Probiotics & Antimicro. Prot. DOI 10.1007/s12602-017-9311-9

Probiotic Features of Lactic Acid Bacteria Isolated from a Diverse Pool of Traditional Greek Dairy Products Regarding Specific Strain-Host Interactions

Georgia Zoumpopoulou1 & Alexandra Tzouvanou 1 & Eleni Mavrogonatou2 & Voula Alexandraki1 & Marina Georgalaki1 & Rania Anastasiou1 & Marina Papadelli1 & Eugenia Manolopoulou1 & Maria Kazou1 & Dimitris Kletsas2 & Konstantinos Papadimitriou1 & Effie Tsakalidou1

# Springer Science+Business Media, LLC 2017

Abstract The increased consumers’ interest on the positive ΗΤ-29 and Caco-2 cells. Co-cultivation of THP-1 cells with role of food in wellbeing and health underscores the need to selected strains indicated a tendency for anti-inflammatory determine new probiotic microorganisms. Triggered by the fact modulation by Lactobacillus plantarum ACA-DC 2640 as that artisanal food products can be a valuable source of novel well as Streptococcus thermophilus ACA-DC 26 and ACA- probiotic strains, 106 lactic acid bacteria, all isolated from tra- DC 170, as shown by an increase in IL10 mRNA levels. ditional Greek dairy products, namely , , Xynotyri, Moreover, milk cell-free supernatants of Lactobacillus Graviera, , Galotyri, and cheeses as well as plantarum ACA-DC 2640 and ACA-DC 4039 exhibited yogurt and milk, were studied for probiotic properties. Based strong angiotensin I-converting enzyme inhibition. To con- on their survival at pH 2.5 and their stability in the presence of clude, new isolates presenting interesting probiotic features bile salts, 20 strains were selected for further analysis. These were described and should be further investigated as health- strains exhibited diverse susceptibility to commonly used an- promoting factors. tibiotics, while none was hemolytic. Seven out of the 20 strains produced functional bile salt hydrolases in vitro. The only an- timicrobial activity detected of Streptococcus thermophilus Keywords Dairy products . Probiotic . Antimicrobial . ACA-DC 26 against the oral pathogen Streptococcus mutans Adhesion . Immunomodulation . Anti-hypertensive LMG 14558T was attributed to compound(s) of proteinaceous nature. Two Lactobacillus plantarum strains, namely ACA- DC 2640 and ACA-DC 4039, displayed the highest adhesion according to a collagen-based microplate assay and by using Introduction

During the last decades, consumers’ awareness and prefer- Electronic supplementary material The online version of this article ences for health-promoting and disease-preventing functional (doi:10.1007/s12602-017-9311-9) contains supplementary material, foods have attracted considerable interest from both the food which is available to authorized users. industry and the scientific community. Products containing probiotics prevail among functional foods, with fermented * Georgia Zoumpopoulou [email protected] dairy products playing a prominent role. Indeed, in 2015, ac- cording to the Mintel Global New Products Database, 79% of the newly launched dairy products were probiotic foods and 1 Laboratory of Dairy Research, Department of Food Science and beverages [1]. Human Nutrition, Agricultural University of Athens, Iera Odos 75, 11855 Athens, Several lactic acid bacteria (LAB) isolated from dairy prod- ucts have been proven to possess health-promoting properties 2 Laboratory of Cell Proliferation and Ageing, Institute of Biosciences and Applications, National Centre for Scientific Research beyond their technological functions [2]. In this context, the BDemokritos^, Patr. Gregoriou E’ & Neapoleos 27, isolation and characterization of strains from traditional 15310 Athens, Greece fermented dairy foods from different culinary cultures and Probiotics & Antimicro. Prot. geographical regions may reveal novel strains with interesting lactis subsp. lactis (24 strains), Streptococcus macedonicus (four functional traits [3]. strains), and Streptococcus thermophilus (25 strains). Unless Nowadays, in the EU, the term Bprobiotic^ is practically otherwise stated, all lactobacilli were grown in MRS (Biokar restricted regarding the labeling and advertising of any probi- Diagnostics, Beauvais, France) while cocci in M17 (Biokar otic food [4]. Nevertheless, it is worth noting that the approval Diagnostics) medium, at 30 or 37 °C, depending on the species. of probiotic claims differs in different parts of the world [1]. All strains were stored at −80 °C in the respective growth me- For instance, even within the EU, Italy regulated the use of the dium, supplemented with 20% (v/v) glycerol (Merck, word Bprobiotic^ for foods under certain conditions with Darmstadt, Germany). claims supporting the intestinal flora balance [5]. Despite the legislative constraints, research in the field is expanding. This Survival Under GIT Conditions includes the use of both conventional and advanced method- ologies to explore probiotic potential of new isolates. In par- The resistance of strains at low pH or in the presence of bile allel, well-designed clinical studies and several meta-analyses salts was assessed as described previously [8]. In brief, sur- are being performed. vival of strains was determined after incubation at 37 °C for Generally, initial assessment of probiotic bacteria focuses 2 h in phosphate buffered saline (PBS) of pH 2.5, as well as in on their tolerance to the hostile environment of the human PBSofpH8,containing1%(w/v) bile salts (LP0055, Oxoid, gastrointestinal tract (GIT) and their ability to colonize the Basingstoke, UK) after incubation at 37 °C for 3 h. host, as well as safety issues. Further, antimicrobial activity, immunomodulatory ability, and proteolytic activity leading to Safety Aspects the release of biologically active peptides are considered ma- jor probiotic features [6]. For testing antibiotic resistance, overnight bacterial cultures In Greece, there is a wide and diverse range of fermented (8–9 log CFU/mL) were inoculated (1% v/v)inMRS dairy products with rich LAB biodiversity [7]. In this study, (lactobacilli) or M17 (cocci) broth supplemented with each we describe novel LAB strains with probiotic potential focus- antibiotic separately (ampicillin, vancomycin, gentamycin, ing on their capacity to resist stresses prevailing in the GIT, kanamycin, streptomycin, erythromycin, tetracycline, and adhere to the intestinal mucosa, produce antimicrobials, mod- chloramphenicol) at various final concentrations (ranging ulate immune responses in the host, and release anti- from 1 to 512 mg/L) and examined for growth using a micro- hypertensive peptides during growth in milk. The acquired plate reader (OD at 600 nm) after 24 h at 30 or 37 °C, depend- results provide valuable information regarding the selection ing on the species. of promising probiotic strains for further in vivo assessment To assess hemolytic activity, overnight bacterial cultures and novel food applications. (8–9 log CFU/mL) were streaked on Columbia (Oxoid) agar plates containing 5% (v/v) sheep blood and plates were incu- bated for 48 h at 30 or 37 °C, depending on the species. Materials and Methods Bile Salt Hydrolase Activity Bacterial Strains and Growth Conditions To assess bile salt hydrolysis, overnight bacterial cultures (8– A total of 106 LAB isolates from traditional Greek dairy prod- 9 log CFU/mL) were streaked on MRS (lactobacilli) or M17 ucts were included in the present study (Online resource 1; (cocci) agar enriched with 0.5% (w/v)ofsodiumsaltof Supplementary Table 1). All strains are held at the ACA-DC taurodeoxycholic acid (TDCA, T0875, Sigma-Aldrich, St. Collection (http://www.aca-dc.gr/) and were selected Louis, MO, USA). Bile salt hydrolase (BSH)-positive and according to previous typing results by pulsed field gel BSH-negative strains were recorded according to characteris- elecrtrophoresis (PFGE) so as to be different (data not shown). tic precipitate halos around the colonies after 48 h of incuba- Among the 106 strains studied, 53 were lactobacilli belong- tion at 37 °C anaerobically (GasPak kit, Becton Dickinson, ing to four different species, namely Lactobacillus delbrueckii Sparks, NJ, USA). (Lactobacillus delbrueckii subsp. bulgaricus: seven strains; Lactobacillus delbrueckii subsp. delbrueckii: one strain; Antimicrobial Activity Lactobacillus delbrueckii subsp. lactis: two strains), Lactobacillus gasseri (four strains), Lactobacillus paracasei Strains were tested for antimicrobial activity against 25 indi- (Lactobacillus paracasei subsp. paracasei: seven strains; cators using the well-diffusion assay [8]. Target strains includ- Lactobacillus paracasei subsp. tolerans: two strains), and ed Gram-positive (18 strains) and Gram-negative (seven Lactobacillus plantarum (30 strains), while the rest were cocci strains) food spoilage and pathogenic bacteria (Online strains belonging to three different species, namely Lactococcus resource 1; Supplementary Table 2). Cell-free culture Probiotics & Antimicro. Prot. supernatants from overnight cultures in 10% (w/v)skimmilk with 1 mL of the above bacterial cell suspension for 2 h at (containing 0.3% w/v yeast extract) as well as in MRS 37 °C. The bacterial suspension was then aspirated and cell (lactobacilli) or M17 (cocci) broth, all filtered (0.22 μm monolayers were washed twice with PBS before adding 1 mL Millex Syringe Filter, Millipore, Billerica, Mass., USA) and of trypsin/citrate solution. For bacterial enumeration (CFU/ adjusted to pH 6.5, were tested. Treatment with ammonium mL), trypsin/citrate solutions with detached eukaryotic cells sulfate (20 to 80% saturation), heat treatment (at 60, 80, 100, were serially diluted and plated in the appropriate for the bac- and 121 °C for 5 min) and treatment with proteinase K (2 mg/ teria agar medium to calculate the % adhesion from the per- mL, Sigma-Aldrich) were applied in all active supernatants to centage of viable bacteria compared to their initial population designate the proteinaceous nature of the compound(s) in- added per well. volved in the antimicrobial effect. Immunomodulation Adhesion THP-1 (TIB-202) human monocytes (ATCC, Rockville, MD, Adhesion ability of the strains was investigated using a USA) were cultured in RPMI-1640 (Biochrom GmbH) con- collagen-based 96-well microplate assay, as well as two hu- taining 100 U/mL penicillin, 100 μg/mL streptomycin, and man colon adenocarcinoma cell lines, namely HT-29 and 10% (v/v) FBS at 37 °C and 5% CO2. Cell number never Caco-2 cells. exceeded 2 × 105 cells/mL in the cultures. For the collagen-based assay, overnight bacterial cultures Immunomodulation ability of bacterial strains was deter- (8–9logCFU/mL)wereinoculated(2%v/v) in the appropriate mined according to the protocol of Siegesmund et al. [10]with broth(MRSorM17)and100μL of these suspensions were some modifications. THP-1 cells were plated in 6-well plates transferred to 96-well collagen-coated microplates (Cellcoat®, (106 cells/well) in culture medium without antibiotics and Collagen Type I, Greiner Bio-One GmbH, Frickenhausen, 100 ng/mL phorbol-12-myristate-13-acetate (PMA, Sigma- Germany). Then, plates were incubated for 24 h at 30 or Aldrich) were added in each well before incubation at 37 °C 37 °C, depending on the species. Supernatant was aspirated for 24 h. Subsequently, 5 × 107–108 CFU of bacterial cultures and cells were washed carefully with PBS (pH 7.2) to remove were re-suspended in 0.3 mL RPMI-1640 and added to the planktonic cells and media. Gram’s crystal violet (Merck, wells (bacteria:THP-1 cells ratio ranging from 50:1 to 100:1). Darmstadt, Germany) aqueous solution (0.05% v/v) was added RPMI-1640 medium (0.3 mL) was used as control. (100 μL) for 15 min, and then cells were washed with PBS Gentamycin (Biochrom GmbH) was also added at a final con- until runoff was clear. Finally, adhered cells were re-suspended centration of 250 μg/mL. RNA extraction was performed after in modified biofilm dissolving solution (MBDS, SDS dis- a 4-h co-culture of THP-1 cells with the bacteria. solved to a final concentration of 10% w/v with 80% v/v etha- RNA extraction from THP-1 cells was performed using the ® nol in H2O) and, after 5 min, supernatants were transferred to a TRI Reagent (Sigma-Aldrich) and first-strand cDNA synthe- polystyrene 96-well microplate (Greiner Bio-One GmbH) to sis was performed with the first-strand cDNA Synthesis Kit measure absorbance at 600 nm [9]. (Sigma-Aldrich). qPCRBIO SyGreen Mix Lo-ROX (PCR For the cell line-based assay, cells (HT-29 or Caco-2) were Biosystems, London, UK) was used in the real-time PCR routinelyculturedinDulbecco’s modified Eagle medium experiments that were performed in a MX3000P cycler (DMEM) supplemented with 4 mM L-glutamine, 100 U/mL (Stratagene, La Jolla, CA, USA). Relative expression of inter- penicillin/100 μg/mL streptomycin, and 10 or 15% (v/v)fetal leukin 10 (IL10), interleukin 12 (IL12), inducible nitric oxide bovine serum (FBS) for HT-29 or Caco-2, respectively (all synthase (iNOS), and cyclooxygenase-2 (COX2) gene expres- purchased from Biochrom GmbH, Berlin, Germany). Cell sion was estimated with the 2−ΔΔCt method, while cultures were incubated at 37 °C and 5% CO2 and cells were glyceraldehyde-3-phosphate dehydrogenase (GAPDH) detached using a trypsin/citrate (0.25%:0.30% w/v) solution. served as the reference gene. Primers for human COX2 and For adhesion experiments, cells were seeded (1 × 105 cells/ GAPDH have been already published [11], while primers for well) in 12-well tissue culture plates (CELLSTAR®,Greiner human IL10, IL12, and iNOS were designed with the Beacon Bio-One GmbH, Frickenhausen, Germany). Plates were incu- Designer 7.0 software (PREMIER Biosoft International, Palo bated for 3 and 5 days for HT-29 and Caco-2 cells, respective- Alto, CA). All sequences of primers used in this study are ly, and culture medium was changed daily. presented in Table 1. Overnight bacterial cultures (8–9logCFU/mL)were Two reference strains, namely Lactobacillus fermentum washed once with PBS (pH 7.2) and re-suspended in fresh ACA-DC 179 and L. plantarum ACA-DC 287, were included DMEM without antibiotics and FBS to achieve a final con- in this experiment as high inducers of IL10 and IL12, respec- centration of 108 CFU/mL. After medium removal in the 12- tively, due to their immunomodulatory effect on human pe- well culture plates, cell monolayers were washed twice with ripheral blood mononuclear cells (PBMCs) reported in a pre- PBS Dulbecco solution (Biochrom GmbH) and co-cultured vious study [8]. Probiotics & Antimicro. Prot.

Table 1 Sequences of forward (F) and reverse (R) primers used in the Results qPCR experiments

Primer Sequence Survival Under GIT Conditions

IL10 (F) CACCCACTTCCCAGGCAACC A preliminary screening concerning the ability to survive at IL10 (R) TCTCAGACAAGGCTTGGCAACC low pH and in the presence of bile salts was performed for all IL12 (F) CGCAGCCTCCTCCTTGTGG 106 LAB strains. At pH 2.5, the survival rates of lactobacilli IL12 (R) ATGGGAACATTCCTGGGTCTGG were higher than the ones determined for cocci strains (Fig. iNOS (F) CCCAGCCTCAAGTCTTATTTCCTC 1a). In particular, 12 lactobacilli strains (22.6% of all iNOS (R) GCACTCAGCAGCAAGTTCCATC lactobacilli tested) showed less than 2 log CFU/mL reduction COX2 (F) CCTGTGCCTGATGATTGC after 2 h of exposure to low pH, followed by 19 strains COX2 (R) CTGATGCGTGAAGTGCTG (35.8%) with a viability decline between 2 and 3 log CFU/ GAPDH (F) GAGTCCACTGGCGTCTTC mL. For the rest lactobacilli strains (41.5%), viability loss was GAPDH (R) GCATTGCTGATGATCTTGAGG more pronounced reaching for some strains 4 to 5 log CFU/ mL reduction. Cocci strains were found to be less robust at low pH. The majority of cocci (84.9% of all cocci tested) was not resistant to low pH (decline >3 log CFU/mL), particularly Determination of Angiotensin I-converting Enzyme the isolates belonging to S. thermophilus species (average de- Inhibitory Activity cline of 5 log CFU/mL). Only eight strains declined between 2 and 3 log CFU/mL (15.1%) and no strain exhibited viability Strains were grown in 10% (w/v) skim milk for 24 h at 30 or loss of less than 2 log CFU/mL. 37 °C, depending on the species. Fermentation was stopped All strains managed to survive well in the presence of bile by heating at 75 °C for 1 min and samples were centrifuged salts (Fig. 1b). No viability loss higher than 0.5 log CFU/mL (11,000 rpm, 20 min, 5 °C) to obtain the corresponding whey was detected in all lactobacilli after 3 h of exposure. Similarly fractions [12]. Supernatants (1 mL) were filtered through to the results obtained after exposure to low pH, cocci strains 0.45 μm PVDF filters (Millipore, Bedford, MA, USA), were less robust than lactobacilli in the presence of bile salts. freeze-dried, dissolved in deionized water in half of the orig- Nevertheless, viability reduction was lower than 1 log CFU/ inal volume, and then used for the determination of angioten- mL with only four exceptions, namely L. lactis subsp. lactis sin I-converting enzyme inhibitory (ACE-I) activity according ACA-DC 1 and ACA-DC 58, S. macedonicus ACA-DC 208, to Quirós et al. [13]. and S. thermophilus ACA-DC 28, which exhibited a viability In brief, each sample (40 μL) was mixed with 0.1 mL of loss between 1 and 1.5 log CFU/mL (7.5% of all cocci tested). 5 mM ACE substrate (hippuryl-histydil-leucine; Sigma- Based on the aforementioned results, 20 strains that dem- Aldrich) diluted in 0.1 M sodium borate buffer containing onstrated the highest survival rates were selected for further 0.3 M NaCl (pH 8.3) and 20 μL of 0.1 U/mL angiotensin analysis. In particular, 15 of the selected strains belonged to converting enzyme solution (ACE, 2 mU, EC 3.4.15.1, three different species of the Lactobacillus genus, namely L. 5.1 U/mg; Sigma-Aldrich). The reaction mixture was incubat- gasseri (two strains), L. paracasei (two L. paracasei subsp. ed at 37 °C for 90 min before terminating the reaction with paracasei, and two L. paracasei subsp. tolerans strains) and 150 μL of 1 M HCl and adding 1 mL of ethyl acetate to extract L. plantarum (nine strains). Additionally, two L. lactis subsp. the hippuric acid formed. The mixture was stirred vigorously lactis and three S. thermophilus strains were included for 20 s, centrifuged (2000 rpm, 10 min, room temperature), (Table 2). and the ethyl acetate phase was transferred to a new tube to be evaporated (25 min, 95 °C). Hippuric acid was redissolved in Safety Aspects 0.8 mL of deionized water and measured spectrophotometri- cally at 228 nm. Percentage of inhibition of ACE (% ACE-I) Antibiotic susceptibility of strains to eight common antibiotics activity was calculated as described before [14]. was assessed according to the microbiological cut-off values recommended by the European Food Safety Authority [15]. Regarding the Lactobacillus strains, all except two were resis- Statistics tant to gentamycin, kanamycin, and tetracycline. L. gasseri ACA-DC 85a was found resistant to gentamycin, kanamycin, Values presented are the means ± standard deviations. and streptomycin, while L. plantarum ACA-DC 2533 only to Differences in gene expression compared to the control were gentamycin and kanamycin. L. lactis subsp. lactis ACA-DC considered statistically significant when P <0.05(Student’s t 57 and ACA-DC 160 strains were susceptible to all antibiotics test). except to streptomycin. Moreover, S. thermophilus ACA-DC Probiotics & Antimicro. Prot.

Fig. 1 Frequency (%) of the 53 a Lactobacilli Cocci b Lactobacilli Cocci lactobacilli and the 53 cocci 100 100 strains according to different 90 90 survival rates (Δlog CFU/mL) 80 80 after exposure to low pH in PBS 70 70 (pH2.5)for2hat37°C(a)orin 60 60 the presence of 1% w/v bile salts 50 50 in PBS (pH 8) for 3 h at 37 °C (b) 40 40 30 30 % of tested strains 20 20 10 10 0 0 <2 2-3 >3 <0.5 0.5-1.0 >1.0 Δlog CFU/mL Δlog CFU/mL

170 and ACA-DC 301 were resistant only to kanamycin, Adhesion while S. thermophilus ACA-DC 26 was susceptible to all eight antibiotics used. Finally, none of the strains was In order to evaluate adherence properties of the strains, a hemolytic. collagen-based 96-well microplate assay was initially per- formed. According to the results obtained, L. gasseri ACA- DC 222 and L. plantarum ACA-DC 2640 and ACA-DC 4039 BSH Activity presented the highest adhesion to collagen (Table 2). Successively, adhesion of the strains to HT-29 and Caco-2 Strains were further tested for hydrolysis of the sodium salt of cells was investigated (Fig. 2). Similarly to the collagen assay, TDCA. L. gasseri ACA-DC 85a and ACA-DC 222, along L. gasseri ACA-DC 222 and L. plantarum ACA-DC 2640 with L. paracasei subsp. tolerans ACA-DC 177 and ACA- and ACA-DC 4039 mentioned above showed the highest ad- DC 196 were found positive, while L. paracasei subsp. hesion, ranging from 5.56 to 9.97% to Caco-2 cells, while paracasei ACA-DC 116 and ACA-DC 4038 were negative. weak adhesion (<1%) was observed for the rest of the strains. Moreover, three out of nine L. plantarum strains (ACA-DC Adherence to HT-29 was found better compared to Caco-2 2411, ACA-DC 2533, and ACA-DC 4039) presented opaque cells, with L. plantarum ACA-DC 2640 and ACA-DC 4039 halos around colonies on MRS-TDCA plates indicating BSH along with S. thermophilus ACA-DC 170 showing the highest activity. Finally, none of the cocci strains presented BSH ac- adhesion (32.28, 20.07, and 14.80%, respectively). tivity (Table 2). Intermediate adhesion levels ranging from 5.03 to 9.44% were detected for the eight out of the 15 Lactobacillus and the two L. lactis subsp. lactis strains, while less than 4% adhesion was Antimicrobial Activity observed for the rest.

Strains were examined for antimicrobial activity against 25 Immunomodulation indicator strains. No activity was detected against Gram- negative bacteria used as targets. Regarding Gram-positive tar- Based on the results obtained for the antimicrobial activity get bacteria, only the milk supernatant of S. thermophilus and the adhesion properties, L. plantarum ACA-DC 2640 ACA-DC 26 was active against Streptococcus mutans LMG and ACA-DC 4039, and S. thermophilus ACA-DC 26 and 14558T (clear inhibition zones of 8 mm diameter), exhibiting ACA-DC 170 were selected for further analysis and were also a borderline inhibition against Streptococcus anginosus investigated regarding their in vitro immunomodulatory po- LMG 14502T (blurry inhibition zones of 6 mm diameter). tential using human THP-1 cells. More specifically, changes The antimicrobial activity against S. mutans LMG 14558T in IL10, IL12, iNOS, and COX2 mRNA levels were was further examined and found unaffected after heat treat- assessed in human monocytes co-cultured with the bacterial ment of the active supernatant at 60 °C for 5 min, while this strains (Fig. 3). Data indicated that all strains exhibited a was not the case after heating at 80, 100, or 121 °C for 5 min trend for increased IL10 expression. This increase reached that resulted in complete loss of antimicrobial activity. statistical significance (P < 0.05) in the case of L. plantarum Furthermore, antimicrobial activity was enhanced (clear inhi- ACA-DC 2640 and both S. thermophilus strains, as well as bition zones of 10 mm diameter) after 50 and 60% saturation of for L. fermentum ACA-DC 179, which was used as a pos- the supernatant with ammonium sulfate and vanished after itive control for anti-inflammatory response [8]. Even treatment with proteinase K. These results indicate the protein- though all four strains showed a similar trend for elevated aceous nature of the compound(s) involved. IL12 expression, only the control L. plantarum ACA-DC Probiotics & Antimicro. Prot.

Table 2 Survival under GIT conditions, BSH activity, and adhesion ability to collagen-coated microplates of the 20 selected strains

Strain Survival at pH 2.5 Survival in the presence BSH Adhesion to collagen-coated a (Δlog CFU/mL) of 1% w/v bile salts activity plates (OD600nm) (Δlog CFU/mL)

L. gasseri ACA-DC 85a 1.48 ± 0.42 0.12 ± 0.14 + 0.120 ± 0.072 L. gasseri ACA-DC 222 1.70 ± 0.58 0.05 ± 0.07 + 0.288 ± 0.078 L. paracasei subsp. paracasei ACA-DC 116 2.05 ± 0.39 −0.15 ± 0.13 − 0.108 ± 0.018 L. paracasei subsp. paracasei ACA-DC 4038 1.42 ± 0.16 0.24 ± 0.16 − 0.104 ± 0.020 L. paracasei subsp. tolerans ACA-DC 177 0.69 ± 0.44 −0.10 ± 0.03 + 0.178 ± 0.070 L. paracasei subsp. tolerans ACA-DC 196 1.46 ± 0.53 0.48 ± 0.12 + 0.085 ± 0.016 L. plantarum ACA-DC 140 0.88 ± 0.37 −0.51 ± 0.21 − 0.121 ± 0.047 L. plantarum ACA-DC 280 1.42 ± 0.60 0.19 ± 0.04 − 0.160 ± 0.065 L. plantarum ACA-DC 2221 1.62 ± 0.52 0.30 ± 0.08 − 0.132 ± 0.079 L. plantarum ACA-DC 2410 2.43 ± 0.61 0.26 ± 0.07 − 0.083 ± 0.017 L. plantarum ACA-DC 2411 2.17 ± 0.13 0.07 ± 0.03 + 0.138 ± 0.043 L. plantarum ACA-DC 2533 1.64 ± 0.51 −0.41 ± 0.16 + 0.113 ± 0.041 L. plantarum ACA-DC 2640 1.47 ± 0.32 0.35 ± 0.08 − 0.799 ± 0.182 L. plantarum ACA-DC 2942 2.26 ± 0.62 0.41 ± 0.14 − 0.104 ± 0.030 L. plantarum ACA-DC 4039 1.79 ± 0.12 0.22 ± 0.08 + 0.513 ± 0.152 L. lactis subsp. lactis ACA-DC 57 2.18 ± 0.06 0.03 ± 0.12 − 0.077 ± 0.024 L . lactis subsp. lactis ACA-DC 160 2.14 ± 0.01 0.02 ± 0.04 − 0.085 ± 0.024 S. thermophilus ACA-DC 26 2.94 ± 0.42 0.31 ± 0.05 − 0.066 ± 0.025 S. thermophilus ACA-DC 170 2.39 ± 0.43 0.10 ± 0.07 − 0.121 ± 0.039 S. thermophilus ACA-DC 301 2.76 ± 0.72 0.33 ± 0.13 − 0.069 ± 0.014 a +: positive BSH activity; −: negative BSH activity

287 resulted in a statistically significant upregulation of this pH in the stomach compartment, as well as to resist toxicity of transcript. iNOS expression was downregulated only when bile salts in the small intestine [16]. Thus, in our study, robust- THP-1 cells were co-cultured with S. thermophilus ACA- ness to GIT stresses allowed us to select 20 LAB strains from DC 170, while COX2 mRNA levels remained statistically an initial pool of 106 strains for further analysis aiming at unaffected in all cases. specific probiotic properties and strain-host interactions. Antibiotic resistance of beneficial microbes, such as ACE-I Activity probiotics, has been in focus of research due to the concern for increased risk of transferring resistance from food to the gut Reconstituted skim milk culture supernatants of L. plantarum bacterial population [17], in particular when resistance is plas- ACA-DC 2640 and ACA-DC 4039, and S. thermophilus mid encoded [18]. Thus, the assessment of the results obtained ACA-DC 26 and ACA-DC 170 were analyzed for ACE-I from conventional phenotypic tests with genomic data has activity. Both L. plantarum strains were strong ACE-I pro- been proposed [19]. In the present study, we only applied a ducers (ACE-I activity ≥50%), S. thermophilus ACA-DC phenotypic approach; however, the strains tested exhibited an- 170 was a weaker one (ACE-I activity = 38%), while no tibiotic resistance profiles similar to those described before for activity was detected with the supernatant of S. thermophilus the species included [20]. High resistance to aminoglycosides, ACA-DC 26. such as gentamycin, kanamycin, and streptomycin, has been reported for several species of Lactobacillus [21], as well as for L. lactis and S. thermophilus [22]. To date, the most common Discussion resistance determinants found in lactobacilli are the tetracy- cline resistance genes with at least 11 different genes detected LAB that can overcome stresses prevailing in the human GIT [18]. Tetracycline resistance has been previously reported for are considered prominent candidates for probiotic use, espe- L. plantarum strains isolated from dairy products [23–25]. It cially in the case of non-encapsulated strains directly used in should be finally noted that natural resistance of LAB to certain food [6]. Indeed, the orally administered probiotic bacteria are antibiotics may be beneficial as such strains can be used during expected to retain their viability during adverse conditions of antibiotic therapy [26]. Probiotics & Antimicro. Prot.

40 HT-29 35 Caco2 30 25 20 15 % adhesion 10 5 0

Fig. 2 Adhesion (%) of the 20 selected bacterial strains to HT-29 or Caco-2 cells after 2 h of co-culture at 37 °C and 5% CO2

BSH activity of microorganisms has been commented as in the intestinal environment. Nevertheless, consistently with one of the most controversial topics regarding the probiotic our findings, recent studies have reported that the resistance to potential of strains [27]. Indeed, the putative role of microbial bile salts is not always correlated to hydrolase activity [24, 30]. BSHs upon host metabolism and physiology is still uncertain Generally, the prevalence of BSH activity is reported foremost and merits consideration [28]. Diverse functions of BSHs af- for inhabitants of the GIT belonging to the genera Lactobacillus fecting gut microbiota, i.e., nutritional role, membrane alter- and Bifidobacterium [31]. Yet, in many cases, dairy isolates of ations and bile detoxification, have been extensively discussed the Lactobacillus genus were found to produce functional BSH in the past [29], including the relation between BSH activity enzymes in vitro [32, 33]. Albeit it is not yet completely clear and bile tolerance of strains related to their survival/persistence whether bile salt deconjugating activity is a desirable trait for a

Fig. 3 In vitro immunomodulation properties of four selected and two qPCR. Asterisks denote statistically significant differences in comparison reference bacterial strains in human THP-1 cells after co-culture for 4 h. to the untreated control for P <0.05 Expression of IL10, IL12, iNOS, and COX2 was determined by RT- Probiotics & Antimicro. Prot. novel probiotic bacterium, it remains informative when choos- unaffected suggests the promotion of the M2 rather than the ing a strain [34]. In the present study, only seven out of 20 M1-polarized activation of macrophages. Since IL10 ex- strainsproducedBSHswithLactococcus and Streptococcus pression plays an important role as a homeostatic regulator ones being BSHs negative as previously reported [31]. in insulin sensitivity by converting M1-polarized macro- Another desired attribute of potential probiotic strains is the phages to M2 [48], further in vivo studies will help us to production of metabolites with inhibitory activity, e.g., organ- elucidate the probiotic potential of strains regarding possi- ic acids and bacteriocins [6]. Among target areas, the restora- ble implications in metabolic disorders [49, 50]. Especially tion of a healthy oral microbiota is generally based on the for S. thermophilus ACA-DC 170, elevated IL10 expression ability of probiotics to suppress growth of pathogens relevant was further combined with a decreased iNOS expression. to the oral cavity [35, 36], such as S. mutans, which is widely iNOS produces large amounts of NO that may not be only known as the main causative microorganism in dental caries toxic to undesired microbes, parasites, or tumor cells, but— development. Thus, the molecule(s) produced by S. when released at the wrong site—mayalsoharmthesur- thermophilus ACA-DC 26 deserves further investigation. rounding tissue [51]. Remarkably, expression of the other Adhesion to the intestinal epithelium is an important pro-inflammatory gene, namely COX2, was unaffected in characteristic of probiotics, and thus one of the main selec- all cases. COX2 is the most important source of prostaglan- tion criteria for potential probiotic strains [37], as it pro- dins (PGs) and plays a key role in the generation of the motes persistence time and colonization in a particular niche inflammatory response [52]. and stimulates microbe-host interactions [38]. Although hu- Through the proteolytic activity of LAB, biologically ac- man cell lines of tumor origin cannot always simulate cells tive peptides are released from precursor food proteins and a deriving from normal tissues, especially regarding surface varietyofsuchpeptideshavebeenidentifiedasinhibitorsof components that interact with bacteria [39, 40], cell line angiotensin I-converting enzyme (ACE) attracting distinct at- models as the ones used in the present study are able to tention for their anti-hypertensive potential [53]. ACE plays a provide a preliminary discrimination between strongly and role in the regulation of blood pressure by catalyzing the con- weakly adhering strains [41, 42]. In our study, the use of a version of angiotensin I to vasoconstrictor angiotensin II and microplate assay and two different cell lines helped us to by inactivating the vasodilatory peptide bradykinin [54]. In comparatively evaluate and select the most adhesive strains this context, in vitro ACE-I activity can be considered the first overcoming drawbacks of the methodologies applied. step for evaluating anti-hypertensive ability of probiotics [55] Specifically, L. plantarum ACA-DC 2640 and ACA-DC as peptide fractions have been reported to decrease systolic 4039 presented the highest adhesion in all three assays per- blood pressure in spontaneously hypertensive rats [56] and formed. Interestingly, adhesion to collagen correlated better hypertensive human subjects [57]. L. plantarum ACA-DC with adhesion to Caco-2 compared to HT-29 cells, while 2640 and ACA-DC 4039 had promising anti-hypertensive adhesion was found generally higher with HT-29 cells. activity and the peptide(s) involved in this effect need further Differences in the adhesion ability of strains to different cell elucidation. lines have been reported in the past and have been associat- In the present study, we evaluated the probiotic potential of ed with the presence of a mucus layer in eukaryotic cells LAB strains isolated from traditional Greek dairy products. As [43], and Caco-2 and HT-29 cells secrete no or little mucus, a result, different strains exhibited diverse probiotic features respectively [41]. and from a broad group of 106 strains, we accomplished to Macrophages are the resident tissue phagocytes that dis- come up with some noticeable potential probiotics. S. play remarkable plasticity and heterogeneity in response to thermophilus ACA-DC 26 (Greek yogurt isolate) was found micro-environmental cues, giving rise to different populations to be the sole bacteriocin producer with inhibitory activity of cells with distinct immune functions [44]. According to the against the oral pathogen S. mutans.TwoL. plantarum strains, literature, THP-1 monocytes treated with PMA are generally namely ACA-DC 2640 (Feta cheese isolate) and ACA-DC used to study macrophage function [45]. Our results indicate a 4039 (Kasseri cheese isolate) had high adherence ability, tendency for anti-inflammatory modulation of THP-1 cells by while, L. plantarum ACA-DC 2640 along with S. L. plantarum ACA-DC 2640 and S. thermophilus ACA-DC thermophilus ACA-DC 26 and ACA-DC 170 (Kasseri cheese 26 and ACA-DC 170 due to elevated IL10 expression. isolate) exhibited anti-inflammatory impact on human mono- Reflecting the Th1/Th2 concept of T-helper cell activation, cytes strengthening their M2 response. Interestingly, the two the M1 and M2 characterization describes also the two major L. plantarum strains showed also ACE-I activity after growth and opposing activities of polarized macrophages [46]. The in milk. Conclusively, the next step of our research is to apply M1 macrophage phenotype is typically IL12high and IL10low, the aforementioned strains in appropriate animal models to whereas M2 macrophages are typically IL10high and IL12low evaluate in vivo strain-host interactions. Furthermore, we will [47]. Thus, the effect of the aforementioned three strains on pursue the evaluation of strains’ performance as adjuncts in IL10 expression as well as on IL12 expression that remained novel dairy products. Probiotics & Antimicro. Prot.

Acknowledgements This work was co-financed by the European from raw milk. Int Dairy J 16(1):61–69. doi:10.1016/j.idairyj.2005. Regional Development Fund (ERDF) of the EU and by the Greek 01.001 National Resources under the Operational Program Competitiveness 13. Quirós A, Ramos M, Muguerza B, Delgado MA, Miguel M, and Entrepreneurship (OPCE II), Action BCOOPERATION 2011^, Aleixandre A, Recio I (2007) Identification of novel antihyperten- Partnerships of Production and Research Institutions in Focused sive peptides in milk fermented with Enterococcus faecalis. Int Research and Technology Sectors—Project 11SYN_2_571_ Dairy J 17(1):33–41. doi:10.1016/j.idairyj.2005.12.011 ProbioDairyMeat. 14. Pan D, Luo Y, Tanokura M (2005) Antihypertensive peptides from skimmed milk hydrolysate digested by cell-free extract of Compliance with Ethical Standards This article does not contain any Lactobacillus helveticus JCM1004. Food Chem 91(1):123–129. studies with human participants or animals performed by any of the doi:10.1016/j.foodchem.2004.05.055 authors. 15. EFSA (2012) Guidance on the assessment of bacterial susceptibility to antimicrobials of human and veterinary importance. EFSA J 10(6):2740-n/a. doi:10.2903/j.efsa.2012.2740 Conflict of Interest The authors declare that they have no conflict of 16. Amund OD (2016) Exploring the relationship between exposure to interest. technological and gastrointestinal stress and probiotic functional properties of lactobacilli and bifidobacteria. Can J Microbiol 62(9):715–725. doi:10.1139/cjm-2016-0186 References 17. Devirgiliis C, Barile S, Perozzi G (2011) Antibiotic resistance de- terminants in the interplay between food and gut microbiota. Genes Nutr 6(3):275–284. doi:10.1007/s12263-011-0226-x — 1. Thomas LV (2016) Probiotics the journey continues. Int J Dairy 18. Gueimonde M, Sanchez B, GdLR-G C, Margolles A (2013) – Technol 69(4):469 480. doi:10.1111/1471-0307.12354 Antibiotic resistance in probiotic bacteria. Front Microbiol 4:202. 2. Zoumpopoulou G, Pot B, Tsakalidou E, Papadimitriou K (2017) doi:10.3389/fmicb.2013.00202 Dairy probiotics: beyond the role of promoting gut and immune 19. Salvetti E, Orrù L, Capozzi V,Martina A, Lamontanara A, Keller D, – health. Int Dairy J 67:46 60. doi:10.1016/j.idairyj.2016.09.010 Cash H, Felis GE, Cattiveli L, Torriani S, Spano G (2016) Integrate 3. Santos TT, Ornellas RMS, Arcucio LB, Oliveira MM, Nicoli JR, genome-based assessment of safety for probiotic strains: Bacillus Dias CV, Uetanabaro APT, Vinderola G (2016) Characterization of coagulans GBI-30, 6086 as a case study. Appl Microbiol lactobacilli strains derived from cocoa fermentation in the south of Biotechnol 100(10):4595–4605. doi:10.1007/s00253-016-7416-9 Bahia for the development of probiotic cultures. LWT Food Sci 20. de Moraes GMD, de Abreu LR, do Egito AS, Salles HO, da Silva – Technol 73:259 266. doi:10.1016/j.lwt.2016.06.003 LMF, Nero LA, Todorov SD, dos Santos KMO (2016) Functional 4. Regulation (EC) No 1924/2006 of the European Parliament and of properties of Lactobacillus mucosae strains isolated from Brazilian the Council of 20 December 2006 on nutrition and health claims goat milk. Probiotics Antimicrob Proteins 1–11. doi:10.1007/ made on foods. Off J Eur Union L12:3–18 s12602-016-9244-8 5. Italian Ministry of Health (2013) Guidelines on probiotics and pre- 21. Ouwehand AC, Forssten S, Hibberd AA, Lyra A, Stahl B (2016) biotics. Internet document URL http://www.salute.gov.it/imgs/C_ Probiotic approach to prevent antibiotic resistance. Ann Med 48(4): 17_pubblicazioni_1016_ulterioriallegati_ulterioreallegato_0_alleg. 246–255. doi:10.3109/07853890.2016.1161232 pdf 22. Ammor MS, Florez AB, Mayo B (2007) Antibiotic resistance in 6. Papadimitriou K, Zoumpopoulou G, Foligné B, Alexandraki V, non-enterococcal lactic acid bacteria and bifidobacteria. Food Kazou M, Pot B, Tsakalidou E (2015) Discovering probiotic mi- Microbiol 24(6):559–570. doi:10.1016/j.fm.2006.11.001 croorganisms: in vitro, in vivo, genetic and omics approaches. Front 23. Bernardeau M, Vernoux JP, Henri-Dubernet S, Guéguen M (2008) Microbiol 6:58. doi:10.3389/fmicb.2015.00058 Safety assessment of dairy microorganisms: the Lactobacillus ge- 7. Litopoulou-Tzanetaki E, Tzanetakis N (2011) Microbiological nus. Int J Food Microbiol 126(3):278–285. doi:10.1016/j. characteristics of Greek traditional cheeses. Small Rumin Res ijfoodmicro.2007.08.015 101(1–3):17–32. doi:10.1016/j.smallrumres.2011.09.022 24. Guidone A, Zotta T, Ross RP, Stanton C, Rea MC, Parente E, 8. Zoumpopoulou G, Foligne B, Christodoulou K, Grangette C, Pot Ricciardi A (2014) Functional properties of Lactobacillus B, Tsakalidou E (2008) Lactobacillus fermentum ACA-DC 179 plantarum strains: a multivariate screening study. LWT Food Sci displays probiotic potential in vitro and protects against Technol 56(1):69–76. doi:10.1016/j.lwt.2013.10.036 trinitrobenzene sulfonic acid (TNBS)-induced colitis and 25. Nawaz M, Wang J, Zhou A, Ma C, Wu X, Moore JE, Millar BC, Xu Salmonella infection in murine models. Int J Food Microbiol J (2011) Characterization and transfer of antibiotic resistance in 121(1):18–26. doi:10.1016/j.ijfoodmicro.2007.10.013 lactic acid bacteria from fermented food products. Curr Microbiol 9. Tram G, Korolik V, Day CJ (2013) MBDS solvent: an improved 62(3):1081–1089. doi:10.1007/s00284-010-9856-2 method for assessment of biofilms. Adv Microbiol 3:200–204. doi: 26. Hashemi SM, Shahidi F, Mortazavi SA, Milani E, Eshaghi Z (2014) 10.4236/aim.2013.32030 Potentially probiotic Lactobacillus strains from traditional Kurdish 10. Siegesmund AM, Konkel ME, Klena JD, Mixter PF (2004) cheese. Probiotics Antimicrob Proteins 6(1):22–31. doi:10.1007/ Campylobacter jejuni infection of differentiated THP-1 macro- s12602-014-9155-5 phages results in interleukin 1β release and caspase-1- 27. Chand D, Avinash VS, Yadav Y, Pundle AV, Suresh CG, independent apoptosis. Microbiol 150(3):561–569. doi:10.1099/ Ramasamy S (2017) Molecular features of bile salt hydrolases mic.0.26466-0 and relevance in human health. Biochim Biophys Acta 1861: 11. Dimozi A, Mavrogonatou E, Sklirou A, Kletsas D (2015) Oxidative 2981–2991. doi:10.1016/j.bbagen.2016.09.024 stress inhibits the proliferation, induces premature senescence and 28. Joyce SA, Shanahan F, Hill C, Gahan CG (2014) Bacterial bile salt promotes a catabolic phenotype in human nucleus pulposus inter- hydrolase in host metabolism: potential for influencing gastrointes- vertebral disc cells. Eur Cell Mater 30:89–102; discussion 103. doi: tinal microbe-host crosstalk. Gut Microbes 5(5):669–674. doi:10. 10.22203/eCM.v030a07 4161/19490976.2014.969986 12. Muguerza B, Ramos M, Sánchez E, Manso MA, Miguel M, 29. Begley M, Hill C, Gahan CG (2006) Bile salt hydrolase activity in Aleixandre A, Delgado MA, Recio I (2006) Antihypertensive ac- probiotics. Appl Environ Microbiol 72(3):1729–1738. doi:10.1128/ tivity of milk fermented by Enterococcus faecalis strains isolated aem.72.3.1729-1738.2006 Probiotics & Antimicro. Prot.

30. Lv LX, Yan R, Shi HY, Shi D, Fang DQ, Jiang HY, Wu WR, Guo cells. Curr Microbiol 57(1):33–38. doi:10.1007/s00284-008-9148- FF, Jiang XW, Gu SL, Chen YB, Yao J, Li LJ (2017) Integrated 2 transcriptomic and proteomic analysis of the bile stress response in 43. Laparra JM, Sanz Y (2009) Comparison of in vitro models to study probiotic Lactobacillus salivarius LI01. J Proteome 150:216–229. bacterial adhesion to the intestinal epithelium. Lett Appl Microbiol doi:10.1016/j.jprot.2016.08.021 49(6):695–701. doi:10.1111/j.1472-765X.2009.02729.x 31. Patel AK, Singhania RR, Pandey A, Chincholkar SB (2010) 44. Mosser DM, Edwards JP (2008) Exploring the full spectrum of Probiotic bile salt hydrolase: current developments and perspec- macrophage activation. Nat Rev Immunol 8(12):958–969. doi:10. tives. Appl Biochem Biotechnol 162(1):166–180. doi:10.1007/ 1038/nri2448 s12010-009-8738-1 45. Qin Z (2012) The use of THP-1 cells as a model for mimicking the 32. Archer AC, Halami PM (2015) Probiotic attributes of Lactobacillus function and regulation of monocytes and macrophages in the vas- fermentum isolated from human feces and dairy products. Appl culature. Atherosclerosis 221(1):2–11. doi:10.1016/j. Microbiol Biotechol 99(19):8113–8123. doi:10.1007/s00253-015- atherosclerosis.2011.09.003 6679-x 46. Cassetta L, Cassol E, Poli G (2011) Macrophage polarization in 33. Vizoso Pinto MG, Franz CM, Schillinger U, Holzapfel WH (2006) health and disease. Sci World J 11:2391–2402. doi:10.1100/2011/ Lactobacillus spp. with in vitro probiotic properties from human 213962 faeces and traditional fermented products. Int J Food Microbiol 47. Mantovani A, Sica A, Sozzani S, Allavena P, Vecchi A, Locati M 109(3):205–214. doi:10.1016/j.ijfoodmicro.2006.01.029 (2004) The chemokine system in diverse forms of macrophage 34. Miquel S, Beaumont M, Martin R, Langella P, Braesco V, Thomas activation and polarization. Trends Immunol 25(12):677–686. doi: M (2015) A proposed framework for an appropriate evaluation 10.1016/j.it.2004.09.015 scheme for microorganisms as novel foods with a health claim in 48. Lumeng CN, Bodzin JL, Saltiel AR (2007) Obesity induces a phe- Europe. Microb Cell Factories 14:48. doi:10.1186/s12934-015- notypic switch in adipose tissue macrophage polarization. J Clin 0229-1 Invest 117(1):175–184. doi:10.1172/JCI29881 35. Reid G, Younes JA, Van der Mei HC, Gloor GB, Knight R, 49. Kim HJ, Higashimori T, Park SY, Choi H, Dong J, Kim YJ, Noh Busscher HJ (2011) Microbiota restoration: natural and supple- HL, Cho YR, Cline G, Kim YB, Kim JK (2004) Differential effects mented recovery of human microbial communities. Nat Rev of interleukin-6 and -10 on skeletal muscle and liver insulin action Microbiol 9(1):27–38. doi:10.1038/nrmicro2473 in vivo. Diabetes 53(4):1060–1067 36. Zoumpopoulou G, Pepelassi E, Papaioannou W, Georgalaki M, 50. Meshkani R, Adeli K (2009) Hepatic insulin resistance, metabolic Maragkoudakis PA, Tarantilis PA, Polissiou M, Tsakalidou E, syndrome and cardiovascular disease. Clin Biochem 42(13–14): Papadimitriou K (2013) Incidence of bacteriocins produced by 1331–1346. doi:10.1016/j.clinbiochem.2009.05.018 food-related lactic acid bacteria active towards oral pathogens. Int 51. Forstermann U, Sessa WC (2012) Nitric oxide synthases: regulation J Mol Sci 14(3):4640–4654. doi:10.3390/ijms14034640 and function. Eur Heart J 33(7):829–837, 837a-837d. doi:10.1093/ 37. Bermudez-Brito M, Plaza-Diaz J, Munoz-Quezada S, Gomez- eurheartj/ehr304 Llorente C, Gil A (2012) Probiotic mechanisms of action. Ann 52. Ricciotti E, FitzGerald GA (2011) Prostaglandins and inflamma- Nutr Metab 61(2):160–174. doi:10.1159/000342079 tion. Arterioscler Thromb Vasc Biol 31(5):986–1000. doi:10. 38. Sengupta R, Altermann E, Anderson RC, McNabb WC, Moughan 1161/ATVBAHA.110.207449 PJ, Roy NC (2013) The role of cell surface architecture of 53. Fitzgerald RJ, Murray BA (2006) Bioactive peptides and lactic lactobacilli in host-microbe interactions in the gastrointestinal tract. fermentations. Int J Dairy Technol 59(2):118–125. doi:10.1111/j. Mediat Inflamm 2013:16. doi:10.1155/2013/237921 1471-0307.2006.00250.x 39. Fabien JC, Stephanie-Marie D, Adriana Perez C, Benoit F, Gwenael 54. Masuyer G, Schwager SL, Sturrock ED, Isaac RE, Acharya KR J (2012) Interactions between probiotic dairy propionibacteria and (2012) Molecular recognition and regulation of human the intestinal epithelium. Curr Immunol Rev 8(3):216–226. doi:10. angiotensin-I converting enzyme (ACE) activity by natural inhibi- 2174/157339512800671976 tory peptides. Sci Rep 2:717. doi:10.1038/srep00717 40. Lievin-Le Moal V, Servin AL (2013) Pathogenesis of human 55. Rutella GS, Tagliazucchi D, Solieri L (2016) Survival and bioac- enterovirulent bacteria: lessons from cultured, fully differentiated tivities of selected probiotic lactobacilli in yogurt fermentation and human colon cancer cell lines. Microbiol Mol Biol Rev 77(3):380– cold storage: new insights for developing a bi-functional dairy food. 439. doi:10.1128/mmbr.00064-12 Food Microbiol 60:54–61. doi:10.1016/j.fm.2016.06.017 41. Gagnon M, Zihler Berner A, Chervet N, Chassard C, Lacroix C 56. Nurminen ML, Sipola M, Kaarto H, Pihlanto-Leppala A, Piilola K, (2013) Comparison of the Caco-2, HT-29 and the mucus-secreting Korpela R, Tossavainen O, Korhonen H, Vapaatalo H (2000) HT29-MTX intestinal cell models to investigate Salmonella adhe- Alpha-lactorphin lowers blood pressure measured by radioteleme- sion and invasion. J Microbiol Methods 94(3):274–279. doi:10. try in normotensive and spontaneously hypertensive rats. Life Sci 1016/j.mimet.2013.06.027 66(16):1535–1543. doi:10.1016/S0024-3205(00)00471-9 42. Wang B, Wei H, Yuan J, Li Q, Li Y, Li N, Li J (2008) Identification 57. Seppo L, Jauhiainen T, Poussa T, Korpela R (2003) A fermented of a surface protein from Lactobacillus reuteri JCM1081 that ad- milk high in bioactive peptides has a blood pressure-lowering effect heres to porcine gastric mucin and human enterocyte-like HT-29 in hypertensive subjects. Am J Clin Nutr 77(2):326–330 本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。

学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，

提供一站式文献检索和下载服务”的24 小时在线不限IP 图书馆。 图书馆致力于便利、促进学习与科研，提供最强文献下载服务。

图书馆导航：

图书馆首页 文献云下载 图书馆入口 外文数据库大全 疑难文献辅助工具