphological features confirmed that DSPEC140-08 was C. borealis, while DSPEC141-08 was actually

Heterozonias alternatus. Taxonomic reanalysis of several other specimens lead to re- assignments in accordance with the barcode data. In these cases, the specimens were often juveniles that had minor morphological differences from closely related sister taxa

15 (P. Lambert pers. comm.). Corrected species identifications were employed in all subsequent analyses.

Genetic distances within and among taxa

An average of 6.1 individuals were sequenced per species (range of 1 to 33) with

107 taxa represented by multiple specimens. In class-level NJ trees, sequences for each species formed a monophyletic cluster with bootstrap values of 99-100%, except for the sequences of Henricia sanguinolenta which were supported by a bootstrap value of 97%

(Fig. 2, Appendix 3). The mean K2P distance within species was 0.41% while mean interspecific divergence was 34-fold greater at 13.8%. Most intraspecific comparisons

(90.6%) showed less than 1% divergence between sequences, while 98.2% of sequence comparisons were less than 2% divergent. A small degree of overlap (< 2%) was observed between minimum interspecific divergence and maximum intraspecific divergence (Fig. 3) obscuring what would otherwise be the 'barcode gap'.

Nine species displayed maximum intraspecific divergences above the 2% threshold (Table 2). Five of these nine species formed two distinct clusters, while two formed three clusters (see Table 2 for bootstrap values). In these seven taxa with intraspecific clusters, four species had lineages that appeared to be allopatric and three species had genetic structure between sympatric lineages. When sufficient sample size permitted (ie. n>l), mean intraspecific divergences were re-calculated after designating allopatric lineages as separate species. This produced an adjusted mean of 0.35% (from

0.41%) for all species/lineages.

16 Mean sequence divergence between species within most genera was high

(13.8%), but comparisons between some individuals in the genus Strongylocentrotus produced divergences < 4%. These low levels of divergence occurred between three closely related species. Divergences between Strongylocentrotus sp. EAC01 and S. droebachiensis ranged from 1.95-2.44% and almost all comparisons between S. sp.

EAC01, S. droebachiensis and S. pallidus were < 4% though divergences as high as

12.68% were observed in this genus. Mean intraspecific divergences within these species were all <1%, with S.pallidus and S. droebachiensis having very low means of 0.04% and 0.17% respectively. Low interspecific divergence was also observed between

Henricia sanguinolenta and H. sp. EAC08 (2.4%) which were separated based on a 2% threshold, and between two Pseudarchaster subspecies (min. 2.47%).

Species identifications could not be assigned with confidence in the genus

Henricia, because morphological differences were very constrained. However, 69 sequences for this genus formed 13 clusters with relatively high nearest neighbour distances (mean 7.1%; range 2.4-10.9%) and low intra-group divergences <2% (Fig. 4).

Of the nine clusters represented by multiple specimens, four are endemic to the Pacific, two are endemic to the Atlantic, one has allopatric populations in the Pacific and Atlantic, one is found in both the Arctic and Atlantic and one is found in all three oceans. By the nature of the threshold applied to delineate putative species, intraspecific divergence was constrained to generate means below the 2% level (average intraspecific mean for all

Henricia clusters was 0.32%). When average sequence divergence between putative species was examined, levels of divergence (mean 12.84%) were consistent with other estimates in this study.

17 Divergence across oceans:

Eighteen species were collected from at least two of the three oceans (Table 3).

Twelve of these species had low levels of intraspecific divergence and little to no geographic structure in the NJ trees (Appendix 3). Two others included more than one cluster but the maximum levels of divergence were below the 2% threshold. Finally, four species showed genetic structure and maximum divergences above 2%. Excerpts of class- level NJ trees and maps indicating sample locations are presented for three species,

Solaster endeca, Crossaster papposus and Pteraster militaris, with varying levels of population structure and genetic divergence (Fig. 5). In all species exhibiting population structure, lineages could be assigned to specific oceans or geographic areas, barring one specimen of Gorgonocephalus arcticus from Nunavut which clustered with Atlantic representatives rather than with other samples from Nunavut.

DISCUSSION:

The results of this study further validate DNA barcoding as a species identification tool for echinoderms. All 131 species examined in this study possessed diagnostic sequence variation at COI. In most cases, species discrimination was straightforward because of the large difference (34-fold) between mean intra- (0.41%) and inter- (13.8%) specific divergence. This pattern is consistent with other studies in which COI was used to examine and define relationships within and between species of echinoderms (Arndt et al. 1996, Vogler et al. 2008, Ward et al. 2008, Waters et al. 2004,

Zigler and Lessios 2004). Ward et al. (2008) found DNA barcoding of echinoderms to be highly effective, but found slightly higher intraspecific divergence (0.62%) based on data

18 from 51 species. Despite some overlap in maximum intraspecific and minimum

interspecific divergences, which involved a very small percentage of pairwise comparisons, barcode data effectively separated morphological species in this study.

Moreover, COI provided sufficient resolution to allow the discrimination of some

geographically distant populations of single species (eg. Leptasterias littoralis and

Crossaster papposus, Table 3).

Species delineation

A growing number of studies have utilized sequence data to diagnose cryptic

species, when supported by other biological characters (morphology, color, habitat, life

history and reproductive mode), in a variety of marine groups (see Knowlton 1993,2000 for review) including several echinoderm genera (Acanthaster, Vogler et al. 2008;

Amphipholis, Sponer and Roy 2002, Boissin et al. 2008; Leptasterias, Hrincevich et al.

2000; Ophiothrix, Baric and Sturmbauer 1999; Patiriellal Parvulastra, Hart et al. 2003,

2006). Although sample sizes for the nine species with divergences above the 2% threshold were limited, the present results highlight possibly overlooked species.

However, further research is needed to fully resolve the taxonomic implications of these results.

Intraspecific divergence between allopatric populations

Four species (Solaster sp. EACOl, Solaster endeca, Pteraster militaris and

Gorgonocephalus arcticus) were characterized by relatively high intraspecific variation

(max. 2-3%) and clear geographic population structure. These cases may represent

19 cryptic species, or misidentifications, particularly for the Arctic and Atlantic lineages where comprehensive taxonomic keys are lacking. When these divergent lineages are considered independently (ie. as individual species), mean intraspecific divergences drop below 0.6% and resulting interspecific distances (2-3%), although low, are similar to those observed for COI in other closely related echinoderm species (Echinometra: 2-3%,

Palumbi et al. 1997; Leptasterias: 0.4-2.2%, Hrincevich et al. 2000; Patiriella 1.1-4.3%,

Hart etal. 2003).

In Solaster sp. EAC01, Solaster endeca and Pteraster militaris, genetic divergence involves separation between Pacific and Arctic-Atlantic populations on either side of the Bering Strait. Although population structure is not surprising, the observed levels of divergence are lower than would be expected if populations had been isolated since the trans-Arctic interchange (~3.5 mya). Assuming a mitochondrial rate of evolution of 1-2% per million years (Ma), as reported in urchins (Palumbi and Kessing

1991), levels of divergence between 3.5 and 7% would be expected. The 2-3% divergence observed in these species suggests that gene flow has occurred as recently as

1-1.5 million years ago, assuming a rate of divergence of 2% per Ma. Slower rates of evolution (<1%) could explain the levels of divergence that I observed, however it is also possible that gene flow has occurred since the trans-Arctic interchange. The divergence

(2.18%) between Pacific and Arctic-Atlantic populations of Solaster endeca (Fig. 4A) is considerably higher than the divergence (1.08%) noted in Crossaster pappossus (Fig 4B), a related species with a similar mode of dispersal (Lambert 2000). The Pacific lineage has typically been called S. endeca pacifica but it was elevated to Solaster pacifica by

Djakonov in 1950 (Mah 2009) although it is not recognized by some taxonomists

20 (Lambert 2000). A similar geographic split was observed in the unidentified Solaster species, though a species-level identification and increased sample size are needed before further interpretation. The 3% divergence between amphiboreal populations of Pteraster militaris (Fig 4C) suggests gene flow is limited between allopatric trans-arctic lineages of this species. This level of divergence may be consistent with population isolation shortly after the trans-Arctic exchange, assuming a low rate of mitochondrial evolution (~1% per

Ma) in this group. Northwest Atlantic populations of P. militaris employ a unique form of reproduction in which females brood some young and broadcast others (McClary and

Mladenov 1989). Considering that high levels of population structure have been observed over tens of kilometres in marine species with low levels of dispersal (Palumbi 1992), the divergence observed in the Pacific representatives of P. militaris may represent cryptic speciation if dispersal is limited or reproductive isolation has evolved. Additional sampling and life history information is required to explain the divergence between

Arctic and Atlantic populations of Gorgonocephalus arcticus.

Intraspecific divergence in sympatry

Four of the five remaining species with intraspecific divergence values >2% have relatively narrow geographic sampling, while one (Ophiopholis aculeata) was collected from Arctic and Atlantic waters. Leptosynapta clarki, a small brooding sea cucumber collected in the NE Pacific, had a maximum intraspecific divergence of 3.07%, due to an outlier that may actually represent L. transgressor, the other Leptosynapta species in this region. These closely related species are very difficult to distinguish morphologically and they have sometimes been treated as synonyms (Lambert 1997, Sewell et al. 1995). If this

21 sequence represents L. transgressor, it would suggest that the two species are genetically distinct. Alternatively, this sequence could represent a previously undocumented cryptic species in this region. Ophiosphalma jolliense and Ophiopholis sp. EAC01 exhibit low levels of population structure, however depth, sample location and dispersal potential do not appear to explain the observed levels of divergence. For Lophaster furcilliger clusters appear to be associated with differences in depth: cluster A represents samples collected from depths between 1200-2000m; cluster B, < 200m and cluster C, ~500m (Figure 6).

When data from other Lophaster species are included (data unpublished), cluster A includes representatives of an unidentified Lophaster sp. from deep waters (500-1000m) off of New Zealand. The bipolar distribution of cluster A suggests that gene flow may be facilitated by lecithotrophic larvae capable of traveling between the northern and southern hemispheres via deep-water currents (C. Mah pers. comm.). It also suggests that depth may present a barrier to gene flow between shallow and deep-water populations of

L. furcilliger in the northeast Pacific. In contrast, Ophiopholis aculeata was relatively well sampled across the Arctic and Atlantic (n=28), but no clear population structure was observed. Larger sample sizes with broader geographic sampling and examination of additional characters are needed to explain the higher levels of intraspecific variation observed in these species.

Patterns of divergence in a species-rich genus

The genus Henricia represents a model case of cryptic diversity between closely related species where subtle morphological differences between species and a tendency to hybridize have made species-level identifications exceedingly difficult (Clark and

22 Downey 1992, Lambert and Austin 2007, Mortensen 1977). The genus Henricia possesses reproductive modes ranging from brood-protection to pelagic lecithotrophy

(Lambert 2000, Mercier and Hamel 2008, Strathmann 1987) however, challenges with species identification have made it difficult to link developmental modes with specific species. The amphi-boreal distributions of Henricia cf. oculata and H. sp. EAC06 suggest that these species may possess pelagic larvae but does not rule out benthic development.

Sponer and Roy (2002) have suggested that rafting by adults may facilitate gene flow between distant brooding ophiuroid populations. A phylogenetic study combining traditional morphological methods with mitochondrial sequence data (COI and 16S) is underway to assess levels of diversity in this genus (Eernisse et al. 2010). Preliminary results suggest that there are over 100 species of Henricia with anti-tropical distributions and high levels of diversity in co-occurring endemics in the NE Pacific (M. Strathmann and D. Eernisse pers. comm.). In this case, the use of molecular techniques, such as DNA barcoding, is critical to determine the relationships between populations and species.

Effects of distribution on interpretation of barcode data

Early DNA barcode studies were criticized (Meyer and Paulay 2005, Moritz and

Cicero 2004) for underestimating intraspecific divergence due to incomplete or restricted geographic sampling. This is a significant issue in the marine environment where many taxa have large effective population sizes and extensive geographic ranges that may lead to high intraspecific variation (Barber and Boyce 2006). It is generally believed that species with highly dispersive larvae have more gene flow and less genetic structure over large spatial scales. However, selection, behaviour and geographic distance between

23 populations, may contribute to genetic structure in such species (Palumbi 1992, 1994).

Furthermore, molecular data has shown that many cosmopolitan species are actually cryptic species complexes (Carr 2010, Graves 1998, Knowlton 2000, Meyer et al. 2005,

Sponer and Roy 2002).

Three general patterns of geographic distribution (Table 3) in widespread species were observed in the present study, indicating that small sample sizes provide an adequate representation of intraspecific variation for some species, whereas extensive sampling across the range is necessary for others. For example, the closely related circumboreal species, Strongylocentrotus droebachiensis and S.pallidus, have very low levels of intraspecific divergence (max. <0.50%, mean < 0.2%), a result consistent with previous findings (Palumbi and Kessing 1991, Palumbi and Wilson 1990). All of the species with no obvious population structure between oceans {Ctenodiscus crispatus,

Cucumaria frondosa, Florometra serratissima, Ophiura sarsii, Psolus fabricii, Psolus phantapus) are characterized by planktonic larval stages capable of long-range dispersal, except the three Henricia species (H. cf. oculata, H sp. EAC03, H. sp. EAC06) and

Ophiuroid sp. EAC01, for which larval development is unknown. Two species,

Crossasterpapposus (see Fig. 4B) and Leptasterias littoralis, exhibited low levels of divergence (<2%) between populations in different oceans. As discussed in the previous section, the four species with maximum intraspecific divergence above 2% have population structure associated with distance and warrant further work to determine the full influence of barriers to gene flow and geographic distribution on their taxonomic status. It is also possible that the geographic structure in these species is emphasized by the lack of continuous geographic sampling between allopatric populations, particularly

24 across the Arctic. These results confirm the importance of comprehensive sampling for accurate estimation of intraspecific divergence, especially in marine species with low dispersal potential.

Maximum levels of intraspecific divergence ranging from 0.31-3.0% were observed for species with distributions spanning the Bering Strait. Although these values are relatively low when compared to other marine taxa that share a common geological history (e.g., polychaetes, Carr 2010; halibut, Mytilus, reviewed in Palumbi and Kessing

1991), the 10-fold difference is considerable. In addition to larval development and dispersal capacity, variation in factors such as thermal tolerance and rates of divergence may also explain differences in intraspecific divergence. Pelagic larvae capable of withstanding very low sea temperatures (e.g., Strongylocentrotus droebachiensis) tend to have prolonged development times and as a result can disperse across the Arctic despite the harsh conditions (Palumbi and Kessing 1991). Taxonomically-biased eradication of

Arctic populations during glacial periods, followed by re-colonization of Pacific migrants during the Pleistocene could also produce relatively low levels of divergence, though secondary contact with relict populations that survived in glacial refugia would likely produce opposite results.

Future work

The varied patterns of divergence observed in trans-oceanic species in the present study demonstrate the need for increased taxonomic and geographic coverage. Extensive circumpolar sampling would improve the accuracy of divergence estimates and species- specific biogeographic hypotheses. Although this study was able to highlight species with

25 limited gene flow across the Bering Strait, it did not uncover any sister species pairs that arose following the Pliocene interchange and have maintained geographic and genetic isolation to the present day. Patterns of genetic diversity for Arctic marine invertebrate species are likely to be altered as changes in the regional climate modify hydrography and circulation patterns and reduce Arctic ice cover. The first appearance of a Pacific diatom in the northwest Atlantic in over 800,000 years provides evidence for these changes, and leads to predictions of increased trans-Arctic migrations over the next 100 years (Reidetal. 2007).

The development of a DNA barcoding protocol that allows the identification of any echinoderm species demands development of universal primers. Although COI primers exist for echinoderms, many have been designed for specific taxonomic groups and are seldom useful across classes. This study has expanded on the primer sets used by

Ward et al. (2008), but more work is needed to streamline protocols for high-throughput

DNA barcoding. The holothurian primer set (COIeF/COIeR, Arndt et al. 1996) targets a

652bp amplicon 189bp further towards the 3' end of the COI gene than other primer sets used in this study (Table 1). Development of new primers that amplify a more similar region of COI (nucleotide positions 48 -705) would strengthen these comparisons, and provide opportunities to design primer cocktails for the whole phylum. Progress is being made with echinoderm barcoding, but there remain species that fail to amplify with existing primers, emphasizing the need for further primer design.

26 CONCLUSION:

The present study has affirmed that DNA barcoding is a valuable tool for species identification in the Echinodermata and has made an important first step towards cataloguing the diversity of echinoderms in Canada's coastal waters by gathering barcode records for one-third of the species known in this region. Additional sampling efforts in the Arctic and deep-sea are needed to improve species coverage. Almost half of Canada's echinoderm species are found at depths greater than 200m, and approximately 30% of those inhabit depths greater than 1500m (Lambert and Austin 2007).

Although broad geographic distributions and life history characteristics may influence levels of divergence within and between species, 98.2% of intraspecific sequence divergence estimates were <2% while only 0.07% of interspecific comparisons were <2%. This result indicates the regular presence of a barcode gap between maximum intraspecific distance and minimum interspecific distance in Canadian echinoderms.

Comprehensive sampling for marine species is recommended along with the use of flexible thresholds for flagging putative cryptic species. A fixed threshold approach is unlikely to accurately delineate closely related sibling species while accommodating situations where species have high levels of intraspecific divergence over broad distributions. Continued expansion of the echinoderm sequence database on BOLD will greatly enhance the application of DNA barcoding as an identification tool in a range of ecological, systematic and biodiversity studies in the marine environment.

27 Table 1: Primer combinations, associated amplicon lengths and location of amplicon in COI gene of the Strongylocentrotus purpuratus mitochondrial genome. Primer references correspond to forward and reverse primers, respectively.

Location Location in Primer Primer sequence Length of in COI mitochondrial combination (5' to 3') amplicon gene (5') genome Reference EchinoFl TTTCAACTAATCATAAGGACATTGG Ward et al. 2008; 841 bp 48 to 888 5832 to 6673 COIeRl GCTCGTGTRTCTACRTCCAT Arndtetal. 1996 EchinoF 1 TTTCAACTAATCATAAGGACATTGG Ward et al. 2008; 658 bp 48 to 705 5832 to 6490 HCQ2198 TAAACTTCAGGGTGACCAAAAAATCA Folmeretal. 1994 LCOechlaFl TTTTTTCTACTAAACACAAGGATATTGG Present study; 658 bp HC02198 TAAACTTCAGGGTGACCAAAAAATCA 48 to 705 5832 to 6490 Folmeretal. 1994

COIeFl ATAATGATAGGAGGRTTTGG 652 bp 237 to 888 6021 to 6673 Arndt et al. 1996 COIeRl GCTCGTGTRTCTACRTCCAT

28 Table 2: Echinoderm species with maximum intraspecific divergences >2%. Bootstrap values for provisional species clusters are shown. Species with two or more clusters associated with geographic differences are indicated with an asterisk (*). Dashes (-) represent single records for which bootstrap values could not be calculated. For species lacking distinct clusters with high bootstrap support, bootstrap values are not reported (n/a).

Mean Maximum Sample intraspecific intraspecific Species size distance (%) distance (%) Bootstrap Gorgonocephalus arcticus* 9 1.13 2.36 93/99 Leptosynapta clarki 10 0.63 3.07 -/100 Lophaster furcilliger 9 1.49 2.49 64 / 97 /100 2 Ophiopholis aculeata 28 0.90 2.18 n/a Ophiopholis sp. EAC01 5 2.26 3.45 n/a Ophiosphalma jolliense 5 1.27 2.18 99/99 Pteraster militarist 8 1.67 3.00 - / 97 / 99 ' Solaster endeca* 8 0.87 2.18 93 / 99 ' Solaster sp. EAC01* 3 1.87 2.82 -/100

1 Species trees, including bootstrap values and collection locations can be viewed in Figure 5 and 2 Figure 6.

29 Table 3: Echinoderm species sampled from at least two of Canada's three oceans. Group A: species with maximum intraspecific divergences > 2% and geographic population structure; Group B: species with maximum intraspecific divergences < 2% and geographic population structure and Group C: species with maximum intraspecific divergences < 2% and no obvious geographic population structure. Pac = Pacific Ocean, Arc = Arctic Ocean, Atl = Atlantic Ocean

Mean Maximum Sample Size intraspecific intraspecific Species Pac / Arc / Atl divergence (%) divergence (%) Gorgonocephalus arcticus 0/3/6 1.13 2.36 Pteraster militaris 3/0/5 1.67 3.00 A Solaster endeca 2/1/5 0.87 2.18 Solaster sp. EAC01 2/ 1/0 1.87 2.82

Crossaster papposus ' 9/4/5 0.47 1.08 B Leptasterias littoralis 0/16/11 0.62 1.84

Ctenodiscus crispatus 10/3/0 0.20 0.62 Cucumaria frondosa 0/9/8 0.41 0.89 Florometra serratissima 9/1/0 0.31 0.81 Henricia cf. oculata 3/0/4 0.68 1.26 Henricia sp. EAC03 0/1/6 0.35 0.77 Henricia sp. EAC06 2/1/13 0.62 1.55 C Ophiura sarsii 3/0/1 0.49 0.93 Ophiuroid sp. EAC01 0/24/3 0.10 0.32 P solus fabricii 0/12/6 0.11 0.62 Psolus phantapus 0/5/2 0.38 0.80 Strongylocentrotus droebachiensis 7/0/7 0.17 0.41 Strongylocentrotus pallidus 1/16/3 0.04 0.31

' Species tree, including bootstrap values and collection locations can be viewed in Figure 5.

30 ~H ARCTIC £\ OCEAN &f

X. tCHO„c~ %&m4^^m,#^«i^^ tlfe,

AriANrzc > OCEAN X ~ Ox it Torngat Mountains iSPR, JVJL =15 X-/ xNr rA «f/lurc/i/J/, V/B

T> . „»„,„ & Queen Charlotte Sound, BC PACIFIC iSp = si ^T-S OCEAN '•? CJJ A » /" . . D/^ H°Wt SOUntl> BC V Bamfield, BC # 0 n = 44 /f\ yfffft. Andrews, NB

Figure 1: Map of Canada indicating approximate collection locations and sample sizes. Proportions of fresh (open) and preserved (shaded) tissues are indicated by pie charts for each collection. *Samples from the RBCM were collected from various locations along the coast of British Columbia. **Samples collected through CHONe were from various locations in the Beaufort and Labrador Seas and Baffin Bay.

31 Figure 2: Neighbour-joining trees based on K2P distances for A) Class Asteroidea (71 species, n = 415); B) Class Echinoidea (10 species, n = 73), C) Class Holothuroidea (20 species, n = 117) and D) Class Ophiuroidea (30 species, n = 194). All species are monophyletic with bootstrap values >99% except for Henricia sanguinolenta (97%). The MEGA Tree Explorer function was used to compress terminal branches for each monophyletic group and replace them with a triangular graphical vector (width represents variation within the compressed sequences; height represents sample size). Clusters representing potentially new species have been highlighted; Solaster sp. EAC01 (in A) and Strongylocentrotus sp. EAC01 (in B).

32 1 Leptasterias polaris (n=33)

—^ Leptasterias hexactis (n=15)

M Leptasterias littoralis (n=27)

4 Evasterias troscheli (n=8) i Pycnopodia helianthoides (n=6) 4 Asterias forbesi (n=10) 1 Asterias rubens (n=11) 4 Orthasterias koehleri (n=6) 1 Stephanasterias albula (n=2) « Pisaster brevispinus (n=2)

i Pisaster ochraceus (n=14)

I Stylasterias forreri (n=9) A Luidia foliata (n=12) i Psilaster pectinatus (n=5) Astropectinidae (n=1) Thrissacanthias pencillatus (n=1) I « Henricia sanguinolenta (n=2) Henricia sp. EAC08 (n=1) < Henricia sp. X EAC (n=2) Henricia sp. EAC07 (n=1) Henricia sp. I EAC (n=1) c Henricia sp. EAC01 (n=2) .Henricia sp. EAC02 (n=2) ^ Henricia cf. oculata (n=7) « Henricia sp. IX EAC (n=2)

A Henricia sp. EAC06 (n=16)

Henricia sp. EAC05 (n=1)

4 Henricia sp. EAC03 (n=7)

Henricia sp. EAC04 (n=24)

I ( Sagenasterevermanni (n=6) 1 \ Zoroaster ophiurus (n=6) —4 Dermasterias imbricata (n=7)

.. .continued on next page

33 A) continued from previous page.

LI — Mediasteraequalis (n=16)

-»Ceramaster patagonicus (n=4) —« Ceramaster cf. arcticus (n=2) -^ Asterina rriniata (n=5) tf Lophasterfurcilliger (n=9) « Solaster sp. EAC01 (n=3) -4 Solasterdawsoni (n=5) —4 Solaster paxillatus (n=7) Crossaster borealis (n=1) Heterzonias altematus (n=1) < Solaster stimpsoni (n=5) -^ Solaster endeca (n=8)

M Crossaster papposus (n=18)

-^^ Pteraster militaris (n=8) i Pteraster jordani (n=3) Pteraster coscinopeplus (n=1) Diplopteraster multipes (n=1) — Pteraster sp. EAC01 (n=1) - Pteraster sp. EAC02 (n=2) —i Pteraster tesselatus (n=2) Pedicellaster magister (n=2) i Ampheraster marianus (n=2) 1 E remicaster pacificus (n=4) Asteroidea (n=1) Freyellasterfecundus (n=1) Hymenodiscus pannychia (n=1) -^ Benthopecten acanthonotus (n=6) —< Benthopecten claviger (n=3) Nearchaster aciculosis (n=1) 4 Pectinaster agassizi (n=3) -4 Pontaster tenuispinus (n=4) Hippasteria califomica (n=4) —4 Pseudarchaster parelii alascensis (n=7) Pseudarchaster parelii (n=1) -^ Pseudarchaster dissonus (n=6) Dipsacaster borealis (n=1) Leptychaster anomalus (n=1) —. Leptychaster pacificus (n=2)

0.02 -i Ctenodiscus crispatus (n=13)

34 B) Strongylocentrotus pallidus (n=20)

Strongylocentrotus sp. EAC01 (n=2) Strongylocentrotus droebachiensis (n=14) —i Strongylocentrotus fragilis (n=5) -i Strongylocentrotus purpuratus (n=5) 1 Strongylocentrotus franciscanus (n=10) H Brisaster latifrons (n=6) —^ Dendraster excentricus (n=5) 1 Echinarachnius parma (n=5) —— Sperosoma biseriatum (n=1)

I 1 0.01

C) Cucumaria frondosa (n=17)

-+ Cucumaria pallida (n=3) -^ Cucumaria niniata (n=7) —i Cucumaria cf. lubrica (n=2) 4 Thynidium drummondii (n=5) H Psolus chitonoides (n=4) \ Psolus phantapus (n=7)

Psolus fabricii (n=18)

Cucumariidae (n=1) — Pannychia moseleyi (n=1) -i Pentamera pseudocalcigera (n=4) H Pentamera cf. pediparva (n=2) —4 Eupentacta quinquesemita (n=4) ( Pentamera calcigera (n=8) —I Parastichopus califomicus (n=5) H Pseudostichopus mollis (n=2) 1 Pseudostichopus tuberosus (n=2) -4 Molpadia intermedia (n=10) Chiridota laevis (n=5) <^ Leptosynapta clarki (n=10)

0.05

35 Ophiuroid sp. EAC01 (n=27)

-< Ophiocten hastatum (n=4)

Ophiocten sericeum (n=21)

Ophiura luetkenii (n=6) i Amphiophiura superba (n=4) Stegophiura carinata (n=1) H Ophiuroid sp. EAC02 (n=5) -4 Ophiura sarsii (n=4) -4 Ophiura sp. EAC01 (n=6) -^ Ophiopleura borealis (n=8) Ophiomusium lymani (n=1) | Ophiosphalma jolliense (n=5) -— Ophiomusium glabrum (n=2) Asteroschema sublaeve (n=1) . Ophioscolex corynetes (n=2) -^ Asteronyx loveni (n=6) -4 Gorgonocephalus eucnemis (n=4) Gorgonocephalus arcticus (n=9) \ Amphiodia cf. occidentals (n=6) >* Amphiodia cf. urtica (n=3) -^ Amphipholis sp. EAC02 (n=6) i Amphipholis sp. EAC01 (n=2) 1 Amphipholis squamata (n=5) -4 Ophiopholis kennerlyi (n=9) -^Ophiopholis sp. EAC01 (n=5) —< Ophiopholis japonica (n=2)

-M Ophiopholus aculeata (n=28)

-+ Ophiophthalmus norma ni (n=3) — Ophiophthalmus cataleimmoidus (n=1) 4 Ophiacantha bidentata (n=8)

0.05

36 100

90 -I

30 -

20 -

0 +" —jJLj-BUpJU1„QI_o.1_iJ^LLIJLLIJ_1JU1J^ r 12 3 4 5 6 7 8 9 10 1112 13 14 15 16 1718 19 20 2122 23 24 25 26 27 Distance (%)

Figure 3: Frequency distributions for 4577 pairwise intraspecific (solid bars) and 6999 pairwise interspecific comparisons (open bars) for echinoderm species from the Pacific, Arctic and Atlantic coastal waters of Canada. Divergence estimates are based on the Kimura 2-parameter distance model.

37 Figure 4: Neighbour-joining tree for 13 putative species in the genus Henricia (Family Echinasteridae) with collection locations indicated as follows: Pacific in bold, Atlantic in regular font and Arctic indicated by an asterisk (*).

100 r DSPEC618-08|Henricia sp. EAC01 ^l DSPEC615-08|Henricia sp. EAC01 DSPEC617-08|Henricia sp. EAC02

39 A. Solaster endeca Maximum divergence between Arctic-Atlantic and Pacific clusters is 2.18% (mean = 0.87%).

.LABBI091-09 1ECNN026-08 Arctic- Atlantic DSPEC105-07 93 1 DSPEC091-07 DSPEC104-07 100 iDb^t^uy^-u/ DSPEC638-08 Pacific 9

B. Crossaster papposus Maximum divergence between Arctic-Atlantic and Pacific clusters is 1.08% (mean = 0.47%).

LABBI094-09 ECNN1 1 1-08 DSPEC106-07 DSPEC107-07 Arctic- Atlantic - ECCH024-09 ECNN002-08 ECNN018-08 DSPEC108-07 DSPEC109-07 DSPEC612-08 DSPEC609-08 EQCS024-08 DSPEC608-08 Pacific EQCS02Q-08 DSPEC613-08 DSPEC611-08 EQCS023-08 DSPEC610-08

40 C. Pteraster militaris Maximum divergence between Atlantic and Pacific clusters is 3.00% (mean = 1.67%).

DSPEC733-08 -DSPEC716-08 DSPEC098-07 Atlantic - DSPEC075-07 DSPEC811-09 -DSPEC622-08 EQCS067-08 r Pacific '97~L DSPEC623-08

Figure 5: Sampling distribution maps and K2P neighbour-joining trees illustrating shallow genetic divergences associated with spatial population structure in presumed species over broad geographic ranges: A) Solaster endeca; B) Crossaster papposus and C) Pteraster militaris.

41 DSPEC302-08 a) RD SPEC303-08 DSPEC300-08 A: 1235-1986m K SPEC301-08 DSPEC011-07 100 EQCS048-08 B: < 200m IEQCS035-08

DSPEC299-08 L_r C: 538m 100IDSPEC298-08 TOO I

0.02

.NZEC697-09|Lophaster sp. lNZEC698-09|Lophaster sp. b) NZEC69609|Lophaster sp.

D5PEC302-081Lophaster furciNiger

64 DSPEC303-08|Lophasterfurcilliger NZEC717-09|Lophaster sp. ^ NZEC701-09|Lophaster sp. DSPEC300-08|Lophaster furci Niger

SPEC301-08|Lophaster furcilliger DSPEC01 1-07|Lophaster furcilliger

99 EQCS048-08|Lophaster furcilliger B 97 I EQCS03 5-08|Lophaster furcilliger

DSPEC299-08| Loph aster furcilliger C 499 I DSPEC298-08|Lophaster furcilliger 99 I

0.05

Figure 6: Sampling distribution for Canadian samples of Lophaster furcilliger and a) an excerpt of the asteroid COI K2P neighbour- joining tree with depth range indicated for each cluster (A-C). b) COI K2P neighbour-joining tree showing relationship between northeastern Pacific Lophaster and New Zealand representatives (in bold) (unpublished data courtesy of P. Smith at the National Institute of Water and Atmospheric Research (NIWA)).

42 CHAPTER 2: Patterns of molecular evolution in the COI gene in the Echinodermata

ABSTRACT:

Echinoderms, like many marine invertebrate groups, have evolved a diversity of reproductive modes, ranging from taxa with highly dispersive planktotrophic larvae to those with maternal brood-protection. Developmental mode is often associated with factors affecting rates of molecular evolution, such as adult body size and effective population size, but few studies have explored the association between developmental mode and rates of molecular evolution. In this study, six phylogenetically independent comparisons between species with contrasting modes of larval development are used to test for an association between mode of larval development and rates of molecular evolution in the cytochrome c oxidase subunit 1 (COI) gene. Results indicate that species with nonpelagic larval development have accelerated rates of molecular evolution when compared to closely related species with pelagic larval development. Limitations of the dataset made it difficult to explore the factors responsible for the observed trend, but possible explanations are discussed along with suggestions for future work.

43 INTRODUCTION:

Variation in rates of molecular evolution has been well documented across genes

and genomes (Vawter and Brown 1986) and among divergent (Britten 1986, Martin and

Palumbi 1993) and closely related taxa (Bromham 2002, Nunn and Stanley 1998,

Thomas et al. 2006. This heterogeneity arises either due to differences in mutation rate

and/or the action of genetic drift and selection on the fixation of variation (see Mindell

and Thacker 1996). Variation in mutation rate may reflect exposure to mutagens

(deWaard et al. unpublished, Hebert et al. 2002, Lutzoni and Pagel 1997, Martin and

Palumbi 1993), generation time differences (Kohne 1970, Wu and Li 1985) or differences

in replication rate and DNA repair efficiency (Britten 1986). Differences in functional or

structural constraints, selective regime and population size (Ohta 1992) largely determine

the rate of fixation of newly introduced variation. Much debate surrounds the

contribution of life history traits to variation in rates of molecular evolution. For example,

diversity in generation time and body size was invoked to explain variation in rates of

molecular evolution in birds (Mooers and Harvey 1994, Nunn and Stanley 1998),

mammals (Bromham et al. 1996) and reptiles (Bromham 2002). Other studies suggested

differences in metabolic rate and body size best explained rates of nucleotide substitution

in vertebrates (Gillooly et al. 2005, Martin and Palumbi 1993), but recent studies that accounted for phylogenetic bias found no metabolic rate effect (Lanfear et al. 2007).

Thomas et al. (2006) investigated the association between body size and rate variation in invertebrates and found no evidence that rate scaled with body size, as in vertebrates.

Many of these life history variables are highly correlated with one another (e.g.,

44 metabolic rate, generation time and body size), making underlying causes difficult to isolate.

While differences in generation time and metabolic rate largely affect rates of mutation, population size has been hotly debated for its effect on rates of substitution through the differential action of selection and genetic drift. According to the nearly neutral theory (Ohta 1973,1992), higher rates of substitution are expected in smaller populations due to the increased exposure of slightly deleterious mutations to genetic drift. However, Bazin et al. (2006) argued that rates of substitution in mitochondrial DNA are independent of population size. Selection for advantageous mutations in large populations may sweep linked neutral mutations to fixation, thereby decreasing genetic variation and eliminating the effect of population size on substitution rates (genetic draft hypothesis Gillespie 2001). Several subsequent studies have refuted this conclusion

(Nabholz et al. 2008, Piganeau and Eyre-Walker 2009) suggesting that lineage-specific rates of mutation are a more likely explanation.

Studies investigating variation in evolutionary rates have largely focused on vertebrates, likely due to the limited life history and sequence data for a broad range of invertebrates. However, heterogeneity in rates of molecular evolution has been observed in echinoderms (Smith et al. 1992, Lockhart 2006), crustaceans (Hebert et al. 2002), diatoms (Kooistra and Medlin 1996), foraminiferans (Pawlowski et al. 1997) and other invertebrates (deWaard et al. 2010, Thomas et al. 2006). Factors such as exposure to ultraviolet radiation (deWaard et al. 2010) and environmental salinity (Hebert et al. 2002) have been proposed as explanations for variation in select groups. In the marine environment, life history traits such as reproductive mode are highly variable among

45 species and have the potential to affect evolutionary rates (Jablonski and Lutz 1983,

Pechenik 1999). For example, developmental mode has been associated with factors affecting rates of molecular evolution, such as body size (Jablonski and Lutz 1983,

Strathmann and Strathmann 1982) and effective population size (Foltz 2003, Foltz et al.

2004, Foltz and Mah 2009, Kyle and Boulding 2000), as well as dispersal capacity and resulting patterns of genetic population structure (Bohonok 1999, Palumbi 1992 and references therein). Lower effective population size in nonpelagic lineages has been proposed to explain higher rates of nonsynonymous substitution in echinoderms and gastropods (Foltz 2003, Foltz et al. 2004 and Foltz and Mah 2009).

In common with other groups of benthic marine invertebrates, echinoderms have evolved diverse forms of larval development. Pelagic feeding (planktotrophic) larvae are thought to represent the ancestral condition (Strathmann 1985, Smith 1997), but nonpelagic larval forms have evolved on multiple occasions across the five classes of echinoderms. A variety of classification systems exist for marine invertebrate larvae

(Jablonski and Lutz 1983, McEdward and Miner 2001, reviewed in Levin and Bridges

1995), but I recognize four modes of larval development in this study: planktotrophic, pelagic lecithotrophic (non-feeding), benthic lecithotrophic (egg masses) and nonpelagic lecithotrophy (maternal brood-protection). Non-feeding larvae obtain their nutritional requirements from lipid reserves in the egg or in some cases directly from the parent

(McClary and Mladenov 1990, reviewed in Gillespie and McClintock 2007), and are often associated with reduced development time and shorter planktonic duration (Emlet

1995, Villinksi et al. 2002). Mode of larval development is generally associated with egg size, body size, pelagic duration, dispersal capacity and genetic population structure (Fig.

46 1), and has even been linked to rates of speciation and extinction in echinoids (Jeffrey and Emlet 2003). For example, egg size is often used to infer larval development (Jeffrey and Emlet 2003, Poulin and Feral 1996) as small eggs (80-200u.m) typically develop into small planktotrophic larvae and large yolky eggs (400-1500|xm) usually give rise to lecithotrophic and/or nonpelagic larvae (Miller 2001). Taxa with smaller adult body size tend to have nonpelagic development, while those with larger adult body size often have pelagic development (Strathmann and Strathmann 1982). Although general trends in egg size, adult body size and larval development are often cited, exceptions have been reported (Miller 2001, Strathmann and Strathmann 1982). The association between pelagic larval duration (PLD) and larval development is less certain due to the variety of environmental factors, such as availability of nutrition or suitable settlements sites, that can impact PLD. Dispersal is also highly dependent on the strength and direction of ocean currents which may act as invisible geographic barriers to gene flow in species with high dispersal potential, or may facilitate gene flow between distant populations of species with low dispersal potential (reviewed in Palumbi 1994).

The present study tests for an association between developmental mode and rates of molecular evolution in the cytochrome c oxidase subunit I (COI) gene of echinoderms.

Specifically, I test the null hypothesis that there is no significant difference between rates of molecular evolution in species with lower dispersal ability (e.g., brood-protecting with no free larval stage) and those with high dispersal ability, (e.g., broadcast spawners with planktotrophic larvae). To test this hypothesis, phylogenetic independent comparisons were used to compare rates of nucleotide substitution between closely related taxa with differing developmental modes. The potential for differing selective pressures in

47 nonpelagic and pelagic lineages was investigated by testing for selective neutrality by comparing the ratios of nonsynonymous to synonymous substitution rates (dN/dS). When coupled with estimates of nucleotide diversity, dN/dS ratios can also be used to indirectly infer population size and its potential effect on rates of substitution.

METHODS:

Taxon choice, developmental mode and independent comparisons:

Phylogenetically independent comparisons (PICs) (Felsenstein 1985; Pagel 1992) between taxa with differing modes of larval development were chosen using published phylogenies, studies on reproductive mode and current taxonomy (Table 1). When published phylogenies were unavailable, ingroup selection was based on taxonomy, allowing for at most one comparison per genus. This approach assumes that existing taxonomy accurately represents phylogenetic relationships and that all pairs of lineages are monophyletic with respect to all other pairs (Lanfear et al. 2007). In an attempt to maximize the contrast in developmental mode, comparisons maximizing larval duration and dispersal potential were chosen (e.g., planktotrophic versus brood-protection).

Comparisons consisted of one ingroup taxon with low dispersal nonpelagic larvae (e.g., brooder or benthic lecithotroph), and one ingroup taxon with high dispersal pelagic larvae

(e.g., pelagic lecithotroph or pelagic planktotroph); hereafter referred to as the nonpelagic

(NP) and pelagic (P) ingroup taxa, respectively. One closely related outgroup taxon, which shares the least-derived developmental mode represented in each comparison was chosen based on available phylogenies. For comparisons two and five, more than one outgroup was used to produce a tree in which the ingroup taxa appear as sister taxa.

48 Despite limited molecular data, developmental, taxonomic and phylogenetic information, six independent comparisons, including representatives from three echinoderm classes, were examined. The limited availability of suitable data made it difficult to correct for confounding factors associated with differences in evolutionary rate, such as metabolic rate and generation time, though for two comparisons (Asteridae and Psolus), the effect of body size was reduced by comparing species with similar maximum adult body size.

Sequence acquisition:

Partial cytochrome c oxidase subunit I (COI) sequences were acquired from

GenBank and the Barcode of Life Data Systems (BOLD; Ratnasingham and Hebert

2007) (Table 1). Sequences were aligned using ClustalW in MEGA version 4.0 (Tamura et al. 2007) and trimmed such that sequences were of similar length within each comparison. All alignments were verified by examining amino acid translations using the echinoderm mitochondrial genetic code (Himeno et al 1987).

Nucleotide diversity:

For four comparisons where each species was represented by two or more individuals in BOLD (Appendix 4), estimates of nucleotide diversity (JC) at synonymous and nonsynonymous sites, as well as across all sites, were calculated for available COI sequences (Table 2) using DnaSP 5.0 (Librado and Rozas 2009). Eight species were included in this analysis. COI sequences were chosen to reflect similar geographic coverage for each species pair to avoid spatial effects on nucleotide diversity. Positions

49 with ambiguous nucleotides or gaps were not considered (complete deletion option) in the analysis as required by the programming input.

Relative rate tests:

Branch lengths, representing rates of nucleotide substitution, were estimated for the pelagic and nonpelagic ingroups using relative rate tests (RRTs) (Sarich and Wilson

1973) which were performed using the two-cluster method of Takezaki et al. (1995) as implemented in Phyltest (Kumar 1996). Genetic distances were estimated using the

Kimura 2-parameter (K2P) (Kimura 1980) method with pairwise deletion of missing nucleotides. The significance of the test statistic was compared to a two-tailed normal (Z) distribution.

Tests for lineage-specific selection:

Nonsynonymous / synonymous (dN/dS) rate ratios (reviewed in Yang and

Bielewski 2000) were calculated for nonpelagic and pelagic lineages to test for a departure from neutral molecular evolution in either lineage. The dN/dS ratio or omega

(co) is estimated by calculating the rate of nonsynonymous (dN) and synonymous substitutions (dS) per site between two sequences, or groups of sequences, and is a measure of natural selection acting on the gene. A value of co = 1 infers strict neutrality, where most amino acid substitutions are neutral and are fixed at the same rate as a synonymous mutation. Values of co > 1 suggest the occurrence of positive or adaptive selection in response to selectively advantageous substitutions, whereas values of co < 1 are consistent with purifying selection acting to reduce the rate of deleterious

50 substitutions. In addition to detecting selection, elevated dN/dS ratios may indicate recent reductions in effective population size due to bottlenecks or range restrictions as demonstrated by endosymbiotic bacteria (Woolfit and Bromham 2003) and island endemics (Woolfit and Bromham 2005), while depressed dN/dS ratios may result from rapid population growth such as that hypothesized for human populations (Merriwether et al. 1991).

Estimation of dN/dS ratios was performed using the CodeML program in the

PAML version 4a package (Yang 2007) as implemented by the online application

Phylemon. To test for potential differences in selective pressures on pelagic and nonpelagic lineages, two evolutionary models were applied to each dataset: a single- omega model that estimated one dN/dS ratio for all lineages in the dataset, and a two- omega model that allowed dN/dS ratios to vary between the foreground lineage

(nonpelagic) and background lineages (pelagic). A likelihood ratio test (LRT) with one degree of freedom was used to compare the fit of the two evolutionary models to each dataset. Tests were conducted using user-specified K2P neighbour-joining trees (NJ) created in MEGA 4.0 and Fequal and F3x4 codon models. The Fequal codon model assumes equal codon frequencies and is therefore the simplest and least parameterized model, whereas the F3x4 model accounts for codon usage bias using nucleotide frequencies at each codon position to calculate codon frequencies.

51 Meta-analysis:

Two-sided binomial and Wilcoxon signed-rank tests were carried out to determine the relationship between nonpelagic modes of larval development and 1) rates of molecular evolution and 2) rates of nonsynonymous substitutions. Analyses were conducted in R version 2.8.1 (R Development Core Team 2008) on In-transformed ratios of nonpelagic to pelagic (NP:P) estimates of branch lengths and dN/dS ratios.

RESULTS:

Nucleotide diversity:

Patterns of nucleotide diversity across all sites (jr) were inconsistent among the four comparisons analyzed (Table 2). For two of four comparisons, the pelagic lineages had higher nucleotide diversities while the other two comparisons showed higher nucleotide diversities in the nonpelagic lineages. In all cases, nucleotide diversity at synonymous sites was higher than that at nonsynonymous sites. Only two species,

Evasterias troschelii (pelagic lineage comparison 1) and Psolus antarcticus (nonpelagic lineage comparison 5) displayed nonsynonymous mutations.

Relative rate tests:

In all six comparisons the nonpelagic ingroup had longer branch lengths than the pelagic ingroup (mean NP:P ratio 1.35) indicating higher rates of nucleotide substitution in the former (Figure 2). For comparison 6, a significantly higher rate of evolution (1.6 times, p = 0.03), was observed for the nonpelagic lineage (Table 3). Results of the meta analysis on In-transformed NP:P ratios rejected the null hypothesis that elevated rates of

52 evolution are equally likely in both groups (one-sided binomial test p = 0.031; Wilcoxon test p = 0.031).

Lineage-specific selection:

All dN/dS ratios were < 1, suggesting that COI is either under purifying selection for the taxa surveyed or that all species have undergone recent demographic changes

(Table 4). Results from the LRTs indicate that the two-omega model did not fit the data significantly better than the single-omega model in 5 of 6 cases. Data for comparison #6

(Cucumaria) fit the two-omega model significantly better than the single omega model

(Fequal: 8.64, p = 0.003; F3x4: 5.09, p = 0.024), where a higher dN/dS ratio was assigned to the lineage with pelagic larvae. Higher dN/dS ratios were observed in the nonpelagic ingroup (Figure 3) for three of the six comparisons. A meta-analysis of all comparisons failed to reject the null hypothesis of equal dN/dS ratios for all branches in the tree

(single-omega model). This result was observed using both the Fequal (binomial test p =

1; Wilcoxon test p = 0.84) and F3x4 codon models (binomial test p = 1; Wilcoxon test p

= 0.56).

DISCUSSION:

Six independent comparisons between closely related species with different modes of larval development were examined to test the null hypothesis that the rate of molecular evolution is independent of developmental mode. Although only one comparison had a significantly higher rate in the nonpelagic lineage in individual tests, the trend for rate acceleration was consistent in all groups and significant when all

53 comparisons were considered in a meta-analysis. Elevated rates of molecular evolution in nonpelagic lineages may reflect a link between reproductive mode and factors that increase mutation rate, such as generation time and metabolic rate, or factors that increase rates of substitution, namely selective regime and population size.

Possible explanations for elevated rates in nonpelagic lineages:

Although most mitochondrial protein-coding genes are under strong purifying selection (Rand 2001), the relative strength of selection may vary among lineages due to relaxed selective constraints or changes in population size. The neutral theory predicts that smaller populations will have higher rates of molecular evolution because genetic drift acts to fix mutations more quickly in such taxa (Kimura 1979, Ohta 1992). Marine invertebrates with highly dispersive pelagic larvae typically have larger effective population sizes and higher haplotype diversity than those lacking planktonic development (Kyle and Boulding 2000). However, variability in reproductive success in broadcast spawners does affect the contribution of adults to subsequent generations

(Hedgecock et al. 2007, Lee and Boulding 2007). This type of sweepstakes recruitment can greatly reduce the effective population size of species with large census sizes thereby increasing the role of genetic drift in their evolution.

All taxa surveyed had dN/dS ratios < 1 (Figure 3) which is consistent with either strong purifying selection on COI or recent population expansion. Although demographic changes for each species could not be investigated, it is unlikely that all species surveyed have undergone dramatic population growth in recent history. It is therefore more likely that the depressed dN/dS ratios observed are due to purifying selection. Because patterns

54 of nucleotide diversity and dN/dS ratios were variable among the nonpelagic and pelagic lineages, no clear relationship was observed between the relative magnitude of lineage- specific dN/dS ratios and nucleotide diversity. These results differ from those of other studies where significantly higher dN/dS ratios were found in nonpelagic lineages of echinoderms for both nuclear (histone H3; Foltz and Mah 2009) and mitochondrial genes

(COI, cytb; Foltz 2003, Foltz et al. 2004). However these comparisons did not account for phylogenetic bias. In these studies, elevated rates of nonsynonymous substitutions and reduced nucleotide diversities led the authors to suggest that smaller effective population sizes in brooding lineages were likely responsible for the trend. It was not possible to assess the impact of population size on substitution rate for the species in this study because limited sample size made it difficult to adequately estimate nucleotide diversity and relative effective population size. To generate accurate estimates of nucleotide diversity and effective population size within species, increased sampling across spatial and temporal scales is necessary to account for fluctuations in recruitment from one generation to the next (Lee and Boulding 2009). The occurrence of selective sweeps

(Bazin et al. 2006) in species with large effective population size also warrants consideration in future analyses, although selective sweeps are unlikely to operate as a function of reproductive mode (Foltz et al. 2004).

The differences in rates of molecular evolution noted in this study may also arise due to higher mutation rates in nonpelagic lineages, a pattern consistent with the generation time and metabolic rate hypotheses. The generation time hypothesis proposes that organisms with shorter generation times have a greater number of DNA replication events per unit time and will therefore accumulate mutations more quickly than

55 organisms with long generation times (Kohne 1970). This hypothesis assumes that germ line cell divisions are relatively consistent among species. Strathmann (1985) suggested that brood-protection is typically associated with small body size, earlier sexual maturation, shorter life spans and shorter generation times. Unfortunately, little data exist for the species examined in this study, so it is unclear if these generalizations apply, and to what degree, if any, they influence mutation rates.

The metabolic rate hypothesis proposes that the elevated rates of DNA synthesis in species with high metabolic rates leads to increased exposure to oxygen free radicals produced during respiration (Martin and Palumbi 1993). This hypothesis has received mixed support, with most recent studies finding no indication of a relationship between rates of molecular evolution and metabolic rate in vertebrates (Lanfear et al. 2007). A single study comparing metabolic rates during larval development in echinoderm species with non-feeding and feeding larvae suggest that non-feeding larvae have higher metabolic rates than feeding larvae in similar thermal environments (Ginsburg and

Manahan 2009). A temperate species with feeding larvae had a metabolic rate approximately twice that of an Antarctic species with non-feeding larvae, though phylogenetic and other life history differences were not considered (Ginsburg and

Manahan 2009). These results suggest that thermal regime may affect metabolic rate in echinoderms, although the extent of this relationship and the effect of metabolic rate remains unclear. Comparisons in the current study targeted species from relatively similar environments where possible, however, in cases where differences arose (e.g., NE Pacific vs. Antarctic), species with nonpelagic larvae were typically associated with colder polar environments and were compared to temperate species with pelagic larvae. If thermal

56 regime and metabolic rate affect rates of molecular evolution, a reduction in perceived rate differences would be expected due to an elevation in mutation rate in the pelagic lineage.

Although the effects of generation time and metabolic rate are worth considering, there was no evidence for differences in mutation rate in the species examined. If rates of mutation differ among species with relatively similar population sizes, higher rates of fixation of both synonymous and nonsynonymous mutations would be expected. Limited nucleotide diversity data and the absence of nonsynonymous mutations in most species made it difficult to test for differences in mutation rate between lineages.

Study design:

An effort was made to choose the most appropriate phylogenetically independent comparisons possible, but limitations of the available data restricted the number of comparisons and taxonomic focus. The power of relative rate tests is sensitive to taxonomic sampling, the number of variable sites considered, sequence length, rate of substitution, distance between the ingroups and the outgroup and the degree of variation in rates of molecular evolution between the ingroup taxa (Bromham et al. 2000). In the case of taxonomic sampling, it has been shown that maximizing sample size while maintaining balanced sampling within ingroups improves the power of the test (Robinson et al. 1998). Limited phylogenetic information and variability in reproductive mode within genera restricted most comparisons in the present study to three-taxon datasets.

Some groups with diverse reproductive modes, such as the Asterinidae (Byrne 2006, Hart et al. 1997) have been studied extensively and as a result phylogenetic hypotheses and

57 details on reproductive modes are readily available. Yet with most groups, family- and genus-level phylogenies are lacking. Furthermore, although species-rich clades of brooders are relatively common in the Antarctic (Lockhart 2006, Pearse and Lockhart

2004), most species with nonpelagic development have arisen independently across groups, naturally limiting ingroup sample size for relative rate tests. Despite these phylogenetic limitations, closely related species were chosen in an effort to reduce the likelihood of Type II error (failure to detect a difference in rates when they exist) and to increase the chance of detecting smaller levels of rate variation (Bromham et al. 2000).

Closely related outgroups were chosen when possible to reduce the effect of substitution saturation on the branch leading to the outgroup, but in some cases (e.g. comparison 2 and 5) multiple outgroups were needed to resolve the sister taxa relationship between ingroups. It is also possible that uncertain phylogenetic relationships may have resulted in sub-optimal outgroup choices. Outgroup choice can have a large impact on the strength and direction of rate estimates especially for three-taxon relative rates tests (Fieldhouse et al. 1997). Lastly, the relatively simple K2P genetic distance model used in Phyltest may underestimate distances because it does not account for nucleotide bias and differences in rates of substitution between nucleotide sites.

Future work:

The present study suggests that an association exists between rates of molecular evolution and developmental mode in echinoderms. However, additional work is needed to determine the generality of this relationship and its underlying causes. Comprehensive taxon sampling and resolution of familial- and generic-level phylogenetic relationships is

58 needed to increase the number and quality of comparisons. Some groups to target include: forcipulate, pterasterid and echinasterid sea stars, apodid, psolid and dendrochirotid cucumbers, ophionereid ophiuroids and cidarid and schizasterid echinoids.

Though not an exhaustive list, these groups include numerous species with nonpelagic forms of larval development. Future attempts to determine the developmental modes of understudied groups, such as the ophiuroids, along with growing sequence databases will also expand the availability of comparisons. Using longer sequences (>1000bp) would increase the power of relative rate tests and facilitate the detection of smaller differences in rates of substitution (Bromham et al. 2000). In addition, extending the study to encompass other marine invertebrate taxa with diverse reproductive modes would illuminate the extent of this trend. The littorinid, conid and turritellid gastropods are good candidates for further investigation; phylogenetic hypotheses exist and larval development has been determined for many species (Conus, Duda and Palumbi 1999;

Turritellidae, Lieberman et al. 1993; Littorinidae, Reid 1990, Williams et al. 2003).

Determining the underlying causes of the association between elevated rates of molecular evolution and nonpelagic larval development may require consideration of other life history variables such as body size and metabolic rate.

CONCLUSION:

Phylogenetically independent comparisons across three of the five echinoderm classes were used to explore the relationship between developmental mode and rates of molecular evolution. Results indicated that species with nonpelagic larval development have accelerated rates of molecular evolution when compared to those with pelagic

59 development. Although explanations such as variation in effective population size, generation time, metabolic rate and body size were considered, limitations of this dataset made it difficult to determine the factors responsible for the observed rate variation.

Targeted sampling campaigns aimed at comprehensive spatial and temporal coverage for taxa with diverse reproductive modes would provide more accurate estimates of genetic diversity and rates of substitution. In addition, more detailed information on genus and species-level phylogenetic relationships and life history traits, such as larval development, generation time, body size and metabolic rate, would permit a more complete exploration of possible mechanisms of rate heterogeneity.

60 Table 1: List of phylogenetically independent comparisons for pelagic and nonpelagic lineages of echinoderms. Larval developmental mode and phylogenetic relationships were derived from the literature cited. OG = outgroups. Abbreviations for developmental mode are as follows: B - brooder; BL - benthic lecithotroph; PL - pelagic lecithotroph; Pt - pelagic planktotroph; Pt? - inferred planktotrophs based on egg size or post-larval characters.

Dev. Process ID or Comparison Species Name Mode GenBank No. References 1 Leptasterias polaris B ECNN140-08 Hamel and Family Mercier 1995, Asteriidae Evasterias troschelii Pt DSPEC490-08 McEdward and Miner 2001, Foltz OG: Pisaster ochraceus Pt DSPEC040-07 et al. 2007 2 Asterina gibbosa BL U50058 Matsubara et al. Genus 2004, Byrne 2006 Asterina Asterina pectinifera Pt D16387.1

OG: Coscinasterias acutispina Pt AF485025.1 and Asterias forbesi DSPEC693-08 3 Aquilonastra minor BL AY370746 Byrne 2006 Genus Aquilonastra Aquilonastra coronata PL AY370747

OG: Cryptasterina pentagona PL U50051 4 Abatus cavernosus B AJ639904 McEdward and Family Abatus nimrodi NZEC348-09 Miner 2001, Schizasteridae Lambert and Brisaster latifrons Pt DSPEC522-08 Austin 2007, Hart Brisaster fragilis AJ639906.1 1996,Stockleyet al. 2005 OG: Paraster doederleini Pt? AJ639907.1 5 Psolus antarcticus B NZEC103-08 McEuen and Chia Genus Psolus 1991, Lambert Psolus chitonoides PL DSPEC594-08 1997, Kerr and Kim 2001 OG: Cucumaria miniata and PL DSPEC486-08 Crossaster papposus DSPEC610-08 6 Cucumaria lubrica B DSPEC474-08 Arndtetal. 1996, Genus Kerr and Kim Cucumaria Cucumaria miniata PL DSPEC486-08 1999,2001

OG: Eupentacta PL DSPEC577-08 quinquesemita

61 Table 2: Nucleotide diversity (JT) estimates for synonymous (s), nonsynonymous (a) and combined sites for echinoderm species with two or more COI sequences. Comparison number (column 1) corresponds to Table 1. n = sample size. S = segregating sites. Species with nonpelagic larval development are indicated in bold. Sample and collection information for specimens included in this analysis are available in Appendix 4.

Species n # sites Jt(s) ji(a) jt

1 Leptasterias polaris 33 624 1 0.00038 0 0.00010 Evasterias troschelii 9 111 6 0.00452 0.00038 0.00170

4 Abatus nimrodi 7 146 1 0.00149 0 0.00038 Brisaster latifrons 6 747 0 0 0 0

5 Psolus antarcticus 3 645 14 0.04793 0.00279 0.01443 Psolus chitonoides 5 606 1 0.00284 0 0.00099

6 Cucumaria lubrica 3 825 1 0.00315 0 0.00081 Cucumaria miniata 7 813 11 0.01518 0 0.00386

62 Table 3: Relative rate calculations for six phylogenetically independent comparisons based on K2P branch lengths for the cytochrome c oxidase subunit I gene in echinoderms. Ratios of nonpelagic (NP) to pelagic (P) branch lengths are provided for each comparison. Results for the two-tailed sign test and Wilcoxon signed-rank test for ln(NP:P ratios) are given. P-values < 0.05 were used to reject the null hypothesis that relative rates of substitution are equal in pelagic and nonpelagic lineages. Independent comparisons that were significant (p < 0.05) are indicated (*).

K2P Branch Lengths Nonpelagic # Taxonomic Group Lineage Pelagic Lineage NP:P ratio

1 Asteridae 0.084 0.065 1.284

2 Asterina 0.117 0.105 1.117

3 Aquilonastra 0.068 0.059 1.157

4 Schizasteridae 0.050 0.034 1.472

5 Psolus 0.121 0.083 1.460

6 Cucumaridae 0.080 0.050 1.606*

Average: 1349

Supportive comparisons: 6 of 6 Binomial test: p = 0.031 Wilcoxon test: p = 0.031

63 Table 4: Ratios of rates of nonsynonymous (dN) to synonymous (dS) substitutions in COI for six independent comparisons between echinoderm lineages with pelagic (P) and nonpelagic (NP) larval development. Likelihood ratio tests (LRTs) compared the fit of a single-ratio model where all lineages in the comparison were assigned a single dN/dS ratio, against a two-ratio model where separate dN/dS ratios were assigned to the pelagic and nonpelagic lineages. LRTs in which the null hypothesis of a single dN/dS ratio across all lineages was rejected (p < 0.05) are indicated with an asterisk (*).

Fequal Codon Model F3x4 Codon Model

Taxonomic ln(NP:P) ln(NP:P) # Group LRT statistic dN/dS LRT statistic dN/dS

1 Asteridae 2.397 3.951 2.757 3.466

2 Asterina 2.540 1.270 3.716 1.629

3 Aquilonastra 0.735 -0.864 0.039 -0.297

4 Schizasteridae 0.373 0.586 1.187 1.088

5 Psolus 0.104 -0.145 0.724 -0.457

6 Cucumaridae 8.635* -1.880 5.086* -1.609

Average NP:P ratio 0.487 0.637

Supportive comparisons 3 of 6 3 of 6 Two-tailed binomial test 1 1 Two-tailed Wilcoxon signed rank 0.84 0.56 test

64 Nonpelagic Benthic Pelagic Pelagic lecithotrophy lecithotrophy lecithotrophy planktotrophy (brood-protection) (egg masses) (non-feeding) (feeding)

Adult body size

Egg size Pelagic duration • Dispersal potential + Genetic population structure

Figure 1: Continuum of reproductive modes in the Echinodermata. General relationships between larval development and adult body size, egg size, length of pelagic duration, dispersal potential and associated levels of genetic population structure are indicated. Arrow direction reflects increases in associated values for each character. Note: this figure is a simplification of the general trends and is not accurate in all cases.

65 0.14 DNonpelagic 0.12 D Pelagic

0.1 i

"So 0.08 s

"s§ 0.06 ua O. 0.04

0.02

o 4- 3 4 Comparisons

Figure 2: Branch lengths for nonpelagic and pelagic lineages of echinoderms based on the COI gene. Comparisons in which the null hypothesis of equal rates of nucleotide substitutions in pelagic and nonpelagic lineages was rejected (p < 0.05) are indicated with an asterisk (*).

66 a) 0.045

0.04 i •single dN/dS DdN/dS nonpelagic 0.035 adN/dS pelagic 0.03

% 0.025 u Cfl 0.02

§0.015

0.01

0.005

0 2 3 4 Comparisons b) 0.018 •single dN/dS 0.016 DdN/dS nonpelagic n 0.014 dN/dS pelagic-

0.012

Comparisons

Figure 3: Estimated dN/dS values for single and two-omega models under a) Fequal and b) F3x4 codon substitution models. Comparisons in which the null hypothesis of a single dN/dS value across all branches was rejected (p < 0.05) are indicated with an asterisk (*).

67 GENERAL DISCUSSION:

Summary of results:

My research explored echinoderm species diversity in Canadian waters through

DNA barcodes and examined the relationship between larval development and rates of molecular evolution in COL The 809 COI sequences generated for this study are the beginning of a comprehensive database of DNA barcodes for Canadian echinoderms, representing approximately one third of recorded species in this region. My results

suggest that larval development and dispersal affect intraspecific variation, especially in species with widespread distributions. Species with long-lived pelagic larvae, such as

strongylocentrotid urchins (S.pallidus and S. droebachiensis), had low intraspecific divergence across oceans, while species with nonpelagic larvae (e.g. Pteraster militaris) exhibited rates of divergence between geographically distant populations. These observations emphasize the need for comprehensive sampling from multiple geographic locations and the use of soft thresholds when delineating species.

My work also included a comparative study which tested for the association between larval development and rates of molecular evolution. Results from a meta analysis of six comparisons indicated that some species with nonpelagic development had significantly higher rates of molecular evolution when compared to closely related species with pelagic development. Although previous studies (Foltz 2003, Foltz et al.

2004, Foltz and Mah 2009) have linked higher rates of nonsynonymous substitutions in nonpelagic lineages of marine invertebrates to a reduction in effective population size, I could not assess relative population sizes for the species involved in my study. These results have implications for the application of local molecular clocks for studies of

68 phylogenetic relationships and studies dating the evolution of different developmental modes.

In my studies, larval development was used to infer dispersal potential and gene flow, based on the assumption that species with pelagic development tend to disperse more widely than species with nonpelagic development. Wider dispersal in species with pelagic development has been observed in several taxa (Emlet 1995, Watts and Thorpe

2006), but contradictory results have also been reported (Johannesson 1988, Shanks

2009, reviewed in Paulay and Meyer 2006). Increased sample sizes and more comprehensive sampling over temporal and spatial scales would be necessary to determine the magnitude of gene flow between distant populations in this study.

DNA bar coding: patterns of diversity and applications

Most molecular studies on marine benthic invertebrates focus on the population dynamics of a single species or genus, and seldom target higher taxonomic groups or large geographic areas. Furthermore, the use of a variety of genetic markers makes it difficult to combine datasets to determine broad-scale patterns of genetic variation across diverse taxa. The large volume of molecular data generated through DNA barcoding will provide increasing opportunities for comparative studies and meta-analysis, and will undoubtedly be useful for a variety of ecological and molecular-based studies. For example, DNA barcode data has been used to explore large-scale patterns of genetic diversity and biogeographic boundaries in Arctic marine fauna (Hardy et al. 2010).

The mean intra- (0.41%) and interspecific (13.8%) divergences observed in this study are consistent with those observed for other marine organisms. Barcoding studies

69 on crustaceans (Costa et al. 2007, Radulovici et al. 2009), polychaetes (Carr 2010), fish

(Ward et al. 2005) and echinoderms (Vogler et al. 2008, Ward et al. 2008) yielded estimates of mean intraspecific divergence from 0.38 to 0.91% and mean congeneric distances between 9.93 and 17.16%. Unlike many benthic taxa involved in the trans-

Arctic exchange following the opening of the Bering Strait approximately 3.5 million years ago, the echinoderms in this study have relatively high levels of gene flow between

Pacific and Arctic-Atlantic populations. This may reflect more recent genetic exchange between populations, or may indicate that these populations have had insufficient time to diverge. Intraspecific divergence for circumboreal echinoderms (means: 0.04-1.87%) was relatively low when compared to other taxa with trans-Arctic distributions, even though several species were flagged as possible cryptic species in this study (see Chapter 1).

Cryptic species separated by the Bering Strait have been documented in polychaetes

(reviewed in Carr 2010) and molluscs (Nikula et al. 2007, reviewed in Vermeij 1991). In particular, divergence between Pacific and Atlantic populations of polychaete morphospecies ranged from 0 to 16%, although it is likely that some of these species assignments were due to assumptions of continuous distributions and an over- conservative taxonomy (Carr 2010). Other explanations for variation in patterns of divergence between allopatric populations may include taxonomic differences in physical and biological barriers to gene flow, larval dispersal potential and temperature tolerance and variation in the occurrence of trans-Arctic invasions.

70 Implications of rate heterogeneity

The observation of rate heterogeneity between echinoderm lineages has broad implications for the application of molecular clocks for dating evolutionary events and exploring mechanisms and processes of evolution. The molecular clock concept assumes that the amount of divergence between two DNA sequences is proportional to the time since the two species diverged (Bromham and Penny 2003). Molecular clocks can be especially useful for taxa with poor or non-existent fossil records, but undetected variation in rates of molecular evolution between lineages, due to differences in mutation rate, population size and variable selection between sites, can lead to spurious date estimates. Smith et al. (2006) compared estimates of divergence times derived from rRNA sequence data and the fossil record for 46 echinoid species and found that in approximately 70% of cases, the results were concordant. Their results suggest that molecular data provided accurate estimates of divergence time in most cases but, variability in rates of evolution in some lineages was likely responsible for the discordant results (Smith et al. 2006). Clock tests are often used to screen for variation in substitution rates between lineages, but the short sequences (< lOOObp) commonly used in phylogenetic studies decrease the power of the tests, reducing the likelihood that small differences in rates of evolution will be detected (Bromham et al. 2000). Future research into the factors responsible for rate variation between lineages may provide opportunities to calibrate local molecular clocks, or more quickly identify lineages that deviate from clock-like molecular evolution. The present study indicates that differences in larval development are associated with molecular rate heterogeneity and should be considered in future studies employing molecular clocks.

71 REFERENCES

Addison JA and MW Hart. 2005. Colonization, dispersal, and hybridization influence

phylogeography of North Atlantic sea urchins {Strongylocentrotus

droebachiensis). Evolution 59: 532-543.

Arndt A, Marquez C, Lambert P and MJ Smith. 1996. Molecular phylogeny of eastern

Pacific sea cucumbers (Echinodermata: Holothuroidea) based on mitochondrial

DNA sequence. Molecular Phylogenetics and Evolution 6: 425-437.

Barber P and SL Boyce. 2006. Estimating diversity of Indo-Pacific coral reef

stomatopods through DNA barcoding of stomatopod larvae. Proceedings of the

Royal Society B: Biological Sciences 273: 2053-2061.

Baric S and C Sturmbauer. 1999. Ecological parallelism and cryptic species in the genus

Ophiothrix derived from mitochondrial DNA sequences. Molecular Phylogenetics

and Evolution 11: 157-162.

Bazin E, Glemin S and N Galtier. 2006. Population size does not influence mitochondrial

genetic diversity in animals. Science 312: 570-572.

Bensasson D, Zhang D, Haiti DL and GM Hewitt. 2001. Mitochondrial pseudogenes:

evolution's misplaced witnesses. Trends in Ecology and Evolution 16: 314-321.

Benson DA, Boguski MS, Lipman DJ, Ostell J, Ouellette BFF, Rapp BA and DL

Wheeler. 1999. GenBank. Nucleic Acids Research 27: 38-43.

Bleidorn C, Kruse I, Albrecht S and T Bartolomaeus. 2006. Mitochondrial sequence data

expose the putative cosmopolitan polychaete Scoloplos armiger (Annelida,

Orbiniidae) as a species complex. BMC Evolutionary Biology 6: 47.

72 Bluhm BA, MacDonald IR, Debenham C and K Iken. 2005. Macro- and megabenthic

communities in the high Arctic Canada basin: initial findings. Polar Biology 28:

218-231.

Bohonak AJ. 1999. Dispersal, gene flow and population structure. Quarterly Review of

Biology 74: 21-45.

Boissin E, Feral JP and A Chenuil. 2008. Defining reproductively isolated units in a

cryptic and syntopic species complex using mitochondrial and nuclear markers:

the brooding brittle star, Amphipholis squamata (Ophiuroidea). Molecular

Ecology 17: 1732-1744.

Brandt A, De Broyer C, De Mesel I, Ellingsen KE, Gooday AJ, Hilbig B, Linse K,

Thomson MRA and PA Tyler. 2007. The biodiversity of the deep Southern Ocean

benthos. Philosophical Transactions of the Royal Society B: Biological Sciences

362: 39-66.

Britten RJ. 1986. Rates of DNA sequence evolution differ between taxonomic groups.

Science 231: 1393-1398.

Bromham L. 2002. Molecular clocks in reptiles: life history influences rate of molecular

evolution. Molecular Biology and Evolution 19: 302-309.

Bromham L and D Penny. 2003. The modern molecular clock. Nature Reviews Genetics

4: 216-224.

Bromham L, Penny D, Rambaut A and MD Hendy. 2000. The power of relative rate tests

depends on the data. Journal of Molecular Evolution 50: 296-301.

73 Bromham L, Rambaut A and PH Harvey. 1996. Determinants of rate variation in

mammalian DNA sequence evolution. Journal of Molecular Evolution 43: 610-

621.

Brusca RC and GJ Brusca. 2003. Invertebrates. 2nd ed. Sinauer Associates Inc.,

Sunderland.

Byrne M. 2006. Life history diversity and evolution in the Asterinidae. Integrative and

Comparative Biology 46: 243-254.

Carr CM. 2010. The Polychaeta of Canada: exploring diversity and distribution patterns

using DNA barcodes. MSc thesis, University of Guelph, Guelph, ON.

Clare EL, Lim BK, Engstrom MK, Eger JL and PDN Hebert. 2007. DNA barcoding of

Neotropical bats: species identification and discovery in Guyana. Molecular

Ecology Notes 7: 184-190.

Clark AM and ME Downey. 1992. Starfishes of the Atlantic. Chapman and Hall, New

York.

Costa FO, deWaard JR, Boutillier J, Ratnasingham S, Dooh RT, Hajibabaei M and PDN

Hebert. 2007. Biological identifications through DNA barcodes: the case of the

Crustacea. Canadian Journal of Fisheries and Aquatic Sciences 64: 272-295. deWaard JR, Clare EL, Corstorphine EA, Carr CM, Wilson JJ, Hebert PDN and SJ

Adamowicz. 2010. Accelerated rates of molecular evolution in pelagic vs. benthic

invertebrates detected through a meta-analysis across multiple phyla. Manuscript

submitted for publication (copy on file with author)

Dodson JJ, Tremblay S, Colombani F, Carscadden JE and F Lecomte. 2007. Trans-Arctic

dispersals and the evolution of a circumpolar marine fish species complex, the

74 capelin (Mallotus villosus). Molecular Ecology 16: 5030-5043.

Duda TF and SR Palumbi. 1999. Developmental shifts and species selection in

gastropods. Proceedings of the National Academy of Science USA 96: 10272-

10277.

Dunton K. 1992. Arctic biogeography: The paradox of the marine benthic fauna and

flora. Trends in Ecology and Evolution 7: 183-189.

Durham JW and FS MacNeil. 1967. Cenozoic migrations of marine invertebrates through

the Bering Strait region. In: The Bering Land Bridge (ed. DM Hopkins), pp. 326-

349. Stanford University Press, Stanford, CA.

Eernisse DJ, Corstorphine E, Clark RN, Mah C and MF Strathmann. 2010. [Seastars

across the oceans: Molecules help untangle biogeographic patterns for a species-

rich genus, Henricia]. Unpublished raw data.

Emlet RB. 1995. Developmental mode and species geographic range in regular sea

urchins (Echinodermata: Echinoidea). Evolution 49: 476-489.

Felsenstein J. 1985. Phylogenies and the comparative method. American Naturalist 125:

1-15.

Feral JP. 2002. How useful are the genetic markers in attempts to understand and manage

marine biodiversity? Journal of Experimental Marine Biology and Ecology 268:

121-145.

Fieldhouse D, Yazdani F and GB Golding. 1997. Substitution rate variation in closely

related rodent species. Heredity 78: 21-31.

Folmer O, Black M, Hoeh W, Lutz R and R Vrijenhoek. 1994. DNA primers for

amplification of mitochondrial cytochrome c oxidase subunit I from diverse

75 metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294-

299.

Foltz DW. 2003. Invertebrate species with nonpelagic larvae have elevated levels of

nonsynonymous substitutions and reduced nucleotide diversities. Journal of

Molecular Evolution 57: 607-612.

Foltz DW, Hrincevich AW and A Rocha-Olivares. 2004. Apparent selection intensity

for the cytochrome oxidase subunit I gene varies with mode of reproduction in

echinoderms. Genetica 122: 115-125.

Foltz DW, Bolton MT, Kelley SP, Kelley BD and AT Nguyen. 2007. Combined

mitochondrial and nuclear sequences support the monophyly of forcipulatacean

sea stars. Molecular Phylogenetics and Evolution 43: 627-634.

Foltz DW and CL Mah. 2009. Recent relaxation of purifying selection on the tandem-

repetitive early-stage histone H3 gene in brooding sea stars. Marine Genomics 2:

113-118.

Gillespie JM. 2001. Is the population size of a species relevant to its evolution? Evolution

55:2161-2169.

Gillespie JM and JB McClintock. 2007. Brooding in echinoderms: how can modern

experimental techniques add to our historical perspective? Journal of

Experimental Marine Biology and Ecology 342: 191-201.

Gillooly JF, Allen AP, West GB and JH Brown. 2005. The rate of DNA evolution:

effects of body size and temperature on the molecular clock. Proceedings of the

National Academy of Sciences 102: 140-145.

Ginsburg DW and DT Manahan. 2009. Developmental physiology of Antarctic asteroids

76 with different life history modes. Marine Biology 156: 2391-2402.

Graves JE. 1998. Molecular insights into the population structures of cosmopolitan

marine fishes. The Journal of Heredity 89: 427-437.

Hamel JF and A Mercier. 1995. Prespawning behaviour, spawning, and development of

the brooding starfish Leptasteriaspolaris. Biological Bulletin 188: 32-45.

Hardy SM, Carr CM, Hardman M, Steinke D, Corstorphine E and C Mah. 2010.

Biodiversity and phylogeography of Arctic marine fauna: insights from molecular

tools. Manuscript submitted for publication (copy on file with author).

Harper FM and MW Hart. 2007. Morphological and phylogenetic evidence for

hybridization and introgression in a sea star secondary contact zone. Invertebrate

Biology 126: 373-384.

Harper FM, Addison J A and MW Hart. 2007. Introgression versus immigration in

hybridizing high-dispersal echinoderms. Evolution 61: 4210-2418.

Hart MW. 1996. Evolutionary loss of larval feeding: development, form and function in a

facultatively feeding larva, Brisaster latifrons. Evolution 50: 174-187.

Hart MW, Byrne M and MJ Smith. 1997. Molecular phylogenetic analysis of life-history

evolution in Asterinid starfish. Evolution 51: 1848-1861.

Hart MW, Byrne M and SL Johnson. 2003. Patiriella pseudoexigua (Asteroidea:

Asterinidae): a cryptic species complex revealed by molecular and embryological

analyses. Journal of the Marine Biological Association of the United Kingdom 83:

1109-1116.

77 Hart MW, Keever CC, Dartnall AJ and M Byrne. 2006. Morphological and genetic

variation indicate cryptic species within Lamarck's Little Sea Star, Parvulastra

(=Patirielld) exigua. Biological Bulletin 210: 158-167.

Hebert PDN, Cywinska A, Ball SL and JR deWaard. 2003. Biological identifications

through DNA barcodes. Proceedings of the Royal Society B: Biological Sciences

270:313-321.

Hebert PDN, Remigio EA, Colbourne JK, Taylor DJ and CC Wilson. 2002. Accelerated

molecular evolution in halophilic crustaceans. Evolution 56: 909-926.

Hebert PDN, Stoeckle MY, Zemlak TS and CM Francis. 2004. Identification of birds

through DNA barcodes. PLoS Biology 2: e312.

Hedgecock D, Launey S, Pudovkin AI, Naciri Y, Lapegue S and F Bonhomme. 2007.

Small effective number of parents (Nb) inferred for a naturally spawning cohort of

juvenile European flat oysters Ostrea edulis. Marine Biology 150: 1173-1182.

Himeno H, Masaki, H, Kawai T, Ohta T, Kumagai I, Miura K and K Watanabe. 1987.

Unusual genetic codes and a novel gene structure for tRNA(AGYSer) in starfish

mitochondrial DNA. Gene 56: 219-230.

Hrincevich AW, Rocha-Olivares A and DW Foltz. 2000. Phylogenetic analysis of

molecular lineages in a species-rich subgenus of sea stars (Leptasterias subgenus

Hexasterias). American Zoologist 40: 365-374.

Ivanova NV, Fazekas AJ and PDN Hebert. 2008. Semi-automated, membrane-based

protocol for DNA isolation from plants. Plant Molecular Biology Reporter 26:

186-198.

78 Ivanova NV and C Grainger. 2010. Canadian Centre for DNA Barcoding: sequencing

protocols. Retrieved April 6,2010 from

http://www.ccdb.ca/pa/ge/research/protocols/sequencing.

Jablonski D and RA Lutz. 1983. Larval ecology of marine benthic invertebrates:

paleobiological implications. Biological Reviews 58: 21-80.

Jeffrey CH and RB Emlet. 2003. Macroevolutionary consequences of developmental

mode in Temnopleurid echinoids from the Tertiary of southern Australia.

Evolution 57: 1031-1048.

Johannesson K. 1988. The paradox of Rockall: why is a brooding gastropod (Littorina

saxatalis) more widespread than one having a planktonic larval dispersal stage (L.

littorea)! Marine Biology 99: 507-513.

Kelly RP and SR Palumbi. 2010. Genetic structure among 50 species of the Northeastern

Pacific rocky intertidal community. PLoS ONE 5: e8594.

Kerr AM and J Kim. 1999. Bi-pent-bi-decaradial symmetry: a review of evolutionary and

developmental trends in Holothuroidea (Echinodermata). Journal of Experimental

Zoology Part B - Molecular and Developmental Evolution 285: 93-103.

Kerr AM and J Kim. 2001. Phylogeny of Holothuroidea (Echinodermata) inferred from

morphology. Zoological Journal of the Linnean Society 13: 63-81.

Kerr KCR, Stoeckle MY, Dove CJ, Weigt LA, Francis CM and PDN Hebert. 2007.

Comprehensive DNA barcode coverage of North American birds. Molecular

Ecology Notes 7: 535-543.

79 Kerr KCR, Lijtmaer DA, Barreira AS, PDN Hebert and PL Tubaro. 2009. Probing

evolutionary patterns in Neotropical birds through DNA barcodes. PLoS ONE 4:

e4379.

Kimura M. 1979. Model of effectively neutral mutations in which selective constraint is

incorporated. Proceedings of the National Academy of Science USA 76: 3440-

3444.

Kimura M. 1980. A simple method for estimating evolutionary rate of base substitutions

through comparative studies of nucleotide sequences. Journal of Molecular

Evolution 16: 111-120.

Klautau M, Russo CA, Lazoski C, Boury-Esnault N, Thorpe JP, Sole-Cava AM. 1999.

Does cosmopolitanism result from over-conservative systematics?: a case study

using the marine sponge Chondrilla nucula. Evolution 53: 1414-1422.

Knowlton N. 1993. Sibling species in the sea. Annual Review in Ecology and

Systematics 24: 189-216.

Knowlton N. 2000. Molecular genetic analyses of species boundaries in the sea.

Hydrobiologia 420: 73-90.

Kohne DE.1970. Evolution of higher organism DNA. Quarterly Reviews of Biophysics

3: 327-375.

Kooistra WHCF and LK Medlin. 1996. Evolution of the diatoms (Bacillariophyta) IV. A

reconstruction of their age from small subunit rRNA coding regions and the fossil

record. Molecular Phylogenetics and Evolution 6: 391-407.

Kozloff EN. 1987. Marine invertebrates of the Pacific Northwest. University of

Washington Press, Seattle.

80 Kumar S. 1996. PHYLTEST: a program for testing phylogenetic hypotheses. Version

2.0. Institute of Molecular Evolutionary Genetics and Department of Biology,

Pennsylvania State University, University Park.

Kyle CJ and EG Boulding. 2000. Comparative population genetic structure of marine

gastropods {Littorina spp.) with and without pelagic larval dispersal. Marine

Biology 137: 835-845.

Lambert P. 1997. Sea cucumbers of British Columbia, Southeast Alaska and Puget

Sound. UBC Press, Vancouver.

Lambert P. 2000. Sea stars of British Columbia, Southeast Alaska and Puget Sound. UBC

Press, Vancouver.

Lambert P and WC Austin. 2007. Brittle stars, sea urchins and feather stars of British

Columbia, Southeast Alaska and Puget Sound. UBC Press, Victoria.

Lanfear R, Thomas JA, Welch JJ, Brey T and L Bromham. 2007. Metabolic rate does not

calibrate the molecular clock. Proceedings of the National Academy of Science

USA 104: 15388-15393.

Lee HJ and EG Boulding. 2007. Mitochondrial DNA variation in space and time in the

northeastern Pacific gastropod, Littorina keenae. Molecular Ecology 16: 3084-

3103.

Lee JH and EG Boulding. 2009. Spatial and temporal population genetic structure of four

northeastern Pacific littorinid gastropods: the effect of mode of larval

development on variation at one mitochondrial and two nuclear DNA markers.

Molecular Ecology 18: 2165-2184.

81 Levin LA and TS Bridges. 1995. Pattern and diversity in reproduction and development.

In: Ecology of marine invertebrate larvae (ed. L McEdward), pp. 1-48. CRC

Press, New York.

Librado P and J Rozas. 2009. DnaSP v5: A software for comprehensive analysis of DNA

polymorphism data. Bioinformatics 25: 1451-1452.

Lieberman BS, Allmon WD and N Eldredge. 1993. Levels of selection and

macroevolutionary patterns in turritellid gastropods. Paleobiology 19: 205-215.

Lockhart SJ. 2006. Molecular evolution, phylogenetics, and parasitism in Antarctic

cidaroid echinoids. PhD Dissertation, University of California, Santa Cruz,

California.

Lutzoni F and M Pagel. 1997. Accelerated molecular evolution as a consequence of

transitions to mutualism. Proceedings of the National Academy of Science USA

94: 11422-11427.

Mah C. 2009. Solaster pacificus Djakonov, 1938. In: Mah CL. 2009. World Asteroidea

database, [online] Available at:

http://www .marinespecies.org/Asteroidea/aphia.php ?p=taxdetails&id=292725

[Accessed 19 January 2010].

Martin AP and SR Palumbi. 1993. Body size, metabolic rate, generation time, and the

molecular clock. Proceedings of the National Academy of Science USA 90: 4087-

4091.

Matsubara M, Komatsu M and H Wada. 2004. Close relationship between Asterina and

Solasteridae (Asteroidea) supported by both nuclear and mitochondrial gene

molecular phylogenies. Zoological Science 21: 785-793.

82 McClary DJ and PV Mladenov. 1989. Reproductive pattern in the brooding and

broadcasting sea star Pteraster militaris. Marine Biology 103: 531-540.

McClary DJ and PV Mladenov. 1990. Brooding biology of the sea star Pteraster militaris

(O. F. Miiller): energetic and histoligical evidence for nutrient translocation to

brooded juveniles. Journal of Experimental Marine Biology and Ecology 142:

183-199.

McEdward LR and BG Miner. 2001. Larval and life-cycle patterns in echinoderms.

Canadian Journal of Zoology 79: 1125-1170.

McEuen FS and FS Chia. 1991. Development and metamorphosis of two psolid sea

cucumbers, Psolus chitonoides and Psolidium bullatum, with a review of

reproductive patterns in the family Psolidae (Holothuroidea: Echinodermata).

Marine Biology 109: 267-279.

Mercier A and JF Hamel. 2008. Depth-related shift in life history strategies of a brooding

and broadcasting deep-sea asteroid. Marine Biology 156: 205-223.

Merriwether DA, Clark AG, Ballinger SW, Schurr TG, Soodyall H, Jenkins T, Sherry ST

and DC Wallace. 1991. The structure of human mitochondrial DNA variation.

Journal of Molecular Evolution 33: 543-555.

Meyer C, Geller J, and G Paulay G. 2005. Fine scale endemism on coral reefs:

archipelagic differentiation in turbinid gastropods. Evolution 59: 113-125.

Meyer CP and G Paulay. 2005. DNA barcoding: error rates based on comprehensive

sampling. PLoS Biology 3: e422.

Michael J, Alves MJ, Costa AC and MB Jones. 2009. Exploitation and conservation of

echinoderms. In: Oceanography and Marine Biology: An Annual Review, vol. 47.

83 (eds Gibson RN, Atkinson RJA and JDM Gordon), pp. 191-208. Taylor and

Francis Group, CRC Press, New York.

Mikkelsen NT, Schander C and E Willassen. 2007. Local scale DNA barcoding of

bivalves (Mollusca): a case study. Zoologica Scripta 36: 455-463.

Miller BA. 2001. Echinodermata. In: An identification guide to the larval marine

invertebrates of the Pacific Northwest (ed Shank AL), pp. 270-290. Oregon State

University Press, Corvallis.

Mindell DP and CE Thacker. 1996. Rates of molecular evolution: phylogenetic issues

and applications. Annual Review of Ecology and Systematics 27: 279-303.

Mooers AO and PH Harvey. 1994. Metabolic rate, generation time and the rate of

molecular evolution in birds. Molecular Phylogenetics and Evolution 3: 344-350.

Moritz C and C Cicero. 2004. DNA barcoding: Promise and pitfalls. PLoS Biology 2:

e354.

Mortensen T. 1977. Handbook of the echinoderms of the British Isles. Claredon Press

Oxford, Rotterdam.

Nabholz B, Mauffrey JF, Bazin E, Galtier N and S Glemin. 2008. Determination of

mitochondrial genetic diversity in mammals. Genetics 178: 351-361.

Nikula R, Strelkov P and R Vainola. 2007. Diversity and Trans-Arctic invasion history of

mitochondrial lineages in the North Atlantic Macoma balthica complex (Bivalvia:

Tellinidae). Evolution 61: 928-941.

Nunn GB and SE Stanley. 1998. Body size effects and rates of cytochrome b evolution in

tube-nosed seabirds. Molecular Biology and Evolution 15: 1360-1371.

Ohta T. 1973. Slightly deleterious mutant substitutions in evolution. Nature 246: 96-98.

84 Ohta T. 1992. The nearly neutral theory of molecular evolution. Annual Reviews of

Ecology and Systematics 23: 263-286.

Pagel MD. 1992. A method for the analysis of comparative data. Journal of Theoretical

Biology 156:431-442.

Palumbi SR. 1992. Marine speciation on a small planet. Trends in Ecology and Evolution

7: 114-118.

Palumbi SR. 1994. Genetic divergence, reproductive isolation, and marine speciation.

Annual Review of Ecology and Systematics 25: 547-572.

Palumbi SR. 1996. Nucleic acids II: the polymerase chain reaction. In: Molecular

Systematics (eds Hillis DM, Moritz C and BK Mable), pp. 205-247. Sinauer &

Associates Inc., Sunderland, Massachusetts.

Palumbi SR, Grabowsky G, Duda T, Geyer L and N Tachino. 1997. Speciation and

population genetic structure in tropical Pacific sea urchins. Evolution 51: 1506-

1517.

Palumbi SR and BD Kessing. 1991. Population biology of the Trans-Arctic exchange:

mtDNA sequence similarity between Pacific and Atlantic sea urchins. Evolution

45: 1790-1805.

Palumbi SR and AC Wilson. 1990. Mitochondrial DNA diversity in the sea urchins

Strongylocentrotuspurpuratus and S. droebachiensis. Evolution 44: 403-415.

Paulay G and C Meyer. 2006. Dispersal and divergence across the greatest ocean region:

do larvae matter? Integrative and Comparative Biology 46: 269-281.

Pawlowski J, Bolivar I, Fahrni JF, de Vargas C, Gouy B and L Zaninetti. 1997. Extreme

differences in rates of molecular evolution of Foraminifera revealed by

85 comparison of ribosomal DNA sequences and the fossil record. Molecular

Biology and Evolution 14: 498-505.

Pearse JS and SJ Lockhart. 2004. Reproduction in cold water: paradigm changes in the

20th century and a role for cidaroid sea urchins. Deep-sea Research II 51: 1533-

1549.

Pechenik JA. 1999. On the advantages and disadvantages of larval stages in benthic

marine invertebrate life cycles. Marine Ecology Progress Series 177: 269-297.

Pegg GG, Sinclair B, Briskey L and WJ Aspden. 2006. MtDNA barcode identification of

fish larvae in the southern Great Barrier Reef, Australia. Scientia Marina 70(S2):

7-12.

Piganeau G and A Eyre-Walker. 2009. Evidence for variation in the effective population

size of animal mitochondrial DNA. PLoS ONE 4: e4396.

Pollock LW. 1998. A practical guide to the marine animals of northeastern North

America. Rutgers University Press, New Brunswick.

Poulin E and JP Feral. 1996. Why are there so many species of brooding Antarctic

echinoids? Evolution 50: 820-830.

Puillandre N, Strong EE, Bouchet P, Boisselier MC, Couloux A and S Samadi. 2009.

Identifying gastropod spawn from DNA barcodes: possible but not yet

practicable. Molecular Ecology Resources 9: 1311-1321.

R Development Core Team. 2008. R: A language and environment for statistical

computing. R Foundation for Statistical Computing, Vienna, Austria [Internet].

Available from: http://www.R-project.org.

Radulovici AE, Sainte-Marie B and F Dufresne. 2009. DNA barcoding of marine

86 crustaceans from the Estuary and Gulf of St Lawrence: a regional-scale approach.

Molecular Ecology Resources 9: 181-187.

Rand DM. 2001. The units of selection of mitochondrial DNA. Annual Review of

Ecology and Systematics 32: 415-448.

Ratnasingham S and PDN Hebert. 2007. BOLD: the Barcode of Life Data System

(www.barcodinglife.org). Molecular Ecology Notes 7: 355-364.

Reid DG. 1990. A cladistic phylogeny of the genus Littorina (Gastropoda): implications

for evolution of reproductive strategies and for classification. Hydrobiologia 193:

1-19.

Reid PC, Johns DG, Edwards M, Starr M, Poulin M and P Snoeijs. 2007. A biological

consequence of reducing Arctic ice cover: arrival of the Pacific diatom

Neodenticula seminae in the North Atlantic for the first time in 800 000 years.

Global Change Biology 13: 1910-1921.

Robinson EA, Blagoev GA, Hebert PDN and SJ Adamowicz. 2009. Prospects for using

DNA barcoding to identify species in species-rich genera. ZooKeys 16: 27-46.

Robinson M, Gouy M, Gautier C and D Mouchiroud. 1998. Sensitivity of the relative-

rate test to taxonomic sampling. Molecular Biology and Evolution 15: 1091-1998.

Sarich VM and AC Wilson. 1973. Generation time and genomic evolution in primates.

Science 179: 1144-1147.

Schander C and E Willasen. 2005. What can biological barcoding do for marine biology?

Marine Biology Research 1: 79-83.

Scroth W, Jarms G, Streit B and B Schierwater. 2002. Speciation and phylogeography in

the cosmopolitan marine moon jelly, Aurelia sp. BMC Evolutionary Biology 2:1.

87 Sewell MA, Thandar AS and FS Chia. 1995. A redescription of Leptosynapta clarki

Heding (Echinodermata: Holothuroidea) from the northeast Pacific, with notes on

changes in spicule form, and size with age. Canadian Journal of Zoology 73: 469-

485.

Shanks AL. 2009. Pelagic larval duration and dispersal distance revisited. Biological

Bulletin 216: 373-385.

Smirnov AV. 1994. Arctic echinoderms: composition, distribution and history of the

fauna. In: Echinoderms through time (eds. David B, Guille A, Feral AP and M

Roux), pp. 135-143. A.A. Balkema Publishers, Rotterdam.

Smith AB. 1997. Echinoderm larvae and phylogeny. Annual Review of Ecology and

Systematics 28: 219-41.

Smith MA, Fisher BL and PDN Hebert. 2005. DNA barcoding for effective biodiversity

assessment of a hyperdiverse arthropod group: the ants of Madagascar.

Philosophical Transactions of the Royal Society B 360: 1825-1834.

Smith AB, Lafay B and R Christen. 1992. Comparative variation of morphological and

molecular evolution through geologic time: 28S ribosomoal RNA versus

morphology in echinoids. Philosophical Transactions of the Royal Society of

London 338: 365-382.

Smith AB, Pisani D, Mackenzie-Dodds JA, Stockley B, Webster BL and DTJ Littlewood.

2006. Testing the molecular clock: molecular and paleontological estimates of

divergence times in the Echinoidea (Echinodermata). Molecular Biology and

Evolution 23: 1832-1851.

Sponer R and MS Roy. 2002. Phylogeographic analysis of the brooding brittle star

88 Amphipholis squamata (Echinodermata) along the coast of New Zealand reveals

high cryptic genetic variation and cryptic dispersal potential. Evolution 56: 1954-

1967.

Steinke D, Zemlak TS and PDN Hebert. 2009. Barcoding Nemo: DNA-based

identifications for the ornamental fish trade. PLoS ONE 4: e6300.

Stockley B, Smith AB, Littlewood T, Lessios HA and JA Mackenzie-Dodds. 2005.

Phylogenetic relationships of spatangoid sea urchins (Echinoidea): taxon

sampling density and congruence between morphological and molecular

estimates. Zoological Scripta 34: 447-468.

Strathmann MF. 1987. Reproduction and development of marine invertebrates of the

northern Pacific coast: data and methods for the study of eggs, embryos, and

larvae. University of Washington Press, Seattle.

Strathmann RR. 1985. Feeding and nonfeeding larval development and life history

evolution in marine invertebrates. Annual Review of Ecology and Systematics 16:

339-361.

Strathmann RR and MF Strathmann. 1982. The relationship between adult size and

brooding in marine invertebrates. American Naturalist 119: 91-101.

Svitoch AA and EE Taldenkova. 1994. Recent history of the Bering Strait. Oceanology

34: 400-404.

Takezaki N, Rzhetsky A and M Nei. 1995. Phylogenetic test of the molecular clock and

linearized trees. Molecular Biology and Evolution 12: 823-833.

89 Tamura K, Dudley J, Nei M and S Kumar. 2007. MEGA4: Molecular Evolutionary

Genetics Analysis (MEGA) software version 4.0. Molecular Biology and

Evolution 24: 1596-1599.

Thomas JA, Welch JJ, Woolfit M and L Bromham. 2006. There is no universal molecular

clock for invertebrates, but rate variation does not scale with body size.

Proceedings of the National Academy of Sciences USA 103: 7366-7371.

Van Guelpen L, Pohle G, Vanden Berghe E and MJ Costello. (eds.). 2005. Marine

Species Registers for the North Atlantic Ocean. World Wide Web electronic

publication. http://www.marinebiodiversity.ca/nonNARMS/classification jsp,

version 1.0/2005.

Vawter L and WM Brown. 1986. Nuclear and mitochondrial DNA comparisons reveal

extreme rate variation in the molecular clock. Science 234: 194-196.

Vermeij GJ. 1991. Anatomy of an invasion: the trans-Arctic interchange. Paleobiology

17: 281-307.

Villinski T, Villinski JC, Byrne M and RA Raff. 2002. Convergent maternal provisioning

and life history evolution in echinoderms. Evolution 56: 1764-1775.

Vogler C, Benzie J, Lessios H, Barber P and G Worheide. 2008. A threat to coral reefs

multiplied? Four species of crown-of-thorns starfish. Biology Letters 4: 696-699.

Ward RD, Zemlak TS, Innes BH, Last PR and PDN Hebert. 2005. DNA barcoding

Australia's fish species. Philosophical Transactions of the Royal Society B:

Biological Sciences 360: 1847-1857.

Ward RD and BH Holmes. 2007. An analysis of nucleotide and amino acid variability in

the barcode region of cytochrome c oxidase I (coxl) in fishes. Molecular Biology

90 Notes 7: 899-907.

Ward RD, Holmes BH and TD O'Hara. 2008. DNA barcoding discriminates echinoderm

species. Molecular Ecology Resources 8: 1202-1211.

Wares JP. 2001. Biogeography of Asterias: North Atlantic climate change and speciation.

Biological Bulletin 201: 95-103.

Waters JM, O'Loughlin PM and MS Roy. 2004. Cladogenesis in a starfish species

complex from southern Australia: evidence for vicariant speciation? Molecular

Phylogenetics and Evolution 32: 236-245.

Watts PC and JP Thorpe. 2006. Influence of contrasting larval developmental types upon

the population-genetic structure of cheilostome bryozoans. Marine Biology 149:

1093-1101.

Webb KE, Barnes DKA, Clark MS and DA Bowden. 2006. DNA barcoding: a molecular

tool to identify Antarctic marine larvae. Deep-Sea Research Part II: Tropical

Studies in Oceanography 53: 1053-1060.

Williams ST, Reid DG and DTJ Littlewood. 2003. A molecular phylogeny of the

Littorininae (Gastropoda: Littorinidae): unequal evolutionary rates, morphological

parallelism, and biogeography of the Southern Ocean. Molecular Phylogenetics

and Evolution 28: 60-86.

Woolfit M and L Bromham. 2003. Increased rates of sequence evolution in

endosymbiotic bacteria and fungi with small effective population sizes. Molecular

Biology and Evolution 20: 1545-1555.

Woolfit M and L Bromham. 2005. Population size and the rate of molecular evolution on

islands. Proceedings of the Royal Society B 272: 2277-2282.

91 Wu CI and WH Li. 1985. Evidence for higher rates of nucleotide substitution in rodents

than in man. Proceedings of the National Academy of Science USA 82: 1741-

1745.

Yang Z. 2007. PAML 4: Phylogenetic Analysis by Maximum Likelihood. Molecular

Biology and Evolution 24: 1586-1591.

Yang Z and JP Bielawski. 2000. Statistical methods for detecting molecular adaptation.

Trends in Ecology and Evolution 15: 496-503.

Young CM, Sewell MA, Tyler PA and A Metaxas. 1997. Biogeographic and bathymetric

ranges of Atlantic deep-sea echinoderms and ascidians: the role of larval

dispersal. Biodiversity and Conservation 6: 1507-1522.

Zemlak TS, Ward RD, Connell AD, Holmes BH and PDN Hebert. 2009. DNA barcoding

reveals overlooked marine fishes. Molecular Ecology Resources 9: 237-242.

Zigler KS and HA Lessios. 2004. Speciation on the coasts of the New World:

phylogeography and the evolution of bindin in the sea urchin genus Lytechinus.

Evolution 58: 1225-1241.

92 Appendix 1: Cycle-sequencing reactions (based on a single reaction volume) used to generate 652-841bp fragments of the COI gene in echinoderms. Cycle-sequencing reactions were dependent on the sequencing clean-up method used. Thermocycling programs and sequencing clean-up protocols for each method are described by Ivanova and Grainger (2010) and can be accessed online on the Canadian Centre for DNA Barcoding website, (http://www.ccdb.ca/pa/ge/research/protocols/sequencing).

Sephadex® CleanSeq® AutoDTR™ (Sigma-Aldrich) (Agencourt®) (EdgeBIO®) Dye terminator mix v3.1 0.25 ul 0.16 ul 0.2 MJ 5 x sequencing buffer 1.875 ul 1.92 ul 1.9 ul 10% trehalose 5 ul 5 ul 5 jxl 10 uM primer 1 ul l[Xl 1 ul Water 0.875 ul 0.92 ul 0.9 ul PCR product 1.2 ul 2ul* 1.5 |il Total reaction volume 10.2 ul 11 ul 10.5 ul * 2 ^1 PCR product diluted to yield ~5-25ng/reaction.

93 Appendix 2: Sample and collection information for 809 sequences used in Chapter 1 analysis. More detailed information is available in the Barcode of Life Data Systems online database (BOLD, www.boldsystems.org). Institution and provincial abbreviations are as follows: RBCM = Royal British Columbia Museum, BIO = Biodiversity of Ontario, TMNPR = Torngat Mountains National Park Reserve, BC = British Columbia, NB = New Brunswick, NU = Nunavut, NL = Newfoundland and Labrador, MB = Manitoba.

COI-5P Sequence Collection Storing Process ID Sample ID Length Date Identification Institution Province DSPEC205-08 RBCM EC00072 840 10-Apr-2003 Ampheraster marianus RBCM BC DSPEC204-08 RBCMEC00071 658 10-Apr-2003 Ampheraster marianus RBCM BC DSPEC553-08 BAM00104 634 08-Jun-2008 Amphiodia cf. occidentalis BIO BC DSPEC552-08 BAM00103 658 08-Jun-2008 Amphiodia cf. occidentalis BIO BC DSPEC545-08 BAM00096 634 04-Jun-2008 Amphiodia cf. occidentalis BIO BC DSPEC544-08 BAM00095 658 04-Jun-2008 Amphiodia cf. occidentalis BIO BC DSPEC472-08 BAM00023 658 03-Jun-2008 Amphiodia cf. occidentalis BIO BC DSPEC471-08 BAM00022 658 03-Jun-2008 Amphiodia cf. occidentalis BIO BC DSPEC548-08 BAM00099 658 06-Jun-2008 Amphiodia cf. urtica BIO BC DSPEC547-08 BAM00098 658 06-Jun-2008 Amphiodia cf. urtica BIO BC DSPEC546-08 BAM00097 634 06-Jun-2008 Amphiodia cf. urtica BIO BC DSPEC366-08 RBCM EC00233 658 07-Sep-2004 Amphiophiura superba RBCM BC DSPEC367-08 RBCM EC00234 658 07-Sep-2004 Amphiophiura superba RBCM BC DSPEC369-08 RBCM EC00236 658 ll-Oct-2006 Amphiophiura superba RBCM BC DSPEC370-08 RBCM EC00237 658 ll-Oct-2006 Amphiophiura superba RBCM BC DSPEC554-08 BAM00105 658 08-Jun-2008 Amphipholis sp. EACOl BIO BC DSPEC517-08 BAM00068 604 03-Jun-2008 Amphipholis sp. EACOl BIO BC DSPEC585-08 BAM00136 658 16-May-2008 Amphipholis sp. EAC02 BIO BC DSPEC558-08 BAM00109 615 06-Jun-2008 Amphipholis sp. EAC02 BIO BC DSPEC557-08 BAM00108 658 06-Jun-2008 Amphipholis sp. EAC02 BIO BC

94 DSPEC556-08 BAM00107 602 06-Jun-2008 Amphipholis sp. EAC02 BIO DSPEC551-08 BAM00102 658 06-Jun-2008 Amphipholis sp. EAC02 BIO DSPEC549-08 BAM00100 657 06-Jun-2008 Amphipholis sp. EAC02 BIO DSPEC725-08 HUNT0048 658 09-Aug-2008 Amphipholis squamata BIO DSPEC724-08 HUNT0047 658 09-Aug-2008 Amphipholis squamata BIO DSPEC723-08 HUNT0046 658 09-Aug-2008 Amphipholis squamata BIO DSPEC722-08 HUNT0045 656 09-Aug-2008 Amphipholis squamata BIO DSPEC720-08 HUNT0043 658 09-Aug-2008 Amphipholis squamata BIO CHONE011-10 09CHON-011 658 12-Oct-2009 Asterias BIO DSPEC095-07 CECE07-025 817 13-Aug-2007 Asterias forbesi BIO DSPEC094-07 CECE07-024 817 13-Aug-2007 Asterias forbesi BIO DSPEC093-07 CECE07-023 785 13-Aug-2007 Asterias forbesi BIO DSPEC694-08 HUNT0017 838 02-Aug-2008 Asterias forbesi BIO DSPEC693-08 HUNT0016 840 02-Aug-2008 Asterias forbesi BIO DSPEC687-08 HUNT0010 817 02-Aug-2008 Asterias forbesi BIO DSPEC686-08 HUNT0009 817 02-Aug-2008 Asterias forbesi BIO DSPEC685-08 HUNT0008 811 02-Aug-2008 Asterias forbesi BIO DSPEC097-07 CECE07-027 808 13-Aug-2007 Asterias forbesi BIO DSPEC096-07 CECE07-026 817 13-Aug-2007 Asterias forbesi BIO DSPEC700-08 HUNT0023 833 02-Aug-2008 Asterias rubens BIO DSPEC699-08 HUNT0022 836 02-Aug-2008 Asterias rubens BIO DSPEC698-08 HUNT0021 783 02-Aug-2008 Asterias rubens BIO DSPEC697-08 HUNT0020 820 02-Aug-2008 Asterias rubens BIO DSPEC696-08 HUNT0019 827 02-Aug-2008 Asterias rubens BIO DSPEC695-08 HUNT0018 841 02-Aug-2008 Asterias rubens BIO DSPEC103-07 CECE07-033 705 13-Aug-2007 Asterias rubens BIO DSPEC102-07 CECE07-032 815 13-Aug-2007 Asterias rubens BIO

95 DSPEC101-07 CECE07-031 790 13-Aug-2007 Asterias rabens BIO NB DSPEC100-07 CECE07-030 753 13-Aug-2007 Asterias rabens BIO NB DSPEC099-07 CECE07-029 659 13-Aug-2007 Asterias rabens BIO NB DSPEC535-08 BAM00086 841 04-Jun-2008 Asterina miniata BIO BC DSPEC534-08 BAM00085 793 04-Jun-2008 Asterina miniata BIO BC DSPEC462-08 BAM00013 841 03-Jun-2008 Asterina miniata BIO BC DSPEC461-08 BAM00012 841 03-Jun-2008 Asterina miniata BIO BC DSPEC460-08 BAM00011 815 03-Jun-2008 Asterina miniata BIO BC DSPEC382-08 RBCM EC00249 627 25-Aug-2001 Asteronyx loveni RBCM BC DSPEC381-08 RBCM EC00248 658 25-Aug-2001 Asteronyx loveni RBCM BC DSPEC380-08 RBCM EC00247 658 16-Apr-2003 Asteronyx loveni RBCM BC DSPEC379-08 RBCM EC00246 647 25-Aug-2001 Asteronyx loveni RBCM BC DSPEC377-08 RBCM EC00244 658 07-Oct-2006 Asteronyx loveni RBCM BC DSPEC376-08 RBCM EC00243 658 07-Oct-2006 Asteronyx loveni RBCM BC DSPEC404-08 RBCMEC00271 658 07-Sep-2004 Asteroschema sublaeve RBCM BC CHONE012-10 09CHON-012 658 29-Oct-2009 Astropectinidae BIO DSPEC 185-08 RBCM EC00052 804 09-Oct-2006 Benthopecten acanthonotus RBCM BC DSPEC 184-08 RBCMEC00051 841 08-Sep-2004 Benthopecten acanthonotus RBCM BC DSPEC 183-08 RBCM EC00050 841 08-Sep-2004 Benthopecten acanthonotus RBCM BC DSPEC 182-08 RBCM EC00049 841 08-Sep-2004 Benthopecten acanthonotus RBCM BC DSPEC181-08 RBCM EC00048 841 08-Sep-2004 Benthopecten acanthonotus RBCM BC DSPEC 180-08 RBCM EC00047 829 08-Sep-2004 Benthopecten acanthonotus RBCM BC DSPEC 188-08 RBCM EC00055 819 07-Oct-2006 Benthopecten claviger RBCM BC DSPEC 187-08 RBCM EC00054 658 ll-Oct-2006 Benthopecten claviger RBCM BC DSPEC 186-08 RBCM EC00053 841 ll-Oct-2006 Benthopecten claviger RBCM BC DSPECO17-07 NEOCAL07-0111 829 27-Jun-2007 Brisaster latifrons RBCM BC DSPECO16-07 NEOCAL07-0110 826 27-Jun-2007 Brisaster latifrons RBCM BC

96 DSPEC015-07 NEOCAL07-0109 752 27-Jun-2007 Brisaster latifrons RBCM BC DSPEC013-07 NEOCAL07-0107 831 27-Jun-2007 Brisaster latifrons RBCM BC DSPEC004-07 NEOCAL07-0098 815 26-Jun-2007 Brisaster latifrons RBCM BC DSPEC522-08 BAM00073 841 06-Jun-2008 Brisaster latifrons BIO BC DSPEC009-07 NEOCAL07-0103 658 26-Jun-2007 Ceramaster cf. arcticus RBCM BC DSPEC008-07 NEOCAL07-0102 658 26-Jun-2007 Ceramaster cf. arcticus RBCM BC DSPEC034-07 NEOCAL07-0128 795 03-Jul-2007 Ceramaster patagonicus RBCM BC DSPEC003-07 NEOCAL07-0097 799 26-Jun-2007 Ceramaster patagonicus RBCM BC DSPEC602-08 BAM00153 841 25-Apr-2008 Ceramaster patagonicus BIO BC DSPEC601-08 BAM00152 841 25-Apr-2008 Ceramaster patagonicus BIO BC DSPEC793-09 HUNT0115 651 12-Aug-2009 Chiridota laevis BIO NB DSPEC709-08 HUNT0032 652 02-Aug-2008 Chiridota laevis BIO NB DSPEC707-08 HUNT0030 616 02-Aug-2008 Chiridota laevis BIO NB DSPEC704-08 HUNT0027 652 02-Aug-2008 Chiridota laevis BIO NB DSPEC680-08 HUNT0003 635 Ol-Aug-2008 Chiridota laevis BIO NB DSPEC140-08 RBCM EC00007 841 12-Oct-2006 Crossaster borealis RBCM BC LABBI094-09 TBLABR-094 658 14-Oct-2008 Crossaster papposus TMNPR NL ECCH024-09 INU067305 658 24-Aug-2002 Crossaster papposus BIO MB ECNN111-08 INU0631 658 25-Aug-2006 Crossaster papposus BIO MB ECNNO18-08 HLC-30263 841 10-Aug-2001 Crossaster papposus BIO NU ECNN002-08 HLC-30104 837 08-Aug-2000 Crossaster papposus BIO NU EQCS024-08 HLC-24109 808 10-May-2002 Crossaster papposus BIO BC EQCS023-08 HLC-24108 841 10-May-2002 Crossaster papposus BIO BC EQCS020-08 HLC-24102 841 16-May-2002 Crossaster papposus BIO BC DSPEC109-07 CECE07-039 824 13-Aug-2007 Crossaster papposus BIO NB DSPEC108-07 CECE07-038 798 13-Aug-2007 Crossaster papposus BIO NB DSPEC 107-07 CECE07-037 805 13-Aug-2007 Crossaster papposus BIO NB

97 OQ U U O u u U U V u U u u o U OQ CQ Z OQ CQ OQ CQ OQ CQ CQ OQ OQ OQ CQ CQ OQ OQ OQ OQ OQ OQ Z Z Z Z z

2 O O O O O O o o O u V u u u o o O O o O O o o o o o t-H M l-H l-H I—I l-H i-H l-H 1—H >-H l-H l-H l-H HH l-H i-H l-H

BI O OQ CQ OQ CQ OQ CQ OQ CQ CQ OQ CQ OQ S OQ OQ S CQ CQ CQ 1 CQ CQ CQ CQ CQ m 04 0< OH 0^ s

CO CO CO co U5 CO CO CO CZ) to CO CO CO CO CO CO CO CO CO 3 ^3 3 o o CO CO CO CO CO 3 3 3 3 3 to 3 3 CO 2 2 CO CO CO CO CO CO CO CO CO co CO CO CO to 'C O O O O co CO CO CO CH CO CO CO CO OH P O O O O CH CH CO CH PH CO P- PH T3 TJ O O O PH p PH P, | | -o -a CH CO CO CO CO CO CO & CH CO CO CO CO CO a e a a 3 TH TH tH t-H t- UH P. p. & P CH Uc IH l- UH o o o o O O o O l-H )H o CJ O O «4-i <+H' co CO CO & P CO O o O O r-H r>H r>H r-H r CO CO CO CO CO CO CO CO CO CO CO l- w •*-H CO CO co CO -*-» CO CO CO CO CO cO CO t« CO CO T3 T3 ce CO CO CO T3 T3 T3 co CO CO O O co co CO CO CO O O O O O O O O O O O CO CO s s s a s a CO CO CO CO a C a a C a fl C C S3 a C s 3 3 3 3 3 3 CO O O o D a 3 o o o u o o O TH u 3 >H )H B w o 3 3 3 3 3 3 Crossaste r papposu s l-H U U U O U 3 u u V U u u u u o o 00 00 oo 00 oo 00 ON tN tN tN tN tN oo 00 oo 00 00 O © © © © o o o O O O © © © © © © © © © © © © ON O O © © © © © © © © © © o o o O © o o © © © O © © (N -. >, a 00 00 00 00 a. P, a a CO CO CO CO- a a. P CH 3 P 3 3 3 3 3 "3 •—a •—I 3 >-^ 3 |—> < < < o i 1 < i < < I I i •—> i <3 < 1 i i 1 lO m tN 00 00 00 00 s <: r- m © oo ON co CO fN

T-H co 00 OO OO 00 oo oo OO 00 oo 00 00 00 ON 00 5- 5- O >n m >n in >n in in NO

80 3 OO 00 00 oo NO NO NO NO NO NO NO NO NO NO NO oo 00 00 00 OO oo NO oo 00

© ON 00 1^ 00 tN ^H f-H © i—i f-H f-H »-H ON OO © © © © © © i 1 i fN T-H fN © © r- co fN 1—1 O ON r- ON 00 00 ON r-- m NO >n © © © © © © © © © © NO NO NO NO NO IT) 1 1 © ON ON NO © © tN fN co co i H-l ON ON T-H T-H i-l © ON ON © © © © co Z z T-H O O o o o o Z < < < 5- ro © © © © o o o o o o o tN fN tN tN fN © © HJ HJ o o 53 o o u u 1 i i i 1 t 53 X o o o o o u z z U u U u u u u u H-l <; <

CECE07-03 6 CQ CQ © w w w 53 53 OQ CQ 53 53 53 53 53 OQ CQ CQ OQ © ON z S3 X © z z z z © © © 00 00 oo 00 00 00 i—i 1^ r- oo 00 00 00 00 00 oo o © o i • i © o © © © oo 00 00 00 00 © © o © 1 o o o © ON 00 1 1 1 1 © © © © © 1 © © © fN 1 1 1 i en co fN 1 1 1 co T-H © © NO <* 1 1 1 co ON to tN l-H ON •* in oo © o tS tN 00 oo tN r- T-H <* NO NO NO o © tN © © NO in in T-H o © © NO en r^ H W © © © U O U NO o w u © © © © © U V U u o U U NO Z z 00 Z w w W z u U u u w oo 00 oo oo w z Z W O OH O O w m w OH OH OH w o o o U u U OH Z Z OH W w OH OH OH z (73 00 OH 53 w oo O 00 53 53 w OH w a o oo u OH OH OH a oo oo oo u DSPEC106-0 7 O0 OH u Q Q Q Q o U u w ffl a Q w w Q Q t/3 on oo oo a w Q Q Q Q Q Q Q w w ECNN053-08 HLC-L13401 841 27-Jul-2001 Cucumaria frondosa BIO NU ECNN077-08 HLC-30467 838 29-Aug-1999 Cucumaria frondosa BIO NU ECNN049-08 HLC-30302 838 ll-Aug-2001 Cucumaria frondosa BIO NU ECNNO17-08 HLC-30301 815 ll-Aug-2001 Cucumaria frondosa BIO NU ECNN048-08 HLC-30166 825 30-Jul-2001 Cucumaria frondosa BIO NU ECNN003-08 HLC-30109 839 09-Aug-2000 Cucumaria frondosa BIO NU DSPEC115-07 CECE07-045 823 13-Aug-2007 Cucumaria frondosa BIO NB DSPEC114-07 CECE07-044 817 13-Aug-2007 Cucumaria frondosa BIO NB DSPEC113-07 CECE07-043 809 13-Aug-2007 Cucumaria frondosa BIO NB DSPEC 112-07 CECE07-042 802 13-Aug-2007 Cucumaria frondosa BIO NB DSPEC 111-07 CECE07-041 809 13-Aug-2007 Cucumaria frondosa BIO NB DSPEC 110-07 CECE07-040 814 13-Aug-2007 Cucumaria frondosa BIO NB DSPEC486-08 BAM00037 841 04-Jun-2008 Cucumaria miniata BIO BC DSPEC485-08 BAM00036 839 04-Jun-2008 Cucumaria miniata BIO BC DSPEC484-08 BAM00035 819 04-Jun-2008 Cucumaria miniata BIO BC DSPEC478-08 BAM00029 824 03-Jun-2008 Cucumaria miniata BIO BC DSPEC477-08 BAM00028 819 03-Jun-2008 Cucumaria miniata BIO BC DSPEC476-08 BAM00027 832 03-Jun-2008 Cucumaria miniata BIO BC DSPEC475-08 BAM00026 818 03-Jun-2008 Cucumaria miniata BIO BC DSPEC629-08 BAM00180 841 25-Apr-2008 Cucumaria pallida BIO BC DSPEC559-08 BAM00110 625 06-Jun-2008 Cucumaria pallida BIO BC DSPEC528-08 BAM00079 832 06-Jun-2008 Cucumaria pallida BIO BC DSPEC070-07 07PROBE-ECH026 800 10-Jul-2007 Cucumariidae BIO MB DSPEC671-08 BAM00222 841 25-Apr-2008 Dendraster excentricus BIO BC DSPEC670-08 BAM00221 841 25-Apr-2008 Dendraster excentricus BIO BC DSPEC669-08 BAM00220 628 25-Apr-2008 Dendraster excentricus BIO BC DSPEC668-08 BAM00219 840 25-Apr-2008 Dendraster excentricus BIO BC

99 DSPEC667-08 BAM00218 828 25-Apr-2008 Dendraster excentricus BIO BC DSPEC651-08 BAM00202 836 25-Apr-2008 Dermasterias imbricata BIO BC DSPEC650-08 BAM00201 658 25-Apr-2008 Dermasterias imbricata BIO BC DSPEC533-08 BAM00084 822 04-Jun-2008 Dermasterias imbricata BIO BC DSPEC532-08 BAM00083 832 04-Jun-2008 Dermasterias imbricata BIO BC DSPEC531-08 BAM00082 834 04-Jun-2008 Dermasterias imbricata BIO BC DSPEC530-08 BAM00081 841 04-Jun-2008 Dermasterias imbricata BIO BC DSPEC529-08 BAM00080 841 04-Jun-2008 Dermasterias imbricata BIO BC DSPEC206-08 RBCM EC00073 834 25-Aug-2001 Diplopteraster multipes RBCM BC DSPEC158-08 RBCM EC00025 658 09-Sep-2004 Dipsacaster borealis RBCM BC DSPEC715-08 HUNT0038 836 31-Jul-2008 Echinarachnius parma BIO NB DSPEC080-07 CECE07-010 767 13-Aug-2007 Echinarachnius parma BIO NB DSPEC079-07 CECE07-009 841 13-Aug-2007 Echinarachnius parma BIO NB DSPEC077-07 CECE07-007 792 13-Aug-2007 Echinarachnius parma BIO NB DSPEC076-07 CECE07-006 764 13-Aug-2007 Echinarachnius parma BIO NB DSPEC169-08 RBCM EC00036 841 04-Sep-2002 Eremicaster pacificus RBCM BC DSPEC168-08 RBCM EC00035 841 04-Sep-2002 Eremicaster pacificus RBCM BC DSPEC 162-08 RBCM EC00029 841 12-Apr-2003 Eremicaster pacificus RBCM BC DSPEC 161-08 RBCM EC00028 841 12-Apr-2003 Eremicaster pacificus RBCM BC DSPEC578-08 BAM00129 834 10-Jun-2008 Eupentacta quinquesemita BIO BC DSPEC577-08 BAM00128 841 10-Jun-2008 Eupentacta quinquesemita BIO BC DSPEC576-08 BAM00127 841 10-Jun-2008 Eupentacta quinquesemita BIO BC DSPEC482-08 BAM00033 840 03-Jun-2008 Eupentacta quinquesemita BIO BC DSPEC540-08 BAM00091 815 04-Jun-2008 Evasterias troscheli BIO BC DSPEC537-08 BAM00088 841 04-Jun-2008 Evasterias troscheli BIO BC DSPEC536-08 BAM00087 841 04-Jun-2008 Evasterias troscheli BIO BC DSPEC502-08 BAM00053 803 03-Jun-2008 Evasterias troscheli BIO BC

100 DSPEC490-08 BAM00041 841 03-Jun-2008 Evasterias troscheli BIO BC DSPEC470-08 BAM00021 840 03-Jun-2008 Evasterias troscheli BIO BC DSPEC044-07 NEOCAL07-0138 790 04-Jul-2007 Evasterias troscheli RBCM BC DSPEC541-08 BAM00092 834 04-Jun-2008 Evasterias troscheli BIO BC CHONE002-10 09CHON-002 650 12-Oct-2009 Florometra serratissima BIO ECNN041-08 HLC-30321 798 29-Jul-2001 Florometra serratissima BIO NU ECNNO19-08 HLC-30245 666 05-Aug-2001 Florometra serratissima BIO NU ECNN032-08 HLC-30140 658 29-Jul-2001 Florometra serratissima BIO NU ECNN030-08 HLC-30131 802 02-Aug-2001 Florometra serratissima BIO NU DSPEC628-08 BAM00179 835 25-Apr-2008 Florometra serratissima BIO BC DSPEC627-08 BAM00178 824 25-Apr-2008 Florometra serratissima BIO BC DSPEC626-08 BAM00177 804 25-Apr-2008 Florometra serratissima BIO BC DSPEC625-08 BAM00176 821 25-Apr-2008 Florometra serratissima BIO BC DSPEC624-08 BAM00175 802 25-Apr-2008 Florometra serratissima BIO BC DSPEC287-08 RBCMEC00154 657 08-Oct-2006 Freyellaster fecundus RBCM BC LABBI088-09 TBLABR-088 658 05-Aug-2008 Gorgonocephalus arcticus TMNPR NL DSPEC718-08 HUNT0041 621 06-Aug-2008 Gorgonocephalus arcticus BIO NB DSPEC717-08 HUNT0040 658 06-Aug-2008 Gorgonocephalus arcticus BIO NB ECNN086-08 HLC-L15002 658 20-Aug-2001 Gorgonocephalus arcticus BIO NU ECNN040-08 HLC-30309 658 20-Aug-2001 Gorgonocephalus arcticus BIO NU ECNN050-08 HLC-30307 658 20-Aug-2001 Gorgonocephalus arcticus BIO NU DSPEC073-07 CECE07-003 634 13-Aug-2007 Gorgonocephalus arcticus BIO NB DSPEC072-07 CECE07-002 566 13-Aug-2007 Gorgonocephalus arcticus BIO NB DSPEC071-07 CECE07-001 634 13-Aug-2007 Gorgonocephalus arcticus BIO NB EQCS076-08 L#QCS-018 658 10-May-2002 Gorgonocephalus eucnemis BIO BC EQCS063-08 HLC-24191 658 09-May-2002 Gorgonocephalus eucnemis BIO BC EQCS013-08 HLC-24077 658 08-May-2002 Gorgonocephalus eucnemis BIO BC

101 DSPEC630-08 BAM00181 634 25-Apr-2008 Gorgonocephalus eucnemis BIO BC DSPEC766-09 HUNT0088 643 12-Aug-2009 Henricia cf. oculata BIO NB DSPEC765-09 HUNT0087 647 ll-Aug-2009 Henricia cf. oculata BIO NB DSPEC739-08 HUNT0062 658 06-Aug-2008 Henricia cf. oculata BIO NB EQCS028-08 HLC-24126 658 10-May-2002 Henricia cf. oculata BIO BC EQCS043-08 HLC-23962 658 10-May-2002 Henricia cf. oculata BIO BC EQCS041-08 HLC-23960 658 10-May-2002 Henricia cf. oculata BIO BC DSPEC086-07 CECE07-016 658 13-Aug-2007 Henricia cf. oculata BIO NB DSPEC757-09 HUNT0079 514 09-Aug-2009 Henr LC a sanguinolenta BIO NB DSPEC738-08 HUNT0061 658 06-Aug-2008 Henr c a sanguinolenta BIO NB DSPEC618-08 BAM00169 658 25-Apr-2008 Henr IC a sp. EAC01 BIO BC DSPEC615-08 BAM00166 658 25-Apr-2008 Henr IC ia sp. EAC01 BIO BC DSPEC617-08 BAM00168 658 25-Apr-2008 Henr LCl a sp. EAC02 BIO BC DSPEC616-08 BAM00167 658 25-Apr-2008 Henr LCi a sp. EAC02 BIO BC DSPEC828-09 HUNT0150 658 17-Aug-2009 Henr LC a sp. EAC03 BIO NB DSPEC824-09 HUNT0146 658 13-Aug-2009 Henr LCi a sp. EAC03 BIO NB DSPEC801-09 HUNT0123 658 12-Aug-2009 Henr LCi a sp. EAC03 BIO NB DSPEC764-09 HUNT0086 658 ll-Aug-2009 Henr LCi a sp. EAC03 BIO NB DSPEC753-08 HUNT0076 658 13-Aug-2008 Henr LCi a sp. EAC03 BIO NB ECNN022-08 HLC-30244 658 Ol-Aug-2001 Henr LCi a sp. EAC03 BIO NU DSPEC122-07 CECE07-052 658 13-Aug-2007 Henr LCi a sp. EAC03 BIO NB DSPEC833-09 HUNT0155 606 16-Aug-2009 Henr LCL a sp. EAC04 BIO NB DSPEC830-09 HUNT0152 658 17-Aug-2009 Henr LCL a sp. EAC04 BIO NB DSPEC826-09 HUNT0148 658 17-Aug-2009 Henr LCi a sp. EAC04 BIO NB DSPEC825-09 HUNT0147 647 17-Aug-2009 Henr LCi a sp. EAC04 BIO NB DSPEC823-09 HUNT0145 650 13-Aug-2009 Henr LCi a sp. EAC04 BIO NB DSPEC819-09 HUNT0141 650 16-Aug-2009 Henr LCi a sp. EAC04 BIO NB

102 DSPEC818-09 HUNT0140 658 16-Aug-2009 Henrici a sp. EAC04 BIO NB DSPEC817-09 HUNT0139 658 16-Aug-2009 Henrici a sp. EAC04 BIO NB DSPEC815-09 HUNT0137 658 16-Aug-2009 Henric a sp. EAC04 BIO NB DSPEC814-09 HUNT0136 649 16-Aug-2009 Henric a sp. EAC04 BIO NB DSPEC813-09 HUNT0135 651 16-Aug-2009 Henric a sp. EAC04 BIO NB DSPEC812-09 HUNT0134 612 16-Aug-2009 Henric a sp. EAC04 BIO NB DSPEC808-09 HUNT0130 629 13-Aug-2009 Henric a sp. EAC04 BIO NB DSPEC807-09 HUNT0129 652 13-Aug-2009 Henric a sp. EAC04 BIO NB DSPEC806-09 HUNT0128 658 13-Aug-2009 Henric a sp. EAC04 BIO NB DSPEC789-09 HUNT0111 658 12-Aug-2009 Henric a sp. EAC04 BIO NB DSPEC773-09 HUNT0095 647 12-Aug-2009 Henric a sp. EAC04 BIO NB DSPEC769-09 HUNT0091 650 12-Aug-2009 Henric a sp. EAC04 BIO NB DSPEC762-09 HUNT0084 658 ll-Aug-2009 Henric a sp. EAC04 BIO NB DSPEC761-09 HUNT0083 658 ll-Aug-2009 Henric a sp. EAC04 BIO NB DSPEC760-09 HUNT0082 658 ll-Aug-2009 Henric a sp. EAC04 BIO NB DSPEC745-08 HUNT0068 658 10-Aug-2008 Henric a sp. EAC04 BIO NB DSPEC088-07 CECE07-018 658 13-Aug-2007 Henric a sp. EAC04 BIO NB DSPEC087-07 CECE07-017 737 13-Aug-2007 Henric a sp. EAC04 BIO NB DSPEC001-07 NEOCAL07-0095 658 25-Jun-2007 Henric la sp. EAC05 RBCM BC DSPEC834-09 HUNT0156 658 16-Aug-2009 Henric ia sp. EAC06 BIO NB DSPEC827-09 HUNT0149 639 17-Aug-2009 Henric la sp. EAC06 BIO NB DSPEC816-09 HUNT0138 658 16-Aug-2009 Henric ia sp. EAC06 BIO NB DSPEC795-09 HUNT0117 634 12-Aug-2009 Henric ia sp. EAC06 BIO NB DSPEC788-09 HUNT0110 654 12-Aug-2009 Henric ia sp. EAC06 BIO NB DSPEC783-09 HUNT0105 658 12-Aug-2009 Henric ia sp. EAC06 BIO NB DSPEC782-09 HUNT0104 658 12-Aug-2009 Henric ia sp. EAC06 BIO NB DSPEC778-09 HUNT0100 658 12-Aug-2009 Henricia sp. EAC06 BIO NB

103 DSPEC776-09 HUNT0098 658 12-Aug-2009 Henricia sp. EAC06 BIO NB DSPEC770-09 HUNT0092 658 12-Aug-2009 Henricia sp. EAC06 BIO NB DSPEC767-09 HUNT0089 658 12-Aug-2009 Henricia sp. EAC06 BIO NB DSPEC763-09 HUNT0085 650 ll-Aug-2009 Henricia sp. EAC06 BIO NB DSPEC747-08 HUNT0070 658 10-Aug-2008 Henricia sp. EAC06 BIO NB EQCS027-08 HLC-24125 599 10-May-2002 Henricia sp. EAC06 BIO BC EQCS010-08 HLC-24069 830 10-May-2002 Henricia sp. EAC06 BIO BC CHONE007-10 09CHON-007 591 12-Oct-2009 Henricia sp. EAC06 BIO DSPEC037-07 NEOCAL07-0131 658 04-Jul-2007 Henricia sp. EAC07 RBCM BC EQCS037-08 HLC-23917 658 09-May-2002 Henricia sp. EAC08 BIO BC DSPEC575-08 BAM00126 658 01-Jun-2008 Henricia sp. I EAC BIO BC DSPEC493-08 BAM00044 658 03-Jun-2008 Henricia sp. IX EAC BIO BC DSPEC492-08 BAM00043 658 03-Jun-2008 Henricia sp. IX EAC BIO BC DSPEC582-08 BAM00133 658 16-May-2008 Henricia sp. X EAC BIO BC DSPEC497-08 BAM00048 658 03-Jun-2008 Henricia sp. X EAC BIO BC DSPEC494-08 BAM00045 658 03-Jun-2008 Henricia sp. X EAC BIO BC DSPEC141-08 RBCM EC00008 841 12-Oct-2006 Heterozonias alternatus RBCM BC DSPEC257-08 RBCM EC00124 658 25-Aug-2001 Hippasteria californica RBCM BC DSPEC255-08 RBCM EC00122 654 25-Aug-2001 Hippasteria californica RBCM BC DSPEC258-08 RBCM EC00125 658 25-Aug-2001 Hippasteria californica RBCM BC DSPEC260-08 RBCM EC00127 658 10-Sep-2004 Hippasteria californica RBCM BC DSPEC160-08 RBCM EC00027 819 08-Oct-2006 Hymenodiscus pannychia RBCM BC DSPEC574-08 BAM00125 841 Ol-Jun-2008 Leptasterias hexactis BIO BC DSPEC573-08 BAM00124 841 01-Jun-2008 Leptasterias hexactis BIO BC DSPEC572-08 BAM00123 819 01-Jun-2008 Leptasterias hexactis BIO BC DSPEC571-08 BAM00122 658 01-Jun-2008 Leptasterias hexactis BIO BC DSPEC570-08 BAM00121 836 01-Jun-2008 Leptasterias hexactis BIO BC

104 O N u U CJ U CJ O U O CJ CJ CQ CQ CQ PQ PQ PQ PQ CQ CQ PQ PQ PQ PQ PQ P p CQ CQ CQ CQ CQ CQ CQ PQ PQ PQ z Z Z Z Z Z Z Z Z Z Z z z

O O O O o O O O O o O o o o o o o o o o o O o o O o

BI O PQ CQ CQ CQ CQ CQ PQ CQ CQ CQ CQ PQ PQ PQ PQ PQ CQ PQ PQ PQ PQ PQ PQ PQ PQ PQ

CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO «3 CO C/J CO CO

o o o o O o o o o CO CO CO CO CO CO CO CO cO CO CO CT5 CO CO CO CO J-l CO CO CO CO CO CO CO CO i- S-H t- l- t- >-H t- l-H Ul u Ui l-l X X X X X X X X X O O O O O O O O O O o o o o O ID o D ID ID ID o -*-• o -4—» o> ID ID c t! tJ •*-* 43 43 43 43 43 43 43 43 43 ts a t! a e -w co CO co CO CO CO CO CO CO in CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO t. u- 1- l-H i- CO CO k-i In i-i 1- t- u- u u- >- l-H >-H u kH IH I-I CO o ID O o CJ ID

CN NO NO ON 00 OO 00 00 00 00 00 00 00 00 in ON 00 00 00 00 00 00 OO 00 00 o o o o o o o o o o o o © © © © © © © © © © © © ON ON o o o o o o o o o o o o © © © © © © © © © © © © ON ON i—> i—> i—> 1—5 *-> i—> i—> 1 • i < < <: < < < 1 S3 i i < < i < < • < i < 1 < < 1 1 < < i in >n CO CN CN i i CN 1 © Ol-Jun-200 8 o o o O o © o o in CN in CN CN © © CN CN © © © © CN © © © © © CN O

*—1 co 00 00 >n CN 00 © co 00 5- en 5- 5 5- >n 00 5- >n CN in in 5" CN co >n 5- 00 00 00 00 00 NO NO NO 00 NO NO NO NO NO NO oo NO 00 00 00 in NO NO 00 00 00

CN ON 00 NO in co CN o O o 1- >n co CN NO >n © >n 1 CN CN © © © © 00 1 1 © © © © © © © © © © © •n >n © © © © © © © © o © © CN © © o o o o O NO NO H H H H co co o o o o o o o H P 1 s D z z z z z Z z z CJ i CJ < < <: s < < D D z H p p O < Z Z D D D P P BAM0012 0 PQ PQ CQ PQ PQ PQ 2 33 B B B P < PQ PQ i-H B B B B CQ B

107 EQCS009-08 HLC-24066 658 10-May-2002 Leptychaster pacificus BIO BC EQCS046-08 HLC-23979 658 10-May-2002 Leptychaster pacificus BIO BC DSPEC011-07 NEOCAL07-0105 658 26-Jun-2007 Lophaster furcilliger RBCM BC EQCS048-08 HLC-23986 658 10-May-2002 Lophaster furcilliger BIO BC EQCS035-08 HLC-23914 658 10-May-2002 Lophaster furcilliger BIO BC DSPEC303-08 RBCMEC00170 841 08-Sep-2004 Lophaster furcilliger RBCM BC DSPEC302-08 RBCMEC00169 775 08-Sep-2004 Lophaster furcilliger RBCM BC DSPEC301-08 RBCMEC00168 820 ll-Apr-2003 Lophaster furcilliger RBCM BC DSPEC300-08 RBCMEC00167 796 ll-Apr-2003 Lophaster furcilliger RBCM BC DSPEC299-08 RBCM EC00166 839 25-Aug-2001 Lophaster furcilliger RBCM BC DSPEC298-08 RBCM EC00165 841 25-Aug-2001 Lophaster furcilliger RBCM BC DSPEC027-07 NEOCAL07-0121 793 28-Jun-2007 Luidia foliolata RBCM BC DSPEC021-07 NEOCAL07-0115 807 28-Jun-2007 Luidia foliolata RBCM BC DSPEC020-07 NEOCAL07-0114 809 28-Jun-2007 Luidia foliolata RBCM BC DSPECO19-07 NEOCAL07-0113 833 28-Jun-2007 Luidia foliolata RBCM BC DSPEC018-07 NEOCAL07-0112 817 27-Jun-2007 Luidia foliolata RBCM BC EQCS066-08 HLC-24195 658 ll-May-2002 Luidia foliolata BIO BC EQCS065-08 HLC-24194 658 ll-May-2002 Luidia foliolata BIO BC EQCS026-08 HLC-24124 841 12-May-2002 Luidia foliolata BIO BC EQCS025-08 HLC-24123 838 12-May-2002 Luidia foliolata BIO BC EQCS055-08 HLC-23993 841 10-May-2002 Luidia foliolata BIO BC EQCS054-08 HLC-23992 658 10-May-2002 Luidia foliolata BIO BC EQCS053-08 HLC-23991 658 10-May-2002 Luidia foliolata BIO BC DSPEC012-07 NEOCAL07-0106 821 27-Jun-2007 Mediaster aequalis RBCM BC DSPEC007-07 NEOCAL07-0101 831 26-Jun-2007 Mediaster aequalis RBCM BC DSPEC006-07 NEOCAL07-0100 791 26-Jun-2007 Mediaster aequalis RBCM BC DSPEC005-07 NEOCAL07-0099 746 26-Jun-2007 Mediaster aequalis RBCM BC

109 D D u CJ D D Z Z CQ CQ CQ Z Z Z CQ z z z Z z Z

o o o cj cj o o o o o o o o o o o o o o o O o o o l-H M l-H h-H l-H l-H l-H l-H l-H ^H i-H l-H l-H BI O 3 DQ CQ CQ CQ CQ CQ CQ CQ 3 3 CQ CQ CQ CQ CQ CQ CQ CQ CQ CQ CQ DQ CQ

C3 C3 H—» a c s S S a s B S s s s S S S S S S S a a a a a a a 4> 3! 31 3! 3t 3S 3S 31 3S 31 3 4> s 3 3 D 4) 4) 4) 4) 4) 4) 3* 4) 4) i> CS 3 4) O 4> 4) 4) 4) 4) 4) 4) 4) •*-» O O O O O 4> 4) 4) 4> O U 4) 4> •o *2 •3 •3 B O O O 4> 4) .3 CO co CO CO i-i kH Ui l-i o l-H tH hH l-H s- t- S-H l-H tH kH l-H u IS C3 C3 OS !)• 4) 4) l-l 4) 4) 4) 4) 4) 4> 4) 4) 4) 4) 4) es t« 4) CO 4) CO 4) CO CO CO CO CO nj 43 43 0) 4) CO sfl CO CO CO 43 43 43 43 W5 CO 43 -4—» S3 <3 a a S3 S3 S3 S3 S3 S3 S3 S3 S3 S3 S3 S3 S3 S3 e S3 C a e a 4) e 4) 4) 4) 4) a 4) 4) 4> 4> 4) 4) 4) 4) 4) 4) ni CO C3 u 4) 4» o o o 4> 4) 4> o 4) 4) O 4> 4> O O a O O 4) 4> 4) 4) o o O O o 2 o 4) o o o o o O o o o s s IS O o o o O 43 2 2 2 2 2 2 OH IS 43 o 43 43 43 43 o 43 43 OH 43 IS 43 OH 43 O, 43 43 43 43 43 a. IS IS IS J3 &, OH & 43 OH 43 O, O. OH Ophiacanth a bidentat O OH OH OH O &, & O OH O a. o OH O O O o O o o O o O O o o o O o o o o O o o ON NO NO NO NO >n >n O o O o ON ON ON ON ON ON ON ON ON ON ON o o © o o o o o ON ON o o O o o o o o o o o o o o O o o o Os ON o o o O o O o o o o o o CN o o o o o o o o o o CN CN 4) 4) 4) 4) O oo 3t 3 o 4) o o o O o 31 31 4) < o < • o <; < < o 1 I <: < o < o o 1 ON o o 1 o o o o o o CN o 00 1 1 1 o o 1 o en 1 en CN) 1 1 20-Aug-200 1 O 1 o o o o en 1 © CN r- en en o o CN

~~00 00 00 00 00 00 00 00 00 oo OO oo ON en NO 00 OO fN en en 00 00 n in 65 8 NO NO NO NO NO NO NO NO NO NO NO NO NO NO NO NO NO NO NO NO NO NO~~

~~o ON 00 o ON ON Os oo n 1 ON 1~~

111 DSPEC084-07 CECE07-014 791 13-Aug-2007 Ophiopholi s aculeata BIO NB DSPEC083-07 CECE07-013 797 13-Aug-2007 Ophiopholi s aculeata BIO NB DSPEC082-07 CECE07-012 777 13-Aug-2007 Ophiopholi s aculeata BIO NB DSPEC081-07 CECE07-011 797 13-Aug-2007 Ophiophol s aculeata BIO NB CCANN523-09 09PROBE-02029 658 30-Jul-2009 Ophiophol s aculeata BIO MB ECCHO14-09 08PROBE22401 658 15-Jul-2008 Ophiophol s aculeata BIO MB EQCS003-08 HLC-24060 658 15-May-2002 Ophiophol s japonica BIO BC EQCS002-08 HLC-24059 658 15-May-2002 Ophiophol s japonica BIO BC DSPEC755-08 BAM00229 841 16-May-2008 Ophiophol s kennerlyi BIO BC DSPEC587-08 BAM00138 841 16-May-2008 Ophiophol s kennerlyi BIO BC DSPEC586-08 BAM00137 817 16-May-2008 Ophiophol s kennerlyi BIO BC DSPEC584-08 BAM00135 835 16-May-2008 Ophiophol s kennerlyi BIO BC DSPEC580-08 BAM00131 841 16-May-2008 Ophiophol is kennerlyi BIO BC DSPEC579-08 BAM00130 841 16-May-2008 Ophiophol is kennerlyi BIO BC DSPEC543-08 BAM00094 821 04-Jun-2008 Ophiophol is kennerlyi BIO BC DSPEC489-08 BAM00040 841 03-Jun-2008 Ophiophol is kennerlyi BIO BC DSPEC488-08 BAM00039 841 03-Jun-2008 Ophiophol is kennerlyi BIO BC EQCS016-08 HLC-24095 639 08-May-2002 Ophiophol is sp. EAC01 BIO BC EQCS007-08 HLC-24064 664 08-May-2002 Ophiophol issp. EAC01 BIO BC EQCS005-08 HLC-24062 647 10-May-2002 Ophiophol issp. EAC01 BIO BC EQCS004-08 HLC-24061 656 10-May-2002 Ophiophol is sp. EAC01 BIO BC DSPEC361-08 RBCM EC00228 658 25-Aug-2001 Ophiophol is sp. EAC01 RBCM BC DSPEC341-08 RBCM EC00208 658 07-Oct-2006 Ophiophthalmus cataleimmoidus RBCM BC DSPEC324-08 RBCM EC00191 584 ll-Oct-2006 Ophiophthalmus normani RBCM BC DSPEC321-08 RBCM ECOO188 530 07-Oct-2006 Ophiophthalmus normani RBCM BC DSPEC319-08 RBCM ECOO186 658 07-Oct-2005 Ophiophthalmus normani RBCM BC CHONE014-10 09CHON-014 658 29-Oct-2009 Ophiopleura borealis BIO

112 CHONE013-10 09CHON-013 658 29-Oct-2009 Ophiopleura borealis BIO CHONE026-10 09CHON-026 658 12-Oct-2009 Ophiopleura borealis BIO CHONE025-10 09CHON-025 656 12-Oct-2009 Ophiopleura borealis BIO CHONE024-10 09CHON-024 645 12-Oct-2009 Ophiopleura borealis BIO CHONE023-10 09CHON-023 658 12-Oct-2009 Ophiopleura borealis BIO CHONE016-10 09CHON-016 658 Ophiopleura borealis BIO CHONE015-10 09CHON-015 658 Ophiopleura borealis BIO DSPEC316-08 RBCMEC00183 658 07-Sep-2004 Ophioscolex corynetes RBCM BC DSPEC314-08 RBCMEC00181 658 25-Aug-2001 Ophioscolex corynetes RBCM BC DSPEC347-08 RBCMEC00214 658 25-Aug-2001 Ophiosphalma jolliense RBCM BC DSPEC346-08 RBCMEC00213 647 25-Aug-2001 Ophiosphalma jolliense RBCM BC DSPEC345-08 RBCMEC00212 658 25-Aug-2001 Ophiosphalma jolliense RBCM BC DSPEC344-08 RBCMEC00211 658 25-Aug-2001 Ophiosphalma jolliense RBCM BC DSPEC343-08 RBCMEC00210 658 25-Aug-2001 Ophiosphalma jolliense RBCM BC DSPEC677-08 BAM00228 658 25-Apr-2008 Ophiura luetkenii BIO BC DSPEC676-08 BAM00227 658 25-Apr-2008 Ophiura luetkenii BIO BC DSPEC675-08 BAM00226 629 25-Apr-2008 Ophiura luetkenii BIO BC DSPEC674-08 BAM00225 628 25-Apr-2008 Ophiura luetkenii BIO BC DSPEC673-08 BAM00224 658 25-Apr-2008 Ophiura luetkenii BIO BC DSPEC387-08 RBCM EC00254 658 31-May-2001 Ophiura luetkenii RBCM BC LABBI089-09 TBLABR-089 658 07-Aug-2008 Ophiura sarsii TMNPR NL EQCSO17-08 HLC-24096 657 08-May-2002 Ophiura sarsii BIO BC EQCS056-08 HLC-24014 658 08-May-2002 Ophiura sarsii BIO BC EQCS044-08 HLC-23972 656 08-May-2002 Ophiura sarsii BIO BC ECNN021-08 HLC-30089 658 08-Aug-2001 Ophiura sp. EAC01 BIO NU ECNN011-08 HLC-30064 658 01-Aug-2000 Ophiura sp. EAC01 BIO NU ECNNO13-08 HLC-30042 631 01-Aug-2000 Ophiura sp. EAC01 BIO NU

113 CHONE019-10 09CHON-019 658 28-Oct-2009 Oph ura sp. EAC01 BIO CHONE018-10 09CHON-018 658 28-Oct-2009 Oph ura sp. EAC01 BIO CHONE017-10 09CHON-017 636 28-Oct-2009 Oph ura sp. EAC01 BIO LABBI087-09 TBLABR-087 658 04-Aug-2008 Oph uroi dsp. EAC01 TMNPR NL LABBI086-09 TBLABR-086 640 04-Aug-2008 Oph uroi dsp. EAC01 TMNPR NL DSPEC732-08 HUNT0055 658 06-Aug-2008 Oph luro dsp. EAC01 BIO NB ECNN109-08 HLC-L20301 658 10-Aug-2001 Oph luro dsp. EAC01 BIO NU ECNN101-08 HLC-L20202 658 10-Aug-2001 Oph uro dsp. EAC01 BIO NU ECNN 100-08 HLC-L20201 637 10-Aug-2001 Oph uro dsp. EAC01 BIO NU ECNN158-09 HLC-30783 658 25-Aug-1995 Oph uro dsp. EAC01 BIO NU ECNN027-08 HLC-30025 658 10-Aug-2001 Oph uro dsp. EAC01 BIO NU ECCH012-09 08PROBE25403 658 15-Jul-2008 Oph uro dsp. EAC01 BIO MB ECCH011-09 08PROBE25402 658 15-Jul-2008 Oph uro dsp. EAC01 BIO MB ECCHO10-09 08PROBE25401 658 15-Jul-2008 Oph uro dsp. EAC01 BIO MB ECCH004-09 08PROBE24802 658 15-Jul-2008 Oph mro dsp. EAC01 BIO MB ECCH003-09 08PROBE24801 658 15-Jul-2008 Oph mro dsp. EAC01 BIO MB ECCHO 17-09 08PROBE24202 658 17-Jul-2008 Oph mro dsp. EAC01 BIO MB ECCHO 16-09 08PROBE242 01 658 17-Jul-2008 Oph luro dsp. EAC01 BIO MB ECCH008-09 08PROBE23001 658 15-Jul-2008 Oph iuro dsp. EAC01 BIO MB ECCH007-09 08PROBE211 03 658 15-Jul-2008 Oph mro d sp. EAC01 BIO MB ECCH001-09 08PROBE18901 658 15-Jul-2008 Oph iuro d sp. EAC01 BIO MB DSPEC066-07 07PROBE-ECH022 634 17-Jul-2007 Oph iuro d sp. EAC01 BIO MB DSPEC065-07 07PROBE-ECH021 627 17-Jul-2007 Oph iuro id sp. EAC01 BIO MB DSPEC064-07 07PROBE-ECH020 658 17-Jul-2007 Oph iuro id sp. EAC01 BIO MB DSPEC062-07 07PROBE-ECH018 658 19-Jul-2007 Oph iuro id sp. EAC01 BIO MB DSPEC056-07 07PROBE-ECH012 634 18-M-2007 Oph iuro id sp. EAC01 BIO MB DSPEC055-07 07PROBE-ECH011 634 18-Jul-2007 Ophiuroid sp. EAC01 BIO MB

114 CHONE043-10 09CHON-043 658 27-Oct-2009 Ophiuroid sp. EAC01 BIO CHONE040-10 09CHON-040 658 27-Oct-2009 Ophiuroid sp. EAC01 BIO CHONE039-10 09CHON-039 658 27-Oct-2009 Ophiuroid sp. EAC01 BIO ECNN106-08 HLC-L02802 658 25-Jul-2001 Ophiuroid sp. EAC02 BIO NU ECNN105-08 HLC-L02801 658 25-Jul-2001 Ophiuroid sp. EAC02 BIO NU ECNN 108-08 HLC-L02602 658 28-Jul-2001 Ophiuroid sp. EAC02 BIO NU ECNN 107-08 HLC-L02601 658 28-Jul-2001 Ophiuroid sp. EAC02 BIO NU ECNN035-08 HLC-30228 658 31-Aug-2001 Ophiuroid sp. EAC02 BIO NU EQCS030-08 HLC-23906 658 12-May-2002 Orthasterias koehleri BIO BC DSPEC634-08 BAM00185 841 25-Apr-2008 Orthasterias koehleri BIO BC DSPEC632-08 BAM00183 841 25-Apr-2008 Orthasterias koehleri BIO BC DSPEC631-08 BAM00182 835 25-Apr-2008 Orthasterias koehleri BIO BC DSPEC523-08 BAM00074 826 06-Jun-2008 Orthasterias koehleri BIO BC DSPEC501-08 BAM00052 841 03-Jun-2008 Orthasterias koehleri BIO BC DSPEC437-08 RBCM EC00304 841 14-Apr-2003 Pannychia moseleyi RBCM BC DSPEC032-07 NEOCAL07-0126 778 29-Jun-2007 Parastichopus californicus RBCM BC DSPEC603-08 BAM00154 841 25-Apr-2008 Parastichopus californicus BIO BC DSPEC527-08 BAM00078 841 06-Jun-2008 Parastichopus californicus BIO BC DSPEC526-08 BAM00077 838 06-Jun-2008 Parastichopus californicus BIO BC DSPEC525-08 BAM00076 841 06-Jun-2008 Parastichopus californicus BIO BC DSPEC234-08 RBCMEC00101 658 08-Sep-2004 Pectinaster agassizi RBCM BC DSPEC235-08 RBCM ECOO102 658 08-Sep-2004 Pectinaster agassizi RBCM BC DSPEC237-08 RBCM ECOO104 658 08-Sep-2004 Pectinaster agassizi RBCM BC EQCS012-08 HLC-24072 658 14-May-2002 Pedicellaster magister BIO BC EQCSO11-08 HLC-24071 658 15-May-2002 Pedicellaster magister BIO BC ECNN083-08 HLC-L14201 841 12-Aug-2001 Pentamera calcigera BIO NU ECNN084-08 HLC-L13701 841 27-Jul-2001 Pentamera calcigera BIO NU

116 DSPEC657-08 BAM00208 630 25-Apr-2008 Pisaster ochraceus BIO BC CHONE036-10 09CHON-036 658 12-Oct-2009 Pontaster tenuispinus BIO CHONE035-10 09CHON-035 658 12-Oct-2009 Pontaster tenuispinus BIO CHONE034-10 09CHON-034 658 12-Oct-2009 Pontaster tenuispinus BIO CHONE033-10 09CHON-033 658 12-Oct-2009 Pontaster tenuispinus BIO DSPEC263-08 RBCMEC00130 658 08-Sep-2004 Pseudarchaster dissonus RBCM BC DSPEC264-08 RBCMEC00131 658 08-Sep-2004 Pseudarchaster dissonus RBCM BC DSPEC253-08 RBCM EC00120 658 12-Apr-2003 Pseudarchaster dissonus RBCM BC DSPEC252-08 RBCMEC00119 658 12-Apr-2003 Pseudarchaster dissonus RBCM BC DSPEC266-08 RBCM EC00133 658 12-Oct-2006 Pseudarchaster dissonus RBCM BC DSPEC267-08 RBCM ECOO134 658 12-Oct-2006 Pseudarchaster dissonus RBCM BC DSPEC277-08 RBCM ECOO 144 841 25-Aug-2001 Pseudarchaster parelii RBCM BC DSPEC281-08 RBCM EC00148 803 06-Apr-2003 Pseudarchaster parelii alascensis RBCM BC DSPEC280-08 RBCM EC00147 615 06-Apr-2003 Pseudarchaster parelii alascensis RBCM BC DSPEC279-08 RBCM ECOO 146 821 07-Sep-2004 Pseudarchaster parelii alascensis RBCM BC DSPEC278-08 RBCM ECOO 145 750 07-Sep-2004 Pseudarchaster parelii alascensis RBCM BC DSPEC276-08 RBCM ECOO 143 841 13-Apr-2003 Pseudarchaster parelii alascensis RBCM BC DSPEC275-08 RBCM ECOO 142 831 13-Apr-2003 Pseudarchaster parelii alascensis RBCM BC DSPEC273-08 RBCM ECOO 140 804 30-Aug-2004 Pseudarchaster parelii alascensis RBCM BC DSPEC424-08 RBCMEC00291 620 25-Aug-2001 Pseudostichopus mollis RBCM BC DSPEC423-08 RBCM EC00290 652 25-Aug-2001 Pseudostichopus mollis RBCM BC DSPEC421-08 RBCM EC00288 628 17-Oct-2006 Pseudostichopus tuberosus RBCM BC DSPEC420-08 RBCM EC00287 652 08-Oct-2006 Pseudostichopus tuberosus RBCM BC DSPEC177-08 RBCM EC00044 841 06-Apr-2003 Psilaster pectinatus RBCM BC DSPEC176-08 RBCM EC00043 815 07-Oct-2006 Psilaster pectinatus RBCM BC DSPEC 173-08 RBCM EC00040 637 13-Oct-2006 Psilaster pectinatus RBCM BC DSPEC 172-08 RBCM EC00039 635 13-Oct-2006 Psilaster pectinatus RBCM BC

~~117 u V O U D3 CQ CQ CQ OQ CQ CQ CQ CQ CQ CQ CQ CQ CQ OQ OQ m CQ Z Z Z CQ CQ CQ 2 2 2 2 2 2 2 z z Z Z Z 2 2 2 z Z Z Z~~

ft* o O o g CM g g o o g g o o o o o o o g o o o o o o o l-H M 1—1 Z CQ I—H M 1—1 1—I l-H l-H M 1—H >-H >-H l-H l-H l-H l-H CQ CQ 5 S m S CQ CQ OQ CQ CQ S CQ CQ CQ OQ CQ CQ OQ RBC M OQ 5 CQ CQ 2 H

CO co CO co a> CO CO CO -o ig 3 3 3 "2 "2 CM CM 'o 'o 'o 'o « CM ca e a S3 a o o o o o o o o o o o o o o o o £ •2 o o o k* k-i k-i kH k-i k-i S-H u- i- kH t- k^ ki kH a o X 4= X X) X5 X> a « c x> a x> S3 43 r* r« u o o M-r H M-H H-M ^+M <4M OH CM CS 43 o M-H & i 43 CM co co (/I co CO CO co CO CO CO CO CO i CO CO CO CO CO CO CO CO co CO CM CO 3 3 3 3 3 3 3 3 3 3 3 3 ^M 3 3 3 3 3 3 CO 3 3 3 3 3 O O O O O O O O O O O O O O CO O O O O O O 3 co CO o CO CO O O en O CO CM co CO CO CO CO CO CO CO CO 3 CO CO CO CO CO CO Psilaste r pectinatu s CO CM CM CO CM O CO CH CM CH CM CM CM CM CM CM CM CM CM CM CM CH CM CM CM O CM CO CM CM CO 00 oo 00 00 00 00 SO so SO SO SO SO SO © CM Os 00 © © © © OS Os o © © © © © © © © OS © © © © © © © © © © © © o © © © © © © © © © © © © © © © © © © © © O © CN fN CN CN CN fN CN fN fN Os fN fN fN fN fN © © fN fN fN CN fN CN fN 1 i i fN CN CN CN i i i k* u. fc« 60 60 60 60 60 60 60 60 60 60 60 60 60 60 i 60 60 00 oo a 3 3 ex CM 3 3 3 3 3 3 3 3 3 3 3 3 "3 —» 3 3 3 3 3 < i i < < i —> i fN in 1 in i i i !—1 i 09-Oct-200 6 en en en SO o co in in fN en i—i • © in © CN in m in © m en © fN fN fN fN CN CN CN ©

~~as o CN CN fN 00 © 00 in CN CN i—i oo fN t"- i—H fN in © r- en n in © co © in in fN in in en in fN en 5- en 5- SO SO so so SO so so SO so SO SO SO SO so so 00 so so so SO SO SO in tr 00 00~~

~~in "si" CN CN Os © © en © 00 SO U ot as co •3- co fN CN © SO in 00 © © © © © © © © <* so in in U in o © 1 1 1 in en © © © © © 1 in en en •~~

119 DSPEC217-08 RBCM EC00084 612 10-Apr-2003 Sagenaster evermanni RBCM BC DSPEC216-08 RBCM EC00083 655 10-Apr-2003 Sagenaster evermanni RBCM BC DSPEC210-08 RBCM EC00077 658 25-Aug-2001 Sagenaster evermanni RBCM BC DSPEC209-08 RBCM EC00076 621 25-Aug-2001 Sagenaster evermanni RBCM BC DSPEC208-08 RBCM EC00075 658 25-Aug-2001 Sagenaster evermanni RBCM BC DSPEC644-08 BAM00195 841 25-Apr-2008 Solaster dawsoni BIO BC DSPEC643-08 BAM00194 841 25-Apr-2008 Solaster dawsoni BIO BC DSPEC500-08 BAM00051 826 03-Jun-2008 Solaster dawsoni BIO BC DSPEC499-08 BAM00050 824 03-Jun-2008 Solaster dawsoni BIO BC DSPEC498-08 BAM00049 822 03-Jun-2008 Solaster dawsoni BIO BC LABBI091-09 TBLABR-091 658 05-Aug-2008 Solaster endeca TMNPR NL ECNN026-08 HLC-30264 830 30-Jul-1999 Solaster endeca BIO NU DSPEC105-07 CECE07-035 805 13-Aug-2007 Solaster endeca BIO NB DSPEC104-07 CECE07-034 841 13-Aug-2007 Solaster endeca BIO NB DSPEC092-07 CECE07-022 841 13-Aug-2007 Solaster endeca BIO NB DSPEC091-07 CECE07-021 836 13-Aug-2007 Solaster endeca BIO NB DSPEC638-08 BAM00189 801 25-Apr-2008 Solaster endeca BIO BC DSPEC637-08 BAM00188 841 25-Apr-2008 Solaster endeca BIO BC DSPEC151-08 RBCMEC00018 656 12-Oct-2006 Solaster paxillatus RBCM BC DSPEC139-08 RBCM EC00006 841 06-Oct-2006 Solaster paxillatus RBCM BC DSPEC138-08 RBCM EC00005 841 06-Oct-2006 Solaster paxillatus RBCM BC DSPEC137-08 RBCM EC00004 841 ll-Oct-2006 Solaster paxillatus RBCM BC DSPEC136-08 RBCM EC00003 841 ll-Oct-2006 Solaster paxillatus RBCM BC DSPEC135-08 RBCM EC00002 841 ll-Oct-2006 Solaster paxillatus RBCM BC DSPEC 134-08 RBCMEC00001 841 ll-Oct-2006 Solaster paxillatus RBCM BC ECNN004-08 HLC-30096 841 Ol-Aug-2001 Solaster sp.EACOl BIO NU DSPEC642-08 BAM00193 837 25-Apr-2008 Solaster sp.EACOl BIO BC

120 DSPEC636-08 BAM00187 841 25-Apr-2008 Solastersp. EAC01 BIO BC DSPEC641-08 BAM00192 658 25-Apr-2008 Solaster stimpsoni BIO BC DSPEC640-08 BAM00191 658 25-Apr-2008 Solaster stimpsoni BIO BC DSPEC639-08 BAM00190 658 25-Apr-2008 Solaster stimpsoni BIO BC DSPEC506-08 BAM00057 658 03-Jun-2008 Solaster stimpsoni BIO BC DSPEC504-08 BAM00055 658 03-Jun-2008 Solaster stimpsoni BIO BC DSPEC410-08 RBCM EC00277 635 30-Aug-2004 Sperosoma biseriatum RBCM BC DSPEC391-08 RBCM EC00258 658 10-Sep-2004 Stegophiura carinata RBCM BC LABBI083-09 TBLABR-083 647 31-Jul-2008 Stephanasterias albula TMNPR NL ECNN042-08 HLC-30330 821 09-Aug-2001 Stephanasterias albula BIO NU LABBI084-09 TBLABR-084 658 31-Jul-2008 Strongylocentrotus droebachiensis TMNPR NL DSPEC035-07 NEOCAL07-0129 781 03-Jul-2007 Strongylocentrotus droebachiensis RBCM BC DSPEC133-07 CECE07-063 747 13-Aug-2007 Strongylocentrotus droebachiens s BIO NB DSPEC132-07 CECE07-062 824 13-Aug-2007 Strongylocentrotus droebachiensis BIO NB DSPEC131-07 CECE07-061 543 13-Aug-2007 Strongylocentrotus droebachiensis BIO NB DSPEC130-07 CECE07-060 800 13-Aug-2007 Strongylocentrotus droebachiensis BIO NB DSPEC129-07 CECE07-059 841 13-Aug-2007 Strongylocentrotus droebachiensis BIO NB DSPEC128-07 CECE07-058 761 13-Aug-2007 Strongylocentrotus droebachiensis BIO NB DSPEC592-08 BAM00143 841 25-Apr-2008 Strongylocentrotus droebachiensis BIO BC DSPEC591-08 BAM00142 841 25-Apr-2008 Strongylocentrotus droebachiensis BIO BC DSPEC590-08 BAM00141 823 25-Apr-2008 Strongylocentrotus droebachiensis BIO BC DSPEC589-08 BAM00140 841 25-Apr-2008 Strongylocentrotus droebachiensis BIO BC DSPEC588-08 BAM00139 841 25-Apr-2008 Strongylocentrotus droebachiensis BIO BC DSPEC581-08 BAM00132 841 16-May-2008 Strongylocentrotus droebachiensis BIO BC EQCS074-08 HLC-24217 840 10-May-2002 Strongylocentrotus fragilis BIO BC EQCS047-08 HLC-23980 839 10-May-2002 Strongylocentrotus fragilis BIO BC EQCS039-08 HLC-23940 824 10-May-2002 Strongylocentrotus fragilis BIO BC

121 EQCS038-08 HLC-23922 841 10-May-2002 Strongylocentrotus fragilis BIO BC EQCS034-08 HLC-23913 772 10-May-2002 Strongylocentrotus fragilis BIO BC DSPEC666-08 BAM00217 642 25-Apr-2008 Strongylocentrotus franciscanus BIO BC DSPEC665-08 BAM00216 699 25-Apr-2008 Strongylocentrotus franciscanus BIO BC DSPEC664-08 BAM00215 841 25-Apr-2008 Strongylocentrotus franciscanus BIO BC DSPEC663-08 BAM00214 658 25-Apr-2008 Strongylocentrotus franciscanus BIO BC DSPEC662-08 BAM00213 817 25-Apr-2008 Strongylocentrotus franciscanus BIO BC DSPEC510-08 BAM00061 838 03-Jun-2008 Strongylocentrotus franciscanus BIO BC DSPEC509-08 BAM00060 613 03-Jun-2008 Strongylocentrotus franciscanus BIO BC DSPEC508-08 BAM00059 841 03-Jun-2008 Strongylocentrotus franciscanus BIO BC DSPEC507-08 BAM00058 658 03-Jun-2008 Strongylocentrotus franciscanus BIO BC DSPEC483-08 BAM00034 658 03-Jun-2008 Strongylocentrotus franciscanus BIO BC CHONE006-10 09CHON-006 619 28-Oct-2009 Strongylocentrotus pallidus BIO CHONE005-10 09CHON-005 619 28-Oct-2009 Strongylocentrotus pallidus BIO CHONE004-10 09CHON-004 658 28-Oct-2009 Strongylocentrotus pallidus BIO CHONE003-10 09CHON-003 658 28-Oct-2009 Strongylocentrotus pallidus BIO ECNN145-08 INU067303 650 24-Aug-2006 Strongylocentrotus pallidus BIO MB ECNN144-08 INU0673 02 658 24-Aug-2006 Strongylocentrotus pallidus BIO MB ECNN143-08 INU0673_01 658 24-Aug-2006 Strongylocentrotus pallidus BIO MB ECNN137-08 INU0672_02 658 23-Aug-2006 Strongylocentrotus pallidus BIO MB ECNN136-08 INU067201 658 23-Aug-2006 Strongylocentrotus pallidus BIO MB ECNN129-08 INU066402 658 25-Aug-2006 Strongylocentrotus pallidus BIO MB ECNN128-08 INU066401 658 25-Aug-2006 Strongylocentrotus pallidus BIO MB ECNN135-08 INU0660 658 25-Aug-2006 Strongylocentrotus pallidus BIO MB ECCH023-09 INU063806 658 25-Aug-2006 Strongylocentrotus pallidus BIO MB ECCH022-09 INU063805 658 25-Aug-2006 Strongylocentrotus pallidus BIO MB ECCH021-09 INU063804 658 25-Aug-2006 Strongylocentrotus pallidus BIO MB

122 ECCH020-09 INU0638_03 658 25-Aug-2006 Strongylocentrotus pallidus BIO MB ECCHO19-09 INU0638 02 658 25-Aug-2006 Strongylocentrotus pallidus BIO MB ECCHO18-09 INU063801 658 25-Aug-2006 Strongylocentrotus pallidus BIO MB ECNN098-08 HLC-30466 840 22-Aug-2000 Strongylocentrotus pallidus BIO NU EQCS061-08 HLC-24085 837 15-May-2002 Strongylocentrotus pallidus BIO BC DSPEC515-08 BAM00066 837 03-Jun-2008 Strongylocentrotus purpuratus BIO BC DSPEC514-08 BAM00065 840 03-Jun-2008 Strongylocentrotus purpuratus BIO BC DSPEC513-08 BAM00064 819 03-Jun-2008 Strongylocentrotus purpuratus BIO BC DSPEC512-08 BAM00063 830 03-Jun-2008 Strongylocentrotus purpuratus BIO BC DSPEC511-08 BAM00062 818 03-Jun-2008 Strongylocentrotus purpuratus BIO BC ECNN008-08 HLC-30005 837 09-Aug-2000 Strongylocentrotus sp. EAC01 BIO NU ECNN007-08 HLC-30001 824 16-Aug-1999 Strongylocentrotus sp. EAC01 BIO NU DSPEC649-08 BAM00200 816 25-Apr-2008 Stylasterias forreri BIO BC DSPEC648-08 BAM00199 821 25-Apr-2008 Stylasterias forreri BIO BC DSPEC647-08 BAM00198 840 25-Apr-2008 Stylasterias forreri BIO BC DSPEC646-08 BAM00197 841 25-Apr-2008 Stylasterias forreri BIO BC DSPEC645-08 BAM00196 825 25-Apr-2008 Stylasterias forreri BIO BC DSPEC466-08 BAM00017 817 03-Jun-2008 Stylasterias forreri BIO BC DSPEC465-08 BAM00016 820 03-Jun-2008 Stylasterias forreri BIO BC DSPEC464-08 BAM00015 819 03-Jun-2008 Stylasterias forreri BIO BC DSPEC463-08 BAM00014 819 03-Jun-2008 Stylasterias forreri BIO BC DSPEC178-08 RBCM EC00045 841 25-Aug-2001 Thrissacanthias penicillatus RBCM BC DSPEC822-09 HUNT0144 658 ll-Aug-2009 Thyonidium drummondii BIO NB DSPEC821-09 HUNT0143 653 12-Aug-2009 Tfayonidium drummondii BIO NB DSPEC751-08 HUNT0074 637 13-Aug-2008 Thyonidium drummondii BIO NB DSPEC750-08 HUNT0073 651 13-Aug-2008 Thyonidium drummondii BIO NB DSPEC741-08 HUNT0064 619 10-Aug-2008 Thyonidium drummondii BIO NB

123 DSPEC197-08 RBCM EC00064 799 30-Aug-2004 Zoroaster ophiurus RBCM BC DSPEC196-08 RBCM EC00063 804 08-Sep-2004 Zoroaster ophiurus RBCM BC DSPEC195-08 RBCM EC00062 814 08-Sep-2004 Zoroaster ophiurus RBCM BC DSPEC 194-08 RBCMEC00061 800 08-Sep-2004 Zoroaster ophiurus RBCM BC DSPEC193-08 RBCM EC00060 810 08-Sep-2004 Zoroaster ophiurus RBCM BC DSPEC192-08 RBCM EC00059 753 04-Sep-2001 Zoroaster ophiurus RBCM BC

124 Appendix 3: Original neighbour-joining trees based on K2P distances for the A) Class Asteroidea (71 species, n = 415); B) Class Echinoidea (10 species, n = 73), C) Class Holothuroidea (20 species, n = 117) and D) Class Ophiuroidea (30 species, n = 194). These trees represent the original state of the compressed trees in Chapter 1, Figure 2. Clusters representing potentially new species have been highlighted; Solaster sp. EAC01 (in A) and Strongylocentrotus sp. EAC01 (in B). DSPEC060-07|Leptasterias polaris DSPEC048-07|Leptasterias polaris A) Asteroidea DSPEC050-07|Leptasterias polaris DSPEC047-07|Leptasterias polaris DSPEC059-07|Leptasterias polaris DSPEC057-07|Leptasterias polaris DSPEC049-07|Leptasterias polaris DSPEC046-07|Leptasterias polaris DSPEC045-07|Leptasterias polaris DSPEC058-07|Leptasterias polaris ECCH032-09|l_eptasterias polaris ECCH029-09|Leptasterias polaris ECNN001-08|Leptasterias polaris ECCH031-09|Leptasterias polaris ECCH006-09|Leptasterias polaris ECCH025-09|Leptasterias polaris ECNN142-08|Leptasterias polaris ECCH028-09|Leptasterias polaris ECNN130-08|Leptasterias polaris ECNN123-08|Leptasterias polaris ECNN146-08|Leptasterias polaris ECCH013-09|Leptasterias polaris ECCH030-09|Leptasterias polaris ECNN010-08|Leptasterias polaris ECNN131-08|Leptasterias polaris ECNN140-08|l_eptasterias polaris ECNN122-08|Leptasterias polaris ECNN141-08|Leptasterias polaris ECNN133-08|Leptasterias polaris 100 ECCH026-09|Leptasterias polaris ECNN139-08|Leptasterias polaris ECNN134-08|Leptasterias polaris ECCH005-09|Leptasterias polaris 99 DSPEC572-08|Leptasterias hexactis "1 DSPEC573-08|Leptasterias hexactis DSPEC571-08|Leptasterias hexactis

125 DSPEC689-08|Leptasterias littoralis DSPEC701-08|Leptasterias littoralis DSPEC683-08|Leptasterias littoralis DSPEC681-08|Leptasterias littoralis DSPEC691-08|Leptasterias littoralis DSPEC688-081Leptasterias littoralis DSPEC682-08|Leptasterias littoralis DSPEC692-081Leptasterias littoralis DSPEC690-08|Leptasterias littoralis DSPEC805-091Leptasterias littoralis DSPEC684-08|Leptasterias littoralis ECNN121-08|Leptasterias littoralis ECCH01 5-091Leptasterias littoralis ECNN 120-08|Leptasterias littoralis 100 ECCH027-091Leptasterias littoralis DSPEC053-071Leptasterias littoralis DSPEC052-071Leptasterias littoralis DSPEC051-07|Leptasterias littoralis DSPEC061-07|Leptasterias littoralis ECNN005-081Leptasterias littoralis ECNN023-08|Leptasterias littoralis ECNN016-081Leptasterias littoralis ECNN090-08|Leptasterias littoralis ECNN088-08|Leptasterias littoralis ECNN 160-091Leptasterias littoralis ECNN038-08|Leptasterias littoralis ECNN028-081Leptasterias littoralis

~~DSPEC148-08|Pteraster coscinopepl DSPEC206-08|Diplopteraster multipes ECNN047-08|Pteraster sp. EAC01~~

132 B) Echinoidea CHONE006-10|Strongylocentrotus pallidus I CHONE005-10|Strongylocentrotus pallidus ECNN145-08| St rongylocentrotus pallidus ECNN098-08|Strongylocentrotus pallidus CHONE003-10|Strongylocentrotus pallidus ECCH022-09|Strongylocentrotus pallidus ECNN135-08|Strongylocentrotus pallidus ECNN1 29-08|Strongylocentrotus pallidus ECCH018-09|Strongylocentrotus pallidus ECNN128-08|Strongylocentrotus pallidus ECCH023-09|Strongylocent rot us pallidus ECNN137-081Strongylocentrotus pallidus ECCH020-09|Strongylocentrotus pallidus ECCH021-09|Strongylocentrotus pallidus ECCH019-09|Strongylocentrotus pallidus CHONE004-10|Strongylocentrotus pallidus ECNN 136-08|Strongylocentrotus pallidus 99 ECNN144-08|Strongylocentrotus pallidus EQCS061-081Strongylocentrotus pallidus ECNN143-08|Strongylocentrotus pallidus ECNN008-08|Strongylocentrotus sp. EAC01 99 FL ECNN007-08|Strongylocentrotus sp. EAC01 LABB1084-09|Strongylocentrotus droebachiensis 90 DSPEC588-08|Strongylocentrotus droebachiensis DSPEC581-081Strongylocentrotus droebachiensis 99 DSPEC591-081Strongylocentrotus droebachiensis DSPEC592-081Strongylocentrotus droebachiensis DSPEC589-08|Strongylocentrotus droebachiensis 99 . DSPEC590-08|Strongylocentrotus droebachiensis DSPEC035-07|Strongylocentrotus droebachiensis DSPEC 131-07| St rongylocentrotus droebachiensis DSPEC1 32-071 St rongylocentrotus droebachiensis DSPEC1 30-07|Strongylocentrotus droebachiensis DSPEC1 29-071Strongylocentrotus droebachiensis . DSPEC133-07|Strongylocentrotus droebachiensis I DSPEC1 28-07|Strongylocentrotus droebachiensis 99 EQCS038-081 Strongylocentrotus tragi I is EQCS047-08| Strongylocentrotus tragi I is 99 EQCS039-08|Strongylocentrotusfragilis EQCS074-081 Strongylocentrotus frag i I is EQCS034-081 Strongylocentrotus tragi I is gg.DSPEC515-08|Strongylocentrotus purpuratus 99 [~L DSPEC514-08|Strongylocentrotus purpuratus

~~0.05~~

~~137 D) Ophiuroidea~~

141 Appendix 4: Sample and collection information for 73 sequences used in the nucleotide diversity calculations in Chapter 2. More detailed information is available in the Barcode of Life Data Systems online database (BOLD, www.boldsystems.org).

COI-5P Sequence Collection Process ID Sample ID Length Date Identification Region NZEC346-09 35916-2 832 Abatus nimrod Ross Sea NZEC347-09 35944-1 816 Abatus nimrod Ross Sea NZEC348-09 35944-2 815 Abatus nimrod Ross Sea NZEC349-09 35944-3 786 Abatus nimrod Ross Sea NZEC343-09 36568 793 Abatus nimrod Ross Sea NZEC344-09 42853-1 752 Abatus nimrod Ross Sea NZEC345-09 35916-1 819 Abatus nimrod Ross Sea DSPEC522-08 BAM00073 841 06-Jun-2008 Brisaster latifrons Bamfield DSPEC004-07 NEOCAL07-0098 815 26-Jun-2007 Brisaster latifrons Howe Sound/Sunshine Coast DSPEC013-07 NEOCAL07-0107 831 27-Jun-2007 Brisaster latifrons Howe Sound/Sunshine Coast DSPEC015-07 NEOCAL07-0109 752 27-Jun-2007 Brisaster latifrons Howe Sound/Sunshine Coast DSPECO16-07 NEOCAL07-0110 826 27-Jun-2007 Brisaster latifrons Howe Sound/Sunshine Coast DSPECO17-07 NEOCAL07-0111 829 27-Jun-2007 Brisaster latifrons Howe Sound/Sunshine Coast DSPEC473-08 BAM00024 838 03-Jun-2008 Cucumaria cf. lubrica Bamfield DSPEC474-08 BAM00025 841 03-Jun-2008 Cucumaria cf. lubrica Bamfield GBEH1494-06 U32216 870 Cucumaria lubrica DSPEC484-08 BAM00035 819 04-Jun-2008 Cucumaria miniata Bamfield DSPEC485-08 BAM00036 839 04-Jun-2008 Cucumaria miniata Bamfield DSPEC486-08 BAM00037 841 04-Jun-2008 Cucumaria miniata Bamfield DSPEC475-08 BAM00026 818 03-Jun-2008 Cucumaria miniata Bamfield DSPEC476-08 BAM00027 832 03-Jun-2008 Cucumaria miniata Bamfield DSPEC477-08 BAM00028 819 03-Jun-2008 Cucumaria miniata Bamfield

142 DSPEC478-08 BAM00029 824 03-Jun-2008 Cucumaria miniata Bamfield DSPEC490-08 BAM00041 0 r—( 03-Jun-2008 Evasterias troscheli Bamfield DSPEC044-07 NEOCAL07-0138 790 04-Jul-2007 Evasterias troscheli Howe Sound/Sunshine Coast DSPEC470-08 BAM00021 840 03-Jun-2008 Evasterias troscheli Bamfield DSPEC502-08 BAM00053 803 03-Jun-2008 Evasterias troscheli Bamfield DSPEC536-08 BAM00087 841 04-Jun-2008 Evasterias troscheli Bamfield DSPEC537-08 BAM00088 841 04-Jun-2008 Evasterias troscheli Bamfield DSPEC540-08 BAM00091 815 04-Jun-2008 Evasterias troscheli Bamfield DSPEC541-08 BAM00092 834 04-Jun-2008 Evasterias troscheli Bamfield GBEH0101-06 AF217386 o Evasterias troschelii DSPEC045-07 07PROBE-ECH001 783 18-Jul-2007 Leptasterias polaris Churchill DSPEC046-07 07PROBE-ECH002 797 18-Jul-2007 Leptasterias polaris Churchill DSPEC047-07 07PROBE-ECH003 793 18-Jul-2007 Leptasterias polaris Churchill DSPEC048-07 07PROBE-ECH004 793 18-Jul-2007 Leptasterias polaris Churchill DSPEC049-07 07PROBE-ECH005 797 18-Jul-2007 Leptasterias polaris Churchill DSPEC050-07 07PROBE-ECH006 793 18-Jul-2007 Leptasterias polaris Churchill DSPEC057-07 07PROBE-ECH013 796 18-Jul-2007 Leptasterias polaris Churchill DSPEC058-07 07PROBE-ECH014 803 17-Jul-2007 Leptasterias polaris Churchill DSPEC059-07 07PROBE-ECH015 793 17-Jul-2007 Leptasterias polaris Churchill DSPEC060-07 07PROBE-ECH016 as 17-Jul-2007 Leptasterias polaris Churchill ECCH005-09 08PROBE21101 658 15-Jul-2008 Leptasterias polaris Churchill ECCH006-09 08PROBE21102 658 15-Jul-2008 Leptasterias polaris Churchill ECCH013-09 08PROBE-1897 658 09-Jul-2008 Leptasterias polaris Churchill ECCH025-09 INV067306 658 24-Aug-2002 Leptasterias polaris Churchill ECCH026-09 INV067307 658 24-Aug-2002 Leptasterias polaris Churchill

~~ECCH028-09 INV067102 658 25-Aug-2002 Leptasterias polaris Churchill I I U90AN 0~~

~~ECCH029-09 £ 658 25-Aug-2002 Leptasterias polaris Churchill CO ECCH030-09 INV067104 658 25-Aug-2002 Leptasterias polaris Churchill~~

~~ECCH031-09 INV0671_05 658 25-Aug-2002 Leptasterias polaris Churchill I I U90AN 0 9 9 9~~

~~ECCH032-09 8S 25-Aug-2002 Leptasterias polaris Churchill ECNN001-08 HLC-30105 658 09-Aug-2000 Leptasterias polaris Resolute~~

~~ECNN010-08 HLC-30046 658 Ol-Aug-2000 Leptasterias polaris Resolute 9 9~~

~~ECNN122-08 INV066201 85 25-Aug-2006 Leptasterias polaris Churchill~~

~~ECNN 123-08 INV0662_02 658 25-Aug-2006 Leptasterias polaris Churchill 9 9~~

ECNN 130-08 INV0665_01 8S 25-Aug-2006 Leptasterias polaris Churchill ECNN 131-08 INV0665_02 658 25-Aug-2006 Leptasterias polaris Churchill ECNN 133-08 INV0668 658 25-Aug-2006 Leptasterias polaris Churchill ECNN 134-08 INV0666 646 25-Aug-2006 Leptasterias polaris Churchill ECNN 139-08 INV0672_04 658 23-Aug-2006 Leptasterias polaris Churchill ECNN 140-08 INV0672_05 658 23-Aug-2006 Leptasterias polaris Churchill ECNN141-08 INV0672 06 658 23-Aug-2006 Leptasterias polaris Churchill ECNN 142-08 INV067207 658 23-Aug-2006 Leptasterias polaris Churchill ECNN146-08 INV0673_04 658 24-Aug-2006 Leptasterias polaris Churchill NZEC101-08 38740 652 Ol-Mar-2008 Psolus antarcticus NZEC102-08 37868 651 Ol-Mar-2008 Psolus antarcticus NZEC 104-08 38654 649 Ol-Mar-2008 Psolus antarcticus DSPEC487-08 BAM00038 652 05-Jun-2008 Psolus chitonoides Bamfield DSPEC593-08 BAM00144 652 25-Apr-2008 Psolus chitonoides Nanaimo DSPEC594-08 BAM00145 652 25-Apr-2008 Psolus chitonoides Nanaimo DSPEC595-08 BAM00146 620 25-Apr-2008 Psolus chitonoides Nanaimo GBEH1498-06 U32220 870 Psolus chitonoides •* •*